This article was downloaded by: [Florida Atlantic University] On: 30 January 2015, At: 20:37 Publisher: Routledge Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK
Nutrition and Cancer Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/hnuc20
Sulforaphane Induces DNA Damage and Mitotic Abnormalities in Human Osteosarcoma MG-63 Cells: Correlation with Cell Cycle Arrest and Apoptosis a
a
a
José Miguel P. Ferreira de Oliveira , Catarina Remédios , Helena Oliveira , Pedro Pinto a
a
a
, Francisco Pinho , Sónia Pinho , Maria Costa & Conceição Santos
a
a
a
CESAM & Laboratory of Biotechnology and Cytomics, Department of Biology , University of Aveiro , Campus Universitário de Santiago, Aveiro , Portugal Published online: 09 Jan 2014.
Click for updates To cite this article: José Miguel P. Ferreira de Oliveira , Catarina Remédios , Helena Oliveira , Pedro Pinto , Francisco Pinho , Sónia Pinho , Maria Costa & Conceição Santos (2014) Sulforaphane Induces DNA Damage and Mitotic Abnormalities in Human Osteosarcoma MG-63 Cells: Correlation with Cell Cycle Arrest and Apoptosis, Nutrition and Cancer, 66:2, 325-334, DOI: 10.1080/01635581.2014.864777 To link to this article: http://dx.doi.org/10.1080/01635581.2014.864777
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
Nutrition and Cancer, 66(2), 325–334 C 2014, Taylor & Francis Group, LLC Copyright ISSN: 0163-5581 print / 1532-7914 online DOI: 10.1080/01635581.2014.864777
Sulforaphane Induces DNA Damage and Mitotic Abnormalities in Human Osteosarcoma MG-63 Cells: Correlation with Cell Cycle Arrest and Apoptosis Jos´e Miguel P. Ferreira de Oliveira, Catarina Rem´edios, Helena Oliveira, Pedro Pinto, Francisco Pinho, S´onia Pinho, Maria Costa, and Conceic¸a˜ o Santos
Downloaded by [Florida Atlantic University] at 20:37 30 January 2015
CESAM & Laboratory of Biotechnology and Cytomics, Department of Biology, University of Aveiro, Campus Universit´ario de Santiago, Aveiro, Portugal
Osteosarcoma is a recalcitrant bone malignancy with poor responsiveness to treatments; therefore, new chemotherapeutic compounds are needed. Sulforaphane (SFN) has been considered a promising chemotherapeutic compound for several types of tumors by inducing apoptosis and cytostasis, but its effects (e.g., genotoxicity) in osteosarcoma cells remains exploratory. In this work, the MG-63 osteosarcoma cell line was exposed to SFN up to 20 μM for 24 and 48 h. SFN induced G2 /M phase arrest and decreased nuclear division index, associated with disruption of cytoskeletal organization. Noteworthy, SFN induced a transcriptome response supportive of G2 /M phase arrest, namely a decrease in Chk1- and Cdc25C-encoding transcripts, and an increase in Cdk1-encoding transcripts. After 48-h exposure, SFN at a dietary concentration (5 μM) contributed to genomic instability in the MG-63 cells as confirmed by increased number of DNA breaks, clastogenicity, and nuclear and mitotic abnormalities. The increased formation of nucleoplasmic bridges, micronuclei, and apoptotic cells positively correlated with loss of viability. These results suggest that genotoxic damage is an important step for SFN-induced cytotoxicity in MG-63 cells. In conclusion, SFN shows potential to induce genotoxic damage at low concentrations and such potential deserves further investigation in other tumor cell types.
INTRODUCTION Osteosarcoma is an aggressive bone malignancy that shows high prevalence in children and adolescents. In Western populations, malignant bone tumors represent 3–5% of all cancers diagnosed in children below 15 years of age and 7–8% of those in adolescents aged to 15–19 years (1). Local recurrence and metastases (mainly at the lungs) still affect approximately
Submitted 16 May 2013; accepted in final form 4 November 2013. Address correspondence to Jos´e Miguel P. Ferreira de Oliveira, CESAM & Laboratory of Biotechnology and Cytomics, Department of Biology, University of Aveiro, Campus Universit´ario de Santiago, 3810-193 Aveiro, Portugal. Phone: +351 234 370 350. Fax: +351 234 372 587. E-mail: [email protected]
30–40% of all patients and seem to be the major cause of death, leading to a poor prognosis of patients affected with osteosarcoma (2). Patients’ low survival rates are largely due to osteosarcoma poor responsiveness to current treatments, which typically involve surgical resection and chemotherapy with cisplatin, doxorubicin, or methotrexate (3,4). It is therefore necessary to find alternative compounds able to increase the sensitization of osteosarcoma cells. As in other cancer types, disruption of pathways related to apoptosis and cell cycle were also observed in osteosarcoma cells, in in vivo and in vitro studies (5,6). The molecular pathogenesis of osteosarcoma remains unclear, as the analysis of signaling networks and pathways underlying initiation and proliferation are not straightforward (7). Various chemical compounds are known inducers of apoptosis or regulators of the cell cycle in vitro. One such example is the group of isothiocyanates (ITCs), which are formed by hydrolysis from their precursor compounds glucosinolates. Two widely studied glucosinolate derivatives (derived mostly from cruciferous vegetables) are sulforaphane (SFN) and indole-3-carbinol. Studies reveal that, after the consumption of SFN-rich foodstuffs, SFN plasma concentrations in humans reach a peak of 2 to 3 μM (8), with maximum concentrations of about 10 μM being found after the consumption of high-glucosinolate broccoli (9). SFN plays a protective role by modulating Phase 1 and Phase 2 enzyme activities (10,11). SFN was also found to be an antiproliferative agent in vitro and in vivo (12–17) by inducing cytostasis and apoptosis. Cytostatic effects of SFN are due to its inhibition of G1 /G0 , G2 /M, or S phase progression, depending on the cell line studied (18–20). In acute lymphoblastic leukemia cells, Suppipat and coworkers found that SFN induced a G2 /M arrest, through inactivation of the cyclin B1-cyclin-dependent kinase 1 (Cdk1) complex (21). Also, Singh and coworkers found that G2 /M phase arrest by SFN was shown to correlate with decreased levels of Cdc25C protein and accumulation of inactive phosphorylated Cdk1 (17). Moreover, SFN induced Ser-216 phosphorylation of Cdc25C resulting from the activation of DNA-damage checkpoint Chk2
325
Downloaded by [Florida Atlantic University] at 20:37 30 January 2015
326
J. M. P. FERREIRA DE OLIVEIRA ET AL.
(17). Despite its promising results on other tumor cells, the potential of SFN as a chemotherapeutic agent for osteosarcoma remains exploratory. In murine LM8 and in human U2-OS osteosarcoma cell lines, this compound induced some cytostatic and apoptotic effects (19,22). Genomic DNA breaks represent an important trigger, though not exclusive, of apoptosis (23). Some studies focused on DNA breaks to assess SFN-induced apoptosis in various cancer cell lines (e.g., 23,24), but the effects were cell line and dosedependent and several studies demonstrated the ability of SFN to protect cells from genotoxic insult (25). SFN genotoxic effects remain to be unveiled and the integration of available data from different studies is hampered given the complexity introduced by the use of different cell lines or different exposure regimens. In normal human and rat cells and at dietary concentrations ≤10 μM, SFN has been shown to offer protection against DNA damage by mutagens in vitro (26), for example, through the inhibition of cytochrome P450 enzymes (27,28) or induction of Phase 2 enzymes (29). However, SFN has been also shown to promote DNA damage in colon tumor cells (30). DNA damage by SFN has so far been found either associated with oxidative stress (31) or unrelated to this type of stress (30), depending on the cell line and exposure conditions used. Other mechanisms associated with DNA damage pathways by SFN include c-Jun N-terminal Kinase (JNK) activation via apoptotic caspase-2 (32) and stimulation of Bid cleavage by leaked lysosomal cathepsin (30). DNA double-strand breaks were found only at SFN concentrations above 10 μM and at longer exposure times in different cell lines (33,34). However, in human lymphocytes lower SFN concentrations (0–10 μM) have been found to inhibit micronuclei (MN) formation induced by selected mutagens (25). Considering the promising effects of SFN on inhibiting other tumor cells proliferation, and the controversial data on its genotoxic effects, we aimed with this study to evaluate the potential of SFN as an antiproliferative agent of osteosarcoma cells and further clarify if it induces genotoxicity in these tumor cells. For that, we investigated the in vitro effects of SFN on MG-63 osteosarcoma cells viability and DNA/nuclear damages, which were then correlated with other parameters of cytotoxicity, namely apoptotic rate and cell cycle dynamics. To our knowledge, this is the first study offering an integrated view on the genotoxic effects of SFN enabled by the use of a wide battery of genotoxic markers. MATERIALS AND METHODS Cell Culture and Exposure to SFN Human osteosarcoma MG-63 cell line (ATCC, Manassas, VA) was cultured in α-Minimum Essential Medium supplemented with 10% fetal bovine serum, 2.5 μg/ml fungizone, 100 U/ml penicillin–100 μg/ml streptomycin at 37◦ C in a 5% CO2 humidified atmosphere. Cells were daily observed under an inverted phase-contrast Eclipse TS100 microscope (Nikon,
Tokyo, Japan), and when culture reached approximately 80% confluence (usually after 3 days), cells were trypsinized with Trypsin-EDTA (0.25% Trypsin, 1 mM EDTA) and subcultured at a split ratio of 1:10. All cell culture reagents were from Life Technologies (Carlsbad, CA). D,L-sulforaphane (Sigma-Aldrich, St. Louis, MO) was dissolved in dimethyl sulfoxide (DMSO, Sigma-Aldrich, St. Louis, MO) at a concentration of 10 mM and stored at −20◦ C. For each experiment, cells were allowed to adhere for 24 h and then medium was replaced with fresh medium containing 0, 5, 10, and 20 μM SFN. The effect of SFN was measured after 24 and 48 h. During the experiment, cultures were routinely visualized for confluence and cell morphology. Cell Viability Assay Cell viability was determined by the colorimetric 3-(4,5dimethyl-2-thiazolyl)-2,5-diphenyl tetrazolium bromide (MTT) assay, which measures the formation of purple formazan in viable cells. The MTT assay was performed according to Twentyman and Luscombe (35) with slight modifications. Briefly, cells were seeded in 96-well plates and after SFN exposure, 50 μl MTT reagent (Sigma-Aldrich, St. Louis, MO) at 1 mg/ml phosphate buffered saline (PBS) were added to each well. Plates were incubated at 37◦ C, 5% CO2 , in darkness, for 4 h. The medium and MTT were removed and 150 μl DMSO were added to each well. Plates were agitated for 2 h, in darkness, to dissolve the formazan crystals. Absorbance was measured at 570 nm using a Synergy HT Multi-mode Microplate Reader (BioTek Instruments, Winooski, VT). Cell Cycle and Clastogenicity Analysis Cell cycle and clastogenicity were assayed by flow cytometry using the fluorescent probe propidium iodide (PI; SigmaAldrich, St. Louis, MO). Cells were seeded in 6-well plates. Control and treated cells were washed with PBS, harvested using Trypsin-EDTA and centrifuged twice at 300 g for 5 min. Cells were then fixed with 1 ml 85% ethanol at 4◦ C and kept at −20◦ C until further analysis. At the time of analysis, fixed cells were centrifuged at 300 g for 5 min and resuspended in 0.8 ml PBS. The cell suspension was collected and filtered through a 35 μm nylon mesh to separate aggregated cells. Subsequently, 50 μl PI (50 μg/ml) and 50 μl RNase (50 μg/ml; Sigma-Aldrich, St. Louis, MO) were added to each sample. Samples were incubated for 20 min, at room temperature, in darkness until analysis. Relative fluorescence intensity of PI-stained nuclei was measured in a Coulter Epics XL Flow Cytometer (Beckman Coulter, Hialeah, FL) equipped with an argon laser (15 mW, 488 nm). Acquisitions were made using SYSTEM II software v. 3.0 (Beckman Coulter, Hialeah, FL). For each sample, the number of events analyzed was approximately 5000. Cell cycle analysis was then conducted based on the histogram outputs. To assess the putative clastogenic effects of SFN on MG-63 cells, full peak coefficient of variation (FPCV) of the G1 /G0 nuclei
327
DNA DAMAGE AND APOPTOSIS BY SULFORAPHANE IN MG-63 CELLS
Downloaded by [Florida Atlantic University] at 20:37 30 January 2015
was determined in each histogram as a measure for clastogenic damage, as recommended by Misra and Easton (36). RNA Extraction and qPCR Gene-specific primer pairs (Table 1) were designed using the program Primer3 (37) and confirmed for specificity by the UCSC In-Silico PCR Genome Browser (http://genome. ucsc.edu/cgi-bin/hgPcr). RNA was extracted from MG-63 control cells and from cells exposed to 10 μM SFN for 48 h, using the TRIzol method. Organic phase separation was achieved in Phase-Lock Gel Heavy tubes (5 Prime 3 Prime, Inc., Boulder, CO). The aqueous phase was mixed with 1 vol 70% ethanol and RNA was purified using RNeasy Mini Kit columns (Qiagen, Hilden, Germany). For cDNA synthesis, 2 μg total RNA were pre-incubated with DNase I (Sigma-Aldrich, St. Louis, MO) and reverse-transcribed with 1 μM Oligo dT18, using the Omniscript RT Kit (Qiagen, Hilden, Germany). The cDNA samples were prediluted in ultrapure MilliQ water (1:20). The final individual qPCR reactions contained iQ SYBR Green Supermix (Bio-Rad, Hercules, CA), 1.5 μM each gene-specific primer, and 1:4 (v/v) prediluted cDNA (1:20). At least 3 qPCR technical replicates were performed per sample from each of 2 independent biological replicates. Average PCR efficiencies and cycle thresholds were determined from the fluorescence data using the algorithm Real-Time PCR Miner (38). Gene expression relative to control cells and normalized with the GAPDH reference gene was calculated from the average efficiencies and cycle thresholds using the Pfaffl method (39). Indirect Immunofluorescence of Cytoskeletal Components For indirect fluorescence, MG-63 cells were grown on glass coverslips and treated with 5, 10, and 20 μM SFN. On the day of experiment, after 24 or 48 h, cells on glass coverslips were washed with PBS, pH 7.4, fixed and permeabilized with ice-cold methanol for 30 min and blocked with bovine serum albumin. After extensive washing with PBS, cells were incubated 1 h for each antibody, being the primary antibody α-tubulin and the secondary antibody DαM-TRITC. Samples were examined using an Eclipse 80i microscope equipped with a PlanApo 100× objective. Fluorescence images were acquired with a
Digital Sight camera, software NIS-Elements F 3.00 SP7 (Nikon, Tokyo, Japan). Usually 2 coverslips per preparation were analyzed and 2 to 4 independent experiments were performed. Comet Assay The comet assay was conducted as referred by Singh and colleagues (40), and Tice and coworkers (41), with few modifications. For this assay, cells were exposed to 5 and 10 μM SFN for 48 h. After SFN treatment, cells were collected and centrifuged at 300 g for 4 min and pellets were resuspended in PBS. Positive control was resuspended in 100 μM H2 O2 (Sigma-Aldrich, St. Louis, MO) for exactly 10 min, and cells were immediately centrifuged at 300 g for 5 min and resuspended in PBS. Fifty microliters of cell suspension were added to 50 μl 1% low melting point agarose and scattered on a slide coated with normal melting point agarose, and a coverslip was placed on top of each slide. After agarose solidification, the coverslip was removed. For cell lysis, slides were immersed in a lysis solution cooled at 4◦ C for 2 h. Slides were then collected and placed in cold electrophoretic buffer (pH 13), in darkness, for 20 min, and electrophoresis was performed for 30 min at 0.74 V. Afterwards, slides were removed and placed in neutralizing buffer for 5 min (repeated twice). Cells were washed with distilled water and dried at room temperature, in darkness. For comet scoring, slides were rehydrated for 15 min, stained with 10 μg/ml ethidium bromide for 5 min, and water excess was removed with distilled water. Slides were observed under the fluorescence microscope Eclipse 80i (Nikon, Tokyo, Japan) equipped with a 510–560nm excitation filter and a 590-nm barrier filter. For each treatment group, 2 slides from each well were screened and 50–100 randomly visualized nucleoids were chosen. Images were captured with imaging software NIS-Elements F 3.00, SP7 (Nikon, Japan). Each nucleoid photograph was run on version 1.2.2 of Comet Assay Software Project to record the comet parameter:% tail DNA. Cytokinesis-Block Micronucleus Cytome (CBMN Cyt) Assay The CBMN Cyt assay was performed according to Fenech’s recommendations for cell lines in log phase (42) with few
TABLE 1 Oligonucleotide primers used for qPCR Target gene CHEK1 CHEK2 CDC25C CCNB1 CDK1 GAPDH
Forward primer (5 -3 ) CCCGCACAGGTCTTTCCTT CACAGCTCTACCCCAGGTTC CCTATGCATCATCAGGACCAC GCTGAAAATAAGGCGAAGATCAA GGGTAGACACAAAACTACAGGTCAA ACACCCACTCCTCCACCTTT
Reverse primer (5 -3 ) CGTGTCATTCTTTTGACCAACC CACAACACAGCAGCACACAC GGCTCATGTCCTTCACCAGA ACCAATGTCCCCAAGAGCTG GGAATCCTGCATAAGCACATC TACTCCTTGGAGGCCATGTG
328
J. M. P. FERREIRA DE OLIVEIRA ET AL.
Downloaded by [Florida Atlantic University] at 20:37 30 January 2015
modifications. Briefly, cells were seeded on coverslips inside 6-well plates and incubated for 24 h. Cells were then exposed to different SFN concentrations for 24 and 48 h. After SFN exposure, cytochalasin B (AppliChem, Darmstadt, Germany) at a 4 μg/ml final concentration was added to each well and incubated during 29 h. At the end of cytochalasin B treatment, cells were fixed with absolute methanol cooled at 4◦ C. Samples were stained with acridine orange (Merck, Darmstadt, Germany), a fluorochrome for nucleic acids that emits green fluorescence and orange fluorescence when binding DNA and RNA, respectively. Finally, coverslips with the adherent cells were removed from the 6-well plates and mounted in slides. These samples were scored for nuclear division index (NDI), nucleoplasmic bridges (NPBs), MN, and apoptosis. NDI The NDI provides a measure of viable cells’ proliferative status and also enables the detection of cytostatic effects. This index was calculated by scoring at least 500 cells for the presence of 1, 2, 3, or 4 nuclei. Nuclear division was not affected by the addition of cytochalasin B, but cytokinesis was arrested. The NDI formula is as follows: NDI = (M1 + 2 ∗ M2 + 3 ∗ M3 + 4 ∗ M4)/N, where M1–M4 is the number of cells with 1–4 nuclei, and N is the total number of cells scored (42). NPBs NPBs were scored according to Fenech (42) in at least 2000 binucleated cells per concentration (2 replicates per concentration). MN At least 2000 binucleated cells were examined per concentration (2 cultures per concentration) for the presence of 1, 2, or more MN. Methyl methanesulfonate- (MMS; Sigma-Aldrich, St. Louis, MO) treated cells were used as positive control at a 20 μg/ml final concentration.
Apoptosis The apoptosis assessment was conducted on the slides used for the assessment of MN according to Fenech (42). Data and Statistical Analysis For qPCR analysis, 2 independent assays with at least 3 replicates were performed. For the remaining quantitative assays, 3 independent assays with at least 3 replicates were performed. The statistical analysis was performed using SigmaPlot for Windows version 11.0 (Systat Software Inc., San Jose, CA). The assessment of statistical significance between control and SFNtreated groups was performed by 1-way or 2-way ANOVA followed by Holm-Sidak’s test. When necessary, data were transformed to achieve normality and equality of variances. The differences were considered significant when P < 0.05. The qPCR data were expressed as mean ± standard error (SE), while the remaining data were expressed as mean ± SD. Pearson’s correlation among the endpoints tested was also performed, and correlations were considered for different thresholds of significance of P < 0.05 and P < 0.01. RESULTS General Cell Characterization and Viability Osteosarcoma MG-63 cells not treated with SFN reached a confluence of 80% after 72 h, with cells showing typical fibroblast-like morphology (Fig. 1A). With the increase of SFN concentration in the medium, the cell confluence decreased, whereas an increase was observed both on the number of detached cells (Fig. 1B–1D) and on the amount of cell debris (Fig. 1C and 1D). Also, morphological changes in the attached cells were observed with increasing SFN concentrations, as cells enlarged and showed a rounder shape. In addition to the changes in cell morphology and number of attached cells after SFN exposure, cell viability was also negatively affected by both SFN concentration and duration of treatment (Fig. 1E). After 24 h of exposure, a significant decrease in cell viability (P < 0.05) was only observed for
FIG. 1. Cytotoxic effect of sulforaphane (SFN) in MG-63 cell line. A–D: Cell confluence and morphology after 48 h of (A) control cells; or cells exposed to (B) 5, (C) 10, or (D) 20 μM SFN. E: Relative viability (%) after 24 and 48 h of exposure to SFN. ∗ Significant differences between control and SFN-treated cells within time (P < 0.05). a,b Significant differences between times (P < 0.05). Bar: 100 μm.
DNA DAMAGE AND APOPTOSIS BY SULFORAPHANE IN MG-63 CELLS
329
Downloaded by [Florida Atlantic University] at 20:37 30 January 2015
FIG. 2. Cytostatic effect of SFN. Cell cycle dynamics of MG-63 cells exposed to sulforaphane (SFN) for (A) 24 and (B) 48 h. ∗ Significant differences between control and SFN-treated cells (P < 0.05).
the concentration of 20 μM. However, after 48 h, cell viability decreased (P < 0.05) in cells exposed to SFN concentrations of 5, 10, and 20 μM compared to control cells. Moreover, the cell viability decreased (P < 0.05) from 24 to 48 h in all SFN conditions, remaining constant in the control. Cell Cycle and Clastogenicity SFN increased the percentage of cells at G2 /M phase in a concentration-dependent manner (Fig. 2). After 24-h exposure, G2 /M phase arrest (P < 0.05) was only observed for cultures exposed to 10 and 20 μM SFN, however, a decrease was observed in the percentage of cells at G1 /G0 already starting from the smallest SFN concentration tested (P < 0.05; Fig. 2A). For 48-h exposure, all SFN concentrations tested increased (P < 0.05) the percentage of cells in the G2 /M phase (Fig. 2B) and decreased the percentage of cells in G1 /G0 . The FPCV of the G1 /G0 peak from the SFN treated cells was not significantly different from that in the control, for the 24-h exposure (Fig. 3A). In contrast, 48-h exposure to SFN induced a significant increase of FPCV, an indicator of clastogenicity (P < 0.05) (Fig. 3B). Expression levels of the analyzed cell cycle genes were in general affected by SFN treatment (Fig. 4). Under the conditions tested, SFN treatment significantly downregulated
(P < 0.01) the expression of the Chk1 kinase-encoding gene and also decreased the expression of CDC25C, encoding the M-phase inducer phosphatase 3. Moreover, a nonsignificant decrease in the expression of the cyclin B1-encoding gene CCNB1 was observed for the SFN-treated cells. SFN was also found to upregulate the expression of CDK1 (P < 0.01). From all the genes tested, the most pronounced effect observed in MG-63 cells upon SFN treatment was downregulation of CDC25C. Cytoskeletal Organization Exposure to increasing SFN concentrations induced marked alterations in the cytoskeletal network of the osteosarcoma cells (Fig. 5). SFN-induced alterations included delocalization of the microtubule-organizing center and disruption of tubulin polymerization, visible at SFN doses ≥ 10 μM (Fig. 5C and 5D).
Comet Assay Higher entrainment of genetic material corresponding to increased number of DNA breaks was observed for increasing SFN concentrations (Fig. 6A–6C). After cells were exposed to 5 and 10 μM SFN for 48 h, an increase (P < 0.05) in % tail
FIG. 3. G1 /G0 peak’s full peak coefficient of variation values of MG-63 cells exposed to sulforaphane (SFN) for (A) 24 and (B) 48 h. ∗ Significant differences between control and SFN-treated cells (P < 0.05).
Downloaded by [Florida Atlantic University] at 20:37 30 January 2015
330
J. M. P. FERREIRA DE OLIVEIRA ET AL.
FIG. 4. Relative gene expression of cell cycle regulators. Gene expression is shown for 48-h exposure to 10 μM sulforaphane (SFN) relative to control. ∗ Significant differences between control and SFN-treated cells (P < 0.01).
DNA was observed for both concentrations. SFN-induced DNA breaks increased with the increase of SFN dose (Fig. 6D). CBMN Cyt Assay Analysis by the CBMN Cyt assay revealed the specific effects of SFN on DNA damage, cytostasis, and cytotoxicity (Fig. 7). This assay enabled to calculate the NDI, to score the NPBs and MN, and to calculate rates of apoptosis. At 20 μM, SFN slides were unsatisfactory for analysis due to extensive cell death (as hinted by MTT assay), although discrete mononucleated cells were observed. At 10 μM SFN, the still low viability levels as
FIG. 5. Sulforaphane (SFN) induces microtubule depolymerization. MG-63 cells were treated with SFN for 48 h and microtubules were visualized by fluorescence microscopy using α-Tubulin antibody. A: Control cells, or cells exposed to (B) 5, (C) 10, or (D) 20 μM SFN. Arrow: microtubule-organizing center; N = nucleus. Bar: 20 μm (color figure available online).
FIG. 6. DNA strand breaks of MG-63 cells treated with sulforaphane (SFN) after 48 h. MG-63 cells were (A) control or exposed to (B) 5 or (C) 10 μM SFN. (D) Percentage of tail DNA induced by different concentrations of SFN for 48 h. ∗ Significant differences between control and SFN-treated cells (P < 0.05).
well as the predominance of mononucleated cells did not allow to score at least 1000 binucleated cells to validate NPBs or MN. This way, NPBs and MN were scored only in cells exposed to up to 5 μM SFN and apoptosis and NDI were scored in cells exposed to up to 10 μM SFN (Fig. 8). NDI only decreased (P < 0.05) at 10 μM SFN for both exposure periods, demonstrating a cytostatic effect of this treatment. For the 5 μM SFN at 48 h of exposure, the results showed a significant increase in NPBs and MN formation (P < 0.05, Fig. 8B and 8C, respectively). As for the apoptosis evaluation, all SFN concentrations produced a significant increase in apoptosis (P < 0.05) (Fig. 8D). Exposure to 5 μM SFN presented a significant increase relatively to control (P < 0.05), but this increased apoptosis was not significantly different between exposure periods. Exposure to 10 μM SFN, however, was significantly more increased at 48- compared to 24-h exposure. DISCUSSION SFN is a plant-derived ITC, which has been shown to display chemopreventive activity against different tumor types, and for which some clinical trials are already ongoing [e.g., breast (http://clinicaltrials.gov/ct2/show/NCT00982319) and prostate cancer (http://clinicaltrials.gov/ct2/show/NCT01228084)]. SFN was reported to induce apoptosis or modulate cell cycle progression of highly proliferative cancer cells (e.g., 43). Importantly, the nature and intensity of SFN effects have been described to depend on SFN concentration, time of exposure, and cell type (25,44). The present study was undertaken to investigate the effects of SFN on MG-63 cell line and therefore to contribute to the evaluation of SFN as a chemotherapeutic agent for osteosarcoma.
Downloaded by [Florida Atlantic University] at 20:37 30 January 2015
DNA DAMAGE AND APOPTOSIS BY SULFORAPHANE IN MG-63 CELLS
FIG. 7. Microphotographs representative of the endpoints scored in cytokinesis-block micronucleus cytome Cyt assay. A: Binucleated cells from control sample. B: Nucleoplasmic bridges, pointed by arrows. C: Micronuclei, pointed by arrows. D: Apoptotic cells (color figure available online).
For this, MG-63 cells were exposed to SFN at physiologically attainable doses, previously described in the human plasma, that is, up to 10 μM SFN (9), and also to the higher dose of 20 μM SFN. We found that SFN exerts dose- and time-dependent cytotoxicity to the MG-63 cell line. SFN caused a concentrationdependent decrease in cell viability and proliferation (Fig. 9). As expected, cell viability is also negatively correlated with the increase in apoptotic cells (Fig. 9). Our data indicate that SFN induces a dose-dependent increase in apoptosis in MG-63 cells in both experimental periods, although in higher degree after 48 h. For the same range of SFN doses, Kim and coworkers (19) also found apoptotic cell death in the osteosarcoma U2-OS cell line. In Saos-2 and MG-63 cells, SFN was shown to promote apoptosis via extrinsic TNF-related apoptosisinducing ligand receptor, involving a cascade of caspases activation (45). SFN was also analyzed for its effects on cell cycle progression. In murine osteosarcoma, SFN has been previously found by Sawai and coworkers to increase the population of cells in
331
G2 /M phase (46). Based on our results, SFN induced a G2 /M phase arrest as shown by flow cytometry DNA content analysis. The cytostatic effect of SFN is also confirmed by the significant decrease of NDI values at 10 μM SFN, and also by the negative correlation between NDI and the percentage of cells in G2 /M phase of cell cycle, although not reaching statistical significance (Fig. 9, P = 0.06). The G2 /M arrest was associated with markedly decreased CDC25C transcript levels for the 10 μM SFN concentration, suggesting that the encoded phosphatase enzyme may play a role in the G2 /M phase arrest observed. Chk1/2 and Cdc25 are the key players in DNA damage control during G2 /M transition, whose main effector is the cyclin B1-Cdk1 complex (47). Furthermore, Cdk1 activity is negatively regulated by phosphorylation (e.g., Wee1 and Myt1 kinases), which can be reversed by the phosphatase Cdc25C, required for G2 /M transition (48). In previous studies (e.g., 17–19), SFN treatment has been found associated with decreased Cdc25C and cyclin B1 protein levels. In this study, and to our knowledge for the first time, SFN was also shown to decrease the expression of the genes encoding these cell cycle regulators. Such differential gene expression reinforces the key role of Cdc25C depletion and hence cyclin B1/Cdk1 complex inactivation in SFN-induced G2 /M cell cycle arrest. Suppipat (21) found that in acute lymphoblastic leukemia cells, SFN inactivated the cyclin B1/Cdk1 complex by increasing phosphorylation of Cdk1. Moreover, Matsui and coworkers (22) found that SFN induced an upregulation of p21Cip1 in MG-63, which contributed to the observed G2 /M blockage and the same was observed in U2-OS, another OS cell line, by Kim and coworkers (19). Apart from the alterations in cell cycle regulators induced by SFN, our data also confirmed in MG-63 cells the previously reported activity of SFN as microtubule depolymerizing agent. Perturbations in microtubule dynamics induced by sulforaphane (e.g., 49–52) have been associated with G2 /M phase arrest. SFN has been reported to affect the cytoskeleton e.g. by conformational changes in tubulin (53), tubulin acetylation (54), and cytoskeleton protein modifications (55). Alterations in microtubule dynamics have been related with MN formation (56) and its formation represents an irreversible DNA damage caused by chromosome loss and/or breakage during mitosis. In this study, a 48-h exposure to 5 μM SFN resulted in a significant increase in MN and NPBs frequency in MG-63 cells and the formation of such nuclear abnormalities is negatively correlated with cell viability (P < 0.05) (Fig. 9). This observation is clearly in contrast with that reported in the literature concerning micronucleus induction by SFN in cultured normal human lymphocytes (24,25), where depending on the conditions, SFN may prevent micronucleus formation. In our study, similarly to what was found in other studies (57), NPBs and MN were observed in control MG-63 cells, confirming chromosomal instability in this cell line. Moreover, in the MG-63 cell line, 48-h exposure to 5 μM SFN resulted in an increase in DNA strand breaks, which is a leading cause of both MN and NPB formation, as previously reviewed (56).
Downloaded by [Florida Atlantic University] at 20:37 30 January 2015
332
J. M. P. FERREIRA DE OLIVEIRA ET AL.
FIG. 8. Cytokinesis-block micronucleus cytome Cyt assay endpoints of MG-63 cells treated with sulforaphane (SFN) after 24 and 48 h. A: Nuclear division index. B: Nucleoplasmic bridges. C: Micronuclei. D: Percentage of apoptotic cells. ∗ Significant differences between control and SFN-treated cells within time (P < 0.05). ∗∗ Significant differences between positive control (methyl methanesulfonate; MMS) and SFN-treated cells (P < 0.05). a,b Significant differences between times (P < 0.05).
The dispersion of nuclear DNA content measured by FPCV also reflects chromosomal perturbations (e.g., chromosome breakage and reattachment, loss of chromosome fragments) that result in unequal distribution of DNA in the daughter cells and magnification of the genomic destabilization by further divisions (36). The significant increase of the FPCV values for all SFN doses, after 48 h of treatment, supports the clastogenic damage induced by longer periods of exposure to this ITC. As mentioned above, apart from clastogenic effects, SFN induces concentration-dependent DNA strand breaks in MG-63 cells. Sestili and colleagues detected DNA single-strand breaks even for low exposure periods to SFN in different cell lines (34). In addition, Kim and coworkers (19) found DNA fragmentation in U2-OS cells upon exposure to SFN. Moreover, Sawai and colleagues reported that SFN can act as radiosensitizer, when used in combination with 2 Gy X-irradiation (46), raising the possibility that SFN could increase DNA damage caused by irradiation. In addition to these observations, results suggest that in our osteosarcoma model, a significant amount of DNA fragmentation is associated with apoptotic events, as expressed by a positive correlation of DNA fragmentation (expressed as % tail DNA) with the percentage of late apoptotic cells, as detected by the CBMN Cyt assay (P < 0.05) (Fig. 9). To our knowledge, this is the first work reporting the genotoxic effects (in particular DNA strand breaks, NPBs and MN formation) of SFN in an in vitro human osteosarcoma model.
FIG. 9. Correlation coefficients between sulforaphane (SFN) concentrations and the several cytotoxicity and genotoxicity endpoints. Blue lines indicate negative correlation and red lines indicate positive correlation. Thick solid lines = significant for P < 0.01; thin solid lines = significant for P < 0.05; dashed lines = large correlation coefficient but not significant (R > 0.5; P ≥ 0.05). MN = micronuclei; NPBs = nucleoplasmic bridges; NDI = nuclear division index (color figure available online).
DNA DAMAGE AND APOPTOSIS BY SULFORAPHANE IN MG-63 CELLS
In conclusion, the present study offers a novel insight into the mechanism of SFN-induced cytotoxicity and genotoxicity in the MG-63 osteosarcoma cell line, supporting that genotoxic effects may play important roles in the arrest of cell cycle and increased apoptosis, and these events correlate with chromosomal and nuclear abnormalities. In particular, the inhibition of cell division by SFN correlated with the raises of NPBs, MN, and cell cycle blockage at G2 /M phase transition. Because osteosarcoma is refractory to conventional chemotherapy, the role of SFN as potentiator of the effects of anticancer drugs deserves careful further consideration.
Downloaded by [Florida Atlantic University] at 20:37 30 January 2015
ACKNOWLEDGMENTS We thank Cristina Monteiro and Andreia Ascenso for proofreading the article.
13.
14.
15.
16.
17.
18.
FUNDING This study was supported by the Portuguese Foundation for Science and Technology through the postdoctoral fellowships of Helena Oliveira (SFRH/BPD/48853/2008) and Jos´e Miguel P. Ferreira de Oliveira (SFRH/BPD/74868/2010). REFERENCES 1. Stiller CA, Bielack SS, Jundt G, and Steliarova-Foucher E: Bone tumours in European children and adolescents, 1978–1997. Report from the Automated Childhood Cancer Information System project. Eur J Cancer 42, 2124–2135, 2006. 2. Ham SJ, Schraffordt Koops H, van der Graaf WT, van Horn JR, Postma L, et al.: Historical, current and future aspects of osteosarcoma treatment. Eur J Surg Oncol 24, 584–600, 1998. 3. Gorlick R and Khanna C: Osteosarcoma. J Bone Miner Res 25, 683–691, 2010. 4. Ta HT, Dass CR, Larson I, Choong PFM, and Dunstan DE: A chitosandipotassium orthophosphate hydrogel for the delivery of Doxorubicin in the treatment of osteosarcoma. Biomaterials 30, 3605–3613, 2009. 5. PosthumaDeBoer J, Witlox MA, Kaspers GJL, and van Royen BJ: Molecular alterations as target for therapy in metastatic osteosarcoma: a review of literature. Clin Exp Metastas 28, 493–503, 2011. 6. Wachtel M and Schafer BW: Targets for cancer therapy in childhood sarcomas. Cancer Treat Rev 36, 318–327, 2010. 7. Broadhead ML, Clark JC, Myers DE, Dass CR, and Choong PF: The molecular pathogenesis of osteosarcoma: a review. Sarcoma 2011, 959248, 1–12, 2011. 8. Clarke JD, Hsu A, Riedl K, Bella D, Schwartz SJ, et al.: Bioavailability and inter-conversion of sulforaphane and erucin in human subjects consuming broccoli sprouts or broccoli supplement in a cross-over study design. Pharmacol Res 64, 456–463, 2011. 9. Gasper AV, Al-janobi A, Smith JA, Bacon JR, Fortun P, et al.: Glutathione S-transferase M1 polymorphism and metabolism of sulforaphane from standard and high-glucosinolate broccoli. Am J Clin Nutr 82, 1283–1291, 2005. 10. Brooks JD, Paton VG, and Vidanes G: Potent induction of phase 2 enzymes in human prostate cells by sulforaphane. Cancer Epidemiol Biomarkers Prev 10, 949–954, 2001. 11. Morimitsu Y, Nakagawa Y, Hayashi K, Fujii H, Kumagai T, et al.: A sulforaphane analogue that potently activates the Nrf2-dependent detoxification pathway. J Biol Chem 277, 3456–3463, 2002. 12. Huang TY, Chang WC, Wang MY, Yang YR, and Hsu YC: Effect of sulforaphane on growth inhibition in human brain malignant glioma GBM
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
333
8401 cells by means of mitochondrial- and MEK/ERK-mediated apoptosis pathway. Cell Biochem Biophys 63, 247–259, 2012. Kallifatidis G, Labsch S, Rausch V, Mattern J, Gladkich J, et al.: Sulforaphane Increases Drug-mediated Cytotoxicity Toward Cancer Stem-like Cells of Pancreas and Prostate. Mol Ther 19, 188–195, 2011. Kanematsu S, Yoshizawa K, Uehara N, Miki H, Sasaki T, et al.: Sulforaphane inhibits the growth of KPL-1 human breast cancer cells in vitro and suppresses the growth and metastasis of orthotopically transplanted KPL-1 cells in female athymic mice. Oncol Rep 26, 603–608, 2011. Li YY, Zhang T, Korkaya H, Liu SL, Lee HF, et al.: Sulforaphane, a dietary component of broccoli/broccoli sprouts, inhibits breast cancer stem cells. Clin Cancer Res 16, 2580–2590, 2010. Rausch V, Liu L, Kallifatidis G, Baumann B, Mattern J, et al.: Synergistic Activity of Sorafenib and Sulforaphane Abolishes Pancreatic Cancer Stem Cell Characteristics. Cancer Res 70, 5004–5013, 2010. Singh SV, Herman-Antosiewicz A, Singh AV, Lew KL, Srivastava SK, et al.: Sulforaphane-induced G2/M phase cell cycle arrest involves checkpoint kinase 2-mediated phosphorylation of cell division cycle 25C. J Biol Chem 279, 25813–25822, 2004. Herman-Antosiewicz A, Xiao H, Lew KL, and Singh SV: Induction of p21 protein protects against sulforaphane-induced mitotic arrest in LNCaP human prostate cancer cell line. Mol Cancer Ther 6, 1673–1681, 2007. Kim MR, Zhou L, Park BH, and Kim JR: Induction of G(2)/M arrest and apoptosis by sulforaphane in human osteosarcoma U2-OS cells. Mol Med Rep 4, 929–934, 2011. Shen G, Xu C, Chen C, Hebbar V, and Kong AN: p53-independent G1 cell cycle arrest of human colon carcinoma cells HT-29 by sulforaphane is associated with induction of p21CIP1 and inhibition of expression of cyclin D1. Cancer Chemother Pharmacol 57, 317–327, 2006. Suppipat K, Park CS, Shen Y, Zhu X, and Lacorazza HD: Sulforaphane induces cell cycle arrest and apoptosis in acute lymphoblastic leukemia cells. PLoS One 7, e51251, 2012. Matsui TA, Murata H, Sakabe T, Sowa Y, Horie N, et al.: Sulforaphane induces cell cycle arrest and apoptosis in murine osteosarcoma cells in vitro and inhibits tumor growth in vivo. Oncol Rep 18, 1263–1268, 2007. Chiao JW, Chung FL, Kancherla R, Ahmed T, Mittelman A, et al.: Sulforaphane and its metabolite mediate growth arrest and apoptosis in human prostate cancer cells. Int J Oncol 20, 631–636, 2002. Fimognari C, Berti F, Iori R, Cantelli-Forti G, and Hrelia P: Micronucleus formation and induction of apoptosis by different isothiocyanates and a mixture of isothiocyanates in human lymphocyte cultures. Mutat Res-Gen Tox En 582, 1–10, 2005. Fimognari C, Berti F, Cantelli-Forti G, and Hrelia P: Effect of sulforaphane on micronucleus induction in cultured human lymphocytes by four different mutagens. Environ Mol Mutagen 46, 260–267, 2005. Tope AM and Rogers PF: Evaluation of protective effects of sulforaphane on DNA damage caused by exposure to low levels of pesticide mixture using comet assay. J Environ Sci Heal B 44, 657–662, 2009. Barcelo S, Gardiner JM, Gescher A, and Chipman JK: CYP2E1-mediated mechanism of anti-genotoxicity of the broccoli constituent sulforaphane. Carcinogenesis 17, 277–282, 1996. Gross-Steinmeyer K, Stapleton PL, Tracy JH, Bammler TK, Strom SC, et al.: Sulforaphane- and phenethyl isothiocyanate-induced inhibition of aflatoxin B1-mediated genotoxicity in human hepatocytes: role of GSTM1 genotype and CYP3A4 gene expression. Toxicol Sci 116, 422– 432, 2010. Bonnesen C, Eggleston IM, and Hayes JD: Dietary indoles and isothiocyanates that are generated from cruciferous vegetables can both stimulate apoptosis and confer protection against DNA damage in human colon cell lines. Cancer Res 61, 6120–6130, 2001. Rudolf E and Cervinka M: Sulforaphane induces cytotoxicity and lysosomeand mitochondria-dependent cell death in colon cancer cells with deleted p53. Toxicol in Vitro 25, 1302–1309, 2011. Cho SD, Li G, Hu H, Jiang C, Kang KS, et al.: Involvement of c-Jun Nterminal kinase in G2/M arrest and caspase-mediated apoptosis induced by
334
32.
33.
34.
35.
Downloaded by [Florida Atlantic University] at 20:37 30 January 2015
36.
37. 38.
39. 40.
41.
42. 43.
44.
J. M. P. FERREIRA DE OLIVEIRA ET AL.
sulforaphane in DU145 prostate cancer cells. Nutr Cancer 52, 213–224, 2005. Rudolf E, Andelova H and Cervinka M: Activation of several concurrent proapoptic pathways by sulforaphane in human colon cancer cells SW620. Food Chem Toxicol 47, 2366–2373, 2009. Sekine-Suzuki E, Yu D, Kubota N, Okayasu R, and Anzai K: Sulforaphane induces DNA double strand breaks predominantly repaired by homologous recombination pathway in human cancer cells. Biochem Bioph Res Co 377, 341–345, 2008. Sestili P, Paolillo M, Lenzi M, Colombo E, Vallorani L, et al.: Sulforaphane induces DNA single strand breaks in cultured human cells. Mutat Res-Fund Mol M 689, 65–73, 2010. Twentyman PR and Luscombe M. 1987. A study of some variables in a tetrazolium dye (MTT) based assay for cell growth and chemosensitivity. Br J Cancer 56, 279–285, 1987. Misra RK and Easton MD: Comment on analyzing flow cytometric data for comparison of mean values of the coefficient of variation of the G1 peak. Cytometry 36, 112–116, 1999. Rozen S and Skaletsky H: Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 132, 365–386, 2000. Zhao S and Fernald RD: Comprehensive algorithm for quantitative real-time polymerase chain reaction. J Comput Biol 12, 1047– 1064, 2005. Pfaffl MW: A new mathematical model for relative quantification in realtime RT-PCR. Nucleic Acids Res 29, e45, 2001. Singh NP, McCoy MT, Tice RR, and Schneider EL: A simple technique for quantitation of low levels of DNA damage in individual cells. Exp Cell Res 175, 184–191, 1988. Tice RR, Agurell E, Anderson D, Burlinson B, Hartmann A, et al.: Single cell gel/comet assay: guidelines for in vitro and in vivo genetic toxicology testing. Environ Mol Mutagen 35, 206–221, 2000. Fenech M: Cytokinesis-block micronucleus cytome assay. Nat Protoc 2, 1084–1104, 2007. Fimognari C, Nusse M, Cesari R, Iori R, Cantelli-Forti G, et al.: Growth inhibition, cell-cycle arrest and apoptosis in human T-cell leukemia by the isothiocyanate sulforaphane. Carcinogenesis 23, 581–586, 2002. Song MY, Kim EK, Moon WS, Park JW, Kim HJ, et al.: Sulforaphane protects against cytokine- and streptozotocin-induced beta-cell damage by suppressing the NF-kappaB pathway. Toxicol Appl Pharmacol 235, 57–67, 2009.
45. Matsui TA, Sowa Y, Yoshida T, Murata H, Horinaka M, et al.: Sulforaphane enhances TRAIL-induced apoptosis through the induction of DR5 expression in human osteosarcoma cells. Carcinogenesis 27, 1768– 1777, 2006. 46. Sawai Y, Murata H, Horii M, Koto K, Matsui T, et al.: Effectiveness of sulforaphane as a radiosensitizer for murine osteosarcoma cells. Oncology Reports 29, 941–945, 2013. 47. Boutros R, Lobjois V, and Ducommun B: CDC25 phosphatases in cancer cells: key players? Good targets? Nat Rev Cancer 7, 495–507, 2007. 48. Medema RH and Macurek L: Checkpoint control and cancer. Oncogene 31, 2601–2613, 2012. 49. Jackson SJ and Singletary KW: Sulforaphane inhibits human MCF-7 mammary cancer cell mitotic progression and tubulin polymerization. J Nutr 134, 2229–2236, 2004. 50. Jackson SJ and Singletary KW: Sulforaphane: a naturally occurring mammary carcinoma mitotic inhibitor, which disrupts tubulin polymerization. Carcinogenesis 25, 219–227, 2004. 51. Jackson SJ, Singletary KW, and Venema RC: Sulforaphane suppresses angiogenesis and disrupts endothelial mitotic progression and microtubule polymerization. Vascul Pharmacol 46, 77–84, 2007. 52. Azarenko O, Okouneva T, Singletary KW, Jordan MA, and Wilson L: Suppression of microtubule dynamic instability and turnover in MCF7 breast cancer cells by sulforaphane. Carcinogenesis 29, 2360–2368, 2008. 53. Mi L, Xiao Z, Hood BL, Dakshanamurthy S, Wang X, et al.: Covalent binding to tubulin by isothiocyanates. A mechanism of cell growth arrest and apoptosis. J Biol Chem 283, 22136–22146, 2008. 54. Rajendran P, Delage B, Dashwood WM, Yu TW, Wuth B, et al. Histone deacetylase turnover and recovery in sulforaphane-treated colon cancer cells: competing actions of 14–3–3 and Pin1 in HDAC3/SMRT corepressor complex dissociation/reassembly. Mol Cancer 10, 68, 2011. 55. Mi L, Hood BL, Stewart NA, Xiao Z, Govind S, et al.: Identification of potential protein targets of isothiocyanates by proteomics. Chem Res Toxicol 24, 1735–1743, 2011. 56. Fenech M, Kirsch-Volders M, Natarajan AT, Surralles J, Crott JW, et al.: Molecular mechanisms of micronucleus, nucleoplasmic bridge and nuclear bud formation in mammalian and human cells. Mutagenesis 26, 125–132, 2011. 57. Al-Romaih K, Bayani J, Vorobyova J, Karaskova J, Park PC, et al.: Chromosomal instability in osteosarcoma and its association with centrosome abnormalities. Cancer Genet Cytogenet 144, 91–99, 2003.
Nutrition and Cancer Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/hnuc20
Sulforaphane Induces DNA Damage and Mitotic Abnormalities in Human Osteosarcoma MG-63 Cells: Correlation with Cell Cycle Arrest and Apoptosis a
a
a
José Miguel P. Ferreira de Oliveira , Catarina Remédios , Helena Oliveira , Pedro Pinto a
a
a
, Francisco Pinho , Sónia Pinho , Maria Costa & Conceição Santos
a
a
a
CESAM & Laboratory of Biotechnology and Cytomics, Department of Biology , University of Aveiro , Campus Universitário de Santiago, Aveiro , Portugal Published online: 09 Jan 2014.
Click for updates To cite this article: José Miguel P. Ferreira de Oliveira , Catarina Remédios , Helena Oliveira , Pedro Pinto , Francisco Pinho , Sónia Pinho , Maria Costa & Conceição Santos (2014) Sulforaphane Induces DNA Damage and Mitotic Abnormalities in Human Osteosarcoma MG-63 Cells: Correlation with Cell Cycle Arrest and Apoptosis, Nutrition and Cancer, 66:2, 325-334, DOI: 10.1080/01635581.2014.864777 To link to this article: http://dx.doi.org/10.1080/01635581.2014.864777
PLEASE SCROLL DOWN FOR ARTICLE Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) contained in the publications on our platform. However, Taylor & Francis, our agents, and our licensors make no representations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of the Content. Any opinions and views expressed in this publication are the opinions and views of the authors, and are not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon and should be independently verified with primary sources of information. Taylor and Francis shall not be liable for any losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoever or howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use of the Content. This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http:// www.tandfonline.com/page/terms-and-conditions
Nutrition and Cancer, 66(2), 325–334 C 2014, Taylor & Francis Group, LLC Copyright ISSN: 0163-5581 print / 1532-7914 online DOI: 10.1080/01635581.2014.864777
Sulforaphane Induces DNA Damage and Mitotic Abnormalities in Human Osteosarcoma MG-63 Cells: Correlation with Cell Cycle Arrest and Apoptosis Jos´e Miguel P. Ferreira de Oliveira, Catarina Rem´edios, Helena Oliveira, Pedro Pinto, Francisco Pinho, S´onia Pinho, Maria Costa, and Conceic¸a˜ o Santos
Downloaded by [Florida Atlantic University] at 20:37 30 January 2015
CESAM & Laboratory of Biotechnology and Cytomics, Department of Biology, University of Aveiro, Campus Universit´ario de Santiago, Aveiro, Portugal
Osteosarcoma is a recalcitrant bone malignancy with poor responsiveness to treatments; therefore, new chemotherapeutic compounds are needed. Sulforaphane (SFN) has been considered a promising chemotherapeutic compound for several types of tumors by inducing apoptosis and cytostasis, but its effects (e.g., genotoxicity) in osteosarcoma cells remains exploratory. In this work, the MG-63 osteosarcoma cell line was exposed to SFN up to 20 μM for 24 and 48 h. SFN induced G2 /M phase arrest and decreased nuclear division index, associated with disruption of cytoskeletal organization. Noteworthy, SFN induced a transcriptome response supportive of G2 /M phase arrest, namely a decrease in Chk1- and Cdc25C-encoding transcripts, and an increase in Cdk1-encoding transcripts. After 48-h exposure, SFN at a dietary concentration (5 μM) contributed to genomic instability in the MG-63 cells as confirmed by increased number of DNA breaks, clastogenicity, and nuclear and mitotic abnormalities. The increased formation of nucleoplasmic bridges, micronuclei, and apoptotic cells positively correlated with loss of viability. These results suggest that genotoxic damage is an important step for SFN-induced cytotoxicity in MG-63 cells. In conclusion, SFN shows potential to induce genotoxic damage at low concentrations and such potential deserves further investigation in other tumor cell types.
INTRODUCTION Osteosarcoma is an aggressive bone malignancy that shows high prevalence in children and adolescents. In Western populations, malignant bone tumors represent 3–5% of all cancers diagnosed in children below 15 years of age and 7–8% of those in adolescents aged to 15–19 years (1). Local recurrence and metastases (mainly at the lungs) still affect approximately
Submitted 16 May 2013; accepted in final form 4 November 2013. Address correspondence to Jos´e Miguel P. Ferreira de Oliveira, CESAM & Laboratory of Biotechnology and Cytomics, Department of Biology, University of Aveiro, Campus Universit´ario de Santiago, 3810-193 Aveiro, Portugal. Phone: +351 234 370 350. Fax: +351 234 372 587. E-mail: [email protected]
30–40% of all patients and seem to be the major cause of death, leading to a poor prognosis of patients affected with osteosarcoma (2). Patients’ low survival rates are largely due to osteosarcoma poor responsiveness to current treatments, which typically involve surgical resection and chemotherapy with cisplatin, doxorubicin, or methotrexate (3,4). It is therefore necessary to find alternative compounds able to increase the sensitization of osteosarcoma cells. As in other cancer types, disruption of pathways related to apoptosis and cell cycle were also observed in osteosarcoma cells, in in vivo and in vitro studies (5,6). The molecular pathogenesis of osteosarcoma remains unclear, as the analysis of signaling networks and pathways underlying initiation and proliferation are not straightforward (7). Various chemical compounds are known inducers of apoptosis or regulators of the cell cycle in vitro. One such example is the group of isothiocyanates (ITCs), which are formed by hydrolysis from their precursor compounds glucosinolates. Two widely studied glucosinolate derivatives (derived mostly from cruciferous vegetables) are sulforaphane (SFN) and indole-3-carbinol. Studies reveal that, after the consumption of SFN-rich foodstuffs, SFN plasma concentrations in humans reach a peak of 2 to 3 μM (8), with maximum concentrations of about 10 μM being found after the consumption of high-glucosinolate broccoli (9). SFN plays a protective role by modulating Phase 1 and Phase 2 enzyme activities (10,11). SFN was also found to be an antiproliferative agent in vitro and in vivo (12–17) by inducing cytostasis and apoptosis. Cytostatic effects of SFN are due to its inhibition of G1 /G0 , G2 /M, or S phase progression, depending on the cell line studied (18–20). In acute lymphoblastic leukemia cells, Suppipat and coworkers found that SFN induced a G2 /M arrest, through inactivation of the cyclin B1-cyclin-dependent kinase 1 (Cdk1) complex (21). Also, Singh and coworkers found that G2 /M phase arrest by SFN was shown to correlate with decreased levels of Cdc25C protein and accumulation of inactive phosphorylated Cdk1 (17). Moreover, SFN induced Ser-216 phosphorylation of Cdc25C resulting from the activation of DNA-damage checkpoint Chk2
325
Downloaded by [Florida Atlantic University] at 20:37 30 January 2015
326
J. M. P. FERREIRA DE OLIVEIRA ET AL.
(17). Despite its promising results on other tumor cells, the potential of SFN as a chemotherapeutic agent for osteosarcoma remains exploratory. In murine LM8 and in human U2-OS osteosarcoma cell lines, this compound induced some cytostatic and apoptotic effects (19,22). Genomic DNA breaks represent an important trigger, though not exclusive, of apoptosis (23). Some studies focused on DNA breaks to assess SFN-induced apoptosis in various cancer cell lines (e.g., 23,24), but the effects were cell line and dosedependent and several studies demonstrated the ability of SFN to protect cells from genotoxic insult (25). SFN genotoxic effects remain to be unveiled and the integration of available data from different studies is hampered given the complexity introduced by the use of different cell lines or different exposure regimens. In normal human and rat cells and at dietary concentrations ≤10 μM, SFN has been shown to offer protection against DNA damage by mutagens in vitro (26), for example, through the inhibition of cytochrome P450 enzymes (27,28) or induction of Phase 2 enzymes (29). However, SFN has been also shown to promote DNA damage in colon tumor cells (30). DNA damage by SFN has so far been found either associated with oxidative stress (31) or unrelated to this type of stress (30), depending on the cell line and exposure conditions used. Other mechanisms associated with DNA damage pathways by SFN include c-Jun N-terminal Kinase (JNK) activation via apoptotic caspase-2 (32) and stimulation of Bid cleavage by leaked lysosomal cathepsin (30). DNA double-strand breaks were found only at SFN concentrations above 10 μM and at longer exposure times in different cell lines (33,34). However, in human lymphocytes lower SFN concentrations (0–10 μM) have been found to inhibit micronuclei (MN) formation induced by selected mutagens (25). Considering the promising effects of SFN on inhibiting other tumor cells proliferation, and the controversial data on its genotoxic effects, we aimed with this study to evaluate the potential of SFN as an antiproliferative agent of osteosarcoma cells and further clarify if it induces genotoxicity in these tumor cells. For that, we investigated the in vitro effects of SFN on MG-63 osteosarcoma cells viability and DNA/nuclear damages, which were then correlated with other parameters of cytotoxicity, namely apoptotic rate and cell cycle dynamics. To our knowledge, this is the first study offering an integrated view on the genotoxic effects of SFN enabled by the use of a wide battery of genotoxic markers. MATERIALS AND METHODS Cell Culture and Exposure to SFN Human osteosarcoma MG-63 cell line (ATCC, Manassas, VA) was cultured in α-Minimum Essential Medium supplemented with 10% fetal bovine serum, 2.5 μg/ml fungizone, 100 U/ml penicillin–100 μg/ml streptomycin at 37◦ C in a 5% CO2 humidified atmosphere. Cells were daily observed under an inverted phase-contrast Eclipse TS100 microscope (Nikon,
Tokyo, Japan), and when culture reached approximately 80% confluence (usually after 3 days), cells were trypsinized with Trypsin-EDTA (0.25% Trypsin, 1 mM EDTA) and subcultured at a split ratio of 1:10. All cell culture reagents were from Life Technologies (Carlsbad, CA). D,L-sulforaphane (Sigma-Aldrich, St. Louis, MO) was dissolved in dimethyl sulfoxide (DMSO, Sigma-Aldrich, St. Louis, MO) at a concentration of 10 mM and stored at −20◦ C. For each experiment, cells were allowed to adhere for 24 h and then medium was replaced with fresh medium containing 0, 5, 10, and 20 μM SFN. The effect of SFN was measured after 24 and 48 h. During the experiment, cultures were routinely visualized for confluence and cell morphology. Cell Viability Assay Cell viability was determined by the colorimetric 3-(4,5dimethyl-2-thiazolyl)-2,5-diphenyl tetrazolium bromide (MTT) assay, which measures the formation of purple formazan in viable cells. The MTT assay was performed according to Twentyman and Luscombe (35) with slight modifications. Briefly, cells were seeded in 96-well plates and after SFN exposure, 50 μl MTT reagent (Sigma-Aldrich, St. Louis, MO) at 1 mg/ml phosphate buffered saline (PBS) were added to each well. Plates were incubated at 37◦ C, 5% CO2 , in darkness, for 4 h. The medium and MTT were removed and 150 μl DMSO were added to each well. Plates were agitated for 2 h, in darkness, to dissolve the formazan crystals. Absorbance was measured at 570 nm using a Synergy HT Multi-mode Microplate Reader (BioTek Instruments, Winooski, VT). Cell Cycle and Clastogenicity Analysis Cell cycle and clastogenicity were assayed by flow cytometry using the fluorescent probe propidium iodide (PI; SigmaAldrich, St. Louis, MO). Cells were seeded in 6-well plates. Control and treated cells were washed with PBS, harvested using Trypsin-EDTA and centrifuged twice at 300 g for 5 min. Cells were then fixed with 1 ml 85% ethanol at 4◦ C and kept at −20◦ C until further analysis. At the time of analysis, fixed cells were centrifuged at 300 g for 5 min and resuspended in 0.8 ml PBS. The cell suspension was collected and filtered through a 35 μm nylon mesh to separate aggregated cells. Subsequently, 50 μl PI (50 μg/ml) and 50 μl RNase (50 μg/ml; Sigma-Aldrich, St. Louis, MO) were added to each sample. Samples were incubated for 20 min, at room temperature, in darkness until analysis. Relative fluorescence intensity of PI-stained nuclei was measured in a Coulter Epics XL Flow Cytometer (Beckman Coulter, Hialeah, FL) equipped with an argon laser (15 mW, 488 nm). Acquisitions were made using SYSTEM II software v. 3.0 (Beckman Coulter, Hialeah, FL). For each sample, the number of events analyzed was approximately 5000. Cell cycle analysis was then conducted based on the histogram outputs. To assess the putative clastogenic effects of SFN on MG-63 cells, full peak coefficient of variation (FPCV) of the G1 /G0 nuclei
327
DNA DAMAGE AND APOPTOSIS BY SULFORAPHANE IN MG-63 CELLS
Downloaded by [Florida Atlantic University] at 20:37 30 January 2015
was determined in each histogram as a measure for clastogenic damage, as recommended by Misra and Easton (36). RNA Extraction and qPCR Gene-specific primer pairs (Table 1) were designed using the program Primer3 (37) and confirmed for specificity by the UCSC In-Silico PCR Genome Browser (http://genome. ucsc.edu/cgi-bin/hgPcr). RNA was extracted from MG-63 control cells and from cells exposed to 10 μM SFN for 48 h, using the TRIzol method. Organic phase separation was achieved in Phase-Lock Gel Heavy tubes (5 Prime 3 Prime, Inc., Boulder, CO). The aqueous phase was mixed with 1 vol 70% ethanol and RNA was purified using RNeasy Mini Kit columns (Qiagen, Hilden, Germany). For cDNA synthesis, 2 μg total RNA were pre-incubated with DNase I (Sigma-Aldrich, St. Louis, MO) and reverse-transcribed with 1 μM Oligo dT18, using the Omniscript RT Kit (Qiagen, Hilden, Germany). The cDNA samples were prediluted in ultrapure MilliQ water (1:20). The final individual qPCR reactions contained iQ SYBR Green Supermix (Bio-Rad, Hercules, CA), 1.5 μM each gene-specific primer, and 1:4 (v/v) prediluted cDNA (1:20). At least 3 qPCR technical replicates were performed per sample from each of 2 independent biological replicates. Average PCR efficiencies and cycle thresholds were determined from the fluorescence data using the algorithm Real-Time PCR Miner (38). Gene expression relative to control cells and normalized with the GAPDH reference gene was calculated from the average efficiencies and cycle thresholds using the Pfaffl method (39). Indirect Immunofluorescence of Cytoskeletal Components For indirect fluorescence, MG-63 cells were grown on glass coverslips and treated with 5, 10, and 20 μM SFN. On the day of experiment, after 24 or 48 h, cells on glass coverslips were washed with PBS, pH 7.4, fixed and permeabilized with ice-cold methanol for 30 min and blocked with bovine serum albumin. After extensive washing with PBS, cells were incubated 1 h for each antibody, being the primary antibody α-tubulin and the secondary antibody DαM-TRITC. Samples were examined using an Eclipse 80i microscope equipped with a PlanApo 100× objective. Fluorescence images were acquired with a
Digital Sight camera, software NIS-Elements F 3.00 SP7 (Nikon, Tokyo, Japan). Usually 2 coverslips per preparation were analyzed and 2 to 4 independent experiments were performed. Comet Assay The comet assay was conducted as referred by Singh and colleagues (40), and Tice and coworkers (41), with few modifications. For this assay, cells were exposed to 5 and 10 μM SFN for 48 h. After SFN treatment, cells were collected and centrifuged at 300 g for 4 min and pellets were resuspended in PBS. Positive control was resuspended in 100 μM H2 O2 (Sigma-Aldrich, St. Louis, MO) for exactly 10 min, and cells were immediately centrifuged at 300 g for 5 min and resuspended in PBS. Fifty microliters of cell suspension were added to 50 μl 1% low melting point agarose and scattered on a slide coated with normal melting point agarose, and a coverslip was placed on top of each slide. After agarose solidification, the coverslip was removed. For cell lysis, slides were immersed in a lysis solution cooled at 4◦ C for 2 h. Slides were then collected and placed in cold electrophoretic buffer (pH 13), in darkness, for 20 min, and electrophoresis was performed for 30 min at 0.74 V. Afterwards, slides were removed and placed in neutralizing buffer for 5 min (repeated twice). Cells were washed with distilled water and dried at room temperature, in darkness. For comet scoring, slides were rehydrated for 15 min, stained with 10 μg/ml ethidium bromide for 5 min, and water excess was removed with distilled water. Slides were observed under the fluorescence microscope Eclipse 80i (Nikon, Tokyo, Japan) equipped with a 510–560nm excitation filter and a 590-nm barrier filter. For each treatment group, 2 slides from each well were screened and 50–100 randomly visualized nucleoids were chosen. Images were captured with imaging software NIS-Elements F 3.00, SP7 (Nikon, Japan). Each nucleoid photograph was run on version 1.2.2 of Comet Assay Software Project to record the comet parameter:% tail DNA. Cytokinesis-Block Micronucleus Cytome (CBMN Cyt) Assay The CBMN Cyt assay was performed according to Fenech’s recommendations for cell lines in log phase (42) with few
TABLE 1 Oligonucleotide primers used for qPCR Target gene CHEK1 CHEK2 CDC25C CCNB1 CDK1 GAPDH
Forward primer (5 -3 ) CCCGCACAGGTCTTTCCTT CACAGCTCTACCCCAGGTTC CCTATGCATCATCAGGACCAC GCTGAAAATAAGGCGAAGATCAA GGGTAGACACAAAACTACAGGTCAA ACACCCACTCCTCCACCTTT
Reverse primer (5 -3 ) CGTGTCATTCTTTTGACCAACC CACAACACAGCAGCACACAC GGCTCATGTCCTTCACCAGA ACCAATGTCCCCAAGAGCTG GGAATCCTGCATAAGCACATC TACTCCTTGGAGGCCATGTG
328
J. M. P. FERREIRA DE OLIVEIRA ET AL.
Downloaded by [Florida Atlantic University] at 20:37 30 January 2015
modifications. Briefly, cells were seeded on coverslips inside 6-well plates and incubated for 24 h. Cells were then exposed to different SFN concentrations for 24 and 48 h. After SFN exposure, cytochalasin B (AppliChem, Darmstadt, Germany) at a 4 μg/ml final concentration was added to each well and incubated during 29 h. At the end of cytochalasin B treatment, cells were fixed with absolute methanol cooled at 4◦ C. Samples were stained with acridine orange (Merck, Darmstadt, Germany), a fluorochrome for nucleic acids that emits green fluorescence and orange fluorescence when binding DNA and RNA, respectively. Finally, coverslips with the adherent cells were removed from the 6-well plates and mounted in slides. These samples were scored for nuclear division index (NDI), nucleoplasmic bridges (NPBs), MN, and apoptosis. NDI The NDI provides a measure of viable cells’ proliferative status and also enables the detection of cytostatic effects. This index was calculated by scoring at least 500 cells for the presence of 1, 2, 3, or 4 nuclei. Nuclear division was not affected by the addition of cytochalasin B, but cytokinesis was arrested. The NDI formula is as follows: NDI = (M1 + 2 ∗ M2 + 3 ∗ M3 + 4 ∗ M4)/N, where M1–M4 is the number of cells with 1–4 nuclei, and N is the total number of cells scored (42). NPBs NPBs were scored according to Fenech (42) in at least 2000 binucleated cells per concentration (2 replicates per concentration). MN At least 2000 binucleated cells were examined per concentration (2 cultures per concentration) for the presence of 1, 2, or more MN. Methyl methanesulfonate- (MMS; Sigma-Aldrich, St. Louis, MO) treated cells were used as positive control at a 20 μg/ml final concentration.
Apoptosis The apoptosis assessment was conducted on the slides used for the assessment of MN according to Fenech (42). Data and Statistical Analysis For qPCR analysis, 2 independent assays with at least 3 replicates were performed. For the remaining quantitative assays, 3 independent assays with at least 3 replicates were performed. The statistical analysis was performed using SigmaPlot for Windows version 11.0 (Systat Software Inc., San Jose, CA). The assessment of statistical significance between control and SFNtreated groups was performed by 1-way or 2-way ANOVA followed by Holm-Sidak’s test. When necessary, data were transformed to achieve normality and equality of variances. The differences were considered significant when P < 0.05. The qPCR data were expressed as mean ± standard error (SE), while the remaining data were expressed as mean ± SD. Pearson’s correlation among the endpoints tested was also performed, and correlations were considered for different thresholds of significance of P < 0.05 and P < 0.01. RESULTS General Cell Characterization and Viability Osteosarcoma MG-63 cells not treated with SFN reached a confluence of 80% after 72 h, with cells showing typical fibroblast-like morphology (Fig. 1A). With the increase of SFN concentration in the medium, the cell confluence decreased, whereas an increase was observed both on the number of detached cells (Fig. 1B–1D) and on the amount of cell debris (Fig. 1C and 1D). Also, morphological changes in the attached cells were observed with increasing SFN concentrations, as cells enlarged and showed a rounder shape. In addition to the changes in cell morphology and number of attached cells after SFN exposure, cell viability was also negatively affected by both SFN concentration and duration of treatment (Fig. 1E). After 24 h of exposure, a significant decrease in cell viability (P < 0.05) was only observed for
FIG. 1. Cytotoxic effect of sulforaphane (SFN) in MG-63 cell line. A–D: Cell confluence and morphology after 48 h of (A) control cells; or cells exposed to (B) 5, (C) 10, or (D) 20 μM SFN. E: Relative viability (%) after 24 and 48 h of exposure to SFN. ∗ Significant differences between control and SFN-treated cells within time (P < 0.05). a,b Significant differences between times (P < 0.05). Bar: 100 μm.
DNA DAMAGE AND APOPTOSIS BY SULFORAPHANE IN MG-63 CELLS
329
Downloaded by [Florida Atlantic University] at 20:37 30 January 2015
FIG. 2. Cytostatic effect of SFN. Cell cycle dynamics of MG-63 cells exposed to sulforaphane (SFN) for (A) 24 and (B) 48 h. ∗ Significant differences between control and SFN-treated cells (P < 0.05).
the concentration of 20 μM. However, after 48 h, cell viability decreased (P < 0.05) in cells exposed to SFN concentrations of 5, 10, and 20 μM compared to control cells. Moreover, the cell viability decreased (P < 0.05) from 24 to 48 h in all SFN conditions, remaining constant in the control. Cell Cycle and Clastogenicity SFN increased the percentage of cells at G2 /M phase in a concentration-dependent manner (Fig. 2). After 24-h exposure, G2 /M phase arrest (P < 0.05) was only observed for cultures exposed to 10 and 20 μM SFN, however, a decrease was observed in the percentage of cells at G1 /G0 already starting from the smallest SFN concentration tested (P < 0.05; Fig. 2A). For 48-h exposure, all SFN concentrations tested increased (P < 0.05) the percentage of cells in the G2 /M phase (Fig. 2B) and decreased the percentage of cells in G1 /G0 . The FPCV of the G1 /G0 peak from the SFN treated cells was not significantly different from that in the control, for the 24-h exposure (Fig. 3A). In contrast, 48-h exposure to SFN induced a significant increase of FPCV, an indicator of clastogenicity (P < 0.05) (Fig. 3B). Expression levels of the analyzed cell cycle genes were in general affected by SFN treatment (Fig. 4). Under the conditions tested, SFN treatment significantly downregulated
(P < 0.01) the expression of the Chk1 kinase-encoding gene and also decreased the expression of CDC25C, encoding the M-phase inducer phosphatase 3. Moreover, a nonsignificant decrease in the expression of the cyclin B1-encoding gene CCNB1 was observed for the SFN-treated cells. SFN was also found to upregulate the expression of CDK1 (P < 0.01). From all the genes tested, the most pronounced effect observed in MG-63 cells upon SFN treatment was downregulation of CDC25C. Cytoskeletal Organization Exposure to increasing SFN concentrations induced marked alterations in the cytoskeletal network of the osteosarcoma cells (Fig. 5). SFN-induced alterations included delocalization of the microtubule-organizing center and disruption of tubulin polymerization, visible at SFN doses ≥ 10 μM (Fig. 5C and 5D).
Comet Assay Higher entrainment of genetic material corresponding to increased number of DNA breaks was observed for increasing SFN concentrations (Fig. 6A–6C). After cells were exposed to 5 and 10 μM SFN for 48 h, an increase (P < 0.05) in % tail
FIG. 3. G1 /G0 peak’s full peak coefficient of variation values of MG-63 cells exposed to sulforaphane (SFN) for (A) 24 and (B) 48 h. ∗ Significant differences between control and SFN-treated cells (P < 0.05).
Downloaded by [Florida Atlantic University] at 20:37 30 January 2015
330
J. M. P. FERREIRA DE OLIVEIRA ET AL.
FIG. 4. Relative gene expression of cell cycle regulators. Gene expression is shown for 48-h exposure to 10 μM sulforaphane (SFN) relative to control. ∗ Significant differences between control and SFN-treated cells (P < 0.01).
DNA was observed for both concentrations. SFN-induced DNA breaks increased with the increase of SFN dose (Fig. 6D). CBMN Cyt Assay Analysis by the CBMN Cyt assay revealed the specific effects of SFN on DNA damage, cytostasis, and cytotoxicity (Fig. 7). This assay enabled to calculate the NDI, to score the NPBs and MN, and to calculate rates of apoptosis. At 20 μM, SFN slides were unsatisfactory for analysis due to extensive cell death (as hinted by MTT assay), although discrete mononucleated cells were observed. At 10 μM SFN, the still low viability levels as
FIG. 5. Sulforaphane (SFN) induces microtubule depolymerization. MG-63 cells were treated with SFN for 48 h and microtubules were visualized by fluorescence microscopy using α-Tubulin antibody. A: Control cells, or cells exposed to (B) 5, (C) 10, or (D) 20 μM SFN. Arrow: microtubule-organizing center; N = nucleus. Bar: 20 μm (color figure available online).
FIG. 6. DNA strand breaks of MG-63 cells treated with sulforaphane (SFN) after 48 h. MG-63 cells were (A) control or exposed to (B) 5 or (C) 10 μM SFN. (D) Percentage of tail DNA induced by different concentrations of SFN for 48 h. ∗ Significant differences between control and SFN-treated cells (P < 0.05).
well as the predominance of mononucleated cells did not allow to score at least 1000 binucleated cells to validate NPBs or MN. This way, NPBs and MN were scored only in cells exposed to up to 5 μM SFN and apoptosis and NDI were scored in cells exposed to up to 10 μM SFN (Fig. 8). NDI only decreased (P < 0.05) at 10 μM SFN for both exposure periods, demonstrating a cytostatic effect of this treatment. For the 5 μM SFN at 48 h of exposure, the results showed a significant increase in NPBs and MN formation (P < 0.05, Fig. 8B and 8C, respectively). As for the apoptosis evaluation, all SFN concentrations produced a significant increase in apoptosis (P < 0.05) (Fig. 8D). Exposure to 5 μM SFN presented a significant increase relatively to control (P < 0.05), but this increased apoptosis was not significantly different between exposure periods. Exposure to 10 μM SFN, however, was significantly more increased at 48- compared to 24-h exposure. DISCUSSION SFN is a plant-derived ITC, which has been shown to display chemopreventive activity against different tumor types, and for which some clinical trials are already ongoing [e.g., breast (http://clinicaltrials.gov/ct2/show/NCT00982319) and prostate cancer (http://clinicaltrials.gov/ct2/show/NCT01228084)]. SFN was reported to induce apoptosis or modulate cell cycle progression of highly proliferative cancer cells (e.g., 43). Importantly, the nature and intensity of SFN effects have been described to depend on SFN concentration, time of exposure, and cell type (25,44). The present study was undertaken to investigate the effects of SFN on MG-63 cell line and therefore to contribute to the evaluation of SFN as a chemotherapeutic agent for osteosarcoma.
Downloaded by [Florida Atlantic University] at 20:37 30 January 2015
DNA DAMAGE AND APOPTOSIS BY SULFORAPHANE IN MG-63 CELLS
FIG. 7. Microphotographs representative of the endpoints scored in cytokinesis-block micronucleus cytome Cyt assay. A: Binucleated cells from control sample. B: Nucleoplasmic bridges, pointed by arrows. C: Micronuclei, pointed by arrows. D: Apoptotic cells (color figure available online).
For this, MG-63 cells were exposed to SFN at physiologically attainable doses, previously described in the human plasma, that is, up to 10 μM SFN (9), and also to the higher dose of 20 μM SFN. We found that SFN exerts dose- and time-dependent cytotoxicity to the MG-63 cell line. SFN caused a concentrationdependent decrease in cell viability and proliferation (Fig. 9). As expected, cell viability is also negatively correlated with the increase in apoptotic cells (Fig. 9). Our data indicate that SFN induces a dose-dependent increase in apoptosis in MG-63 cells in both experimental periods, although in higher degree after 48 h. For the same range of SFN doses, Kim and coworkers (19) also found apoptotic cell death in the osteosarcoma U2-OS cell line. In Saos-2 and MG-63 cells, SFN was shown to promote apoptosis via extrinsic TNF-related apoptosisinducing ligand receptor, involving a cascade of caspases activation (45). SFN was also analyzed for its effects on cell cycle progression. In murine osteosarcoma, SFN has been previously found by Sawai and coworkers to increase the population of cells in
331
G2 /M phase (46). Based on our results, SFN induced a G2 /M phase arrest as shown by flow cytometry DNA content analysis. The cytostatic effect of SFN is also confirmed by the significant decrease of NDI values at 10 μM SFN, and also by the negative correlation between NDI and the percentage of cells in G2 /M phase of cell cycle, although not reaching statistical significance (Fig. 9, P = 0.06). The G2 /M arrest was associated with markedly decreased CDC25C transcript levels for the 10 μM SFN concentration, suggesting that the encoded phosphatase enzyme may play a role in the G2 /M phase arrest observed. Chk1/2 and Cdc25 are the key players in DNA damage control during G2 /M transition, whose main effector is the cyclin B1-Cdk1 complex (47). Furthermore, Cdk1 activity is negatively regulated by phosphorylation (e.g., Wee1 and Myt1 kinases), which can be reversed by the phosphatase Cdc25C, required for G2 /M transition (48). In previous studies (e.g., 17–19), SFN treatment has been found associated with decreased Cdc25C and cyclin B1 protein levels. In this study, and to our knowledge for the first time, SFN was also shown to decrease the expression of the genes encoding these cell cycle regulators. Such differential gene expression reinforces the key role of Cdc25C depletion and hence cyclin B1/Cdk1 complex inactivation in SFN-induced G2 /M cell cycle arrest. Suppipat (21) found that in acute lymphoblastic leukemia cells, SFN inactivated the cyclin B1/Cdk1 complex by increasing phosphorylation of Cdk1. Moreover, Matsui and coworkers (22) found that SFN induced an upregulation of p21Cip1 in MG-63, which contributed to the observed G2 /M blockage and the same was observed in U2-OS, another OS cell line, by Kim and coworkers (19). Apart from the alterations in cell cycle regulators induced by SFN, our data also confirmed in MG-63 cells the previously reported activity of SFN as microtubule depolymerizing agent. Perturbations in microtubule dynamics induced by sulforaphane (e.g., 49–52) have been associated with G2 /M phase arrest. SFN has been reported to affect the cytoskeleton e.g. by conformational changes in tubulin (53), tubulin acetylation (54), and cytoskeleton protein modifications (55). Alterations in microtubule dynamics have been related with MN formation (56) and its formation represents an irreversible DNA damage caused by chromosome loss and/or breakage during mitosis. In this study, a 48-h exposure to 5 μM SFN resulted in a significant increase in MN and NPBs frequency in MG-63 cells and the formation of such nuclear abnormalities is negatively correlated with cell viability (P < 0.05) (Fig. 9). This observation is clearly in contrast with that reported in the literature concerning micronucleus induction by SFN in cultured normal human lymphocytes (24,25), where depending on the conditions, SFN may prevent micronucleus formation. In our study, similarly to what was found in other studies (57), NPBs and MN were observed in control MG-63 cells, confirming chromosomal instability in this cell line. Moreover, in the MG-63 cell line, 48-h exposure to 5 μM SFN resulted in an increase in DNA strand breaks, which is a leading cause of both MN and NPB formation, as previously reviewed (56).
Downloaded by [Florida Atlantic University] at 20:37 30 January 2015
332
J. M. P. FERREIRA DE OLIVEIRA ET AL.
FIG. 8. Cytokinesis-block micronucleus cytome Cyt assay endpoints of MG-63 cells treated with sulforaphane (SFN) after 24 and 48 h. A: Nuclear division index. B: Nucleoplasmic bridges. C: Micronuclei. D: Percentage of apoptotic cells. ∗ Significant differences between control and SFN-treated cells within time (P < 0.05). ∗∗ Significant differences between positive control (methyl methanesulfonate; MMS) and SFN-treated cells (P < 0.05). a,b Significant differences between times (P < 0.05).
The dispersion of nuclear DNA content measured by FPCV also reflects chromosomal perturbations (e.g., chromosome breakage and reattachment, loss of chromosome fragments) that result in unequal distribution of DNA in the daughter cells and magnification of the genomic destabilization by further divisions (36). The significant increase of the FPCV values for all SFN doses, after 48 h of treatment, supports the clastogenic damage induced by longer periods of exposure to this ITC. As mentioned above, apart from clastogenic effects, SFN induces concentration-dependent DNA strand breaks in MG-63 cells. Sestili and colleagues detected DNA single-strand breaks even for low exposure periods to SFN in different cell lines (34). In addition, Kim and coworkers (19) found DNA fragmentation in U2-OS cells upon exposure to SFN. Moreover, Sawai and colleagues reported that SFN can act as radiosensitizer, when used in combination with 2 Gy X-irradiation (46), raising the possibility that SFN could increase DNA damage caused by irradiation. In addition to these observations, results suggest that in our osteosarcoma model, a significant amount of DNA fragmentation is associated with apoptotic events, as expressed by a positive correlation of DNA fragmentation (expressed as % tail DNA) with the percentage of late apoptotic cells, as detected by the CBMN Cyt assay (P < 0.05) (Fig. 9). To our knowledge, this is the first work reporting the genotoxic effects (in particular DNA strand breaks, NPBs and MN formation) of SFN in an in vitro human osteosarcoma model.
FIG. 9. Correlation coefficients between sulforaphane (SFN) concentrations and the several cytotoxicity and genotoxicity endpoints. Blue lines indicate negative correlation and red lines indicate positive correlation. Thick solid lines = significant for P < 0.01; thin solid lines = significant for P < 0.05; dashed lines = large correlation coefficient but not significant (R > 0.5; P ≥ 0.05). MN = micronuclei; NPBs = nucleoplasmic bridges; NDI = nuclear division index (color figure available online).
DNA DAMAGE AND APOPTOSIS BY SULFORAPHANE IN MG-63 CELLS
In conclusion, the present study offers a novel insight into the mechanism of SFN-induced cytotoxicity and genotoxicity in the MG-63 osteosarcoma cell line, supporting that genotoxic effects may play important roles in the arrest of cell cycle and increased apoptosis, and these events correlate with chromosomal and nuclear abnormalities. In particular, the inhibition of cell division by SFN correlated with the raises of NPBs, MN, and cell cycle blockage at G2 /M phase transition. Because osteosarcoma is refractory to conventional chemotherapy, the role of SFN as potentiator of the effects of anticancer drugs deserves careful further consideration.
Downloaded by [Florida Atlantic University] at 20:37 30 January 2015
ACKNOWLEDGMENTS We thank Cristina Monteiro and Andreia Ascenso for proofreading the article.
13.
14.
15.
16.
17.
18.
FUNDING This study was supported by the Portuguese Foundation for Science and Technology through the postdoctoral fellowships of Helena Oliveira (SFRH/BPD/48853/2008) and Jos´e Miguel P. Ferreira de Oliveira (SFRH/BPD/74868/2010). REFERENCES 1. Stiller CA, Bielack SS, Jundt G, and Steliarova-Foucher E: Bone tumours in European children and adolescents, 1978–1997. Report from the Automated Childhood Cancer Information System project. Eur J Cancer 42, 2124–2135, 2006. 2. Ham SJ, Schraffordt Koops H, van der Graaf WT, van Horn JR, Postma L, et al.: Historical, current and future aspects of osteosarcoma treatment. Eur J Surg Oncol 24, 584–600, 1998. 3. Gorlick R and Khanna C: Osteosarcoma. J Bone Miner Res 25, 683–691, 2010. 4. Ta HT, Dass CR, Larson I, Choong PFM, and Dunstan DE: A chitosandipotassium orthophosphate hydrogel for the delivery of Doxorubicin in the treatment of osteosarcoma. Biomaterials 30, 3605–3613, 2009. 5. PosthumaDeBoer J, Witlox MA, Kaspers GJL, and van Royen BJ: Molecular alterations as target for therapy in metastatic osteosarcoma: a review of literature. Clin Exp Metastas 28, 493–503, 2011. 6. Wachtel M and Schafer BW: Targets for cancer therapy in childhood sarcomas. Cancer Treat Rev 36, 318–327, 2010. 7. Broadhead ML, Clark JC, Myers DE, Dass CR, and Choong PF: The molecular pathogenesis of osteosarcoma: a review. Sarcoma 2011, 959248, 1–12, 2011. 8. Clarke JD, Hsu A, Riedl K, Bella D, Schwartz SJ, et al.: Bioavailability and inter-conversion of sulforaphane and erucin in human subjects consuming broccoli sprouts or broccoli supplement in a cross-over study design. Pharmacol Res 64, 456–463, 2011. 9. Gasper AV, Al-janobi A, Smith JA, Bacon JR, Fortun P, et al.: Glutathione S-transferase M1 polymorphism and metabolism of sulforaphane from standard and high-glucosinolate broccoli. Am J Clin Nutr 82, 1283–1291, 2005. 10. Brooks JD, Paton VG, and Vidanes G: Potent induction of phase 2 enzymes in human prostate cells by sulforaphane. Cancer Epidemiol Biomarkers Prev 10, 949–954, 2001. 11. Morimitsu Y, Nakagawa Y, Hayashi K, Fujii H, Kumagai T, et al.: A sulforaphane analogue that potently activates the Nrf2-dependent detoxification pathway. J Biol Chem 277, 3456–3463, 2002. 12. Huang TY, Chang WC, Wang MY, Yang YR, and Hsu YC: Effect of sulforaphane on growth inhibition in human brain malignant glioma GBM
19.
20.
21.
22.
23.
24.
25.
26.
27.
28.
29.
30.
31.
333
8401 cells by means of mitochondrial- and MEK/ERK-mediated apoptosis pathway. Cell Biochem Biophys 63, 247–259, 2012. Kallifatidis G, Labsch S, Rausch V, Mattern J, Gladkich J, et al.: Sulforaphane Increases Drug-mediated Cytotoxicity Toward Cancer Stem-like Cells of Pancreas and Prostate. Mol Ther 19, 188–195, 2011. Kanematsu S, Yoshizawa K, Uehara N, Miki H, Sasaki T, et al.: Sulforaphane inhibits the growth of KPL-1 human breast cancer cells in vitro and suppresses the growth and metastasis of orthotopically transplanted KPL-1 cells in female athymic mice. Oncol Rep 26, 603–608, 2011. Li YY, Zhang T, Korkaya H, Liu SL, Lee HF, et al.: Sulforaphane, a dietary component of broccoli/broccoli sprouts, inhibits breast cancer stem cells. Clin Cancer Res 16, 2580–2590, 2010. Rausch V, Liu L, Kallifatidis G, Baumann B, Mattern J, et al.: Synergistic Activity of Sorafenib and Sulforaphane Abolishes Pancreatic Cancer Stem Cell Characteristics. Cancer Res 70, 5004–5013, 2010. Singh SV, Herman-Antosiewicz A, Singh AV, Lew KL, Srivastava SK, et al.: Sulforaphane-induced G2/M phase cell cycle arrest involves checkpoint kinase 2-mediated phosphorylation of cell division cycle 25C. J Biol Chem 279, 25813–25822, 2004. Herman-Antosiewicz A, Xiao H, Lew KL, and Singh SV: Induction of p21 protein protects against sulforaphane-induced mitotic arrest in LNCaP human prostate cancer cell line. Mol Cancer Ther 6, 1673–1681, 2007. Kim MR, Zhou L, Park BH, and Kim JR: Induction of G(2)/M arrest and apoptosis by sulforaphane in human osteosarcoma U2-OS cells. Mol Med Rep 4, 929–934, 2011. Shen G, Xu C, Chen C, Hebbar V, and Kong AN: p53-independent G1 cell cycle arrest of human colon carcinoma cells HT-29 by sulforaphane is associated with induction of p21CIP1 and inhibition of expression of cyclin D1. Cancer Chemother Pharmacol 57, 317–327, 2006. Suppipat K, Park CS, Shen Y, Zhu X, and Lacorazza HD: Sulforaphane induces cell cycle arrest and apoptosis in acute lymphoblastic leukemia cells. PLoS One 7, e51251, 2012. Matsui TA, Murata H, Sakabe T, Sowa Y, Horie N, et al.: Sulforaphane induces cell cycle arrest and apoptosis in murine osteosarcoma cells in vitro and inhibits tumor growth in vivo. Oncol Rep 18, 1263–1268, 2007. Chiao JW, Chung FL, Kancherla R, Ahmed T, Mittelman A, et al.: Sulforaphane and its metabolite mediate growth arrest and apoptosis in human prostate cancer cells. Int J Oncol 20, 631–636, 2002. Fimognari C, Berti F, Iori R, Cantelli-Forti G, and Hrelia P: Micronucleus formation and induction of apoptosis by different isothiocyanates and a mixture of isothiocyanates in human lymphocyte cultures. Mutat Res-Gen Tox En 582, 1–10, 2005. Fimognari C, Berti F, Cantelli-Forti G, and Hrelia P: Effect of sulforaphane on micronucleus induction in cultured human lymphocytes by four different mutagens. Environ Mol Mutagen 46, 260–267, 2005. Tope AM and Rogers PF: Evaluation of protective effects of sulforaphane on DNA damage caused by exposure to low levels of pesticide mixture using comet assay. J Environ Sci Heal B 44, 657–662, 2009. Barcelo S, Gardiner JM, Gescher A, and Chipman JK: CYP2E1-mediated mechanism of anti-genotoxicity of the broccoli constituent sulforaphane. Carcinogenesis 17, 277–282, 1996. Gross-Steinmeyer K, Stapleton PL, Tracy JH, Bammler TK, Strom SC, et al.: Sulforaphane- and phenethyl isothiocyanate-induced inhibition of aflatoxin B1-mediated genotoxicity in human hepatocytes: role of GSTM1 genotype and CYP3A4 gene expression. Toxicol Sci 116, 422– 432, 2010. Bonnesen C, Eggleston IM, and Hayes JD: Dietary indoles and isothiocyanates that are generated from cruciferous vegetables can both stimulate apoptosis and confer protection against DNA damage in human colon cell lines. Cancer Res 61, 6120–6130, 2001. Rudolf E and Cervinka M: Sulforaphane induces cytotoxicity and lysosomeand mitochondria-dependent cell death in colon cancer cells with deleted p53. Toxicol in Vitro 25, 1302–1309, 2011. Cho SD, Li G, Hu H, Jiang C, Kang KS, et al.: Involvement of c-Jun Nterminal kinase in G2/M arrest and caspase-mediated apoptosis induced by
334
32.
33.
34.
35.
Downloaded by [Florida Atlantic University] at 20:37 30 January 2015
36.
37. 38.
39. 40.
41.
42. 43.
44.
J. M. P. FERREIRA DE OLIVEIRA ET AL.
sulforaphane in DU145 prostate cancer cells. Nutr Cancer 52, 213–224, 2005. Rudolf E, Andelova H and Cervinka M: Activation of several concurrent proapoptic pathways by sulforaphane in human colon cancer cells SW620. Food Chem Toxicol 47, 2366–2373, 2009. Sekine-Suzuki E, Yu D, Kubota N, Okayasu R, and Anzai K: Sulforaphane induces DNA double strand breaks predominantly repaired by homologous recombination pathway in human cancer cells. Biochem Bioph Res Co 377, 341–345, 2008. Sestili P, Paolillo M, Lenzi M, Colombo E, Vallorani L, et al.: Sulforaphane induces DNA single strand breaks in cultured human cells. Mutat Res-Fund Mol M 689, 65–73, 2010. Twentyman PR and Luscombe M. 1987. A study of some variables in a tetrazolium dye (MTT) based assay for cell growth and chemosensitivity. Br J Cancer 56, 279–285, 1987. Misra RK and Easton MD: Comment on analyzing flow cytometric data for comparison of mean values of the coefficient of variation of the G1 peak. Cytometry 36, 112–116, 1999. Rozen S and Skaletsky H: Primer3 on the WWW for general users and for biologist programmers. Methods Mol Biol 132, 365–386, 2000. Zhao S and Fernald RD: Comprehensive algorithm for quantitative real-time polymerase chain reaction. J Comput Biol 12, 1047– 1064, 2005. Pfaffl MW: A new mathematical model for relative quantification in realtime RT-PCR. Nucleic Acids Res 29, e45, 2001. Singh NP, McCoy MT, Tice RR, and Schneider EL: A simple technique for quantitation of low levels of DNA damage in individual cells. Exp Cell Res 175, 184–191, 1988. Tice RR, Agurell E, Anderson D, Burlinson B, Hartmann A, et al.: Single cell gel/comet assay: guidelines for in vitro and in vivo genetic toxicology testing. Environ Mol Mutagen 35, 206–221, 2000. Fenech M: Cytokinesis-block micronucleus cytome assay. Nat Protoc 2, 1084–1104, 2007. Fimognari C, Nusse M, Cesari R, Iori R, Cantelli-Forti G, et al.: Growth inhibition, cell-cycle arrest and apoptosis in human T-cell leukemia by the isothiocyanate sulforaphane. Carcinogenesis 23, 581–586, 2002. Song MY, Kim EK, Moon WS, Park JW, Kim HJ, et al.: Sulforaphane protects against cytokine- and streptozotocin-induced beta-cell damage by suppressing the NF-kappaB pathway. Toxicol Appl Pharmacol 235, 57–67, 2009.
45. Matsui TA, Sowa Y, Yoshida T, Murata H, Horinaka M, et al.: Sulforaphane enhances TRAIL-induced apoptosis through the induction of DR5 expression in human osteosarcoma cells. Carcinogenesis 27, 1768– 1777, 2006. 46. Sawai Y, Murata H, Horii M, Koto K, Matsui T, et al.: Effectiveness of sulforaphane as a radiosensitizer for murine osteosarcoma cells. Oncology Reports 29, 941–945, 2013. 47. Boutros R, Lobjois V, and Ducommun B: CDC25 phosphatases in cancer cells: key players? Good targets? Nat Rev Cancer 7, 495–507, 2007. 48. Medema RH and Macurek L: Checkpoint control and cancer. Oncogene 31, 2601–2613, 2012. 49. Jackson SJ and Singletary KW: Sulforaphane inhibits human MCF-7 mammary cancer cell mitotic progression and tubulin polymerization. J Nutr 134, 2229–2236, 2004. 50. Jackson SJ and Singletary KW: Sulforaphane: a naturally occurring mammary carcinoma mitotic inhibitor, which disrupts tubulin polymerization. Carcinogenesis 25, 219–227, 2004. 51. Jackson SJ, Singletary KW, and Venema RC: Sulforaphane suppresses angiogenesis and disrupts endothelial mitotic progression and microtubule polymerization. Vascul Pharmacol 46, 77–84, 2007. 52. Azarenko O, Okouneva T, Singletary KW, Jordan MA, and Wilson L: Suppression of microtubule dynamic instability and turnover in MCF7 breast cancer cells by sulforaphane. Carcinogenesis 29, 2360–2368, 2008. 53. Mi L, Xiao Z, Hood BL, Dakshanamurthy S, Wang X, et al.: Covalent binding to tubulin by isothiocyanates. A mechanism of cell growth arrest and apoptosis. J Biol Chem 283, 22136–22146, 2008. 54. Rajendran P, Delage B, Dashwood WM, Yu TW, Wuth B, et al. Histone deacetylase turnover and recovery in sulforaphane-treated colon cancer cells: competing actions of 14–3–3 and Pin1 in HDAC3/SMRT corepressor complex dissociation/reassembly. Mol Cancer 10, 68, 2011. 55. Mi L, Hood BL, Stewart NA, Xiao Z, Govind S, et al.: Identification of potential protein targets of isothiocyanates by proteomics. Chem Res Toxicol 24, 1735–1743, 2011. 56. Fenech M, Kirsch-Volders M, Natarajan AT, Surralles J, Crott JW, et al.: Molecular mechanisms of micronucleus, nucleoplasmic bridge and nuclear bud formation in mammalian and human cells. Mutagenesis 26, 125–132, 2011. 57. Al-Romaih K, Bayani J, Vorobyova J, Karaskova J, Park PC, et al.: Chromosomal instability in osteosarcoma and its association with centrosome abnormalities. Cancer Genet Cytogenet 144, 91–99, 2003.
