Journal of Applied Microbiology ISSN 1364-5072

ORIGINAL ARTICLE

Superoxide dismutase recombinant Lactobacillus fermentum ameliorates intestinal oxidative stress through inhibiting NF-jB activation in a trinitrobenzene sulphonic acid-induced colitis mouse model C.L. Hou*, J. Zhang*, X.T. Liu, H. Liu, X.F. Zeng and S.Y. Qiao State Key Laboratory of Animal Nutrition, College of Animal Science and Technology, China Agricultural University, Beijing, China

Keywords gastrointestinal tract, Lactobacillus fermentum, oxidative stress, superoxide dismutase. Correspondence Shiyan Qiao, Ministry of Agriculture Feed Industry Centre, China Agricultural University, No. 2 Yuanmingyuan West Road, Beijing 100193, China. E-mail: [email protected] *These authors contributed equally to this work. 2013/2215: received 5 November 2013, revised 26 December 2013 and accepted 24 January 2014 doi:10.1111/jam.12461

Abstract Aims: Superoxide dismutase (SOD) can prevent and cure inflammatory bowel diseases by decreasing the amount of reactive oxygen species. Unfortunately, short half-life of SOD in the gastrointestinal tract limited its application in the intestinal tract. This study aimed to investigate the treatment effects of recombinant SOD Lactobacillus fermentum in a colitis mouse model. Methods and Results: In this study, we expressed the sodA gene in Lact. fermentum I5007 to obtain the SOD recombinant strain. Then, we determined the therapeutic effects of this SOD recombinant strain in a trinitrobenzene sulphonic acid (TNBS)-induced colitis mouse model. We found that SOD activity in the recombinant Lact. fermentum was increased by almost eightfold compared with that in the wild type. Additionally, both the wild type and the recombinant Lact. fermentum increased the numbers of lactobacilli in the colon of mice (P < 0
05). Colitis mice treated with recombinant Lact. fermentum showed a higher survival rate and lower disease activity index (P < 0
05). Recombinant Lact. fermentum significantly decreased colonic mucosa histological scoring for infiltration of inflammatory cells, lipid peroxidation, the expression of pro-inflammatory cytokines and myeloperoxidase (P < 0
05) and inhibited NF-jB activity in colitis mice (P < 0
05). Conclusions: SOD recombinant Lact. fermentum significantly reduced oxidative stress and inflammation through inhibiting NF-jB activation in the TNBS-induced colitis model. Significance and Impact of the Study: This study provides insights into the anti-inflammatory effects of SOD recombinant Lact. fermentum, indicating the potential therapeutic effects in preventing and curing intestinal bowel diseases.

Introduction Reactive oxygen species (ROS) have been shown to play a key role in the pathogenesis of inflammatory bowel diseases (Kruidenier and Verspaget 2002; Tuzun et al. 2002; Keshavarzian et al. 2003). In farm animals, oxidative stress is involved in several pathological conditions, including conditions that are relevant for animal production and the general welfare of the individuals (Lykkesfeldt and Svendsen 2007). Superoxide (O 2 ) and hydrogen

peroxide (H2O2) are often found in inflammatory bowel diseases, as well as some animal diseases, such as enteritis, and their presence can damage the DNA, proteins and lipids of the cell membranes (Tuzun et al. 2002; Lykkesfeldt and Svendsen 2007; Almenier et al. 2012). Cells have developed protective mechanisms to detoxify ROS via antioxidant enzymes such as superoxide dismutase (SOD), catalase and glutathione peroxidase, as well as nonenzymatic antioxidants such as glutathione and vitamin E (Borek et al. 1986; Borek 2001). In the process of

Journal of Applied Microbiology 116, 1621--1631 © 2014 The Society for Applied Microbiology

1621

Recombinant Lact. fermentum prevents colitis

C.L. Hou et al.

ROS scavenging, SOD converts the superoxide anion (O 2 ) into the more stable metabolite, hydrogen peroxide (H2O2), and H2O2 is converted to water by catalase or glutathione peroxidase (Nakamura et al. 1989; Dekaris et al. 1998). Many studies have documented that exogenous SOD, including copper/zinc superoxide dismutase (Cu/Zn SOD) and manganese superoxide dismutase (Mn-SOD), attenuated inflammation by exerting antioxidative effects in a variety of experimental models (Dowling et al. 1993; Segui et al. 2004; Ishihara et al. 2009). Unfortunately, instability and the short half-life of SOD in the gastrointestinal tract limited its use as a drug (Turrens et al. 1984). However, several studies have indicated that recombinant lactobacilli can be used as a novel therapeutic strategy to deliver SOD against intestine inflammation. For example, Lactobacillus gasseri expressing manganese SOD decreased hydrogen peroxide toxicity in vitro (Bruno-Barcena et al. 2004) and alleviated the severity of IL-10 deficiency in a mouse model of colitis (Carroll et al. 2007). SOD recombinant Lactobacillus casei BL23 strain had anti-inflammatory effects on gut inflammation (Watterlot et al. 2010). Oral administration of Lactococcus lactis or Lactobacillus plantarum strains expressing SOD improved 2, 4, 6-trinitrobenzene sulphonic acid (TNBS) experimental colitis in rats (Han et al. 2006). Lactobacillus fermentum I5007, isolated from the gastrointestinal mucosa of healthy piglets, showed a high adhesion to the Caco-2 cell line in our previous study (Li et al. 2008). It is used as a feed additive to improve animal growth performance (Wang et al. 2009). The sodA gene, from the Bacillus subtilis 168 (ATCC33234), encodes a manganese superoxide dismutase (MnSOD). Bacillus subtilis MnSOD shares 53% identity and 65% similarity with human Mn-SOD at the protein sequence level, while larger differences were observed at crystal structure (Liu et al. 2007). These differences may be related to differences in activities, specificities, structure– function relationships. In contrast to that it is still unknown whether B. subtilis 168 could be used as a probiotic (Inaoka et al. 1998), our previous research has shown Lact. fermentum I5007 has probiotic benefits. The aim of this study was to construct an SOD-expressing Lact. fermentum and to evaluate its anti-inflammatory effect in TNBS-induced mice. Materials and methods Bacterial strains, plasmids and growth conditions The bacterial strains and plasmids used in this study are listed in Table 1. Lactobacilli strains were grown in ManRogosa-Sharpe (Mrsic-Pelcic et al. 2012) broth (AOBIX, 1622

Table 1 Characteristics and sources of bacterial strains and plasmids used in this study

Strains Lactobacillus fermentum I5007 Lact. fermentum (pMF009) Bacillus subtilis 168 Escherichia coli DH5a Plasmids pLEM415 pJET1
2 pMF009

Characteristics

Source

Wild type

Our laboratory

I5007 harbouring pMF009 Wild type

The present study

Cloning host

TIANGEN, Beijing, China

AmpR, EmR, shuttle vector Clone vector

Our laboratory

The shutter plasmid carrying the sodA gene of B. Subtilis

Our laboratory

GenScript, Nanjing, China The present study

BEIJING AOBOXING UNIVERSEEN BIO-TECH COMPANY, Beijing, China) or MRS agar (1
5% [wt/vol]; (AOBIX)) under anaerobic conditions at 37°C. Recombinant strains were selected in the presence of 15 lg ml1 of erythromycin (Amresco, Solon, OH). Escherichia coli strains were grown in Luria-Bertani (LB) (OXOID, OXOID COMPANY, Basingstoke, Hampshire, UK) medium at 37°C under aeration with 100 lg ml1 ampicillin (Amresco) added when necessary. Bacillus subtilis 168 was grown at 37°C under aeration conditions in a nutrient broth (AOBIX) medium. The construction and transformation of the plasmids The scheme of expression vector constructions is shown in Fig. 1. Primer design was carried out in CLONE MANAGER PROFESSIONAL SUITE ver. 8 (Scientific & Educational Software, Cary, NC), and the sequences are shown in Table 2. The vector pJET1.2 linearization was digested by EcoRV (Takara, Dalian, China). The promoter PldhL (from Lact. casei ATCC334), sodA (from B. subtilis 168) and terminator TldhL (from Lact. casei ATCC334) fragments were amplified by the primers P1/P2, P3/P4 and P5/P6, respectively. The purified PCR products were mixed with linearized vector and transformed into E. coli DH5a to construct pMF008 using the In-FusionTM system (Clontech, Clontech Laboratories, Mountain View, CA) as per the manufacturer’s instructions. Then, the plasmid pMF008 was linearized by Kpn I (Takara, Dalian, China), while the erythromycin resistance and replication protein gene (erm-rep) fragment from plasmid pLEM415 (Fons et al. 1997) was amplified using

Journal of Applied Microbiology 116, 1621--1631 © 2014 The Society for Applied Microbiology

Recombinant Lact. fermentum prevents colitis

C.L. Hou et al.

PldhL P1

TldhL

sodA

P2

P3

P4

P5

Detection of SOD activity in vitro P6

PCR pJET1·2

EcoR V

Linearized vector Mix

In-fusion™ pLEM415

pMF008 P7

P8 PCR

Kpn I

erm-rep fragment

Mix

A quantitative assay of SOD activity was performed according to the method of Kono (1978). Briefly, one ml each of overnight cultures (1 9 109 CFU) of Lact. fermentum I5007 and Lact. fermentum (pMF009) was resuspended in 1 ml PBS buffer, respectively. 2
1 ml of the reaction mixture contained 1924 ll sodium carbonate buffer (50 mmol l1), 3 ll nitro-blue tetrazolium (1
6 mmol l1), 6 ll Triton X-100 (10%) and 20 ll hydroxylamine-HCl (100 mmol l1). Subsequently, 100 ll cell resuspended solution was added and kept for 10 min at room temperature before centrifugation at 6010 g for 5 min (5424R, Eppendorf, Hamburg, Germany), and absorbance (560 nm) was read against a blank (reaction mixture sans cell extract). Meanwhile, one ml of each overnight cultures of Lact. fermentum I5007 and Lact. fermentum (pMF009) was enumerated on MRS agar. The results were expressed as the amount of SOD activity per 109 CFU.

Linearized vector In-fusion™

Animal experiments and induction of colitis pMF009

Figure 1 Flow scheme of expression vector pMF009 construction. The oligonucleotide primers are approximately 35–40 bp long (including the extension and gene-specific region). Grey regions of primers and fragments indicate overlap regions with 15–20 bp of identity. The sequences of the primers P2/P3 and P4/P5 extensions (grey region) matched at 50 ends. The sequences of the primers P1/P6 and P7/P8 extensions (grey region) matched precisely the 50 and 30 ends of the linearization vector at the position into which the PCR products are to be inserted. Therefore, the PldhL-sodA-TldhL and erm-rep fragments also contained 15–20 bp at the 30 and 50 ends with exact homology to the destination vector insertion site flanking the EcoR V or Kpn I site. They were fully complementary to the plasmids. Therefore, no additional nucleotides were introduced.

the primers P7 and P8 and then inserted into a linearized vector to construct pMF009 using the In-FusionTM system (Clontech).

Six-week-old female BALB/c mice weighing about 19–25 g were obtained from the Beijing Laboratory Animal Centre (Beijing, China) and housed in a 28 9 17 9 18 cm plastic box with wood shavings placed on the bottom at 23°C under a 12-h light and 12-h dark photoperiod cycle. Mice were given free access to water and standard laboratory chow (Beijing Laboratory Animal Centre, Beijing, China). The mice were randomly divided into four groups (15 animals each): one control group and three TNBS-induced colitis groups, including (i) TNBS group (or inflammation control group); (ii) LF group (5 9 109 CFU of Lact. fermentum I5007 day per mice); and (iii) LF-SOD group (5 9 109 CFU of recombinant SOD Lact. fermentum per day per mice). Intestinal inflammation was induced as described previously (Ten Hove et al. 2001). After a 7-day acclimation period, mice were anaesthetized using ether. Then, they received an intrarectal administration of 100 ll of TNBS (Sigma, St Louis, MI) solution at a concentration

Table 2 The primers utilized in this study Primers

Sequence (50 –30 )

P1 P2 P3 P4 P5 P6 P7 P8

GTTTTTCAGCAAGATGTTAACAAATCGCTCATGCAAGCGTT CGTAAGCCATGGTGATATCATCCTTTCTTA TGATATCACCATGGCTTACGAACTTCCAGA ATGATGATGATTATTTTGCTTCGCTGTATA AGCAAAATAATCATCATCATGACTGAGTCT GCCATCTAGAAAGATGGTACCAAAACATTATACTTTCAGGA AAGTATAATGTTTTGGTACCTTGGTCAAGGACTGATATAT TCTTCTAGAAAGATGGTACCCAACCTGCCTTGATTTGCGC

Journal of Applied Microbiology 116, 1621--1631 © 2014 The Society for Applied Microbiology

Outcome

Amplify promoter PldhL fragment (233 bp) Amplify sodA fragment (629 bp) Amplify terminator fragment (157 bp) Amplify erythromycin resistance and replication protein gene of Lact. fermentum (3350 bp)

1623

Recombinant Lact. fermentum prevents colitis

C.L. Hou et al.

of 20 mg ml1 (dissolved in PBS, 0
01 mol l1, pH 7
4 and mixed with an equal volume of 50% ethanol) administered intracolonically by a catheter inserted 3
5–4 cm proximal to the anus. The control group received PBS mixed with ethanol (without TNBS) using the same technique. Mice were observed, weighed and monitored for mortality. The severity of colitis was assessed using a disease activity index as previously described in detail by Cooper et al. (1993). The following parameters were used for the calculation: (i) 0 point: no weight loss, 1 point: weight loss of 1–5%, 2 points: weight loss of 5–10%, 3 points: weight loss of 10–15% and 4 points: weight loss of >15%; (ii) stool consistency/diarrhoea (0 point: normal, 2 points: loose stools and 4 points: watery diarrhoea); and (iii) bleeding (0 point: no bleeding, 2 points: slight bleeding and 4 points: gross bleeding). The stool score was calculated as the sum of weight loss, diarrhoea and bleeding, resulting in the total clinical activity score ranging from 0 (healthy) to 12 (severe colitis). All mice were killed on the 6th day, and the colon tissues were collected for further research. The colonic digesta were collected, and the numbers of lactobacilli, bifidobacteria and E. coli were enumerated on MRS agar, Beerens agar (Mikkelsen et al. 2003) and eosin-methylene blue agar (Tilton and Rosenberg 1978), respectively. Mucosa histological scoring for infiltration of inflammatory cells To assess mucosa histological scoring for infiltration of inflammatory cells, proximal colon samples were collected, cut longitudinally, fixed in neutral phosphatebuffered 4% formalin and then embedded in paraffin. Transverse slices (6 lm thick) were stained with haematoxylin and eosin and were examined by light microscopy. Mucosa inflammatory histological scoring of the colon was performed according to Hartmann et al. (2000): For infiltration of inflammatory cells: 0, rare inflammatory cells in the lamina propria were counted; 1, increased numbers of inflammatory cells in the lamina propria; 2, confluence of inflammatory cells, extending into the submucosa; or a score of 3 was given for the transmural extension of the infiltrate. Assessment of antioxidative indexes in the colon The activity of lipid peroxidation, myeloperoxidase and SOD in the colon samples was determined using assay kits supplied by the Nanjing Jiancheng Bioengineering Institute (Nanjing, China) according to the manufacturer’s instructions. Briefly, the lipid peroxidation assay is based on the reaction of a chromogenic reagent, 1624

N-methyl-2-phenylindole, with malonaldehyde and 4-hydroxynonenals at 45°C. These compounds react with N-methyl-2-phenylindole to yield a stable chromophore with maximal absorbance at 586 nm, which was measured using a UV-1200 spectrophotometer (MAPADA, Shanghai, China). Myeloperoxidase was assayed with o-anisidine in phosphate buffer with hydrogen peroxide. Change in absorbance was monitored continuously at 460 nm using a UV-1200 spectrophotometer, and the results were expressed as the change in optical density per minute. SOD activity was assayed as described previously. Determination of cytokines in colon Samples of colonic tissue were weighed and homogenized in ice-cold phosphate buffer. The homogenates were centrifuged at 9391 g at 4°C for 5 min. Tumour necrosis factor-a (TNF-a), interleukin-1b (IL-1b) and interleukin-8 (IL-8) concentration in the supernatants were determined by ELISA using the commercially available Quantikine Kit (R&D Systems, Minneapolis, MN) according to the manufacturer’s recommendations. Optical densities were measured at a wavelength of 450 nm. Data were analysed using the linear portion of the generated standard curve. Cytokine concentration was standardized to the amount of protein in the supernatant by the BCA quantification method (Pierce, Rockford, IL) and expressed as the amount of cytokines per mg of protein. Western blot for NF-jB, pIjBa and IjBa For analysis of nuclear transcription factor-kappa B (NFjB), about 100 mg of colonic tissue was homogenized in 900 ll of ice-cold hypotonic buffer A (10 mmol l1 HEPES, pH 7
9; 10 mmol l1 KCl; 0
1 mmol l1 EDTANa; 0
1 mmol l1 EGTA; 1 mmol l1 DTT; and 0
5 mmol l1 PMSF) with a tissue homogenizer. Then, 10% solution of Nonidet P-40 was added. Afterwards, the homogenate was transferred to a polypropylene centrifuge tube for 15 min of incubation on ice and centrifuged at 18 407 g for 3 min at 4°C. The supernatant was removed, and the nuclear pellet was extracted with 60 ll of hypertonic buffer B (20 mmol l1 HEPES, pH 7
9; 0
4 mol l1 NaCl; 1 mmol l1 EDTA; 1 mmol l1 EGTA; 1 1 1 mmol l DTT; and 1 mmol l PMSF) by shaking at 4°C for 15 min. The extract was centrifuged at 18 407 g for 4 min at 4°C, and the supernatant was frozen at 80°C. For pIjBa and IjBa, 100 mg of the colon tissue homogenates was prepared in 900 ll of lysis buffer (0
25 mmol l1 sucrose, 1 mmol l1 EDTA, 10 mmol l1 Tris, 1% protease inhibitor cocktail and 1% phosphatase inhibitor cocktail). The mixture was incubated for

Journal of Applied Microbiology 116, 1621--1631 © 2014 The Society for Applied Microbiology

Recombinant Lact. fermentum prevents colitis

C.L. Hou et al.

Statistical analysis Results are expressed as means  SD. The chi square test was used to detect differences in mortality rate. Statistical comparisons of measured indices among the five treatment groups were performed by analysis of variance (ANOVA) procedures followed by the Student–Newman– Keuls (SNK) multiple comparison test of the SAS (ver. 8.0, SAS Institute, Cary, NC). The level of significance was set at P < 0
05. Results The construction of sodA recombinant Lactobacillus fermentum strains The expected amounts of about 233 bp (promoter PldhL), 629 bp (sodA fragment) (Tauchi et al. 1991) and 157 bp (terminator TldhL) of fragments were amplified with primers P1/P2, P3/P4 and P5/P6, respectively, and then linked and inserted into linearized pJET1.2 to generate plasmid pAF008 using the In-Fusion cloning strategy. A 3350-bp fragment was obtained by P7/P8 and inserted linearized pAF008 to construct pAF009. After enzyme digestion and sequencing identification, the recombinant plasmid was transformed to Lact. fermentum by electroporation. The positive recombinants were identified by colony PCR to produce an expected amount of about 950-bp fragments (PldhL-sodA-TldhL). For the same amount of 109 CFU, the SOD activity of the recombinant strain (54
35 U) was about eightfold higher than that of the wild-type cell (7
70 U) (Fig. 2).

60

50 SOD activity U per 109 CFU

30 min at 4°C and centrifuged for 10 min at 15 871 g and 4°C. Protein concentration was measured by Bradford assay (Applygen Technologies Inc., Beijing, China). Protein extracts (5 lg) were separated by sodium dodecyl sulphate polyacrylamide gel electrophoresis (PAGE) (10% acrylamide) and transferred onto a polyvinylidene difluoride (PVDF) membrane (Millipore, Bedford, MA) for immunodetection. Target proteins were detected using rabbit anti-mouse NF-jB p65, phosphorylated IjBa (pIjB-a) and pIjBa (1 : 1000, Cell Signaling Technology, Boston, MA), as primary antibodies, and HRPconjugated anti-rabbit IgG, (1 : 10 000) as a secondary antibody. Specifically bound peroxidase was detected by Western blot detection reagent (AmershamTM ECLTM Prime Western Blotting Detection Reagent, GE Healthcare, UK Limited Little Chalfont Buckinghamshire, UK) and then exposed to X-ray (GE Healthcare) for 5–60 s. The optical density of the bands was quantified using IMAGE J (ver. 1.38) (National Institutes of Health, Maryland).

40

30

20

10

0 L. fermentum

L. fermentum-sodA

Figure 2 Superoxide dismutase (SOD) activity in Lactobacillus fermentum strains, Lact. fermentum and Lact. fermentum-sodA strains were cultured overnight at 37°C. The SOD activity (U) and bacterial numbers (CFU) in overnight cultures were measured. The results were expressed as the amount of SOD activity per 109 CFU. Values were means  SD of the mean of triplicate experiments.

Body weight, symptoms and signs of colitis All animals that were treated with TNBS showed a significant decrease in average body weight immediately afterwards compared with control animals (Fig. 3a). The average body weight of the animals that received the wild-type or recombinant strains was significantly higher than those of the TNBS group on day 2 (P < 0
05). However, there was no difference between the wild-type or recombinant strains. All animals treated with TNBS showed a significant increase in disease activity index than control animals (P < 0
05). Both the wild-type and the recombinant strains significantly decreased the disease activity index induced by TNBS from day 2 to day 4 post-TNBS inoculation (P < 0
05). The disease activity index of TNBS-treated mice that received the recombinant strain was lower than that of mice that received the wild-type strain (P < 0
05) (Fig. 3b). The mortality rates of mice with TNBS-induced colitis were 33
3% (unsupplemented), 40
0% (Lact. fermentum) and 20
0% (recombinant Lact. fermentum) compared with no mortality in the control group. There were significant differences in mortality between the control group and TNBS treatment. However, there were no significant differences between the control and TNBS mice that received the recombinant strain (Table 3).

Journal of Applied Microbiology 116, 1621--1631 © 2014 The Society for Applied Microbiology

1625

Recombinant Lact. fermentum prevents colitis

C.L. Hou et al.

affected by the addition of the Lact. fermentum strains (P > 0
05).

(a) 27 Body weight (g)

25 23

a

a

a

a

21

a b

a

19

Disease activity index

(b) 10 9 8 7 6 5 4 3 2 1 0

Inflammation of the colon

b

Treatment with TNBS significantly increased mucosa histological scoring for infiltration of inflammatory cells. However, the administration of recombinant strain appeared to decrease significantly histological scoring for infiltration of inflammatory cells (P < 0
05) (Table 3). As shown in Fig. 5, treatment with TNBS significantly increased the levels of IL-1b, TNF-a and IL-8 compared with the control (P < 0
05). The administration of recombinant Lact. fermentum appeared to decrease the production of IL-1b and IL-8 (P < 0
05). However, neither of the treatments appeared to decrease TNF-a (P > 0
05). Compared with control group, mice treated with TNBS-PBS significantly increased IjBa phosphorylation, which led to IjBa degradation (P < 0
05, Fig. 6). However, the recombinant strain significantly inhibited IjBa phosphorylation and resulted in inhibition of IjB degradation, compared with TNBS-PBS group (P < 0
05). In addition, mice treated with TNBS showed an increase in NF-jB production (P < 0
05), while the recombinant strain significantly decreased it (P < 0
05).

b c

17 15

a

b

b

0

2 3 4 Days post-TNBS (days)

1

b

b

b c

5

b bc c

c

6

b c

a

0

a

a

1

a

a

2 3 4 Days post-TNBS (days)

a

c

a

5

6

Figure 3 Effects of Lactobacillus fermentum and recombinant Lact. fermentum on TNBS-induced colitis in BALB/c mice. (a) Body weight changes, (b) disease activity index. Colitis was induced by rectal administration of TNBS (2 mg per mouse) solution. Mice treated with PBS mixed with 50% ethanol (without TNBS) were used as controls. TNBS+LF-treated group were received the wild-type Lact. fermentum strain (5 9 109 CFU per day per mouse) (filled triangle). TNBS+LF-SOD-treated group were received the recombinant Lact. fermentum (5 9 109 CFU per day per mouse) (fork). TNBS (filled squares) and control groups (filled circle) were received equal volume of PBS. Values were means  SD, n = the number of living mice on the 1st–6th day. Values at each time point without a common letter differed significantly (P < 0
05). (a) ( ) Control, ( ) TNBS, ( ) TNBS+LF and ( ) TNBS+LF-SOD. (b) ( ) Control, ( ) TNBS, ( ) TNBS+LF and ( ) TNBS+LF-SOD.

Antioxidative indexes and intestinal microflora Treatment with TNBS significantly increased the levels of lipid peroxidation and myeloperoxidase compared with the control, whereas there was no difference in SOD activity. The TNBS mice that received wild-type Lact. fermentum did not increase SOD activity of colon digesta, but significantly decreased lipid peroxidation of colon tissue. The administration of recombinant Lact. fermentum decreased lipid peroxidation and myeloperoxidase significantly (P < 0
05) and also had increased SOD in colonic digesta (P < 0
05) (Fig. 4). Mice which received either the recombinant or wildtype Lact. fermentum showed higher (P < 0
05) lactobacilli counts than the other treatments (Table 3). However, neither E. coli nor bifidobacteria population was 1626

Discussion In the present study, the SOD expression shuttle vector was successfully constructed using the In-Fusion cloning strategy, which enabled rapid and sequence-independent insertion of the promoter, target gene, terminator and other fragments into the clone vector, which were transformed into Lact. fermentum. The recombinant Lact. fermentum exhibited approximately eightfold SOD activity than the wild type, which indicated that sodA was successfully expressed in the host. Accumulating evidence indicates that an increase in ROS is associated with diseases in human and animals (Lykkesfeldt and Svendsen 2007; Brawek et al. 2010). SOD, the key rate-limiting enzyme of the antioxidant systems, can convert superoxide anion to H2O2 and decrease overall ROS levels. There are numerous studies suggested that SOD ameliorated colonic inflammation in experimental colitis (Segui et al. 2004). However, the use of SOD in inflammatory diseases is hampered by its short half-life in the gastrointestinal tract (Turrens et al. 1984). Treatment with TNBS is a commonly used method to develop an experimental animal model for colitis (Watterlot et al. 2010). The well-characterized TNBSinduced colitis is similar to human Crohn’s disease in terms of its various macroscopic and histological features,

Journal of Applied Microbiology 116, 1621--1631 © 2014 The Society for Applied Microbiology

Recombinant Lact. fermentum prevents colitis

C.L. Hou et al.

Table 3 Mortality, as well as scoring for infiltration of inflammatory cell and intestinal bacterial composition Treated with TNBS Control

Unsupplemented

a

Mortality (%) Scoring for infiltration of inflammatory cell Lactobacilli (LogCFU per g) Bifidobacteria (LogCFU per g) Escherichia coli (LogCFU per g)

0 0
06 6
74 5
85 3
94

b

   

a

0
26 0
88a 0
30 1
08

33
3 1
70 7
01 6
04 4
94

   

Lactobacillus fermentum b

40
0 1
66 7
83 6
09 4
31

c

0
67 0
70a 0
21 1
40

   

Lact. fermentum - sodA 20
0ab 1
08  7
67  6
31  4
33 

c

0
71 0
68b 0
44 1
69

0
51b 0
39b 0
53 1
14

Values were means  SD, n = 15 for controls, n = 10 for TNBS-unsupplemented group, n = 9 for TNBS-Lact. fermentum group and n = 12 for TNBS-Lact. fermentum-sodA group. Values in a row with different superscripts were significantly different (P < 0
05).

250

IL-1β pg mg–1 protein

a

150 100 50

4

Control

(b)

TNBS

TNBS+LF

9·0 6·0 3·0

Control

TNBS

TNBS+LF TNBS+LF-SOD

bc

3

b

100·0

(b)

a

2

b

1·5 1 0·5

45 40 35 30 25 20 15 10 5 0

b

0·0

2·5

0

bc

a

c

3·5

c

12·0

TNBS+LF-SOD

Control

(c)

TNBS

TNBS+LF

TNBS+LF-SOD

d

TNF-α pg mg–1 protein

Myeloperoxidase (U g–1 tissue) Lipid peroxidation (µmol mg–1 pr)

a

(a)

15·0

a

200

0

18·0

b

(a)

b

75·0

50·0

b

a

25·0

c

0·0

Control

TNBS

TNBS+LF TNBS+LF-SOD

b 80·0 a

Control

TNBS

TNBS+LF

TNBS+LF-SOD

Figure 4 Antioxidative indexes in colon. (a) SOD activity in colonic digesta, (b) myeloperoxidase activity and (c) lipid peroxidation concentrations in the colonic tissue. Experimental design was the same as Fig. 3. At day 6, mice were killed, and colonic digesta and colonic tissues were collected for further analysis. Values were means  SD, n = 15 for controls, n = 10 for TNBS group, n = 9 for TNBS+LF group and n = 12 for TNBS+LF-SOD group. Bars with different letters differed, P < 0
05.

including body weight loss, diarrhoea, bloody stool, neutrophils and inflammatory cell infiltration in the colonic mucosa. In this study, mice treated with TNBS displayed

IL-8 pg mg–1 protein

SOD (U g–1 digesta)

300

c

(c)

c b

60·0

40·0 a 20·0

0·0

Control

TNBS

TNBS+LF TNBS+LF-SOD

Figure 5 (a) IL-1b, (b) TNFa and (c) IL-8 concentrations in the colonic homogenates Experimental design was the same as Fig. 3. At day 6, mice were killed, and the colonic homogenates were collected for further analysis. Values were means  SD, n = 15 for controls, n = 10 for TNBS group, n = 9 for TNBS+LF group and n = 12 for TNBS+LF-SOD group. Bars with different letters differed, P < 0
05.

Journal of Applied Microbiology 116, 1621--1631 © 2014 The Society for Applied Microbiology

1627

Recombinant Lact. fermentum prevents colitis

C.L. Hou et al.

(b)

IκBα/β-actin

(a)

Control

TNBS

TNBS+LF TNBS+LF-SOD

IκBα

37 kDa

β-actin

42 kDa

1 0·9 0·8 0·7 0·6 0·5 0·4 0·3 0·2 0·1 0

c b a

a

c

1·6 1·4

c

pIκBα β-actin

41 kDa 42 kDa

pIκBα/β-actin

1·2 1 b

0·8 0·6

a

0·4 0·2 65 kDa

β-actin

42 kDa

0 c

1·2 NF-κB(p65)/β-actin

p65

c

1 0·8 b 0·6 0·4

a

0·2 0

Control

TNBS

TNBS+LF

TNBS+LF-SOD

Figure 6 The pIjBa, IjBa and NF-jB p65 expression in the colonic tissue. (a) Western blot analysis of pIjBa, IjBa and NF-jB p65 expression in the colonic tissue of mice; and (b) band intensities were quantified using IMAGE J. Experimental design was the same as Fig. 3. At day 6, mice were killed, and the colonic homogenates were collected for further analysis. NF-jB p65 was measured in the nuclear extract of the colonic tissue homogenate, whereas IkBa and pIkBa were measured directly in the tissue homogenate. Values were means  SD, n = 15 for controls, n = 10 for TNBS group, n = 9 for TNBS+LF group and n = 12 for TNBS+LF-SOD group. Bars with different letters differed, P < 0
05.

typical symptoms of colitis and inflammatory cell infiltration score in mucous, which indicated that the animal model was successfully established. Recombinant Lact. fermentum significantly decreased the inflammatory cell infiltration score indicating that expressing SOD could improve its anti-inflammatory activities, while Lact. fermentum I5007 did not alter the inflammatory cell infiltration score in mucous. These findings are compatible with previous research that lactic acid bacteria expressing manganese SOD decreased the inflammatory score of mice colitis model (Carroll et al. 2007). Myeloperoxidase and lipid peroxidation activity are an important index of neutrophil infiltration and a biomarker of tissue damage (Mullane et al. 1985; Tauchi et al. 1991; Gutteridge 1995; McCabe et al. 2001). The antioxidative and inflammatory indexes in the colon were also assessed in our study. The results demonstrated that lipid peroxidation and myeloperoxidase were increased in colonic 1628

tissue in TNBS-treated mice. However, supplementation with Lact. fermentum I5007 or recombinant Lact. fermentum decreased these parameters. Previous studies have demonstrated that Lact. fermentum I5007 could be used to alleviate oxidative stress (Wang et al. 2009, 2013). Our data indicated that recombinant Lact. fermentum has a better antioxidative effect than Lact. fermentum I5007, as the recombinant strain markedly increased SOD activity, scavenged free radicals and decreased lipid peroxidation in colonic tissue. Additionally, IL-8 and IL-1b were significantly decreased in the colonic tissue of TNBS-treated mice that received recombinant Lact. fermentum, suggesting that recombinant Lact. fermentum decreased the expression of inflammatory cytokines and relieved the inflammatory damage. IL-8 and IL-1b are two inflammatory cytokines that activate neutrophil chemotaxis and mediate a wide range of immune and inflammatory responses (Kato et al. 2002; Henkels et al. 2011). They are

Journal of Applied Microbiology 116, 1621--1631 © 2014 The Society for Applied Microbiology

Recombinant Lact. fermentum prevents colitis

C.L. Hou et al.

mediated by the activation of NF-jB. Various studies indicate that NF-jB, as one of the key regulators in this immunological setting, mediates the expression of a number of inflammatory cytokines and the inflammatory response to damage (Kretzmann et al. 2008). Generally, during TNBS-induced colitis, excess ROS, such as superoxide and hydrogen peroxide in the colonocytes (Grisham et al. 1991), activate immune cells, such as neutrophils, macrophages and cytotoxic T cells, which play the role of aggressors to the colonic mucosa through the release of Th1 cytokines (e.g. IFN-c and TNF-a) (te Velde et al. 2006). Meanwhile, excess ROS induced by TNBS-mediated IjBa phosphorylation triggered IjBa degradation and subsequent release and activation of NF-jB dimers (Kretzmann et al. 2008). Then, the released NF-jB enters into the nucleus bound to specific promoter sites and activated pro-inflammatory gene transcription and expression such as IL-8 and IL-1b (Kretzmann et al. 2008). In the present study, recombinant strain supplementation in TNBS-treated mice significantly decreased the IjBa phosphorylation and increased the cytoplasmic IjBa level, which suggested that the blocking effect of recombinant Lact. fermentum on NF-jB signalling may be through the inhibition of IjBa phosphorylation. Previous studies showed that Lactobacillus ameliorated the inflammation by inhibition of the NF-jB activation in colitis (Lee et al. 2009; Hegazy and El-Bedewy 2010). Therefore, we speculated that recombinant Lact. fermentum might relieve the intestinal inflammatory response through inhibition of the NF-jB activation in mice with colitis. Notably, in the present study, TNBS-treated mice supplemented with the wild-type strain also slightly inhibited the activation of NF-jB p65, although not significant, which may be attributed to its innate property (Lee et al. 2009; Hegazy and El-Bedewy 2010). In conclusion, this study demonstrated that treatment with recombinant SOD Lact. fermentum attenuated TNBS-induced colitis, which was associated with an increase in intestinal SOD activity and a reduction in oxidative stress, NF-jB activity and cytokine production. Recombinant SOD Lact. fermentum is a highly antiinflammatory bacterial strain, which could be a promising candidate to alleviate oxidative stress and inflammation response in commercial animals.

Acknowledgements This work was supported by the National Natural Science Foundation of China (NO. 30930066), the Chinese Universities Scientific Fund (NO. 2012QJ102) and National Key Basic Research Program of China (973 Program) 2012CB124702.

Conflict of Interest No conflict of interest declared. References Almenier, H.A., Al Menshawy, H.H., Maher, M.M. and Al Gamal, S. (2012) Oxidative stress and inflammatory bowel disease. Front Biosci (Elite Ed) 4, 1335–1344. Borek, C. (2001) Antioxidant health effects of aged garlic extract. J Nutr 131, 1010S–1015S. Borek, C., Ong, A., Mason, H., Donahue, L. and Biaglow, J.E. (1986) Selenium and vitamin E inhibit radiogenic and chemically induced transformation in vitro via different mechanisms. Proc Natl Acad Sci USA 83, 1490–1494. Brawek, B., Loffler, M., Wagner, K., Huppertz, H.J., Wendling, A.S., Weyerbrock, A., Jackisch, R. and Feuerstein, T.J. (2010) Reactive oxygen species (ROS) in the human neocortex: role of aging and cognition. Brain Res Bull 81, 484–490. Bruno-Barcena, J.M., Andrus, J.M., Libby, S.L., Klaenhammer, T.R. and Hassan, H.M. (2004) Expression of a heterologous manganese superoxide dismutase gene in intestinal lactobacilli provides protection against hydrogen peroxide toxicity. Appl Environ Microbiol 70, 4702–4710. Carroll, I.M., Andrus, J.M., Bruno-Barcena, J.M., Klaenhammer, T.R., Hassan, H.M. and Threadgill, D.S. (2007) Anti-inflammatory properties of Lactobacillus gasseri expressing manganese superoxide dismutase using the interleukin 10-deficient mouse model of colitis. Am J Physiol Gastrointest Liver Physiol 293, G729–G738. Cooper, H.S., Murthy, S.N., Shah, R.S. and Sedergran, D.J. (1993) Clinicopathologic study of dextran sulfate sodium experimental murine colitis. Lab Invest 69, 238–249. Dekaris, I., Marotti, T., Sprong, R.C., van Oirschot, J.F. and van Asbeck, B.S. (1998) Hydrogen peroxide modulation of the superoxide anion production by stimulated neutrophils. Immunopharmacol Immunotoxicol 20, 103–117. Dowling, E.J., Chander, C.L., Claxson, A.W., Lillie, C. and Blake, D.R. (1993) Assessment of a human recombinant manganese superoxide dismutase in models of inflammation. Free Radic Res Commun 18, 291–298. Fons, M., Hege, T., Ladire, M., Raibaud, P., Ducluzeau, R. and Maguin, E. (1997) Isolation and characterization of a plasmid from Lactobacillus fermentum conferring erythromycin resistance. Plasmid 37, 199–203. Grisham, M.B., Volkmer, C., Tso, P. and Yamada, T. (1991) Metabolism of trinitrobenzene sulfonic acid by the rat colon produces reactive oxygen species. Gastroenterology 101, 540–547. Gutteridge, J.M. (1995) Lipid peroxidation and antioxidants as biomarkers of tissue damage. Clin Chem 41, 1819–1828. Han, W., Mercenier, A., Ait-Belgnaoui, A., Pavan, S., Lamine, F., van Swam, I.I., Kleerebezem, M., Salvador-Cartier, C.

Journal of Applied Microbiology 116, 1621--1631 © 2014 The Society for Applied Microbiology

1629

Recombinant Lact. fermentum prevents colitis

C.L. Hou et al.

et al. (2006) Improvement of an experimental colitis in rats by lactic acid bacteria producing superoxide dismutase. Inflamm Bowel Dis 12, 1044–1052. Hartmann, G., Bidlingmaier, C., Siegmund, B., Albrich, S., Schulze, J., Tschoep, K., Eigler, A., Lehr, H.A. et al. (2000) Specific type IV phosphodiesterase inhibitor rolipram mitigates experimental colitis in mice. J Pharmacol Exp Ther 292, 22–30. Hegazy, S.K. and El-Bedewy, M.M. (2010) Effect of probiotics on pro-inflammatory cytokines and NF-jB activation in ulcerative colitis. World J Gastroenterol 16, 4145–4151. Henkels, K.M., Frondorf, K., Gonzalez-Mejia, M.E., Doseff, A.L. and Gomez-Cambronero, J. (2011) IL-8-induced neutrophil chemotaxis is mediated by Janus kinase 3 (JAK3). FEBS Lett 585, 159–166. Inaoka, T., Matsumura, Y. and Tsuchido, T. (1998) Molecular cloning and nucleotide sequence of the superoxide dismutase gene and characterization of its product from Bacillus subtilis. J Bacteriol 180, 3697–3703. Ishihara, T., Tanaka, K., Tasaka, Y., Namba, T., Suzuki, J., Okamoto, S., Hibi, T., Takenaga, M. et al. (2009) Therapeutic effect of lecithinized superoxide dismutase against colitis. J Pharmacol Exp Ther 328, 152–164. Kato, A., Gabay, C., Okaya, T. and Lentsch, A.B. (2002) Specific role of interleukin-1 in hepatic neutrophil recruitment after ischemia/reperfusion. Am J Pathol 161, 1797–1803. Keshavarzian, A., Banan, A., Farhadi, A., Komanduri, S., Mutlu, E., Zhang, Y. and Fields, J.Z. (2003) Increases in free radicals and cytoskeletal protein oxidation and nitration in the colon of patients with inflammatory bowel disease. Gut 52, 720–728. Kono, Y. (1978) Generation of superoxide radical during autoxidation of hydroxylamine and an assay for superoxide dismutase. Arch Biochem Biophys 186, 189–195. Kretzmann, N.A., Fillmann, H., Mauriz, J.L., Marroni, C.A., Marroni, N., Gonzalez-Gallego, J. and Tunon, M.J. (2008) Effects of glutamine on proinflammatory gene expression and activation of nuclear factor kappa B and signal transducers and activators of transcription in TNBS-induced colitis. Inflamm Bowel Dis 14, 1504–1513. Kruidenier, L. and Verspaget, H.W. (2002) Review article: oxidative stress as a pathogenic factor in inflammatory bowel disease-radicals or ridiculous? Aliment Pharmacol Ther 16, 1997–2015. Lee, J.H., Lee, B., Lee, H.S., Bae, E.A., Lee, H., Ahn, Y.T., Lim, K.S., Huh, C.S. et al. (2009) Lactobacillus suntoryeus inhibits pro-inflammatory cytokine expression and TLR-4linked NF-jB activation in experimental colitis. Int J Colorectal Dis 24, 231–237. Li, X.J., Yue, L.Y., Guan, X.F. and Qiao, S.Y. (2008) The adhesion of putative probiotic lactobacilli to cultured epithelial cells and porcine intestinal mucus. J Appl Microbiol 104, 1082–1091.

1630

Liu, P., Ewis, H.E., Huang, Y.J., Lu, C.D., Tai, P.C. and Weber, I.T. (2007) Structure of Bacillus subtilis superoxide dismutase. Acta Crystallogr Sect F Struct Biol Cryst Commun 63, 1003–1007. Lykkesfeldt, J. and Svendsen, O. (2007) Oxidants and antioxidants in disease: oxidative stress in farm animals. Vet J 173, 502–511. McCabe, A.J., Dowhy, M., Holm, B.A. and Glick, P.L. (2001) Myeloperoxidase activity as a lung injury marker in the lamb model of congenital diaphragmatic hernia. J Pediatr Surg 36, 334–337. Mikkelsen, L.L., Bendixen, C., Jakobsen, M. and Jensen, B.B. (2003) Enumeration of bifidobacteria in gastrointestinal samples from piglets. Appl Environ Microbiol 69, 654–658. Mrsic-Pelcic, J., Pilipovic, K., Pelcic, G., Vitezic, D. and Zupan, G. (2012) Temporal and regional changes of superoxide dismutase and glutathione peroxidase activities in rats exposed to focal cerebral ischemia. Cell Biochem Funct 30, 597–603. Mullane, K.M., Kraemer, R. and Smith, B. (1985) Myeloperoxidase activity as a quantitative assessment of neutrophil infiltration into ischemic myocardium. J Pharmacol Methods 14, 157–167. Nakamura, Y., Ohtaki, S., Makino, R., Tanaka, T. and Ishimura, Y. (1989) Superoxide anion is the initial product in the hydrogen peroxide formation catalyzed by NADPH oxidase in porcine thyroid plasma membrane. J Biol Chem 264, 4759–4761. Segui, J., Gironella, M., Sans, M., Granell, S., Gil, F., Gimeno, M., Coronel, P., Pique, J.M. et al. (2004) Superoxide dismutase ameliorates TNBS-induced colitis by reducing oxidative stress, adhesion molecule expression, and leukocyte recruitment into the inflamed intestine. J Leukoc Biol 76, 537–544. Tauchi, T., Ohyashiki, K., Ohyashiki, J.H., Saito, M., Nakazawa, S., Enomoto, Y., Hosoda, Y. and Toyama, K. (1991) Acute lymphoblastic leukemia with azurophilic granules that contain ultrastructural myeloperoxidase activity. Am J Hematol 36, 288–290. Ten Hove, T., Corbaz, A., Amitai, H., Aloni, S., Belzer, I., Graber, P., Drillenburg, P., van Deventer, S.J. et al. (2001) Blockade of endogenous IL-18 ameliorates TNBS-induced colitis by decreasing local TNF-alpha production in mice. Gastroenterology 121, 1372–1379. Tilton, R.C. and Rosenberg, B. (1978) Reversal of the silver inhibition of microorganisms by agar. Appl Environ Microbiol 35, 1116–1120. Turrens, J.F., Crapo, J.D. and Freeman, B.A. (1984) Protection against oxygen toxicity by intravenous injection of liposome-entrapped catalase and superoxide dismutase. J Clin Invest 73, 87–95. Tuzun, A., Erdil, A., Inal, V., Aydin, A., Bagci, S., Yesilova, Z., Sayal, A., Karaeren, N. et al. (2002) Oxidative stress and antioxidant capacity in patients with inflammatory bowel disease. Clin Biochem 35, 569–572.

Journal of Applied Microbiology 116, 1621--1631 © 2014 The Society for Applied Microbiology

Recombinant Lact. fermentum prevents colitis

C.L. Hou et al.

te Velde, A.A., Verstege, M.I. and Hommes, D.W. (2006) Critical appraisal of the current practice in murine TNBSinduced colitis. Inflamm Bowel Dis 12, 995–999. Wang, A., Yu, H., Gao, X., Li, X. and Qiao, S. (2009) Influence of Lactobacillus fermentum I5007 on the intestinal and systemic immune responses of healthy and E. coli challenged piglets. Antonie Van Leeuwenhoek 96, 89–98. Wang, A.N., Cai, C.J., Zeng, X.F., Zhang, F.R., Zhang, G.L., Thacker, P.A., Wang, J.J. and Qiao, S.Y. (2013) Dietary

supplementation with Lactobacillus fermentum I5007 improves the anti-oxidative activity of weanling piglets challenged with diquat. J Appl Microbiol 114, 1582–1591. Watterlot, L., Rochat, T., Sokol, H., Cherbuy, C., Bouloufa, I., Lefevre, F., Gratadoux, J.J., Honvo-Hueto, E. et al. (2010) Intragastric administration of a superoxide dismutaseproducing recombinant Lactobacillus casei BL23 strain attenuates DSS colitis in mice. Int J Food Microbiol 144, 35–41.

Journal of Applied Microbiology 116, 1621--1631 © 2014 The Society for Applied Microbiology

1631