Suppression of LUBAC-mediated linear ubiquitination by a specific interaction between LUBAC and the deubiquitinases CYLD and OTULIN Tsuyoshi Takiuchi1,2, Tomoko Nakagawa1, Hironari Tamiya1,3, Hiroaki Fujita1,4,5, Yoshiteru Sasaki1, Yasushi Saeki6, Hiroyuki Takeda7, Tatsuya Sawasaki7, Alexander Buchberger8, Tadashi Kimura2 and Kazuhiro Iwai1,4* 1

Department of Molecular and Cellular Physiology, Graduate School of Medicine, Kyoto University, Sakyo-ku, Kyoto 606-8501, Japan 2 Department of Obstetrics and Gynecology, Graduate School of Medicine, Osaka University, Suita, Osaka 565-0871, Japan 3 Department of Orthopedic Surgery, Graduate School of Medicine, Osaka University, Suita, Osaka 565-0871, Japan 4 Cell Biology and Metabolism Group, Graduate School of Frontier Biosciences, Osaka University, Suita, Osaka 565-0871, Japan 5 Department of Frontier Biosciences, Graduate School of Frontier Biosciences, Osaka University, Suita, Osaka 565-0871, Japan 6 Laboratory of Protein Metabolism, Tokyo Metropolitan Institute of Medical Science, Tokyo 156-8506, Japan 7 Proteo-Science Center, Ehime University, Matsuyama, Ehime 790-8577, Japan 8 Department of Biochemistry, Biocenter, University of W€urzburg, Am Hubland, W€urzburg 97074, Germany

Linear ubiquitin chains generated by the linear ubiquitin chain assembly complex (LUBAC) play an important role in NF-jB activation. However, the regulation of linear ubiquitin chain generation by LUBAC is not well characterized. Here, we identified two deubiquitinating enzymes (DUBs), ovarian tumor DUB with linear linkage specificity (OTULIN/Gumby/ FAM105B) and cylindromatosis (CYLD) that can cleave linear polyubiquitin chains and interact with LUBAC via the N-terminal PNGase/UBA or UBX (PUB) domain of HOIP, a catalytic subunit of LUBAC. HOIP interacts with both CYLD and OTULIN even in unstimulated cells. The interaction of CYLD and OTULIN with HOIP synergistically suppresses LUBACmediated linear polyubiquitination and NF-jB activation. Moreover, introduction of a HOIP mutant unable to bind either deubiquitinase into HOIP-null cells augments the activation of NF-jB by TNF-a stimulation. Thus, the interactions between these two deubiquitinases and the LUBAC ubiquitin ligase are involved in controlling the extent of TNF-a-induced NF-jB activation in cells by fine-tuning the generation of linear ubiquitin chains by LUBAC. The interaction of HOIP with OTULIN is also involved in OTULIN suppressing the canonical Wnt signaling pathway activation by LUBAC. Our observations provide molecular insights into the roles of ligase–deubiquitinase interactions in regulating molecular events resulting from linear ubiquitin conjugation.

Introduction The ubiquitin conjugation system is a reversible posttranslational modification system that regulates protein function by several mechanisms, including proteolysis of polyubiquitinated proteins (Hershko & Ciechanover 1998; Kornitzer & Ciechanover 2000). Conjugation of Communicated by: Keiji Tanaka *Correspondence: [email protected]

254

Genes to Cells (2014) 19, 254–272

ubiquitin chains to proteins requires the sequential transfer of ubiquitin monomers by three classes of enzymes as follows: a ubiquitin activating enzyme (E1), a ubiquitin conjugating enzyme (E2), and a ubiquitin ligase (E3) (Hershko & Ciechanover 1998; Kornitzer & Ciechanover 2000). Several types of ubiquitin chains can be produced, and the type may determine the mode of regulation of the conjugated protein. Approximately 90 deubiquitinating enzymes (DUBs) are present in the human genome, which

DOI: 10.1111/gtc.12128 © 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

LUBAC suppression by DUBs

down-regulate ubiquitination-initiated events by removing ubiquitin chains from the ubiquitinated protein by cleaving a particular type of ubiquitin chain (Komander et al. 2009a). Most ubiquitin chains are generated by an isopeptide linkage between one of seven Lys residues in one ubiquitin and the C-terminal Gly of another ubiquitin (Peng et al. 2003). However, we have reported that linear polyubiquitin chains are generated by the formation of a peptide bond between the N-terminal a-amino-group of Met of one ubiquitin and the C-terminal Gly of another ubiquitin (Kirisako et al. 2006). Linear ubiquitin chains are generated by the linear ubiquitin chain assembly complex (LUBAC) that is comprised of HOIL-1L, SHARPIN, and HOIP, the catalytic subunit of LUBAC (Gerlach et al. 2011; Ikeda et al. 2011; Tokunaga et al. 2011). LUBAC-mediated linear polyubiquitination plays crucial roles in NF-jB activation (Kirisako et al. 2006; Tokunaga et al. 2009; Iwai 2012). NF-jB proteins are a family of transcription factors that are involved in inflammatory, antiapoptotic, and immune processes (Vallabhapurapu & Karin 2009). As abnormal activation of NF-jB has been reported in inflammatory diseases and in several types of malignancies, including B-cell lymphomas (Pasparakis 2009; BenNeriah & Karin 2011; Tokunaga et al. 2012), the mechanism by which linear polyubiquitination by LUBAC is regulated is of great interest. The HOIP subunit of LUBAC possesses multiple domains, and although the roles of most of the domains have been clarified, the function of the PUB (PNGase/UBA or UBX) domain (amino acids 51– 144) in the N-terminal region of HOIP has remained unclear (Tokunaga 2013). The PUB domain is found in several proteins including PNGase and Ubxd1 and is a highly conserved domain in protozoans, plants, and animals (Suzuki et al. 2001; Doerks et al. 2002; Allen et al. 2006; Madsen et al. 2009). PUB domains have been shown to associate with the valosin-containing protein (VCP), an AAA-type ATPase complex (Allen et al. 2006; Zhao et al. 2007; Madsen et al. 2009). VCP binds to ubiquitinated proteins and exerts its functions mainly with the help of regulatory cofactors (Yeung et al. 2008; Madsen et al. 2009; Buchberger 2010). To probe the function of the PUB domain of HOIP, we identified PUB domainbinding proteins by mass spectrometry (MS) and found that two DUBs, cylindromatosis (CYLD) and OTULIN/Gumby/Fam105B, directly interact with the N-terminal PUB domain-containing region of HOIP. Both OTULIN and CYLD cleave linear

ubiquitin chains, although CYLD can also cleave Lys 63 (K63)-linked chains (Komander et al. 2009b; Keusekotten et al. 2013; Rivkin et al. 2013). We then dissected the physiological relevance of the interaction between the two DUBs and HOIP and found that the interaction is involved in regulating the amount of linear ubiquitin chains in cells and in controlling the extent of TNF-a-induced NF-jB activation and canonical Wnt activation.

Results HOIP PUB domain interacts with CYLD and OTULIN

The HOIL-1L, SHARPIN, and HOIP subunits of LUBAC each possess multiple domains, including a PUB domain in the N-terminal part of HOIP. The PUB domain is a VCP-binding domain found in several VCP cofactors (Allen et al. 2006; Zhao et al. 2007). Asn41 and Tyr51 in the PUB domain of human PNGase are crucial for VCP binding (Allen et al. 2006), and these residues correspond to Asn84 (N84) and Tyr93 (Y93) of the PUB domain of mouse HOIP. Therefore, we generated a HOIP mutant in which N84 and Y93 were substituted with Ala (HOIP N84A/Y93A) (Fig. 1A). Co-immunoprecipitaion analyses using HEK293T cells confirmed that HOIP N84A/Y93A failed to bind to VCP (Fig. 1B). To probe the effect of over-expression of LUBAC containing HOIP wild type (WT) (LUBAC WT) or HOIP N84A/Y93A (LUBAC N84A/Y93A) on the amount of the linear polyubiquitin chains in cells, lysates of HEK293T cells expressing LUBAC WT or LUBAC N84A/Y93A were immunoblotted using an antilinear ubiquitin-specific antibody (Sasaki et al. 2013). To our surprise, the amount of linear polyubiquitin was dramatically greater in cells expressing LUBAC N84A/Y93A than in cells expressing LUBAC WT (Fig. 1C). We thus hypothesized that the PUB domain of HOIP is involved in the suppression of LUBAC-mediated linear polyubiquitination. As VCP binds to numerous ubiquitin system proteins, including DUBs (Madsen et al. 2009), we hypothesized that DUBs that can digest linear ubiquitin chains may associate with the PUB domain of HOIP. To examine the association of DUBs with LUBAC, LUBAC WT or N84A/Y93A immunoprecipitated from HEK293T cells expressing HA-tagged HOIP WT or N84A/Y93A together with HOIL1L-Myc and T7-SHARPIN was incubated with GST-linear tri-ubiquitin. GST-linear tri-ubiquitin

© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

Genes to Cells (2014) 19, 254–272

255

T Takiuchi et al. (A)

(C)

(B)

(D)

(E)

(F)

Figure 1 HOIP PUB domain interacts with CYLD and OTULIN. (A) Schematic representation of HOIP and HOIP mutants. The PUB domain is located at the N-terminus of HOIP. PUB, PNGase/UBA or UBX; ZF, zinc finger; NZF, Npl4 zinc finger; UBA, ubiquitin-associated; RING, really interesting new gene; IBR, in-between RING; LDD, linear ubiquitin chain determining domain. (B) N84 and Y93 in the PUB domain of HOIP are crucial for binding to VCP. HEK293T cells were transiently transfected with plasmids encoding HA-HOIP WT or N84A/Y93A, together with HOIL-1L-Myc and T7-SHARPIN, as indicated, and cell lysates were immunoprecipitated and immunoblotted using the indicated antibodies. (C) A dramatic increase in linear polyubiquitination in cells expressing LUBAC N84A/Y93A. HEK293T cells were transiently transfected with indicated plasmids followed by immunoblotting with the indicated antibodies. *nonspecific band. (D) Association of deubiquitinase activity for linear polyubiquitin with LUBAC WT but not LUBAC N84A/Y93A. Anti-HA immunoprecipitates from HEK293T cells expressing HA-LUBAC WT or N84A/Y93A were incubated with GST-linear tri-ubiquitin for 20 min at 37 °C followed by immunoblotting with the indicated antibodies. (E) LUBAC WT but not N84A/Y93A bound to CYLD and OTULIN. HEK293T cells were transiently transfected with the indicated plasmids, and cell lysates were treated as in (B). (F) Interaction of endogenous CYLD and OTULIN with HOIP in unstimulated MEFs. Immunoprecipitates with anti-HOIP, anti-CYLD, or anti-OTULIN were immunoblotted with the indicated antibodies.

was efficiently cleaved in the presence of LUBAC WT (Fig. 1D). However, LUBAC N84A/Y93A failed to digest linear tri-ubiquitin effectively, indicat256

Genes to Cells (2014) 19, 254–272

ing that DUBs that can cleave linear ubiquitin chains co-immunoprecipitate with HOIP WT but not with HOIP N84A/Y93A.

© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

LUBAC suppression by DUBs

To identify DUBs that specifically interact with the PUB domain in HOIP, 3xFLAG-3xHA-tagged HOIP 1–299 WT or N84A/Y93A was stably introduced into a mouse B cell line, Bal17.2 (Fig. S1A in the Supporting Information). Lysates of Bal17.2 cells expressing 3xFLAG-3xHA-HOIP 1–299 WT or N84A/Y93A were subjected to tandem affinity purification (TAP) by sequential precipitations with antiFLAG and anti-HA antibodies and then analyzed by liquid chromatography-tandem MS (TAP-MS). Two independent TAP-MS experiments were carried out (Fig. S1B in the Supporting Information). The proteins of relevance to this study that were specifically associated with HOIP 1–299 WT are listed in Tables S1 and S2 in the Supporting Information. In addition to VCP, OTULIN and CYLD, two DUBs that have been shown to digest the linear ubiquitin linkage, were identified as specific binding proteins of HOIP 1–299 WT but not the N84A/Y93A mutant (Tables S1 and S2 in the Supporting Information). By contrast, Otu1, Ataxin-3, or VCIP135, DUBs that bind to VCP, were not detected (Uchiyama et al. 2002; Rumpf & Jentsch 2006; Wang et al. 2006), nor were other VCP-binding proteins p47 or Ufd1/Npl4 (Kondo et al. 1997; Meyer et al. 2000). When expressed in HEK293T cells, OTULIN and CYLD bound to HOIP WT but not HOIP N84A/Y93A (Fig. 1E). The interaction between the endogenous OTULIN and CYLD, and HOIP was also probed, and both CYLD and OTULIN were detected in anti-HOIP immunoprecipitates from unstimulated mouse embryonic fibroblasts (MEFs) (Fig. 1F, Fig. S2 in the Supporting Information). These results confirmed that both OTULIN and CYLD interact with HOIP. HOIP PUB domain binds to the CYLD C-terminus and the OTULIN N-terminus

As the PUB domain binds to VCP, which can interact with several DUBs (Allen et al. 2006; Zhao et al. 2007; Madsen et al. 2009; Meyer et al. 2012), we first examined whether CYLD interacted with HOIP directly or via VCP using purified proteins. When purified CYLD was incubated with MBP-HOIP 1–299 WT or N84/Y93A bound to maltose–magnetic beads (Matsunaga et al. 2010), CYLD bound to MBP-HOIP 1–299 WT but not to MBP-HOIP N84/Y93A, regardless of the presence or absence of VCP (Fig. 2A, Fig. S3 in the Supporting Information). HOIP 1–299 contains additional regions flanking the PUB domain (residues 51–144). We thus

generated HOIP fragments containing amino acids 1–164 and 165–299 (HOIP 1–164 and 165–299) (Fig. 2B). Co-immunoprecipitation analyses showed that CYLD interacted with HOIP 1–164, but not HOIP 165–299. The N84A/Y93A mutations in HOIP 1–164 abolished the interaction with CYLD (Fig. 2C). Considering that N84 and Y93 are located in the PUB domain, these results strongly suggest that the PUB domain plays the major role in direct binding to CYLD, although an additional involvement of the N-terminal 50 amino acids and/or amino acids 145–164 of HOIP in CYLD binding cannot be formally excluded. Next, the CYLD regions involved in interactions with the PUB domain of HOIP were probed. Co-expression of the truncated CYLD mutants shown in Figure 2D with HOIP 1–299 WT showed that CYLD 782– 952 was sufficient to interact with HOIP (Fig. 2E, lane 4), and an MBP pull-down assay confirmed that CYLD 782–952 bound to HOIP 1–164 directly (Fig. 2F). However, deletion of the C-terminal (CYLD 1–932) or B-box (CYLD D772–851) regions rendered CYLD unable to bind to HOIP (Fig. 2E, lanes 5 and 6). These results indicated that CYLD interacts directly with HOIP via two motifs, the B-box and the C-terminus. The HOIP and OTULIN domains needed for interactions between the two proteins were also probed. OTULIN bound to HOIP 1–164 WT, but not the N84A/Y93A mutant in MBP pull-down assays using purified proteins (Fig. S4 in the Supporting Information). Consistent with a previous report (Rivkin et al. 2013), the N-terminal amino acids 1–105 of OTULIN (OTULIN 1–105 WT) interacted with HOIP 1–164, but not the N84A/Y93A mutant (Fig. 2G,H). The PUB domain of PNGase binds to the C-terminal region of VCP, and Y805 of VCP is critical for this interaction (Zhao et al. 2007). The region encompassing amino acids 50–56 of OTULIN shows significant homology to this C-terminal sequence of VCP. An OTULIN 1–105 mutant (Y56F), in which Tyr56, the amino acid corresponding to Y805 of VCP, was mutated to Phe, failed to bind to HOIP 1–164 (Fig. 2G,I), suggesting that the interaction between OTULIN and HOIP is mediated via the HOIP PUB domain. Binding of the PUB domain to OTULIN or CYLD was specific to the HOIP PUB domain because a PNGase construct that includes the PUB domain (PNGase 1–260) failed to interact with either OTULIN or CYLD. As PNGase 1–260 interacted much more strongly with VCP than HOIP 1–299,

© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

Genes to Cells (2014) 19, 254–272

257

T Takiuchi et al.

(A)

(B)

(C)

(D) (E)

(F)

(G)

(H)

(J)

258

Genes to Cells (2014) 19, 254–272

(I)

(K)

© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

LUBAC suppression by DUBs

the HOIP PUB domain may be unique among the PUB domains in binding selectively to OTULIN or CYLD (Fig. 2J). HOIP 1–164 is involved in the interaction with both CYLD and OTULIN; therefore, we examined whether LUBAC can interact with both DUBs simultaneously. CYLD co-immunoprecipitated with OTULIN in the presence, but not in the absence, of LUBAC (Fig. 2K), which indicates that LUBAC does indeed interact with both CYLD and OTULIN simultaneously. HOIP binding to CYLD and/or OTULIN is involved in suppression of linear ubiquitin chain generation and LUBAC-induced NF-jB activation

To directly examine the production of linear ubiquitin chains by LUBAC containing HOIP WT (LUBAC WT) or N84A/Y93A (LUBAC N84A/Y93A), LUBAC WT or N84A/Y93A was immunoprecipitated from HEK293T cells co-expressing HA-HOIP WT or HA-HOIP N84A/Y93A, together with HOIL-1LMyc and T7-SHARPIN, and subjected to an in vitro ubiquitination assay. As shown in Figure 3A, the levels of the LUBAC subunits in the immunoprecipitates were almost identical and CYLD and OTULIN coimmunoprecipitated with LUBAC WT, but not with the N84A/Y93A mutant. LUBAC N84A/Y93A generated linear ubiquitin chains at a much greater rate than LUBAC WT (Fig. 3B), indicating that the interaction between HOIP and the DUBs, which can

digest linear chains, is involved in the regulation of linear ubiquitin chain generation by LUBAC. We then examined the functional relevance of the binding of HOIP to OTULIN and CYLD. HEK293T cells were co-transfected with a CYLD WT or C597A, an enzymatically inactive mutant, expression plasmid, LUBAC WT or LUBAC N84A/ Y93A expression plasmids, and a 5 9 NF-jB luciferase reporter plasmid (Fig. 3C). In HEK293T cells co-expressing LUBAC WT and CYLD WT, LUBAC-induced NF-jB activation decreased in a dose-dependent manner. By contrast, NF-jB activation was not suppressed in cells co-expressing CYLD WT and LUBAC N84A/Y93A. Moreover, introduction of CYLD C597A augmented LUBACdependent NF-jB activation. The augmentation might be partially due to the competitive binding of CYLD C597A and endogenous CYLD to HOIP, and the DUB activity of CYLD appears involved in the suppression of NF-jB activation (Fig. 3C). Next, OTULIN WT or C129A, an enzymatically inactive mutant, was tested in HEK293T cell co-transfections with LUBAC WT or LUBAC N84A/Y93A and the 5 9 NF-jB luciferase reporter (Fig. 3D). As observed with CYLD, OTULIN WT suppressed LUBAC-mediated NF-jB activation in LUBAC WT-expressing cells in a dose-dependent fashion (Keusekotten et al. 2013; Rivkin et al. 2013). OTULIN WT failed to suppress NF-jB activation in cells expressing LUBAC N84A/Y93A, as observed with

Figure 2 HOIP PUB domain binds to the C-terminal region of CYLD or the N-terminal region of OTULIN. (A) An N-terminal HOIP fragment that includes the PUB domain binds to CYLD in the absence of VCP. Equimolar amounts of MBPHOIP 1–299 WT or MBP-HOIP 1–299 N84A/Y93A prebound to Amylose Magnetic Beads was incubated with recombinant CYLD. CYLD binding to the beads was evaluated by immunoblotting with the indicated antibodies. The input lane was loaded with 20% of the total protein. (B) Schematic representation of HOIP mutants. (C) HOIP 1–164 is sufficient for binding to CYLD. Lysates and anti-HA immunoprecipitates from HEK293T cells transfected with the indicated plasmids were immunoblotted with the indicated antibodies. *nonspecific band. (D) Schematic representation of CYLD WT and mutants. CAP, cytoskeletal-associated protein; USP: ubiquitin-specific protease. (E) CYLD 782–952 is sufficient for binding to HOIP 1–299 WT. HA-CYLD 1–952 (full) or HA-CYLD mutants were co-expressed with FLAG-HOIP 1–299 WT. Cell lysates were treated as in (C). (F) HOIP 1–164 WT, but not HOIP 1–164 N84A/Y93A, directly binds to CYLD 782–952. An equimolar amount of 6xHis-HOIP 1–164 WT or N84A/Y93A was incubated with recombinant MBP-CYLD 782–952 prebound to Amylose Magnetic Beads, and incubated as in (A). The input controls represent 25% of the total protein. (G) Schematic representation of OTULIN WT and mutants. Abbreviation: OTU: ovarian tumor. (H) HOIP 1–164 WT, but not HOIP 1–164 N84A/Y93A, binds to OTULIN 1–105 directly. An equimolar amount of 6xHis-HOIP 1–164 WT or N84A/Y93A was incubated with recombinant MBPOTULIN 1–105 prebound to Amylose Magnetic Beads and incubated as in (A). The input controls represent 25% of the total protein. (I) Y56 of OTULIN is crucial for binding to the PUB domain of HOIP. Lysates of HEK293T cells transfected with the indicated plasmids were treated as in (C). (J) The PUB domain in PNGase does not bind to either CYLD or OTULIN. Schematic representation of HOIP and PNGase mutants (upper panel). FLAG-HOIP 1–299 WT or FLAG-PNGase 1–260 was co-expressed with CYLD (middle panel) or with V5-OTULIN (lower panel) in HEK293T cells. Cell lysates were treated as in (C). *nonspecific band. (K) LUBAC WT interacts with both CYLD and OTULIN simultaneously. Indicated plasmids were transfected in HEK293T cells. Cell lysates were treated as in (C). © 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

Genes to Cells (2014) 19, 254–272

259

T Takiuchi et al. (A)

(B)

(C)

(D)

Figure 3 Interactions between HOIP and CYLD and/or OTULIN mediate suppression of linear ubiquitin chain formation and LUBAC-induced NF-jB activation. (A) The levels of the LUBAC components in the immunoprecipitates were almost identical between LUBAC WT and LUBAC N84A/Y93A lysates. Lysates and anti-HA immunoprecipitates from HEK293T cells transfected with the indicated plasmids were immunoblotted with the indicated antibodies. (B) LUBAC N84A/Y93A generated linear ubiquitin chains more rapidly and to a greater extent than LUBAC WT. The immunoprecipitated LUBAC WT or N84A/Y93A was incubated with E1, UbcH7, ubiquitin, and ATP for the indicated periods, followed by immunoblotting with antilinear polyubiquitin. (C), (D) Both CYLD and OTULIN, dependently of the catalytic activity of the DUBs, suppress LUBAC-mediated NF-jB activation mainly via interaction with the HOIP PUB domain. The luciferase activity of a 59 NF-jB reporter in HEK293T cells expressing either FLAG-CYLD WT or FLAG-CYLD C597A (C) or FLAG-OTULIN WT or FLAG-OTULIN C129A (D), together with HA-HOIP WT or HA-HOIP N84A/Y93A, HOIL-1L-Myc and T7-SHARPIN, was measured. The relative luciferase activities compared with the control (lane 1 or lane 6) are shown as mean  SEM (n = 3 or more). Expression of the LUBAC components and CYLD or OTULIN was assessed by immunoblotting; **P < 0.05, ***P < 0.01 (Student’s t-test).

CYLD although NF-jB activation by LUBAC N84A/Y93A was mildly suppressed in a larger amount of OTULIN. Also, OTULIN C129A failed to inhibit LUBAC WT-induced NF-jB activation, although the NF-jB activity was gently suppressed at the high OTULIN level. This was probably due to that OTULIN C129A bound to linear ubiquitins 260

Genes to Cells (2014) 19, 254–272

with a high affinity and competes with other linear ubiquitin-specific ubiquitin-binding domains required for NF-jB signaling (Keusekotten et al. 2013). Collectively, these results indicate that both CYLD and OTULIN inhibit LUBAC-mediated NF-jB activation via their interaction with HOIP and their DUB activities are involved in the inhibition.

© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

LUBAC suppression by DUBs (A)

(B)

(C)

(D)

(E)

Figure 4 Synergistic effect of CYLD and OTULIN on regulation of linear ubiquitin chain generation by LUBAC. (A) The amount of HOIP in HOIP WT MEFs was similar to that of HOIP N84A/Y93A MEFs. Expression of HOIP, HOIP N84A/ Y93A, HOIL-1L, and SHARPIN in HOIP-null MEFs, HOIP WT MEFs or HOIP N84A/Y93A MEFs was probed with the indicated antibodies. *, nonspecific band. Endogenous HOIP expression by WT MEFs (left lane) is shown for comparison. (B) HOIP WT, but not HOIP N84A/Y93A, bound to endogenous CYLD and OTULIN. Lysates and anti-HA immunoprecipitates from HOIP WT MEFs or HOIP N84A/Y93A MEFs were immunoblotted with the indicated antibodies. (C) Interaction of CYLD or OTULIN with HA-HOIP WT or N84A/Y93A in HOIP WT or N84A/Y93A MEFs treated with indicated siRNAs. HOIP WT MEFs or HOIP N84A/Y93A MEFs were transfected with a nontargeting siRNA (NT), or CYLD, OTULIN, or CYLD and OTULIN siRNAs. Lysates and anti-HA immunoprecipitates from these cells were immunoblotted with the indicated antibodies. (D), (E) Knockdown of both CYLD and OTULIN enhanced in vitro linear ubiquitin chain generation in HOIP WT MEFs. Immunoprecipitated LUBAC WT or N84A/Y93A was incubated with E1, UbcH7, ubiquitin, and ATP for 30 min (D) or for the indicated times (E) followed by immunoblotting with the indicated antibodies.

Synergistic effect of CYLD and OTULIN on the regulation of linear ubiquitin chain generation by LUBAC

To address the involvement of the interactions between HOIP and the two DUBs in the regulation

of linear chain generation in physiological settings, we established MEFs that lack the expression of HOIP. MEF cells established from mice that express a truncated HOIP (HOIP Dlinear) that lacks the C-terminal catalytic region (Fig. S5A, B in Supporting Information) were transfected with shRNAs

© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

Genes to Cells (2014) 19, 254–272

261

T Takiuchi et al.

specific for the N-terminal region of HOIP (Sasaki et al. 2013). These MEFs (HOIP-null MEFs) did not express detectable amounts of HOIP (Fig. S5C in Supporting Information). An shRNA-resistant HAHOIP WT or HA-HOIP N84A/Y93A construct was then retrovirally introduced into the HOIP-null MEFs. HOIP-null MEFs expressing HA-HOIP WT or HA-HOIP N84A/Y93A are referred to as HOIP WT MEFs or HOIP N84A/Y93A MEFs, respectively (Fig. 4A). The amounts of HOIP WT or HOIP N84A/Y93A protein were slightly greater than that of endogenous HOIP levels in WT MEFs. However, the amount of HOIP WT was almost identical to that of HOIP N84A/Y93A, and the amounts of HOIL-1L and SHARPIN were also very similar (Fig. 4A). Co-immunoprecipitation analyses showed that HOIP WT, but not the HOIP N84A/ Y93A mutant, bound to both endogenous CYLD and OTULIN (Fig. 4B). We then examined the involvement of CYLD and OTULIN in linear ubiquitin chain generation by LUBAC WT or LUBAC N84A/Y93A. Both HOIP WT and HOIP N84A/Y93A MEFs were transfected with siRNAs specific for CYLD and/or OTULIN. Expression of CYLD and OTULIN was effectively suppressed by the respective siRNAs (Fig. 4C). In vitro generation of linear ubiquitin chains by LUBAC WT immunopurified from cells, in which expression of either CYLD or OTULIN was suppressed, was slightly greater than that purified

from cells treated with a nonspecific siRNA (Fig. 4D). By contrast, the suppression of both CYLD and OTULIN greatly enhanced the generation of linear ubiquitin chains by LUBAC WT, with the amount of linear ubiquitin chains being comparable with that generated by LUBAC N84A/Y93A (Fig. 4D). The amount of linear ubiquitin chains generated by LUBAC N84A/Y93A was virtually identical regardless of the amount of CYLD and/or OTULIN in the cells from which LUBAC N84A/ Y93A was immunopurified. To confirm that the lack of CYLD and OTULIN accelerates the generation of linear ubiquitin chains by LUBAC, in vitro generation of linear ubiquitin chains by LUBAC WT or LUBAC N84A/Y93A purified from nonspecific siRNA treated cells, or LUBAC WT from CYLD and OTULIN-deficient cells, was examined. Lack of CYLD and OTULIN accelerated the generation of linear ubiquitin chains by LUBAC WT. The LUBAC WT from CYLD and OTULIN-deficient cells generated linear ubiquitin chains at a rate comparable with LUBAC N84A/Y93A (Fig. 4E). Of note, LUBAC WT from CYLD and OTULINdeficient cells and LUBAC N84A/Y93A generated longer chains than LUBAC WT from cells treated with either nonspecific or CYLD or OTULIN-specific siRNAs (Fig. 4D). These results strongly suggest that OTULIN and CYLD are synergistically involved in the regulation of linear ubiquitin chain generation by LUBAC.

Figure 5 Interaction of HOIP with CYLD and/or OTULIN suppresses TNF-a-induced NF-jB activation. (A) Enhanced NFjB activation in HOIP N84A/Y93A MEFs. Lysates and anti-HOIP immunoprecipitates from TNF-a (10 ng/mL)-treated HOIP WT MEFs and HOIP N84A/Y93A MEFs were immunoblotted with the indicated antibodies. (B) Enhanced TNFa-induced phosphorylation of IKK2 and linear ubiquitination of NEMO in HOIP N84A/Y93A MEFs. Lysates and anti-NEMO immunoprecipitates from TNF-a (10 ng/mL)-treated HOIP WT MEFs and HOIP N84A/Y93A MEFs were probed with the indicated antibodies. (C) TNF-a-induced recruitment of HOIP to TNF-RSC was facilitated in HOIP N84A/Y93A MEFs. Lysates and anti-FLAG immunoprecipitates from FLAG-TNF-a (1 lg/mL)-stimulated HOIP WT MEFs and HOIP N84A/Y93A MEFs were probed with the indicated antibodies. (D) TNF-a-induced nuclear translocation of p65 was accelerated in HOIP N84A/Y93A MEFs. HOIP WT MEFs and HOIP N84A/Y93A MEFs were serum starved for 4 h and then treated with TNF-a (10 ng/mL). The amounts of p65 in the cytoplasm and nucleus were analyzed by immunoblotting. Tubulin and lamin B1 were used to confirm the purity and equal loading of the cytosolic and nuclear fractions, respectively. (E) Transcription of NF-jB target genes was enhanced in TNF-a-treated HOIP N84A/Y93A MEFs. HOIP WT MEFs and HOIP N84A/Y93A MEFs were treated with TNF-a (100 ng/mL) for the indicated times. The relative VCAM-1 and IL-6 mRNA expression, normalized to glyceraldehyde 3-phosphate dehydrogenase expression, was measured by quantitative real-time PCR. Expression of VCAM-1 was also assessed by immunoblotting. Data represent the mean  SEM (n = 3); **P < 0.05 (Student’s t-test). (F) Synergistic effect of CYLD and OTULIN on suppression of LUBAC-induced NF-jB activation. The luciferase activity of a 5 9 NF-jB reporter in HEK293T cells expressing either FLAG-CYLD WT and/or FLAG-OTULIN WT, together with HA-HOIP WT, HOIL-1LMyc, and T7-SHARPIN, was measured. Relative luciferase activities compared with the control (lane 1) are shown as mean  SEM (n = 3); **P < 0.05, ***P < 0.01 (Student’s t-test). Expression of the LUBAC components, CYLD, and OTULIN was assessed by immunoblotting.

262

Genes to Cells (2014) 19, 254–272

© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

LUBAC suppression by DUBs (A)

(B)

(C)

(D)

(E)

(F)

© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

Genes to Cells (2014) 19, 254–272

263

T Takiuchi et al.

Interaction of HOIP with CYLD and/or OTULIN suppresses TNF-a-induced NF-jB activation

We next examined the physiological roles of the interactions between HOIP and the two DUBs. Involvement of LUBAC linear ubiquitination in TNF-a-mediated activation of the NF-jB pathway has been well characterized (Tokunaga et al. 2009, 2011; Sasaki et al. 2013). We treated HOIP WT and N84A/Y93A MEFs with TNF-a and examined downstream signaling components. Phosphorylation and degradation of IjBa, which are hallmarks of canonical NF-jB activation, were accelerated in HOIP N84A/Y93A MEFs compared with HOIP WT MEFs (Fig. 5A). TNF-a stimulation did not affect the interaction between HOIP and CYLD or OTULIN (Fig. 5A). LUBAC-mediated linear polyubiquitination is involved in the activation of IKK by phosphorylation of IKK2 (Tokunaga et al. 2009; Sasaki et al. 2013). TNF-a-induced IKK2 phosphorylation was, indeed, enhanced in HOIP N84A/ Y93A MEFs (Fig. 5B). NEMO, the regulatory subunit of the IKK complex, is linearly ubiquitinated by LUBAC upon TNF-a stimulation, and linear ubiquitination of NEMO is suggested to be involved in phosphorylation of IKK2, subsequently leading to NF-jB activation (Tokunaga et al. 2009). Linear polyubiquitination of NEMO was accelerated in HOIP N84A/Y93A MEFs (Fig. 5B). LUBAC’s linear ubiquitination activity may also be involved in the recruitment of LUBAC to the activated TNF receptor I signaling complex (TNF-RSC) (Haas et al. 2009; Gerlach et al. 2011). We evaluated recruitment of LUBAC to TNF-RSC in LUBAC WT and N84A/Y93A cells. As shown in Figure 5C, LUBAC was recruited to TNF-RSC more rapidly in HOIP N84A/Y93A than in HOIP WT MEFs upon TNF-a stimulation. TNF-a-induced nuclear translocation of p65, a subunit of NF-jB, was also accelerated in HOIP N84A/Y93A MEFs (Fig. 5D). Finally, we examined the expression of NF-jB target genes. Transcripts and protein products of NF-jB target genes such as VCAM-1 or IL-6 were more greatly increased in response to TNF-a in HOIP N84A/Y93A MEFs than in WT MEFs (Fig. 5E). These results clearly indicate that the association of the two linear chain-cleaving DUBs with LUBAC via the PUB domain of HOIP is involved in the suppression of TNF-a-mediated NF-jB activation through a down-regulation of linear ubiquitination of LUBAC substrates including NEMO. To address the synergistic roles of CYLD

264

Genes to Cells (2014) 19, 254–272

and OTULIN in NF-jB activation, CYLD WT and/or OTULIN WT were co-expressed in HEK293T cells together with LUBAC WT and the 5 9 NF-jB luciferase reporter. As shown in Figure 5F, introduction of CYLD WT and OTULIN WT synergistically suppressed LUBAC-mediated NF-jB activation. Involvement of the HOIP PUB domain in modulation of the canonical Wnt signaling pathway

Recently, involvement of OTULIN in activation of the canonical Wnt signaling pathway was reported (Rivkin et al. 2013). Canonical Wnt ligands, such as Wnt3a, activate T-cell-specific transcription factor/ lymphoid enhancer factor (TCF/LEF) to induce downstream target gene expression (Yamamoto et al. 2008; Kikuchi et al. 2011). We examined the effects of HOIP binding to OTULIN on canonical Wnt signaling, using TOPFLASH, which contains four TCF-binding sites and a thymidine kinase promoter sequence ligated to a luciferase reporter gene. The luciferase activity of TOPFLASH-expressing cells was strongly induced upon co-expression with LRP6GFP in the presence of Wnt3a-conditioned medium (Fig. S6A in the Supporting Information), but luciferase activity of cells expressing FOPFLASH, which contains mutated TCF-binding sites, was not (Fig. S6B in the Supporting Information). LUBAC suppressed LRP6-induced canonical Wnt signaling, and OTULIN WT mildly enhanced canonical Wnt3a signaling in HEK 293T cells, as observed in a previous report (Fig. 6A,B) (Rivkin et al. 2013). The DUB activity of OTULIN is involved in the enhancement of canonical Wnt signaling (Rivkin et al. 2013), and OTULIN, which can digest linear polyubiquitin chains, binds to LUBAC. Thus, we examined the effect of the PUB domain-mediated interaction between HOIP and OTULIN via the HOIP PUB domain in canonical Wnt3a signaling. LUBAC WT and LUBAC N84A/Y93A each inhibited canonical Wnt3a signaling (Fig. 6A,B). OTULIN WT slightly reversed the LUBAC WT suppression of Wnt3a-dependent activation of TCF/ LEF, as previously reported (Rivkin et al. 2013). However, OTULIN WT failed to effectively reverse the inhibition of Wnt signaling by LUBAC N84A/ Y93A (Fig. 6A,B). FOPFLASH activity was not affected by the introduction of LUBAC or OTULIN (Fig. S6B in Supporting Information). These results

© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

LUBAC suppression by DUBs (A)

(B)

Figure 6 Involvement of the HOIP PUB domain in modulation of the canonical Wnt signaling pathway. (A) Inhibition of Wnt activation mediated by LUBAC WT but not N84A/Y93A in a dose-dependent manner of OTULIN. The luciferase activities of TOPFLASH in HEK293T cells expressing the indicated plasmids are shown as mean  SEM (n = 3) (left panel). Relative luciferase activities compared with controls (lane 4 or lane 8) are shown as mean  SEM (n = 3) (right panel); **P < 0.05, ***P < 0.01 (Student’s t-test). (B) Immunoblots show inputs for the luciferase assays in (A).

suggest that OTULIN can reverse LUBAC-mediated suppression of Wnt signaling via binding the HOIP PUB domain.

Discussion The linear polyubiquitination activity of LUBAC is involved in signal-induced NF-jB activation (Tokunaga et al. 2009). Here, we showed that two DUBs with specificity for linear ubiquitin chains, CYLD and OTULIN, interact with LUBAC via the N-terminal region (1–164) of HOIP via the HOIP PUB domain. Ubiquitin conjugation can modulate the function of target proteins. DUBs are believed to terminate ubiquitination-initiated behaviors by removing the ubiquitin chains from the target proteins (Komander et al. 2009a). LUBAC’s linear chain conjugation activity plays a crucial role in NF-jB activation (Tokunaga et al. 2009). Linear ubiquitin conjugation to NEMO is involved in the activation of IKK, although the precise mechanism underlying IKK activation by linear polyubiquitination of NEMO remains unresolved (Rahighi et al. 2009; Tokunaga et al. 2009). Here, CYLD and OTULIN were shown to synergistically down-regu-

late NF-jB activation by LUBAC, and NEMO was linearly ubiquitinated more efficiently in cells expressing the HOIP N84A/93A mutant than in cells expressing HOIP WT upon TNF-a stimulation. Both LUBAC WT and N84A/Y93A appear to possess almost identical linear polyubiquitin generation activity as WT and the mutant LUBAC purified from cells deficient for CYLD and OTULIN generated the comparable amount of linear chains (Fig. 4D). We have also observed that the catalytic activity of the two DUBs was necessary to suppress LUBAC-induced NFjB activation. Thus, CYLD and/or OTULIN interacted with HOIP is involved in down-regulation of the response stimulated by linear polyubiquitination of proteins by LUBAC mainly by cleaving linear chains. After TNF-a stimulation, linear polyubiquitination of NEMO was more rapid and more extensive in cells expressing HOIP N84A/Y93A than WT. Recruitment of LUBAC to TNF-RSC triggers TNF-a-mediated NF-jB activation, and the linear polyubiquitination activity of LUBAC is involved in the formation of TNF-RSC (Haas et al. 2009). LUBAC N84A/Y93A was recruited to TNF-RSC more rapidly than the LUBAC WT after TNF-a

© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

Genes to Cells (2014) 19, 254–272

265

T Takiuchi et al.

stimulation. As both OTULIN and CYLD interact with HOIP even in unstimulated cells, CYLD and OTULIN may be recruited to TNF-RSC together with LUBAC and may modulate linear polyubiquitin chain conjugation to target proteins, including NEMO, to initiate NF-jB signaling. As linear polyubiquitination of NEMO seems not to be involved in the recruitment of LUBAC, CYLD and OTULIN may suppress TNF-RSC recruitment by cleaving linear polyubiquitin chains conjugated to other LUBAC substrates including components of LUBAC. Thus, both CYLD and OTULIN appear to play a role in fine-tuning the initiation of signaling events that are provoked by LUBAC’s linear polyubiquitination activity by binding to the HOIP PUB domain. The linear polyubiquitination activity of LUBAC per se is not regulated in cells (Emmerich et al. 2013), and thus, the interaction between the two DUBs and LUBAC might be involved in suppression of the linear polyubiquitination activity of LUBAC in the unstimulated condition (Fig. 4D,E). The E3-DUB interaction may be involved in initiating an appropriate level of NF-jB signaling. Although both OTULIN and CYLD suppress NF-jB signaling, they exhibit several differences (Brummelkamp et al. 2003; Kovalenko et al. 2003; Trompouki et al. 2003; Keusekotten et al. 2013; Rivkin et al. 2013). OTULIN expression is not affected by NF-jB (Keusekotten et al. 2013), whereas CYLD expression is induced by NF-jB (Jono et al. 2004), suggesting that the amount of CYLD bound to LUBAC is much lower in unstimulated than in stimulated cells. It is tempting to speculate that OTULIN is the major DUB for suppressing LUBAC activity in unstimulated cells, whereas CYLD synergizes with OTULIN in a negative feedback loop to limit NFjB signaling after stimulation. In other words, OTULIN exhibits a greater ability to repress signal-mediated NF-jB activation than CYLD, and this feature may, at least in part, underlie the phenotypic difference between OTULIN- and CYLD-mutant mice. Mice homozygous for the W96R protease dead mutation in OTULIN are embryonic lethal at E10.5 (Rivkin et al. 2013). By contrast, CYLD-null mice are viable, although the phenotypes vary among different CYLD-null strains (Massoumi 2010; Sun 2010). However, the interaction between CYLD and LUBAC may be involved in the termination of NFjB signaling because CYLD can cleave K63-linked ubiquitin chains in addition to linear chains (Komander et al. 2009b). The ubiquitin ligase activity of cIAPs is required for the recruitment of LUBAC 266

Genes to Cells (2014) 19, 254–272

to TNF-RSC, and cIAPs are known to generate several types of ubiquitin chains including K63 chains (Bertrand et al. 2008; Haas et al. 2009). CYLD might down-regulate NF-jB activation by cleaving the K63/linear hybrid ubiquitin chains, which is suggested to be involved in IKK activation (Emmerich et al. 2013). Further analyses of the interaction between CYLD and HOIP will be needed to clarify the role of CYLD in NF-jB signaling. LUBAC suppresses canonical Wnt signaling, and OTULIN counteracts LUBAC-mediated suppression of Wnt signaling (Rivkin et al. 2013). We have shown here that OTULIN binding to LUBAC reverses the LUBAC-mediated suppression of canonical Wnt activation. CYLD is also a negative regulator of canonical Wnt signaling (Tauriello et al. 2010). However, in our preliminary analyses, CYLD failed to counteract LUBAC-mediated suppression of the Wnt signaling effectively, suggesting that the CYLD-HOIP interaction may not be involved in regulation of Wnt signaling. The N-terminal HOIP PUB domain is involved in HOIP interactions with OTULIN and CYLD. PUB domains are found in several proteins. The PNGase PUB domain interacts with VCP, and residue Y805 of VCP is crucial for this interaction (Allen et al. 2006; Zhao et al. 2007; Madsen et al. 2009). Amino acids 51–56 in OTULIN 1–105 share sequence homology with the C-terminus of VCP. Mutation of the Y56, which corresponds to the PNGase Y805, to Phe in OTULIN 1–105 abolished the interaction with HOIP, indicating that the HOIP PUB domain is crucial for recognition of OTULIN. In the HOIP mutant N84A/Y93A, the PUB domain amino acids corresponding to the amino acids required for the PNGase PUB interaction with VCP have been substituted with Ala. These changes abolished the interaction with CYLD or OTULIN. As the HOIP N84A/Y93A mutant failed to bind to CYLD, CYLD may bind to the PUB domain of HOIP in the same manner as OTULIN. Both the C-terminal and B-box regions of CYLD are necessary for the interaction with HOIP. However, the C-terminus and B-box of CYLD did not show any significant homology to OTULIN 51–56 although several Tyr residues exist in these regions. As both CYLD and OTULIN can associate with the same LUBAC complex, CYLD may bind to the PUB domain of HOIP in a different context from OTULIN. Alternatively, CYLD may bind to HOIP by the same context as OTULIN, and simultaneous binding of both CYLD and OTULIN might be caused by the

© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

LUBAC suppression by DUBs

presence of multiple HOIP in one LUBAC complex (Ikeda et al. 2011; Tokunaga et al. 2011; Walczak 2011). The B-box of CYLD is involved in the cytoplasmic localization of the protein (Komander et al. 2008), suggesting that the HOIP-CYLD interaction may be involved in cytoplasmic retention of the deubiquitinase. Thus, further analyses of the mode of binding between CYLD and the N-terminal region of HOIP will clarify the precise role of the CYLD-HOIP interaction. The HOIP PUB domain can also bind to VCP, but the HOIP PUB domain differs from that of the PNGase PUB domain because PNGase cannot bind to CYLD or OTULIN. Nevertheless, these observations do not exclude the possibility that the interaction between HOIP and VCP may affect both linear ubiquitin chain generation and TNF-a-induced NF-jB activation. However, LUBAC WT purified from cells in which both CYLD and OTULIN were knocked down can bind to VCP, but the linear ubiquitin chain generation was almost identical to LUBAC N84A/ Y93A, which cannot bind to VCP (Fig. 4D,E). These results indicate that VCP seems not to exert a major effect on linear ubiquitin chain generation by LUBAC. VCP has been reported to positively regulate NF-jB activation (Dai et al. 1998; Dai & Li 2001). However, the reported effect of VCP on NF-jB activation seems contradictory to our observation that HOIP N84A/Y93A, which cannot bind to VCP, induces NF-jB activation more efficiently than HOIP WT. Thus, any potential effect of VCP binding to HOIP on linear ubiquitin chain generation and NF-jB activation appears negligible. Taken together, our present results suggest that the interaction between HOIP and OTULIN and/or CYLD optimizes the extent of NF-jB activation by fine-tuning the linear ubiquitin chain generation by LUBAC. The fact that CYLD has been identified as a tumor-suppressor gene product associated with the development of inherited familial cylindromatosis, benign tumors of the skin (Bignell et al. 2000), suggests that E3-DUB interactions may play a role in homeostatic regulation of the extent of signaling responses, including NF-jB activation. Thus, mutations in LUBAC or OTULIN may also play a role in familial tumor syndromes. Moreover, as inhibition of the interaction augments linear polyubiquitination by LUBAC, leading to NF-jB activation, inhibitors of the E3-DUB interaction might be therapeutic agents for the diseases that are provoked by attenuation of NF-jB activation.

Experimental procedures Reagents Anti-CYLD, antiphosphorylated IjBa, anti-IjBa, antiphosphorylated IKK1/2, anti-IKK1/2, and anti-VCP were obtained from Cell Signaling Technology. Anti-CYLD, anti-GFP, antiGST, anti-HA, anti-MBP, anti-NEMO, anti-p65, and antiVCAM-1 were obtained from Santa Cruz Biotechnology. The following antibodies were obtained from the indicated sources: anti-HA, anti-NEMO (MBL); anti-Myc, anti-His (Millipore); anti-TNF Receptor, anti-Lamin B1 (Abcam); anti-T7 (Novagen), anti-V5 (Invitrogen), anti-FLAG (Sigma-Aldrich), anti-FLAG (M2, Stratagene), anti-VCP (BD Biosciences), anti-tubulin (Cedarlane). Monoclonal antibodies against mouse HOIL-1L (2E2) and linear ubiquitin (LUB9), and polyclonal antibodies against mouse HOIP and SHARPIN were described previously (Kirisako et al. 2006; Tokunaga et al. 2009, 2011; Sasaki et al. 2013). Recombinant human TNF-a was purchased from Promega. Wnt3a-conditioned medium was kindly provided by Drs. H. Yamamoto and A. Kikuchi (Osaka University, Osaka, Japan).

Plasmids Open reading frames (ORFs) of mouse CYLD and OTULIN were amplified by RT-PCR. Two-step PCR was used to generate shRNA-resistant cDNAs of mouse HOIP WT or N84A/Y93A and their mutants, including HOIP 1–299 (amino acids 1–299), HOIP 1–164 (amino acids 1–164), and HOIP 165–299 (amino acids 165–299). CYLD C597A, and the CYLD mutants, including CYLD 1–771 (amino acids 1–771), CYLD 1–851 (amino acids 1–851), CYLD 782–952 (amino acids 782–952), CYLD 1–932 (amino acids 1–932), and CYLD D772–851 (amino acids 1–771, 852–952), were generated from the amplified CYLD ORF. OTULIN C129A and the OTULIN truncated mutants, OTULIN 1–105 WT and Y56F, were generated from the amplified OTULIN ORF. PNGase 1–260 (amino acids 1–260) was generated from the amplified PNGase ORF. Other cDNAs used in this study were described previously (Tokunaga et al. 2009, 2011; Kensche et al. 2012). The cDNAs were ligated to the appropriate epitope tag sequences and then cloned into pcDNA3.1, pGEX-6p1 (GE Healthcare), pMAL-c2x (New England Biolabs), pCold ProS2 (Takara), or pMXs-neo (kindly provided by T. Kitamura). TOP-TK-LUC and FOP-TK-LUC were purchased from Upstate. pCS2/LRP6-EGFP was kindly provided by Drs. H. Yamamoto and A. Kikuchi (Osaka University, Osaka, Japan).

Cell lines Primary MEFs were prepared from embryonic day 14 (E14) HOIP neo/neo embryos and their wild-type littermates, and SV40-immortalized as described previously (Tokunaga et al. 2011; Sasaki et al. 2013). To establish HOIP Dlinear MEFs, Cre recombinase was transfected into immortalized HOIP neo/neo

© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

Genes to Cells (2014) 19, 254–272

267

T Takiuchi et al. MEFs (Yamamoto et al. 2006; Sasaki et al. 2013). To establish HOIP-null MEFs, both a shRNA plasmid for HOIP Dlinear knockdown and a plasmid for hygromycin resistance were transfected with FuGENE HD (Promega) into HOIP Dlinear MEFs. After 48 h, the medium was changed to fresh medium containing 200 lg/mL of hygromycin B (Wako) for selection. To establish HOIP WT and HOIP N84A/Y93A MEFs, mouse HA-HOIP WT and HA-HOIP N84A/Y93A cDNAs were cloned into the pMXs-neo vector for retroviral expression. Retroviral packaging was carried out by transfection of Plat-E cells with the plasmids using FuGENE HD. After 48 h, retroviral supernatants were collected and used to infect HOIP-null MEFs in the presence of 10 lg/mL polybrene (Millipore). After 24 h, the medium was changed to fresh medium containing 400 lg/mL G418 for selection. The sequence of the shRNA used for the HOIP Dlinear knockdown was 5′-GATCCCCG GAGATAGCTCTCTTTCTTCCGTGTGCTGTCCGGAAG AAAGAGAGCTATCTCCTTTTTGGAAA-3′. Bal17.2 cells were co-transfected with 3xFLAG-3xHA HOIP 1–299 WT or 3xFLAG-3xHA HOIP1–299 N84A/Y93A and a plasmid for puromycin resistance by electroporation (300V, 500 lF) using the Gene Pulser II (Bio-Rad) and were selected with 0.4 lg/mL puromycin (Sigma-Aldrich).

Cell cultures and transfection HEK293T cells, HOIP-null MEFs, HOIP Dlinear MEFs, HOIP WT MEFs, and HOIP N84A/Y93A MEFs were grown in DMEM (Sigma-Aldrich) containing 10% fetal bovine serum, 100 IU/mL penicillin, and 100 lg/mL streptomycin. Bal17.2 cells were grown in RPMI (Sigma-Aldrich) containing 10% fetal bovine serum, 50 lM 2-mercaptoethanol, 100 IU/mL penicillin, and 100 lg/mL streptomycin. Plasmids were transfected in HEK293T cells using Lipofectoamine 2000 (Invitrogen) for 48 h.

Tandem affinity purification Bal17.2 cells were lysed in buffer containing 50 mM Tris–HCl (pH 7.5), 150 mM NaCl, 1% Triton X-100, 2 mM PMSF, and a protease inhibitor cocktail (Sigma-Aldrich) on ice for 20 min. The lysates were centrifuged at 20 000 9 g at 4 °C for 40 min, and supernatants were precipitated with Protein G Dynabeads (Invitrogen) preincubated with a FLAG antibody at 4 °C for 60 min. The beads were washed eight times with 1% lysis buffer and eluted with 3 9 FLAG peptides (SigmaAldrich). The eluates were incubated with anti-HA resin (Sigma-Aldrich) at 4 °C for 2 h. The resin was washed four times with Tris-buffered saline (TBS) (Sigma-Aldrich) and eluted with HA peptide (Sigma-Aldrich).

Mass spectrometric analysis The purified proteins were precipitated with five volumes of cold acetone and dissolved in 50 mL of 0.2% RapiGest SF (Waters) in 50 mM ammonium bicarbonate. After denatur-

268

Genes to Cells (2014) 19, 254–272

ation by incubating 10 min at 70 °C, the proteins were digested with 500 ng of trypsin (Promega) for 16 h at 37 °C. Digests were quenched by addition of 50 mL of 50% acetonitrile (ACN)/0.5% trifluoroacetic acid (TFA) for 1 h at 37 °C. After centrifugation, the resultant peptides were desalted using a C18 Stage-Tip (Thermo Fisher Scientific) and resuspended in 0.1% TFA. Shotgun proteomic analysis was conducted using a nano-liquid chromatography (easy nLC 1000, Thermo Fisher Scientific) column coupled to a Q Exactive mass spectrometer (Thermo Fisher Scientific). Reversed-phase chromatography was carried out using the Thermo easy-nLC 1000 with a binary buffer system consisting of 0.1% formic acid (FA) (solvent A) and 100% ACN/ 0.1% FA (solvent B) with a flow rate of 300 nL/min. The peptides were directly loaded on a reverse-phase column (75 lm inner diameter 9 120 mm length, 3 lm C18 Reprosil-Pur, Nikkyo Technos Co. Ltd) and separated using a 140 min 2-step gradient (0–40% solvent A for 120 min, followed by 40–100% solvent B for 20 min). The Q Exactive was operated in the data-dependent mode, using the Xcalibur software, with survey scans acquired at a resolution of 70 000 at m/z 200. Up to the top 10, most abundant isotope patterns with charge 2–5 from the survey scan were selected with an isolation window of 1.5 Th and fragmented by HCD with normalized collision energies of 28. The maximum ion injection times for the survey scan and the MS/MS scans were 60 ms, and the ion target values were set to 3e6 and 1e6, respectively. Raw files were searched by the Protein Discoverer software (version 1.3; Thermo Fisher Scientific) using the MASCOT search engine against the Swiss-Prot database (version 2012_10 of UniProtKB/Swiss-Prot protein database). The precursor and fragment mass tolerances were set to 10 ppm and 20 mmu, respectively. Methionine oxidation, protein amino-terminal acetylation, pyroglutamate formation, serine/threonine phosphorylation, tyrosine phosphorylation, and diglycine modification of lysine side chains were set as variable modifications for database searching. Peptide identification was filtered at 1% false discovery rate.

Generation of an anti-OTULIN polyclonal antibody MBP-mouse OTULIN was expressed in Escherichia coli (E. coli) and then purified using amylose resin (New England Biolabs). The purified recombinant fusion protein was used to immunize rabbits. Affinity-purified anti-OTULIN IgG was prepared from antisera using Protein A Sepharose (GE Healthcare) followed by affinity chromatography using immobilized recombinant GST-OTULIN NHS-activated Sepharose (GE Healthcare).

Immunoprecipitation, immunoblotting, in vitro ubiquitination, and in vitro deubiquitination assays Cells were lysed with buffer containing 50 mM Tris–HCl (pH 7.5), 150 mM NaCl, 1% Triton X-100, 2 mM PMSF, and a

© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

LUBAC suppression by DUBs protease inhibitor cocktail. For immunoprecipitations, lysates were incubated with the appropriate antibodies at 4 °C for 2 h and then immobilized on Protein A Sepharose (GE Healthcare) at 4 °C for 45 min. The beads were washed four times with buffer containing 50 mM Tris–HCl (pH 7.5), 150 mM NaCl, and 1% Triton X-100 and boiled in SDS sample buffer. To perform in vitro ubiquitination assays, anti-HA immunoprecipitates from HA-HOIP WT or N84A/Y93Aexpressing cells were washed twice with buffer containing 50 mM Tris–HCl (pH 7.5), 150 mM NaCl, and 1% Triton X100, followed by two washes with 20 mM Tris–HCl (pH 7.5), and then incubated with 5 lg/mL E1, 10 lg/mL UbcH7, 250 lg/mL ubiquitin, and 2 mM ATP for the indicated times at 37 °C in a reaction buffer containing 20 mM Tris–HCl (pH 7.5), 5 mM MgCl2, and 0.5 mM DTT. To perform in vitro deubiquitination assays, anti-HA immunoprecipitates from HAHOIP WT or N84A/Y93A-expressing cells were washed three times with buffer containing 50 mM Tris–HCl (pH 7.5), 150 mM NaCl, and 1% Triton X-100, followed by two washes with 50 mM Tris–HCl (pH 7.5), and then incubated with 0.5 lg/mL GST-linear tri-ubiquitin for 20 min at 37 °C in a reaction buffer containing 50 mM Tris–HCl (pH 7.5) and 1 mM DTT. Samples were separated by SDS-PAGE and then transferred to PVDF membranes. After blocking in TBS containing 0.1% Tween-20 and 5% (w/v) nonfat dry milk, the membrane was incubated with the appropriate primary antibodies, followed by incubation with secondary antibodies. The membranes were visualized using enhanced chemiluminescence and analyzed on an LAS3000 or LAS4000mini (Fuji Film).

Recombinant protein expression and purification GST-fused linear tri-ubiquitin, His-fused mouse HOIP (amino acids 1–164), MBP-fused mouse HOIP (1–299), MBP-fused mouse CYLD (782–952), MBP-fused mouse OTULIN (full length), MBP-fused mouse OTULIN (1–105), and mutants derived from the fusion proteins were expressed in E. coli. Fusion proteins were purified using glutathioneSepharose (GE Healthcare) (GST-linear tri-ubiquitin), Ni-NTA agarose (Qiagen) (His-HOIP and derivatives), or amylose resin (MBP-HOIP, MBP-CYLD, MBP-OTULIN and derivatives) using standard laboratory protocols as described previously (Tokunaga et al. 2009, 2011). Recombinant E1 and UbcH7 were prepared as described (Kirisako et al. 2006; Tokunaga et al. 2009). Human VCP was expressed in bacteria and purified exactly as described (Fernandez-Saiz & Buchberger 2010). Cell-free synthesis and BISOP purification of CYLD was conducted as described previously (Matsunaga et al. 2010). The cDNA clone of CYLD was subcloned into the pEUbls-SrtA-MCS vector using the SpeI and NotI sites. The SrtA cleavage sequence (LPETG, ctg ccc gag acc ggc) was inserted upstream of the start codon of the CYLD ORF. In vitro transcription was conducted using the resultant plasmid as template. In vitro translation and biotinylation was

carried out using the WEPRO1240 wheat germ extract (CellFree Sciences) according to the manufacturer’s instructions. For biotinylation of the synthesized protein, biotin protein ligase (BirA, GenBank accession no. NP_0312927) produced by wheat cell-free system was added into the translation reaction with 0.5 lM biotin. The synthesized blsSrtA-fusion CYLD (36 mL) was mixed with 300 lL of Streptavidin Sepharose High Performance (GE Healthcare) and incubated for 1 h at 4 °C with gentle rotation. Sepharose bead-captured bls-srtA-fusion CYLD was collected by centrifugation at 3000 9 g and 4 °C for 1 min, and the beads were washed five times with the buffer containing 20 mM Hepes-NaOH, pH 7.4, 150 mM NaCl, and 1 mM DTT. Self-cleavage of SrtA was conducted by incubation in elution buffer (20 mM Hepes-NaOH, pH 7.4, 150 mM NaCl, 2% glycerol, 5 mM CaCl2, 5 mM triglycine, 1 mM DTT) for 3 h at 16 °C. The mixture was transferred into a microspin column, and cleaved CYLD was collected by centrifugation at 3000 9 g and 4 °C, for 1 min.

MBP pull-down assays MBP-HOIP proteins (5 lg, for each of the indicated proteins) were prebound to Amylose Magnetic Beads (New England Biolabs) and then incubated with 0.3 lg of the indicated CYLD protein in the presence or absence of 0.5 lg VCP at 4 °C for 1 h in a buffer containing 20 mM Tris–HCl (pH 7.5), 150 mM NaCl, and 0.1% Triton X-100. The beads were washed six times with buffer containing 50 mM Tris–HCl (pH 7.5), 150 mM NaCl, 1% Triton X-100 and then boiled in SDS sample buffer. To probe direct interactions between HOIP and CYLD or OTULIN, 500 ng of MBP-CYLD or MBP-OTULIN prebound to Amylose Magnetic Beads was incubated with 100 ng of 6xHis-HOIP constructs at 4 °C for 1 h in the buffer containing 20 mM Tris–HCl (pH 7.5), 150 mM NaCl, 0.1% Triton X-100. The beads were washed and eluted described as above.

RNAi For transient silencing of CYLD and OTULIN, smart-pool siRNAs against CYLD or OTULIN, or a control siRNA (Dharmacon) were transfected into immortalized MEF lines according to the manufacturer’s instructions using Lipofectamine RNAiMAX (Invitrogen).

TNF-a stimulation MEFs were stimulated with the indicated concentrations of TNF-a and lysed in buffer containing 50 mM Tris–HCl, pH 7.5, 150 mM NaCl, 1% Triton X-100, 2 mM PMSF, a protease inhibitor cocktail, and a phosphatase inhibitor cocktail (Sigma-Aldrich). The lysates were incubated on ice for 20 min. After centrifugation at 20 000 9 g at 4 °C for 20 min, the supernatants were collected.

© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

Genes to Cells (2014) 19, 254–272

269

T Takiuchi et al.

Precipitation of TNF-RSC

References

For TNF-RSC precipitation, MEFs were stimulated with 1 lg/mL of FLAG–mTNF-a (Enzo Lifescience) for the indicated periods, and cells were lysed in buffer containing 20 mM Tris–HCl, pH 7.4, 150 mM NaCl, 10% glycerol, 0.2% NP-40, 2 mM PMSF, a protease inhibitor cocktail, and a phosphatase inhibitor cocktail on ice for 10 min. The lysates were centrifuged at 10 000 9 g for 10 min, and the supernatants were precipitated using Dynabeads (Invitrogen) preincubated with the anti-FLAG M2 antibody for 75 min. The beads were washed five times with the lysis buffer and eluted with 3 9 FLAG peptides. The eluates were separated by SDSPAGE and analyzed by immunoblotting.

Allen, M.D., Buchberger, A. & Bycroft, M. (2006) The PUB domain functions as a p97 binding module in human peptide N-glycanase. J. Biol. Chem. 281, 25502–25508. Ben-Neriah, Y. & Karin, M. (2011) Inflammation meets cancer, with NF-jB as the matchmaker. Nat. Immunol. 12, 715–723. Bertrand, M.J., Milutinovic, S., Dickson, K.M., Ho, W.C., Boudreault, A., Durkin, J., Gillard, J.W., Jaquith, J.B., Morris, S.J. & Barker, P.A. (2008) cIAP1 and cIAP2 facilitate cancer cell survival by functioning as E3 ligases that promote RIP1 ubiquitination. Mol. Cell 30, 689–700. Bignell, G.R., Warren, W., Seal, S. et al. (2000) Identification of the familial cylindromatosis tumour-suppressor gene. Nat. Genet. 25, 160–165. Brummelkamp, T.R., Nijman, S.M., Dirac, A.M. & Bernards, R. (2003) Loss of the cylindromatosis tumour suppressor inhibits apoptosis by activating NF-jB. Nature 424, 797–801. Buchberger, A. (2010) Control of ubiquitin conjugation by cdc48 and its cofactors. Subcell. Biochem. 54, 17–30. Dai, R.M., Chen, E., Longo, D.L., Gorbea, C.M. & Li, C.C. (1998) Involvement of valosin-containing protein, an ATPase Co-purified with IjBa and 26 S proteasome, in ubiquitin-proteasome-mediated degradation of IjBa. J. Biol. Chem. 273, 3562–3573. Dai, R.M. & Li, C.C. (2001) Valosin-containing protein is a multi-ubiquitin chain-targeting factor required in ubiquitin-proteasome degradation. Nat. Cell Biol. 3, 740–744. Doerks, T., Copley, R.R., Schultz, J., Ponting, C.P. & Bork, P. (2002) Systematic identification of novel protein domain families associated with nuclear functions. Genome Res. 12, 47–56. Emmerich, C.H., Ordureau, A., Strickson, S., Arthur, J.S., Pedrioli, P.G., Komander, D. & Cohen, P. (2013) Activation of the canonical IKK complex by K63/M1-linked hybrid ubiquitin chains. Proc. Natl Acad. Sci. USA 110, 15247–15252. Fernandez-Saiz, V. & Buchberger, A. (2010) Imbalances in p97 co-factor interactions in human proteinopathy. EMBO Rep. 11, 479–485. Gerlach, B., Cordier, S.M., Schmukle, A.C. et al. (2011) Linear ubiquitination prevents inflammation and regulates immune signalling. Nature 471, 591–596. Haas, T.L., Emmerich, C.H., Gerlach, B., Schmukle, A.C., Cordier, S.M., Rieser, E., Feltham, R., Vince, J., Warnken, U., Wenger, T., Koschny, R., Komander, D., Silke, J. & Walczak, H. (2009) Recruitment of the linear ubiquitin chain assembly complex stabilizes the TNF-R1 signaling complex and is required for TNF-mediated gene induction. Mol. Cell 36, 831–844. Hershko, A. & Ciechanover, A. (1998) The ubiquitin system. Annu. Rev. Biochem. 67, 425–479. Ikeda, F., Deribe, Y.L., Skanland, S.S. et al. (2011) SHARPIN forms a linear ubiquitin ligase complex regulating NF-jB activity and apoptosis. Nature 471, 637–641.

Real-time PCR Total RNA was isolated using RNeasy Mini kits with DNase treatment (Qiagen) and reverse-transcribed to cDNA using a High Capacity RNA-to-cDNA kit (Applied Biosystems). Real-time PCR was carried out using Taqman universal PCR master mix (Applied Biosystems) in Applied Biosystemsâ ViiATM 7 (Applied Biosystems). The DDCt method was used for relative quantification, and the level of mRNA expression was normalized to glyceraldehyde3-phosphate dehydrogenase (GAPDH) expression in each sample.

Luciferase assays For the measurement of NF-jB activation, HEK293T cells were co-transfected with pGL4.32 (Luc2p/NF-jB–RE/ Hygro) and pGL4.74 (hRLuc/TK) (Promega), together with various expression plasmids. At 24 h post-transfection, cells were lysed, and luciferase activities were measured on a Lumat Luminometer (Berthold) using the Dual-Luciferase reporter assay system (Promega). For TCF/LEF activation, HEK293T cells were co-transfected with TOP-TK-LUC or FOP-TKLUC and pGL4.74 (hRLuc/TK), together with various expression constructs. At 24 h post-transfection, cells were stimulated for 8 h with Wnt3a-conditioned or control medium and lysed. Luciferase activities were measured as described above. None of the constructs activated the FOPFLASH reporters. At least three independent experiments were carried out with samples for each construct.

Statistical analysis The data were expressed as the mean  SD and were evaluated by Student’s t-test for unpaired and paired data.

Acknowledgements We thank Dr H. Yamamoto and Dr A. Kikuchi for providing Wnt3a CM and Dr T. Kitamura for providing pMX-IP.

270

Genes to Cells (2014) 19, 254–272

© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

LUBAC suppression by DUBs Iwai, K. (2012) Diverse ubiquitin signaling in NF-jB activation. Trends Cell Biol. 22, 355–364. Jono, H., Lim, J.H., Chen, L.F., Xu, H., Trompouki, E., Pan, Z.K., Mosialos, G. & Li, J.D. (2004) NF-jB is essential for induction of CYLD, the negative regulator of NF-jB: evidence for a novel inducible autoregulatory feedback pathway. J. Biol. Chem. 279, 36171–36174. Kensche, T., Tokunaga, F., Ikeda, F., Goto, E., Iwai, K. & Dikic, I. (2012) Analysis of nuclear factor-jB (NF-jB) essential modulator (NEMO) binding to linear and lysine-linked ubiquitin chains and its role in the activation of NF-jB. J. Biol. Chem. 287, 23626–23634. Keusekotten, K., Elliott, P.R., Glockner, L., Fiil, B.K., Damgaard, R.B., Kulathu, Y., Wauer, T., Hospenthal, M.K., Gyrd-Hansen, M., Krappmann, D., Hofmann, K. & Komander, D. (2013) OTULIN antagonizes LUBAC signaling by specifically hydrolyzing Met1-linked polyubiquitin. Cell 153, 1312–1326. Kikuchi, A., Yamamoto, H., Sato, A. & Matsumoto, S. (2011) New insights into the mechanism of Wnt signaling pathway activation. Int. Rev. Cell Mol. Biol. 291, 21–71. Kirisako, T., Kamei, K., Murata, S., Kato, M., Fukumoto, H., Kanie, M., Sano, S., Tokunaga, F., Tanaka, K. & Iwai, K. (2006) A ubiquitin ligase complex assembles linear polyubiquitin chains. EMBO J. 25, 4877–4887. Komander, D., Clague, M.J. & Urbe, S. (2009a) Breaking the chains: structure and function of the deubiquitinases. Nat. Rev. Mol. Cell Biol. 10, 550–563. Komander, D., Lord, C.J., Scheel, H., Swift, S., Hofmann, K., Ashworth, A. & Barford, D. (2008) The structure of the CYLD USP domain explains its specificity for Lys63-linked polyubiquitin and reveals a B box module. Mol. Cell 29, 451–464. Komander, D., Reyes-Turcu, F., Licchesi, J.D., Odenwaelder, P., Wilkinson, K.D. & Barford, D. (2009b) Molecular discrimination of structurally equivalent Lys 63-linked and linear polyubiquitin chains. EMBO Rep. 10, 466–473. Kondo, H., Rabouille, C., Newman, R., Levine, T.P., Pappin, D., Freemont, P. & Warren, G. (1997) p47 is a cofactor for p97-mediated membrane fusion. Nature 388, 75–78. Kornitzer, D. & Ciechanover, A. (2000) Modes of regulation of ubiquitin-mediated protein degradation. J. Cell. Physiol. 182, 1–11. Kovalenko, A., Chable-Bessia, C., Cantarella, G., Israel, A., Wallach, D. & Courtois, G. (2003) The tumour suppressor CYLD negatively regulates NF-jB signalling by deubiquitination. Nature 424, 801–805. Madsen, L., Seeger, M., Semple, C.A. & Hartmann-Petersen, R. (2009) New ATPase regulators–p97 goes to the PUB. Int. J. Biochem. Cell Biol. 41, 2380–2388. Massoumi, R. (2010) Ubiquitin chain cleavage: CYLD at work. Trends Biochem. Sci. 35, 392–399. Matsunaga, S., Matsuoka, K., Shimizu, K., Endo, Y. & Sawasaki, T. (2010) Biotinylated-sortase self-cleavage purification (BISOP) method for cell-free produced proteins. BMC Biotechnol. 10, 42.

Meyer, H., Bug, M. & Bremer, S. (2012) Emerging functions of the VCP/p97 AAA-ATPase in the ubiquitin system. Nat. Cell Biol. 14, 117–123. Meyer, H.H., Shorter, J.G., Seemann, J., Pappin, D. & Warren, G. (2000) A complex of mammalian ufd1 and npl4 links the AAA-ATPase, p97, to ubiquitin and nuclear transport pathways. EMBO J. 19, 2181–2192. Pasparakis, M. (2009) Regulation of tissue homeostasis by NF-jB signalling: implications for inflammatory diseases. Nat. Rev. Immunol. 9, 778–788. Peng, J., Schwartz, D., Elias, J.E., Thoreen, C.C., Cheng, D., Marsischky, G., Roelofs, J., Finley, D. & Gygi, S.P. (2003) A proteomics approach to understanding protein ubiquitination. Nat. Biotechnol. 21, 921–926. Rahighi, S., Ikeda, F., Kawasaki, M., Akutsu, M., Suzuki, N., Kato, R., Kensche, T., Uejima, T., Bloor, S., Komander, D., Randow, F., Wakatsuki, S. & Dikic, I. (2009) Specific recognition of linear ubiquitin chains by NEMO is important for NF-jB activation. Cell 136, 1098–1109. Rivkin, E., Almeida, S.M., Ceccarelli, D.F., Juang, Y.C., MacLean, T.A., Srikumar, T., Huang, H., Dunham, W.H., Fukumura, R., Xie, G., Gondo, Y., Raught, B., Gingras, A.C., Sicheri, F. & Cordes, S.P. (2013) The linear ubiquitin-specific deubiquitinase gumby regulates angiogenesis. Nature 498, 318–324. Rumpf, S. & Jentsch, S. (2006) Functional division of substrate processing cofactors of the ubiquitin-selective Cdc48 chaperone. Mol. Cell 21, 261–269. Sasaki, Y., Sano, S., Nakahara, M., Murata, S., Kometani, K., Aiba, Y., Sakamoto, S., Watanabe, Y., Tanaka, K., Kurosaki, T. & Iwai, K. (2013) Defective immune responses in mice lacking LUBAC-mediated linear ubiquitination in B cells. EMBO J. 32, 2463–2476. Sun, S.C. (2010) CYLD: a tumor suppressor deubiquitinase regulating NF-jB activation and diverse biological processes. Cell Death Differ. 17, 25–34. Suzuki, T., Park, H., Till, E.A. & Lennarz, W.J. (2001) The PUB domain: a putative protein-protein interaction domain implicated in the ubiquitin-proteasome pathway. Biochem. Biophys. Res. Commun. 287, 1083–1087. Tauriello, D.V., Haegebarth, A., Kuper, I., Edelmann, M.J., Henraat, M., Canninga-van Dijk, M.R., Kessler, B.M., Clevers, H. & Maurice, M.M. (2010) Loss of the tumor suppressor CYLD enhances Wnt/beta-catenin signaling through K63-linked ubiquitination of Dvl. Mol. Cell 37, 607–619. Tokunaga, F. (2013) Linear ubiquitination-mediated NF-jB regulation and its related disorders. J. Biochem. 154, 313–323. Tokunaga, F., Nakagawa, T., Nakahara, M., Saeki, Y., Taniguchi, M., Sakata, S., Tanaka, K., Nakano, H. & Iwai, K. (2011) SHARPIN is a component of the NF-jB-activating linear ubiquitin chain assembly complex. Nature 471, 633– 636. Tokunaga, F., Nishimasu, H., Ishitani, R., Goto, E., Noguchi, T., Mio, K., Kamei, K., Ma, A., Iwai, K. & Nureki, O. (2012) Specific recognition of linear polyubiquitin by A20

© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd

Genes to Cells (2014) 19, 254–272

271

T Takiuchi et al. zinc finger 7 is involved in NF-jB regulation. EMBO J. 31, 3856–3870. Tokunaga, F., Sakata, S., Saeki, Y., Satomi, Y., Kirisako, T., Kamei, K., Nakagawa, T., Kato, M., Murata, S., Yamaoka, S., Yamamoto, M., Akira, S., Takao, T., Tanaka, K. & Iwai, K. (2009) Involvement of linear polyubiquitylation of NEMO in NF-jB activation. Nat. Cell Biol. 11, 123–132. Trompouki, E., Hatzivassiliou, E., Tsichritzis, T., Farmer, H., Ashworth, A. & Mosialos, G. (2003) CYLD is a deubiquitinating enzyme that negatively regulates NF-jB activation by TNFR family members. Nature 424, 793–796. Uchiyama, K., Jokitalo, E., Kano, F., Murata, M., Zhang, X., Canas, B., Newman, R., Rabouille, C., Pappin, D., Freemont, P. & Kondo, H. (2002) VCIP135, a novel essential factor for p97/p47-mediated membrane fusion, is required for Golgi and ER assembly in vivo. J. Cell Biol. 159, 855–866. Vallabhapurapu, S. & Karin, M. (2009) Regulation and function of NF-jB transcription factors in the immune system. Annu. Rev. Immunol. 27, 693–733. Walczak, H. (2011) TNF and ubiquitin at the crossroads of gene activation, cell death, inflammation, and cancer. Immunol. Rev. 244, 9–28. Wang, Q., Li, L. & Ye, Y. (2006) Regulation of retrotranslocation by p97-associated deubiquitinating enzyme ataxin-3. J. Cell Biol. 174, 963–971. Yamamoto, H., Sakane, H., Michiue, T. & Kikuchi, A. (2008) Wnt3a and Dkk1 regulate distinct internalization pathways of LRP6 to tune the activation of beta-catenin signaling. Dev. Cell 15, 37–48. Yamamoto, M., Okamoto, T., Takeda, K., Sato, S., Sanjo, H., Uematsu, S., Saitoh, T., Yamamoto, N., Sakurai, H., Ishii, K.J., Yamaoka, S., Kawai, T., Matsuura, Y., Takeuchi, O. & Akira, S. (2006) Key function for the Ubc13 E2 ubiquitin-conjugating enzyme in immune receptor signaling. Nat. Immunol. 7, 962–970. Yeung, H.O., Kloppsteck, P., Niwa, H., Isaacson, R.L., Matthews, S., Zhang, X. & Freemont, P.S. (2008) Insights

272

Genes to Cells (2014) 19, 254–272

into adaptor binding to the AAA protein p97. Biochem. Soc. Trans. 36, 62–67. Zhao, G., Zhou, X., Wang, L., Li, G., Schindelin, H. & Lennarz, W.J. (2007) Studies on peptide:N-glycanase-p97 interaction suggest that p97 phosphorylation modulates endoplasmic reticulum-associated degradation. Proc. Natl Acad. Sci. USA 104, 8785–8790. Received: 20 November 2013 Accepted: 2 December 2013

Supporting Information Additional Supporting Information may be found in the online version of this article at the publisher’s web site: Figure S1 Expression of 3xFLAG-3xHA-tagged HOIP 1–299 in Bal17.2 cells and scheme of TAP-MS. Figure S2 Specificity of anti-OTULIN serum. Figure S3 The PUB domain in HOIP binds to CYLD in the presence of VCP. Figure S4 HOIP 1–164 WT, but not HOIP 1–164 N84A/ Y93A, binds to OTULIN. Figure S5 HOIP-null MEFs did not express detectable amounts of HOIP. Figure S6 The TOPFLASH reporter was strongly transcribed upon co-expression with LRP6-EGFP in the presence of Wnt3a-conditioned medium, but the FOPFLASH reporter was not. Table S1 Identification of CYLD and OTULIN as proteins in the HOIP 1–299 WT interactome Table S2 Identified peptides by MS

© 2014 The Authors Genes to Cells © 2014 by the Molecular Biology Society of Japan and Wiley Publishing Asia Pty Ltd