Suppression of stromal interaction molecule 1 inhibits SMMC7721 hepatocellular carcinoma cell proliferation by inducing cell cycle arrest
Zhengshan Wu Jiangjie Qing Yongxiang Xia ∗ Ke Wang ∗ Feng Zhang
The Liver Transplantation Center, the First Affiliated Hospital of Nanjing Medical University, Nanjing, People’s Republic of China
Abstract Stromal interaction molecule 1 (STIM1), an endoplasmic reticulum luminal Ca2+ sensor, activates Ca2+ -release-activated Ca2+ channels and migrates from the Ca2+ store to the plasma membrane. Recently, STIM1 was shown be critical for the progression of several cancers, including breast cancer and cervical cancer. However, its role in hepatocellular carcinoma has remained unknown. The current study was aimed to evaluate the effect of STIM1 on the growth of hepatocellular cancer. Lentivirus-mediated short hairpin RNA targeting STIM1 was transduced into SMMC7721
cells to knock down STIM1 expression. Knockdown of STIM1 significantly inhibited cell proliferation and colony-forming ability and arrested the cell cycle at the G0/G1 phase. Moreover, the DNA synthesis progression was also decreased. Furthermore, lentiviral vector-mediated overexpression of STIM1 promoted the proliferation of SMMC7721 cells. Our findings suggest that STIM1 may play an important role in the development of hepatocellular cancer and may be a potential C 2014 International Union of Biochemistry and target for therapy. Molecular Biology, Inc. Volume 62, Number 1, Pages 107–111, 2015
Keywords: STIM1, lentivirus, hepatocellular carcinoma, proliferation, cell cycle
1. Introduction Hepatocellular carcinoma (HCC) is one of the most common malignancies in the world. Chronic hepatitis B virus infection greatly increases the risk of liver cirrhosis and HCC. In addition to hepatitis-B-virus-related factors, development of HCC is considered to be a multistep biological process including
Abbreviations: BrdU, bromodeoxyuridine; ER, endoplasmic reticulum; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GFP, green fluorescent protein; HCC, hepatocellular carcinoma; MTT, methylthiazoletetrazolium; RNAi, RNA interference; shRNA, short hairpin RNA; siRNA, small interfering RNA; SOCE, store-operated Ca2+ entry; STIM, stromal interaction molecule. ∗ Address for correspondence: Feng Zhang, PhD, and Ke Wang, PhD, The Liver Transplantation Center, The First Affiliated Hospital of Nanjing Medical University, Nanjing 210029, People’s Republic of China. Tel.: +86 21 34692656; Fax: +86 21 34692656; e-mails:[email protected] and [email protected].
No benefits in any form have been received or will be received from a commercial party related directly or indirectly to the subject of this article. Supporting Information is available in the online issue at wileyonlinelibrary.com. Received 4 January 2014; accepted 13 May 2014 DOI: 10.1002/bab.1245 Published online 15 December 2014 in Wiley Online Library (wileyonlinelibrary.com)
uncontrolled cellular proliferation, detachment from the extracellular matrix, and invasion into the surrounding tissue. Despite a recent improvement in long-term survival rates, the prognosis of HCC is still poor because of the high rate of relapse and metastasis [1–4]. New molecular targets and therapeutic strategies are needed for the prevention and treatment of HCC. However, the mechanism of hepatocarcinogenesis remains incomplete. Stromal interaction molecules (STIMs) were identified as the endoplasmic reticulum (ER) Ca2+ sensor controlling store-operated Ca2+ entry (SOCE) and Ca2+ -release-activated Ca2+ channels in nonexcitable cells[5]. STIM1 is predominantly located in the ER lumina, the main intracellular Ca2+ store [6, 7]. Upon Ca2+ store depletion, STIM1 translocates into ER–plasma membrane junctions and couples to activate Orai1 [8] and possibly transient receptor potential channels [9]. STIM1 also in turn regulates the entry of external calcium through plasma membrane channels to affect immune cell activation [10]. STIM1 mutation was shown to be associated with a syndrome of immunodeficiency and autoimmunity [11]. Recently, it has been reported that STIM1 is critical for breast cancer cell migration and metastasis [12]. Chen et al. demonstrated that STIM1-dependent signaling plays an important role in cervical cancer growth, migration, and angiogenesis [13], which makes the STIM1 gene an attractive target for therapeutic use. SOCE is the main Ca2+ influx pathway
107
Biotechnology and Applied Biochemistry involved in controlling proliferation of human hepatoma cells [14]. However, the biological role of STIM1 in HCC remains to be elucidated. In the present study, we examined the biological role of STIM1 in HCC cell growth via an RNA interference lentivirus system and an overexpression lentivirus system. Knockdown of STIM1 resulted in reduced cell proliferation, decreased DNA replication, and impaired colony-forming ability. Moreover, the cell cycle was arrested at the G0/G1 phase after STIM1 silencing. Overexpression of STIM1 resulted in increased cell proliferation. Our data provide a supplementary insight for the functional role of STIM1 in human HCC.
Master PCR Mix (Applied Biosystems) on the TP800 qPCR System (Takara, Japan). All quantification was normalized to an endogenous gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH). For relative quantification, 2−(Ct – Cc) (Ct and Cc are the mean threshold cycle differences after normalizing to GAPDH) was calculated and used as an indication of the relative expression levels. The primers used in real-time PCR were as follows: GAPDH forward, 5 -TGACTTCAACAGCGACACCCA3 ; GAPDH reverse, 5 -GGAGTGTTGGAGAAGTCATATTAC-3 ; STIM1 forward, 5 -AGCCTCAGCCATAGTCACAG-3 ; STIM1 reverse, 5 -TTCCACATCCACATCACCATTG-3 .
2.4. Western blotting analysis
2. Materials and Methods 2.1. Cell culture Human HCC cell line SMMC7721 was purchased from the Shanghai Institute of Biochemistry and Cell biology (People’s Republic of China). Cells were routinely maintained in Dulbecco’s modified eagle medium supplemented with 10% fetal bovine serum at 37 ◦ C in a humidified incubator with a constant air flow of 5% CO2 and 95% O2 .
2.2. Lentivirus packaging and cell infection Small interfering RNA (siRNA) sequence targeting STIM1 (NM 003156) (CCTGGATGATGTAGATCATAA) and nonsilencing sequence (AATTCTCCGAACGTGTCACGT) were transformed into short hairpin RNA (shRNA; stem–loop–stem structure) and were cloned into pFH-L vectors (Shanghai Hollybio, People’s Republic of China). To rule out the possible off-target effect of shRNA, another siRNA (5 -GCTCTCCACATTTGGATTCTT-3 ) against STIM1 was used to get comparable results. The generated plasmids were transfected into 293T cells, together with two lentiviral packaging plasmids: pVSVG-I and pCMVR8.92 (Shanghai Hollybio). After 3 days of incubation, the lentiviruses were collected and concentrated with Centricon Plus-20 (Millipore, Billerica, MA, USA). The pLVTHM vector (Biovector Science Lab) encoding the full length of the human STIM1 gene (NM 003156) was constructed. Positive colonies with inserted fragments were confirmed by DNA sequencing to generate pLVTHM–STIM1 expression plasmid. For cell infection, SMMC7721 cells (5 × 104 cells/well) were incubated with the lentivirus expressing the STIM1 shRNA (Lv-shSTIM1), the control shRNA (Lv-shCon), or the full-length STIM1 (oxSTIM1) at a multiplicity of infection of 30. The infection efficiency was determined by counting green-fluorescent-protein-positive (GFP-positive) cells under a fluorescence microscope.
2.3. Quantitative real-time PCR The knockdown or overexpression efficiency was validated with quantitative real-time PCR at day 3 posttransduction. Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and reverse-transcribed using M-MLV-RTase (Promega, Madison, WI, USA), according to the manufacturer’s instructions. Real-time PCR was performed using the SYBR Green
108
To detect the STIM1 silencing at protein level, endogenous GAPDH protein was used as an internal standard. Cell lysates were separated on 12% SDS-PAGE gels and transferred onto polyvinylidene difluoride membranes (Millipore). After blocking, the membranes were incubated in milk containing mouse anti-STIM1 monoclonal antibody (Santa Cruz Biotechnology, Dallas, TX, USA), followed by horseradishperoxidase-conjugated goat antimouse immunoglobulin G (Santa Cruz Biotechnology). Protein expression was visualized using an enhanced chemiluminescence reagent (Santa Cruz Biotechnology).
2.5. Methylthiazoletetrazolium cell proliferation assay SMMC7721 cells infected with the lentivirus expressing the STIM1 shRNA (RNAi+) or the control shRNA (RNAi−) were seeded in 96-well plates at a density of 2 × 103 cells/well. At indicated time points, 20 μL of methylthiazoletetrazolium (MTT) solution (5 mg/mL) was added into each well. After 4 H of incubation at 37 ◦ C 150 μL of dimethyl sulfoxide was added to dissolve the crystals. After 10 Min at room temperature, the absorbance was recorded at 490 nm.
2.6. Colony formation assay After infection for 3 days, SMMC7721 cells (200 cells/well) were seeded in 6-well plates and incubated at 37 ◦ C in air with 5% CO2 . The medium were renewed every 3 days. After 10 days of culture, the colony formed was washed with phosphatebuffered saline (PBS) and fixed with 4% paraformaldehyde for 30 Min at room temperature. The colonies were then stained with Giemsa for 20 Min, washed with water, and air-dried. The number of colonies was statistically analyzed.
2.7. Fluorescence-activated cell sorting analysis For cell cycle analysis, lentivirus-transduced cells (1 × 106 cells/well) were inoculated into a 6 cm dish and cultured for 40 H at 37 ◦ C. Cells were harvested after trypsinization, washed with PBS, and fixed in 70% ethanol for 1 H. After being washed three times, the cells were treated with 50 μL/mL propidium iodide solution (Sigma, St. Louis, MO, USA) and 100 μL/mL ribonuclease in PBS for 15 Min at room temperature in dark, followed by flow cytometry analysis (BD FACSCalibur, San Diego, CA, USA).
STIM1 in Hepatocellular Cacinoma Cells
2.8. Bromodeoxyuridine assay After infection for 3 days, SMMC7721 cells (2 × 103 cells/well) were seeded into 96-well plates. Bromodeoxyuridine (BrdU) reagents (20 μL/well) were added at 24 H or 72 H after cells seeded and incubated at 37 ◦ C in 5% CO2 atmosphere for 8 H. Then, fixing solution (200 μL/well) was added and incubated for 30 Min at room temperature. After washing three times by wash buffer, anti-BrdU antibody (100 μL/well) was added and incubated for 1 H at room temperature, followed by second antibody (100 μL/well) and incubation for 30 Min at room temperature. Then, 3,3 ,5,5 -tetramethylbenzidine peroxidase substrate (100 μL/well) was added to develop color in dark for 30 Min. Stop solution (100 μL/well) was provided into each well, and signals were measured at 450 nm.
2.9. Statistical analysis All statistical calculations were carried out with the Statistical Package for Social Sciences 16.0 software. Continuous variables were compared using Student’s t-test. Statistical significance was accepted when P < 0.05.
3. Results 3.1. Lentivirus-mediated knockdown of STIM1 strongly inhibits its mRNA and protein expression in SMMC7721 cells We first examined lentiviral infection efficiency by detecting the expression of GFP by fluorescence microscopy. At the average infection efficiency, GFP was identified in more than 90% of SMMC7721 cells (Fig. 1A). After lentiviral infection with STIM1 shRNA for 72 H, real-time PCR analysis showed that the mRNA expression of STIM1 in SMMC7721cells was significantly decreased, 72.5% lower than in cells infected with the control shRNA (P < 0.05, Fig. 1C). Immunoblot analysis of cell lysates extracted 4 days after infection revealed that the expression of STIM1 protein was decreased simultaneously (Fig. 1B). As shown in Fig. SA in the Supporting Information, the level of STIM1 mRNA was significantly decreased in SMMC7721 cells infected with another Lv-shSTIM1. Western blotting confirmed the silencing effect of another siRNA, as only weak band was detected in the Lv-shSTIM1 group (Supporting Information Fig. SC). These findings demonstrated that the STIM1 lentiviral shRNA vector exerted a specific knockdown effect on endogenous STIM1expression in SMMC7721 cells.
3.2. Lentivirus-mediated knockdown of STIM1 decreases the proliferation of SMMC7721 cells To explore the effect of STIM1 shRNA on HCC cell proliferation, SMMC7721 cells were infected with STIM1 shRNA lentivirus, and viable cells were counted using MTT assay 5 days postinfection. Knockdown of STIM1 decreased the numbers of SMMC7721 cells to 59.9% of the control shRNA-infected cells after 5 days of culture (P < 0.05, Fig. 1D). Similarly, the growth curve of SMMC7721 cells indicated that the proliferative ability was markedly impaired after infection with another Lv-shSTIM1 (P < 0.001, Fig. SE in the Supporting Information).
Biotechnology and Applied Biochemistry
3.3. The colony-forming ability of SMMC7721 cells is inhibited upon STIM1 lentiviral shRNA treatment To elucidate the role of STIM1 in HCC tumorigenesis in vitro, SMMC7721 cells infected with STIM1 lentiviral shRNA were examined by colony formation assay. Obviously, downregulation of STIM1 reduced the number of surviving SMMC7721 cell colonies (Fig. 2A); STIM1-shRNA-treated group had lower colony formation ability compared with the control shRNAinfected group (P < 0.05, Fig. 2B). Moreover, we found that the number of cells in each colony was markedly decreased compared with that of control cells (Fig. 2C); the counting of 10 random colonies in two groups affirmed this result (P < 0.05, Fig. 2D), suggesting that STIM1 knockdown is detrimental to the colony formation of SMMC7721 cells.
3.4. Knockdown of STIM1 arrested SMMC7721 cells in the G0/G1 phase and decreased DNA synthesis To investigate whether STIM1 has a regulative function in cell cycle, we performed cell cycle assay using the FACScalibur flow cytometer (BD FACSCalibur) 5 days after infection. The results showed that when treated with STIM1 lentivirual shRNA, SMMC7721 cells were arrested in the G0/G1 phase of interphase of the cell cycle and the S-phase cell
FIG. 1
Lentivirus-mediated downregulation of STIM1 strongly inhibits its mRNA and protein expression and decreases cell proliferation in SMMC7721 cells. (A) SMMC7721 cells were examined 3 days after infection by fluorescence microscopy. Representative cultures are shown. (B) The protein level of STIM1 was downregulated by lentivirus-mediated shRNA in SMMC7721 cells. (C) Expression of STIM1 mRNA was downregulated by lentivirus-mediated shRNA in SMMC7721 cells. Results were calculated as means ± SD of three independent experiments in triplicate (* represents P < 0.05). (D) Growth curve by MTT assay. SMMC7721 cells were treated with lentivirus-mediated shRNA targeting STIM1 or negative control shRNA and cultured for 1 to 5 days (* represents P < 0.05).
109
Biotechnology and Applied Biochemistry
FIG. 2
The colony-forming ability of SMMC7721 cells is inhibited upon STIM1 lentiviral shRNA treatment. (A) Lentivirus-mediated downregulation of STIM1 suppressed the colony-forming ability of SMMC7721 cells. The cells were stained with Giemsa solution and visualized. Representative images of three independent experiments are shown. (B) The number of colonies were calculated and statistically analyzed. Cells treated with lentivirus-mediated shRNA targeting STIM1 made less clone number compared with negative control shRNA. Results represent the means ± SD of three independent experiments (* represents P < 0.05). (C) Lentivirus-mediated downregulation of STIM1 reduced the cell number per colony of SMMC7721 cells. Representative colonies of SMMC7721 cells are shown. (D) The cell number in GFP-labeled colonies were calculated and statistically analyzed. Downregulation of STIM1 inhibited the cell number in per SMMC7721 cell colony. Results represent the means ± SD of 10 random colonies (* represents P < 0.05).
number was reduced significantly (P < 0.05, Fig. 3B), indicating that the DNA duplication was impaired following STIM1 downregulation. As determined in the BrdU incorporation assay, the STIM1silencing group (RNAi+) displayed significant DNA synthesis defect with a reduction of 31.5% at 72 H compared with the control shRNA (RNAi−) group (Fig. 3C). This result verified the fact that suppression of STIM1 induced lesion of DNA replication accompanied by the G0/G1 phase arrest.
3.5. Lentivirus-mediated overexpression of STIM1 increases the proliferation of SMMC7721 cells As shown in Fig. SB of the Supporting Information, the STIM1 mRNA was upregulated 1.5-fold compared with control. West-
110
FIG. 3
Knockdown of STIM1 arrested SMMC7721 cells in the G0/G1 phase and decreased DNA synthesis. (A) Lentivirus-transduced SMMC7721 cells were stained with propidium iodide solution and analyzed using the flow cytometer. Representative images of three independent fluorescenceactivated cell sorting analyses are shown. (B) Knock-down of STIM1 induced G0/G1 phase arrest in SMMC7721 cells. Results were calculated as means ± SD of three independent experiments in triplicate (* represents P < 0.05). (C) Knocking down of STIM1 inhibited SMMC7721 cell growth by decreasing DNA synthesis. Lentivirustransduced cells were analyzed with BrdU cell proliferation assay at 24 H and 72 H (* represents P < 0.05).
ern blotting confirmed the increase of STIM1 protein level in the oxSTIM1 group (Supporting Information Fig. SD). The MTT assay showed that the overexpression of STIM1 increased the proliferation of SMMC7721 cells (P < 0.001, Supporting Information Fig. SF). In summary, these data suggested that STIM1 might be an oncogene in human HCC.
4. Discussion Tumor cells have the ability to malignantly proliferate and migrate into surrounding tissue, which is known as metastasis. To date, a number of studies have revealed that many genes, such as oncogenes and tumor-suppressor genes, could be involved in the complex and multistep process of tumorigenesis. Recent advances in bioscience have greatly developed our understanding of the molecular mechanisms of HCC progression. There are now promising research opportunities to screen and identify
STIM1 in Hepatocellular Cacinoma Cells
molecular targets for anticancer applications. The molecular targets for tumor therapy are growing rapidly. STIM1, an ER luminal Ca2+ sensor, activates Ca2+ -releaseactivated Ca2+ channels and migrates from the Ca2+ store to the plasma membrane [7]. It is proved that knockdown of STIM1 by RNAi reduces SOCE [15]. In addition to being a molecular player in cellular Ca2+ homeostasis, STIM1 has recently been implicated in tumor cell migration and the metastatic phenotype [16]. Its function in malignant tumor promotion is becoming increasingly intriguing. STIM2, the other STIM sensor, is a potent inhibitor of STIM1-mediated SOCE [17]. Recently, Aytes et al. showed that STIM2 is frequently expressed in colorectal carcinoma and that overexpression of STIM2 reduces cell proliferation and growth [18]. However, the role of STIM1 in hepatocellular cancer is still little known. In the current study, we showed that knockdown of STIM1 resulted in reduced cell proliferation, decreased DNA replication, and impaired colony-forming ability. Moreover, the cell cycle was arrested in the G0/G1 phase after STIM1 silencing. Overexpression of STIM1 resulted in increased cell proliferation. Our findings indicate that STIM1 may play an important role in the progression of HCC and that STIM1 silencing by RNA interference has an antitumorigenic effect on HCC cells, suggesting that it may be a potential molecular target for HCC diagnosis and therapy. Further investigations are required to evaluate the molecular basis for STIM1-induced cell growth in HCC. In conclusion, our work provides the evidence that lentivirus-mediated knockdown of STIM1 inhibits the growth of SMMC7721 cells. STIM1 could be a potential biomarker in human HCC.
Biotechnology and Applied Biochemistry
5. References [1] Frau, M., Biasi, F., Feo, F., and Pascale, R. M. (2010) Mol. Aspects Med. 31, 179–193. [2] Lee, M., and Keeffe, E. B. (2011) Gastroenterol. Clin. North Am. 40, 495–505. [3] Minguez, B., and Lachenmayer, A. (2011) Dis. Markers 31, 181–190. [4] Kudo, M. (2011) Dig. Dis. 29, 273–277. [5] Kiviluoto, S., Decuypere, J. P., De Smedt, H., Missiaen, L., Parys, J. B., and Bultynck, G. (2011) Skelet. Muscle 1, 16. [6] Luik, R. M., Wu, M. M., Buchanan, J., and Lewis, R. S. (2006) J. Cell Biol. 174, 815–825. [7] Zhang, S. L., Yu, Y., Roos, J., Kozak, J. A., Deerinck, T. J., Ellisman, M. H., Stauderman, K. A., and Cahalan, M. D. (2005) Nature 437, 902–905. [8] Luik, R. M., Wang, B., Prakriya, M., Wu, M. M., and Lewis, R. S. (2008) Nature 454, 538–542. [9] Cheng, K. T., Liu, X., Ong, H. L., Swaim, W., and Ambudkar, I. S. (2011) PLoS Biol. 9, e1001025. [10] Zhang, H., Clemens, R. A., Liu, F., Hu, Y., Baba, Y., Theodore, P., Kurosaki, T., and Lowell, C. A. (2014) Blood 123, 2238–2249. [11] Picard, C., McCarl, C. A., Papolos, A., Khalil, S., Luthy, K., Hivroz, C., LeDeist, F., Rieux-Laucat, F., Rechavi, G., Rao, A., Fischer, A., and Feske, S. (2009) N. Engl. J. Med. 360, 1971–1980. [12] Yang, S., Zhang, J. J., and Huang, X. Y. (2009) Cancer Cell 15, 124–134. [13] Chen, Y. F., Chiu, W. T., Chen, Y. T., Lin, P. Y., Huang, H. J., Chou, C. Y., Chang, H. C., Tang, M. J., and Shen, M. R. (2011) Proc. Natl. Acad. Sci. USA 108, 15225–15230. [14] El Boustany, C., Bidaux, G., Enfissi, A., Delcourt, P., Prevarskaya, N., and Capiod, T. (2008) Hepatology 47, 2068–2077. [15] Yan, X., Xing, J., Lorin-Nebel, C., Estevez, A. Y., Nehrke, K., Lamitina, T., and Strange, K. (2006) J. Gen. Physiol. 128, 443–459. [16] El Boustany, C., Katsogiannou, M., Delcourt, P., Dewailly, E., Prevarskaya, N., Borowiec, A. S., and Capiod, T. (2010) Cell Calcium 47, 350–359. [17] Prevarskaya, N., Skryma, R., and Shuba, Y. (2011) Nat. Rev. Cancer 11, 609–618. [18] Aytes, A., Mollevi, D. G., Martinez-Iniesta, M., Nadal, M., Vidal, A., Morales, A., Salazar, R., Capella, G., and Villanueva, A. (2012) Mol. Carcinog. 51, 746–753.
111
Copyright of Biotechnology & Applied Biochemistry is the property of Wiley-Blackwell and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
Zhengshan Wu Jiangjie Qing Yongxiang Xia ∗ Ke Wang ∗ Feng Zhang
The Liver Transplantation Center, the First Affiliated Hospital of Nanjing Medical University, Nanjing, People’s Republic of China
Abstract Stromal interaction molecule 1 (STIM1), an endoplasmic reticulum luminal Ca2+ sensor, activates Ca2+ -release-activated Ca2+ channels and migrates from the Ca2+ store to the plasma membrane. Recently, STIM1 was shown be critical for the progression of several cancers, including breast cancer and cervical cancer. However, its role in hepatocellular carcinoma has remained unknown. The current study was aimed to evaluate the effect of STIM1 on the growth of hepatocellular cancer. Lentivirus-mediated short hairpin RNA targeting STIM1 was transduced into SMMC7721
cells to knock down STIM1 expression. Knockdown of STIM1 significantly inhibited cell proliferation and colony-forming ability and arrested the cell cycle at the G0/G1 phase. Moreover, the DNA synthesis progression was also decreased. Furthermore, lentiviral vector-mediated overexpression of STIM1 promoted the proliferation of SMMC7721 cells. Our findings suggest that STIM1 may play an important role in the development of hepatocellular cancer and may be a potential C 2014 International Union of Biochemistry and target for therapy. Molecular Biology, Inc. Volume 62, Number 1, Pages 107–111, 2015
Keywords: STIM1, lentivirus, hepatocellular carcinoma, proliferation, cell cycle
1. Introduction Hepatocellular carcinoma (HCC) is one of the most common malignancies in the world. Chronic hepatitis B virus infection greatly increases the risk of liver cirrhosis and HCC. In addition to hepatitis-B-virus-related factors, development of HCC is considered to be a multistep biological process including
Abbreviations: BrdU, bromodeoxyuridine; ER, endoplasmic reticulum; GAPDH, glyceraldehyde 3-phosphate dehydrogenase; GFP, green fluorescent protein; HCC, hepatocellular carcinoma; MTT, methylthiazoletetrazolium; RNAi, RNA interference; shRNA, short hairpin RNA; siRNA, small interfering RNA; SOCE, store-operated Ca2+ entry; STIM, stromal interaction molecule. ∗ Address for correspondence: Feng Zhang, PhD, and Ke Wang, PhD, The Liver Transplantation Center, The First Affiliated Hospital of Nanjing Medical University, Nanjing 210029, People’s Republic of China. Tel.: +86 21 34692656; Fax: +86 21 34692656; e-mails:[email protected] and [email protected].
No benefits in any form have been received or will be received from a commercial party related directly or indirectly to the subject of this article. Supporting Information is available in the online issue at wileyonlinelibrary.com. Received 4 January 2014; accepted 13 May 2014 DOI: 10.1002/bab.1245 Published online 15 December 2014 in Wiley Online Library (wileyonlinelibrary.com)
uncontrolled cellular proliferation, detachment from the extracellular matrix, and invasion into the surrounding tissue. Despite a recent improvement in long-term survival rates, the prognosis of HCC is still poor because of the high rate of relapse and metastasis [1–4]. New molecular targets and therapeutic strategies are needed for the prevention and treatment of HCC. However, the mechanism of hepatocarcinogenesis remains incomplete. Stromal interaction molecules (STIMs) were identified as the endoplasmic reticulum (ER) Ca2+ sensor controlling store-operated Ca2+ entry (SOCE) and Ca2+ -release-activated Ca2+ channels in nonexcitable cells[5]. STIM1 is predominantly located in the ER lumina, the main intracellular Ca2+ store [6, 7]. Upon Ca2+ store depletion, STIM1 translocates into ER–plasma membrane junctions and couples to activate Orai1 [8] and possibly transient receptor potential channels [9]. STIM1 also in turn regulates the entry of external calcium through plasma membrane channels to affect immune cell activation [10]. STIM1 mutation was shown to be associated with a syndrome of immunodeficiency and autoimmunity [11]. Recently, it has been reported that STIM1 is critical for breast cancer cell migration and metastasis [12]. Chen et al. demonstrated that STIM1-dependent signaling plays an important role in cervical cancer growth, migration, and angiogenesis [13], which makes the STIM1 gene an attractive target for therapeutic use. SOCE is the main Ca2+ influx pathway
107
Biotechnology and Applied Biochemistry involved in controlling proliferation of human hepatoma cells [14]. However, the biological role of STIM1 in HCC remains to be elucidated. In the present study, we examined the biological role of STIM1 in HCC cell growth via an RNA interference lentivirus system and an overexpression lentivirus system. Knockdown of STIM1 resulted in reduced cell proliferation, decreased DNA replication, and impaired colony-forming ability. Moreover, the cell cycle was arrested at the G0/G1 phase after STIM1 silencing. Overexpression of STIM1 resulted in increased cell proliferation. Our data provide a supplementary insight for the functional role of STIM1 in human HCC.
Master PCR Mix (Applied Biosystems) on the TP800 qPCR System (Takara, Japan). All quantification was normalized to an endogenous gene, glyceraldehyde 3-phosphate dehydrogenase (GAPDH). For relative quantification, 2−(Ct – Cc) (Ct and Cc are the mean threshold cycle differences after normalizing to GAPDH) was calculated and used as an indication of the relative expression levels. The primers used in real-time PCR were as follows: GAPDH forward, 5 -TGACTTCAACAGCGACACCCA3 ; GAPDH reverse, 5 -GGAGTGTTGGAGAAGTCATATTAC-3 ; STIM1 forward, 5 -AGCCTCAGCCATAGTCACAG-3 ; STIM1 reverse, 5 -TTCCACATCCACATCACCATTG-3 .
2.4. Western blotting analysis
2. Materials and Methods 2.1. Cell culture Human HCC cell line SMMC7721 was purchased from the Shanghai Institute of Biochemistry and Cell biology (People’s Republic of China). Cells were routinely maintained in Dulbecco’s modified eagle medium supplemented with 10% fetal bovine serum at 37 ◦ C in a humidified incubator with a constant air flow of 5% CO2 and 95% O2 .
2.2. Lentivirus packaging and cell infection Small interfering RNA (siRNA) sequence targeting STIM1 (NM 003156) (CCTGGATGATGTAGATCATAA) and nonsilencing sequence (AATTCTCCGAACGTGTCACGT) were transformed into short hairpin RNA (shRNA; stem–loop–stem structure) and were cloned into pFH-L vectors (Shanghai Hollybio, People’s Republic of China). To rule out the possible off-target effect of shRNA, another siRNA (5 -GCTCTCCACATTTGGATTCTT-3 ) against STIM1 was used to get comparable results. The generated plasmids were transfected into 293T cells, together with two lentiviral packaging plasmids: pVSVG-I and pCMVR8.92 (Shanghai Hollybio). After 3 days of incubation, the lentiviruses were collected and concentrated with Centricon Plus-20 (Millipore, Billerica, MA, USA). The pLVTHM vector (Biovector Science Lab) encoding the full length of the human STIM1 gene (NM 003156) was constructed. Positive colonies with inserted fragments were confirmed by DNA sequencing to generate pLVTHM–STIM1 expression plasmid. For cell infection, SMMC7721 cells (5 × 104 cells/well) were incubated with the lentivirus expressing the STIM1 shRNA (Lv-shSTIM1), the control shRNA (Lv-shCon), or the full-length STIM1 (oxSTIM1) at a multiplicity of infection of 30. The infection efficiency was determined by counting green-fluorescent-protein-positive (GFP-positive) cells under a fluorescence microscope.
2.3. Quantitative real-time PCR The knockdown or overexpression efficiency was validated with quantitative real-time PCR at day 3 posttransduction. Total RNA was extracted using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and reverse-transcribed using M-MLV-RTase (Promega, Madison, WI, USA), according to the manufacturer’s instructions. Real-time PCR was performed using the SYBR Green
108
To detect the STIM1 silencing at protein level, endogenous GAPDH protein was used as an internal standard. Cell lysates were separated on 12% SDS-PAGE gels and transferred onto polyvinylidene difluoride membranes (Millipore). After blocking, the membranes were incubated in milk containing mouse anti-STIM1 monoclonal antibody (Santa Cruz Biotechnology, Dallas, TX, USA), followed by horseradishperoxidase-conjugated goat antimouse immunoglobulin G (Santa Cruz Biotechnology). Protein expression was visualized using an enhanced chemiluminescence reagent (Santa Cruz Biotechnology).
2.5. Methylthiazoletetrazolium cell proliferation assay SMMC7721 cells infected with the lentivirus expressing the STIM1 shRNA (RNAi+) or the control shRNA (RNAi−) were seeded in 96-well plates at a density of 2 × 103 cells/well. At indicated time points, 20 μL of methylthiazoletetrazolium (MTT) solution (5 mg/mL) was added into each well. After 4 H of incubation at 37 ◦ C 150 μL of dimethyl sulfoxide was added to dissolve the crystals. After 10 Min at room temperature, the absorbance was recorded at 490 nm.
2.6. Colony formation assay After infection for 3 days, SMMC7721 cells (200 cells/well) were seeded in 6-well plates and incubated at 37 ◦ C in air with 5% CO2 . The medium were renewed every 3 days. After 10 days of culture, the colony formed was washed with phosphatebuffered saline (PBS) and fixed with 4% paraformaldehyde for 30 Min at room temperature. The colonies were then stained with Giemsa for 20 Min, washed with water, and air-dried. The number of colonies was statistically analyzed.
2.7. Fluorescence-activated cell sorting analysis For cell cycle analysis, lentivirus-transduced cells (1 × 106 cells/well) were inoculated into a 6 cm dish and cultured for 40 H at 37 ◦ C. Cells were harvested after trypsinization, washed with PBS, and fixed in 70% ethanol for 1 H. After being washed three times, the cells were treated with 50 μL/mL propidium iodide solution (Sigma, St. Louis, MO, USA) and 100 μL/mL ribonuclease in PBS for 15 Min at room temperature in dark, followed by flow cytometry analysis (BD FACSCalibur, San Diego, CA, USA).
STIM1 in Hepatocellular Cacinoma Cells
2.8. Bromodeoxyuridine assay After infection for 3 days, SMMC7721 cells (2 × 103 cells/well) were seeded into 96-well plates. Bromodeoxyuridine (BrdU) reagents (20 μL/well) were added at 24 H or 72 H after cells seeded and incubated at 37 ◦ C in 5% CO2 atmosphere for 8 H. Then, fixing solution (200 μL/well) was added and incubated for 30 Min at room temperature. After washing three times by wash buffer, anti-BrdU antibody (100 μL/well) was added and incubated for 1 H at room temperature, followed by second antibody (100 μL/well) and incubation for 30 Min at room temperature. Then, 3,3 ,5,5 -tetramethylbenzidine peroxidase substrate (100 μL/well) was added to develop color in dark for 30 Min. Stop solution (100 μL/well) was provided into each well, and signals were measured at 450 nm.
2.9. Statistical analysis All statistical calculations were carried out with the Statistical Package for Social Sciences 16.0 software. Continuous variables were compared using Student’s t-test. Statistical significance was accepted when P < 0.05.
3. Results 3.1. Lentivirus-mediated knockdown of STIM1 strongly inhibits its mRNA and protein expression in SMMC7721 cells We first examined lentiviral infection efficiency by detecting the expression of GFP by fluorescence microscopy. At the average infection efficiency, GFP was identified in more than 90% of SMMC7721 cells (Fig. 1A). After lentiviral infection with STIM1 shRNA for 72 H, real-time PCR analysis showed that the mRNA expression of STIM1 in SMMC7721cells was significantly decreased, 72.5% lower than in cells infected with the control shRNA (P < 0.05, Fig. 1C). Immunoblot analysis of cell lysates extracted 4 days after infection revealed that the expression of STIM1 protein was decreased simultaneously (Fig. 1B). As shown in Fig. SA in the Supporting Information, the level of STIM1 mRNA was significantly decreased in SMMC7721 cells infected with another Lv-shSTIM1. Western blotting confirmed the silencing effect of another siRNA, as only weak band was detected in the Lv-shSTIM1 group (Supporting Information Fig. SC). These findings demonstrated that the STIM1 lentiviral shRNA vector exerted a specific knockdown effect on endogenous STIM1expression in SMMC7721 cells.
3.2. Lentivirus-mediated knockdown of STIM1 decreases the proliferation of SMMC7721 cells To explore the effect of STIM1 shRNA on HCC cell proliferation, SMMC7721 cells were infected with STIM1 shRNA lentivirus, and viable cells were counted using MTT assay 5 days postinfection. Knockdown of STIM1 decreased the numbers of SMMC7721 cells to 59.9% of the control shRNA-infected cells after 5 days of culture (P < 0.05, Fig. 1D). Similarly, the growth curve of SMMC7721 cells indicated that the proliferative ability was markedly impaired after infection with another Lv-shSTIM1 (P < 0.001, Fig. SE in the Supporting Information).
Biotechnology and Applied Biochemistry
3.3. The colony-forming ability of SMMC7721 cells is inhibited upon STIM1 lentiviral shRNA treatment To elucidate the role of STIM1 in HCC tumorigenesis in vitro, SMMC7721 cells infected with STIM1 lentiviral shRNA were examined by colony formation assay. Obviously, downregulation of STIM1 reduced the number of surviving SMMC7721 cell colonies (Fig. 2A); STIM1-shRNA-treated group had lower colony formation ability compared with the control shRNAinfected group (P < 0.05, Fig. 2B). Moreover, we found that the number of cells in each colony was markedly decreased compared with that of control cells (Fig. 2C); the counting of 10 random colonies in two groups affirmed this result (P < 0.05, Fig. 2D), suggesting that STIM1 knockdown is detrimental to the colony formation of SMMC7721 cells.
3.4. Knockdown of STIM1 arrested SMMC7721 cells in the G0/G1 phase and decreased DNA synthesis To investigate whether STIM1 has a regulative function in cell cycle, we performed cell cycle assay using the FACScalibur flow cytometer (BD FACSCalibur) 5 days after infection. The results showed that when treated with STIM1 lentivirual shRNA, SMMC7721 cells were arrested in the G0/G1 phase of interphase of the cell cycle and the S-phase cell
FIG. 1
Lentivirus-mediated downregulation of STIM1 strongly inhibits its mRNA and protein expression and decreases cell proliferation in SMMC7721 cells. (A) SMMC7721 cells were examined 3 days after infection by fluorescence microscopy. Representative cultures are shown. (B) The protein level of STIM1 was downregulated by lentivirus-mediated shRNA in SMMC7721 cells. (C) Expression of STIM1 mRNA was downregulated by lentivirus-mediated shRNA in SMMC7721 cells. Results were calculated as means ± SD of three independent experiments in triplicate (* represents P < 0.05). (D) Growth curve by MTT assay. SMMC7721 cells were treated with lentivirus-mediated shRNA targeting STIM1 or negative control shRNA and cultured for 1 to 5 days (* represents P < 0.05).
109
Biotechnology and Applied Biochemistry
FIG. 2
The colony-forming ability of SMMC7721 cells is inhibited upon STIM1 lentiviral shRNA treatment. (A) Lentivirus-mediated downregulation of STIM1 suppressed the colony-forming ability of SMMC7721 cells. The cells were stained with Giemsa solution and visualized. Representative images of three independent experiments are shown. (B) The number of colonies were calculated and statistically analyzed. Cells treated with lentivirus-mediated shRNA targeting STIM1 made less clone number compared with negative control shRNA. Results represent the means ± SD of three independent experiments (* represents P < 0.05). (C) Lentivirus-mediated downregulation of STIM1 reduced the cell number per colony of SMMC7721 cells. Representative colonies of SMMC7721 cells are shown. (D) The cell number in GFP-labeled colonies were calculated and statistically analyzed. Downregulation of STIM1 inhibited the cell number in per SMMC7721 cell colony. Results represent the means ± SD of 10 random colonies (* represents P < 0.05).
number was reduced significantly (P < 0.05, Fig. 3B), indicating that the DNA duplication was impaired following STIM1 downregulation. As determined in the BrdU incorporation assay, the STIM1silencing group (RNAi+) displayed significant DNA synthesis defect with a reduction of 31.5% at 72 H compared with the control shRNA (RNAi−) group (Fig. 3C). This result verified the fact that suppression of STIM1 induced lesion of DNA replication accompanied by the G0/G1 phase arrest.
3.5. Lentivirus-mediated overexpression of STIM1 increases the proliferation of SMMC7721 cells As shown in Fig. SB of the Supporting Information, the STIM1 mRNA was upregulated 1.5-fold compared with control. West-
110
FIG. 3
Knockdown of STIM1 arrested SMMC7721 cells in the G0/G1 phase and decreased DNA synthesis. (A) Lentivirus-transduced SMMC7721 cells were stained with propidium iodide solution and analyzed using the flow cytometer. Representative images of three independent fluorescenceactivated cell sorting analyses are shown. (B) Knock-down of STIM1 induced G0/G1 phase arrest in SMMC7721 cells. Results were calculated as means ± SD of three independent experiments in triplicate (* represents P < 0.05). (C) Knocking down of STIM1 inhibited SMMC7721 cell growth by decreasing DNA synthesis. Lentivirustransduced cells were analyzed with BrdU cell proliferation assay at 24 H and 72 H (* represents P < 0.05).
ern blotting confirmed the increase of STIM1 protein level in the oxSTIM1 group (Supporting Information Fig. SD). The MTT assay showed that the overexpression of STIM1 increased the proliferation of SMMC7721 cells (P < 0.001, Supporting Information Fig. SF). In summary, these data suggested that STIM1 might be an oncogene in human HCC.
4. Discussion Tumor cells have the ability to malignantly proliferate and migrate into surrounding tissue, which is known as metastasis. To date, a number of studies have revealed that many genes, such as oncogenes and tumor-suppressor genes, could be involved in the complex and multistep process of tumorigenesis. Recent advances in bioscience have greatly developed our understanding of the molecular mechanisms of HCC progression. There are now promising research opportunities to screen and identify
STIM1 in Hepatocellular Cacinoma Cells
molecular targets for anticancer applications. The molecular targets for tumor therapy are growing rapidly. STIM1, an ER luminal Ca2+ sensor, activates Ca2+ -releaseactivated Ca2+ channels and migrates from the Ca2+ store to the plasma membrane [7]. It is proved that knockdown of STIM1 by RNAi reduces SOCE [15]. In addition to being a molecular player in cellular Ca2+ homeostasis, STIM1 has recently been implicated in tumor cell migration and the metastatic phenotype [16]. Its function in malignant tumor promotion is becoming increasingly intriguing. STIM2, the other STIM sensor, is a potent inhibitor of STIM1-mediated SOCE [17]. Recently, Aytes et al. showed that STIM2 is frequently expressed in colorectal carcinoma and that overexpression of STIM2 reduces cell proliferation and growth [18]. However, the role of STIM1 in hepatocellular cancer is still little known. In the current study, we showed that knockdown of STIM1 resulted in reduced cell proliferation, decreased DNA replication, and impaired colony-forming ability. Moreover, the cell cycle was arrested in the G0/G1 phase after STIM1 silencing. Overexpression of STIM1 resulted in increased cell proliferation. Our findings indicate that STIM1 may play an important role in the progression of HCC and that STIM1 silencing by RNA interference has an antitumorigenic effect on HCC cells, suggesting that it may be a potential molecular target for HCC diagnosis and therapy. Further investigations are required to evaluate the molecular basis for STIM1-induced cell growth in HCC. In conclusion, our work provides the evidence that lentivirus-mediated knockdown of STIM1 inhibits the growth of SMMC7721 cells. STIM1 could be a potential biomarker in human HCC.
Biotechnology and Applied Biochemistry
5. References [1] Frau, M., Biasi, F., Feo, F., and Pascale, R. M. (2010) Mol. Aspects Med. 31, 179–193. [2] Lee, M., and Keeffe, E. B. (2011) Gastroenterol. Clin. North Am. 40, 495–505. [3] Minguez, B., and Lachenmayer, A. (2011) Dis. Markers 31, 181–190. [4] Kudo, M. (2011) Dig. Dis. 29, 273–277. [5] Kiviluoto, S., Decuypere, J. P., De Smedt, H., Missiaen, L., Parys, J. B., and Bultynck, G. (2011) Skelet. Muscle 1, 16. [6] Luik, R. M., Wu, M. M., Buchanan, J., and Lewis, R. S. (2006) J. Cell Biol. 174, 815–825. [7] Zhang, S. L., Yu, Y., Roos, J., Kozak, J. A., Deerinck, T. J., Ellisman, M. H., Stauderman, K. A., and Cahalan, M. D. (2005) Nature 437, 902–905. [8] Luik, R. M., Wang, B., Prakriya, M., Wu, M. M., and Lewis, R. S. (2008) Nature 454, 538–542. [9] Cheng, K. T., Liu, X., Ong, H. L., Swaim, W., and Ambudkar, I. S. (2011) PLoS Biol. 9, e1001025. [10] Zhang, H., Clemens, R. A., Liu, F., Hu, Y., Baba, Y., Theodore, P., Kurosaki, T., and Lowell, C. A. (2014) Blood 123, 2238–2249. [11] Picard, C., McCarl, C. A., Papolos, A., Khalil, S., Luthy, K., Hivroz, C., LeDeist, F., Rieux-Laucat, F., Rechavi, G., Rao, A., Fischer, A., and Feske, S. (2009) N. Engl. J. Med. 360, 1971–1980. [12] Yang, S., Zhang, J. J., and Huang, X. Y. (2009) Cancer Cell 15, 124–134. [13] Chen, Y. F., Chiu, W. T., Chen, Y. T., Lin, P. Y., Huang, H. J., Chou, C. Y., Chang, H. C., Tang, M. J., and Shen, M. R. (2011) Proc. Natl. Acad. Sci. USA 108, 15225–15230. [14] El Boustany, C., Bidaux, G., Enfissi, A., Delcourt, P., Prevarskaya, N., and Capiod, T. (2008) Hepatology 47, 2068–2077. [15] Yan, X., Xing, J., Lorin-Nebel, C., Estevez, A. Y., Nehrke, K., Lamitina, T., and Strange, K. (2006) J. Gen. Physiol. 128, 443–459. [16] El Boustany, C., Katsogiannou, M., Delcourt, P., Dewailly, E., Prevarskaya, N., Borowiec, A. S., and Capiod, T. (2010) Cell Calcium 47, 350–359. [17] Prevarskaya, N., Skryma, R., and Shuba, Y. (2011) Nat. Rev. Cancer 11, 609–618. [18] Aytes, A., Mollevi, D. G., Martinez-Iniesta, M., Nadal, M., Vidal, A., Morales, A., Salazar, R., Capella, G., and Villanueva, A. (2012) Mol. Carcinog. 51, 746–753.
111
Copyright of Biotechnology & Applied Biochemistry is the property of Wiley-Blackwell and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
