JOURNAL

OF BACTERIOLOGY, Jan. 1992, p. 331-335 0021-9193/92/010331-05$02.00/0 Copyright © 1992, American Society for Microbiology

Vol. 174, No. 1

Synergism between the Trp Repressor and Tyr Repressor in Repression of the aroL Promoter of Escherichia coli K-12t VIRGINIA M. HEATWOLE AND RONALD L. SOMERVILLE*

Department of Biochemistry, Purdue University, West Lafayette, Indiana 47907-6799 Received 16 September 1991/Accepted 2 November 1991

Computer analysis identified a potential Trp repressor operator 56 nucleotides downstream of the transcriptional start point of aroL, the gene that encodes shikimate kinase II. Tryptophan-dependent interaction of Trp repressor with this operator was demonstrated in vitro by means of a restriction endonuclease protection assay. Regulation of expression from the aroL promoter was evaluated with several genetically marked Escherichia coli strains by using a single-copy aroL-lacZ transcriptional-translational reporter system. The expression of aroL was repressed 6.9-fold by the Tyr repressor alone and 29-fold when both Tyr and Trp repressors were present. The Trp repressor had no effect on expression from the aroL promoter in the absence of the Tyr repressor. Possible mechanisms for Trp repressor-mediated repression, including cooperative interactions with the Tyr repressor, are discussed. The tryptophan repressor of Escherichia coli negatively regulates genes involved in tryptophan biosynthesis and transport, namely aroH, trpR, mtr, and the trp operon. The Trp holorepressor binds to a 24-bp palindromic operator sequence within each of these promoter regions. The protein-DNA complex represses transcription by interfering with the ability of RNA polymerase to interact with the promoter. A consensus of the operator for the Trp repressor can be derived by aligning the eight known half-operator sequences (reviewed by Somerville [24]). The common aromatic amino acid biosynthetic pathway is controlled at two different steps. The first step of the pathway involves three isoenzymes of 3-deoxy-D-arabinoheptulosonate 7-phosphate (DAHP) synthase which are regulated at the enzyme level by feedback inhibition by phenylalanine, tyrosine, and tryptophan and at the transcriptional level by mechanisms involving the tyrosine repressor and tryptophan repressor (for a review, see reference 20). The second point of control in the common aromatic amino acid biosynthetic pathway involves transcriptional control of the gene that encodes shikimate kinase II. The aroL gene, the first gene in a two gene operon, aroLM, encodes shikimate kinase II, one of two isoenzymes that catalyze this intermediate step in the pathway. The aroL promoter is repressed by the tyrosine repressor (reviewed by Pittard and Davidson [21]). Three operator sites for the Tyr repressor have been identified within the aroL promoter region (7). Shikimate kinase activity is repressed when cells are grown in medium containing tyrosine or tryptophan. This repression is abolished in a tyrR background (11). Therefore, it was suggested that the Tyr repressor, in combination with tyrosine or tryptophan, mediated repression of the aroL promoter (8, 11). Although the Tyr repressor binds tyrosine in vitro, attempts to demonstrate interaction between the Tyr repressor and tryptophan were inconclusive (1). Computer search. The Trp repressor operator within the mtr promoter has only recently been identified (13, 14, 23). The nucleotide sequence of the mtr operator decreased by

the number of absolutely conserved nucleotides within the known half operators. The possibility that the additional degeneracy that this operator introduced into the consensus would lead to the identification of previously unrecognized Trp repressor operators was investigated. A consensus table of the eight known half operators was constructed (Fig. 1) by using the Consensus program (9). The Fitconsensus program (9) was modified so that the consensus table could be used to scan all the E. coli sequences in the GenBank and EMBL data bases. This search revealed a potentially strong half operator in the aroL promoter region. Visual inspection of the aroL nucleotide sequence identified a potential full Trp repressor operator site that included the computer-predicted half operator (Fig. 2). The possible contradiction between the in vitro binding studies and the in vivo analysis of regulation cited above, coupled with our identification of a potential Trp repressor operator site, suggested that the Trp repressor, not the Tyr repressor, may be responsible for the tryptophan-mediated one

repression.

Tryptophan holorepressor binds to an operator downstream of the aroL promoter. Within the putative Trp repressoroperator site is an RsaI restriction endonuclease cleavage site (Fig. 2). Purified Trp repressor was shown to specifically protect this RsaI site from cleavage in a tryptophan-dependent manner (Fig. 3). When the Trp repressor cannot bind its operator, RsaI digestion of pMU371 is predicted to produce two fragments of 730 and 420 bp, as well as other RsaI fragments. (The 420-bp band is too small to be visualized well under these conditions, but the 730-bp band is clearly visible.) When the Trp repressor and tryptophan are both present, the RsaI site within the operator is protected, resulting in the appearance of the 1,150-bp band and the disappearance of the 730-bp band. No protection of this RsaI site by the Trp repressor was observed in the absence of tryptophan. These results clearly demonstrate that the Trp repressor, in a tryptophandependent manner, specifically protects the RsaI site within the operator that was predicted by computer analysis. Construction of an aroL-lacZ transcription-translation fusion on a X phage. To test whether the Trp repressor affects expression from the promoter in vivo, a transcriptionaltranslational fusion was constructed on a X phage by the

Corresponding author. t Journal paper no. 13161 from the Purdue University Agricultural Experimental Station. *

331

332

J. BACTERIOL.

NOTES

* * * * * a n t/c G T A C T a/c G T 12 11 10 9 8 7 6 5 4 3 2

A.

vector sequence upstream of the aroL sequence. The other t

1

A. trp trp

aroH aroH trpR trpR

1 2 1 2 1 2

mtr 1 mtr 2

A T C G A A C T A G T T T G C G T A C T A G T T A A T G T A C T A G A G A 0 T A

T T T C

C G T A T G T A T G T A T G T A

C C C C

A

T T T C

T C T C G A G

T T T T T G T A

C. A T T G T A C T A G T T A T C A T A C C A T C A FIG. 1. Con sensus table of Trp repressor half operators. (A) The consensus sequ4ence (before the addition of the aroL operator) for the Trp repressor bialf operators is shown at the top. The positions at which mutationIs have the greatest effect on Trp repressor operator interaction as idlentified previously (4) are indicated by asterisks. The numbering systoem (given on the line below the sequence) begins at the axis of symnnetry. (B) The consensus table used to scan the E. coli sequence data base by using the modified Fitconsensus program as described previiously (22). Each Trp repressor operator is represented in two lines. 1'he first (labeled 1) represents the first half of the operator, and thie second (labeled 2) is the reverse complement of the second half of the operator. Three positions, 6, 7 and 9, are 100o conserved in th e table. One criterion for the computer-aided identification of a ma tch to the consensus table was that these three residues be conserv ed. (C) The computer search identified the first half of the aroL opera tor (aroL 1). The second half (aroL 2), positioned directly adjacenLt to the first aroL sequence, was not identified by the computer searclh because there was an A instead of a G at conserved position 9. Howtever, visual analysis suggested that this half operator, in combination with aroL 1, was a potentially valid Trp repressor operator site. A 1l computer analyses were done with programs from the University (of Wisconsin Genetics Computer Group (9). aroL 1 aroL 2

following pro cedure. With pMU371 as the template, a fragment of DNA containing the aroL promoter was synthesized by the polyrnerase chain reaction with two specifically designed olig()nucleotides. One oligonucleotide (CTACTTG GAGCCACT.ATCG) was designed to anneal to the pMU371

oligonucleotide (TTAAGCGGATCCGCAAGGG) was designed to anneal within the coding region of aroL and to introduce a BamHI site at the 3' end of the amplified DNA fragment. The amplified DNA contained a second BamHI site 5' to the aroL promoter region at the junction between aroL and the vector DNA sequence (8) (Fig. 2). The poly-

merase chain reaction-amplified DNA was purified, cleaved with BamHI, and ligated into the BamHI site of pMLB1034. The ligation mixture was transformed into BW3912. Identification of the aroL-lacZ fusion was accomplished by selecting blue colonies on X-Gal (5-bromo-4-chloro-3-indolyl-1-Dgalactoside)-containing medium. The resulting construct, pSLW22, contained 287 bp upstream of the aroL gene and the first 24 codons of aroL fused in frame to full-length lacZ. (The aroL DNA present in pSLW22 is shown in Fig. 2.) The plasmid bearing the aroL-lacZ transcriptional-translational fusion, pSLW22, was transformed into CSH26(XRZ11). Lac' recombinant A phage bearing the aroL-lacZ fusion were isolated from this plasmid-bearing lysogen as previ-

ously described (2). The phage, designated ASLW22, was then inserted, in single-copy form, into SP1312 and SP1313 (Table 1) according to published procedures (18, 27). Double lysogens were identified and eliminated by the independent isolation of four lysogens in each strain. ,B-Galactosidase assays were performed with these lysogens. Isolates giving values twice as high as those of other isolates were eliminated. Derivatives of single copy lysogens lacking a functional Trp repressor were constructed by P1 transduction T reda (18).

Effects of the tyrosine and tryptophan repressors on expres-

sion from the aroL promoter. P-Galactosidase assays were performed with strains lysogenic for XSLW22 lacking either

the tyrosine or tryptophan repressor or both to evaluate the role of these regulatory proteins in aroL expression. The results are presented in Table 2. With wild-type cells (SP1312), expression from the aroL promoter was repressed 2.8-fold by tyrosine but only 1.3fold by tryptophan, compared with P-galactosidase levels in minimal medium. However, cells grown in medium containing both tyrosine and tryptophan showed a 6.6-fold repression compared with the levels in minimal medium. The

1

GATCCAGACCGGCGGACCAGATAGCCTTTCACAACGTGACCGCCAGGCCT

51

TTGCCGCGGAGCTGGAGAAGTGGTGGCTGGAAGTGCAACGTAGTCGTGGC Strong

-

36

-1 O

101

TAN

151

IAAGG

201

CGAA

251

TTCGCCGCATTGCGACCTATTGGGGAAAACCCACGATGACACAACCTCTT

301

TTTCTGATCGGGCCTCGGGGCTGTGGTAAAACAACGGTCGGAATGGCCCT

351

TGCGGATCC

rCATTCTTGAATATTTATTGGTATAG *

Venk

Strong

XR*sI CGCTALTTCTCATGACACCGGCT

FIG. 2. Nucleotide sequence of the promoter-operator region of aroL that is contained in pSLW22. The Tyr repressor boxes (7) (black boxes) and the Trp repressor operator (shaded box) identified by the computer search (Fig. 1 and see text) are indicated. The -35 and -10 hexamers, transcriptional start site (*), and translational start site (underlined) previously identified (7, 17) are indicated. The strong and weak Tyr repressor boxes as identified by Pittard and Davidson (21) are indicated. The Rsal site within the Trp repressor operator is indicated. The nucleotide sequence begins on the 5' end with the BamHI site used in the construction of pMU371 (7). The BamHI site at the 3' end of the sequence was created by the BamHI-containing mutagenic oligonucleotide which changed C to G at position 354 and T to C at position 358. The coordinates are identicaJ to those previously reported (17).

VOL. 174, 1992

NOTES 1

2

+ +

+

3

4

+

-

TrpR w

TABLE 1. E. coli strains, phage, and plasmids Relevant genotype Strain, phage, Reference or or plasmid or description source Strains BW3912 26 AlacZJ69 pho-SlO thi CSH26 ara A(lac-pro) thi 18 SP1312 As W3110, but zah-735:: 14

TnlOA&(argF-Iac)Ul69

SP1313 SP1324 SP1453 1150 7300

-N.

SP1454 W3110 Plasmids

FIG. 3. Trp repressor-specific protection of the RsaI site within the aroL promoter is tryptophan dependent. Plasmid DNA (pMU371) was prepared as described previously (15), dissolved in 100 ,u1 of TE buffer (10 mM Tris-HCl, 1 mM EDTA [pH 7.6]), and treated with 1.5 ,u1 RNAsePlus (5Prime>3Prime Inc.) for 15 min at 37°C. The DNA was then treated with phenol-chloroform-isoamyl alcohol, precipitated, and resuspended in 15 of TE buffer for use in restriction endonuclease protection assays. Protection assays were performed with 20 RI1 of commercially supplied (Promega) Rsal buffer (50 mM NaCl, 10 mM Tris-HCl [pH 7.9], 10 mM MgCl2, 6 mM 2-mercaptoethanol, 0.1 p.g of bovine serum albumin per ,u1). Equal volumes of plasmid (2 p.1) and 0.145 p.g of the Trp repressor (TrpR) or tryptophan (W) (final concentration, 0.5 mM) or both were added to appropriate tubes as indicated above the lanes by + (- indicates no addition) and incubated for 20 min at 37°C. RsaI (60 U) was then added, and incubation was continued for 45 min at 37°C. Each reaction was then stopped by the addition of stop dye. The products of the digestion were separated by electrophoresis on a 1.3% agarose gel. Arrows indicate the 1,150-bp fragment resulting from protection of the operator (lane 1) and the 730-bp fragment resulting from RsaI cleavage within the operator (lanes 2 to 4). The other cleavage product, a 420-bp fragment, cannot be visualized under these conditions. extent of repression observed when both aromatic amino acids were present was greater than the amount of repression imposed by each amino acid individually. With a trpR strain (SP1453), tyrosine-mediated repression was decreased to 1.5-fold, only half of the amount of tyrosine-mediated repression obtained with the wild type. Tryptophan alone had no effect on expression. Tryptophan and tyrosine together decreased expression only 1.9-fold. With the tyrR strain (SP1313) and the double-mutant strain (SP1454), no effect of either of the aromatic amino acids was observed. Therefore, in the absence of a functional Tyr repressor, no regulation of expression from the aroL promoter occurred under these conditions. Additional insight into the dual nature of repression at the aroL promoter comes from a consideration of the 3-galactosidase activities in groups of strains differing only in their repressor genotypes. When the tyrosine-grown set of strains was analyzed (Table 2), cells with a functional Tyr repressor were much more strongly repressed (13-fold) when Trp repressor was present than when Trp repressor was absent (5.5-fold). In the tryptophan-grown set of strains (Table 2), cells with a functional Trp repressor were much more strongly repressed (6-fold) when the Tyr repressor was present than when the Tyr repressor was absent (1.2-fold). For cells grown in the presence of both amino acids (Table

333

pMLB1034 pMU371 pSLW22

As SP1312, but A(tyrR) As W3110, but trpR::Qlkan As SP1312(XSLW22), but trpR: :fkan As SP1313(XSLW22), but trpR: :flkan Wild type

14 B. Hagewood This work

Promoterless lacZ, Ampr Complete aroLM operon aroL-lacZ transcriptional-

5 8 This work

This work 3

translational fusion

Phage XRZ11

As XplacS(cI857 Sam7), but promoterless lacZ aroL-lacZ transcriptionaltranslational fusion

XSLW22

27 This work

2), repression was maximal (29-fold) when both repressors were available. Repression was much less pronounced (6.9fold) when only the Tyr repressor was present. Repression was negligible (1.2-fold) when only the Trp repressor was available. Implications for repression mediated by the tyrosine and tryptophan repressors. Tryptophan-mediated repression via the Tyr repressor has been suggested for a number of operons, including the aroLM operon (7). This is not supported by in vitro binding studies in which an interaction between tryptophan and the Tyr repressor could not be demonstrated (1). The data presented here show that with aroL, the Trp repressor is actually responsible for the tryptophan-mediated repression. One unexpected observation from this work was that the Trp repressor had no observable effect on expression from the aroL promoter unless a functional Tyr repressor was present. In all of the other genes known to be regulated by the Trp repressor, the operator site and the RNA polymerase TABLE 2. P-Galactosidase levels in strains

lysogenic for XSLW22a

Relevant Strain Stan genotype

SP1312

3-Galactosidase level in cells grown in minimal mediumb Alone

38.9 (4.2) 153 (7.6) 47.2 (2.8) SP1454 tyrR trpR 178 (7.0)

SP1313 tyrR SP1453 trpR

+ Tyrosine

13.9 (1.5) 159 (14.6) 32.5 (3.7) 180 (6.4)

+ Tryp-

tophan opn

29.8 (2.4) 151 (9.8) 45.7 (2.1) 178 (8.5)

+ Tyrosine and tryp-

tophan 5.9 (0.6) 148 (12.6) 24.8 (1.7) 172 (6.9)

XSLW22 contains an aroL-lacZ transcriptional-translational fusion. b

p-Galactosidase assays were performed with permeabilized cells grown to mid-log phase at 30°C. The values obtained are reported in Miller's units (18). Each value is the result of at least six independent assays. Minimal medium contained 0.2% glucose, vitamin B1 (1 mg/liter), biotin (0.1 mg/liter), and the salt mix E of Vogel and Bonner (25). Aromatic amino acids were added at a concentration of 1 mM. Standard deviations for each set of assays are given in parentheses.

334

J. BACTERIOL.

NOTES

binding site overlap. In these cases, the Trp repressor interferes with the ability of RNA polymerase to interact with the promoter. However, this model is clearly inadequate for the aroL promoter. The axis of dyad symmetry of the Trp repressor operator site is 56 bp downstream of the transcriptional start site. Elledge and Davis demonstrated that as the Trp repressor operator is positioned greater distances downstream of the transcriptional start point, the effect of the Trp repressor on expression from a synthetic promoter is greatly diminished (10). One possible mechanism by which the Trp repressor might mediate repression from the aroL promoter could involve the cooperative interaction between the Trp repressor and Tyr repressor proteins. Between the transcriptional start site and the Trp repressor operator lies a pair of Tyr repressor boxes (Fig. 2). Pittard and Davidson (21) suggested that every operon subject to repression by the Tyr repressor and tyrosine contains a pair of adjacent Tyr repressor operators analogous to those of the aroL promoter. In each case, the Tyr repressor exhibits strong affinity for one of the boxes (independent of tyrosine) and a weak affinity for the other box (tyrosine dependent). Tyr repressor binding to these adjacent boxes is cooperative. The strong box must be occupied by the Tyr repressor before the protein can bind to the weak box. These authors also suggested that occupancy of the weak box is required for maximal repression, on the grounds that the weak boxes are usually best positioned to interfere with RNA polymerase binding (i.e., within the promoter). The data presented here are consistent with a model in which the interaction of the Trp repressor with the Tyr repressor assists the binding of the Tyr repressor to the weak box. This would explain why no effect of the Trp repressor on expression from the aroL promoter could be observed unless the Tyr repressor was present. This model could also explain why repression by the Tyr repressor and tyrosine was less pronounced with the trpR background than with the wild type (Table 2). Another possible mechanism by which the Trp repressor might mediate repression from the aroL promoter when only the Tyr repressor is available could be related to the strength of the aroL promoter. It has been shown that the ability of the Lac repressor to mediate repression of a promoter is dependent on the position of the operator, the rate of RNA polymerase-promoter complex formation, and the rate at which RNA polymerase clears the promoter region (16). In a similar manner, it is possible that the Trp repressor is able to mediate repression of aroL only after the Tyr repressor has first significantly reduced expression from that promoter. The dependence by the Trp repressor on the presence of the Tyr repressor in aroL repression suggests a fundamentally different mechanism for Trp repressor action at the aroL promoter than for the other promoters of the Trp regulon. There are few examples of E. coli promoters that are repressed by two different repressor proteins (6). However, the gal promoter appears to be another example of a promoter that is subject to dual repression (12). Repression by the Tyr repressor via tryptophan has also been suggested for aroP, another gene in the Tyr repressor regulon (21). It is possible that the Trp repressor is actually a component of the regulatory machinery involved in aroP expression, as seen for aroL in the work presented here. This work brings to five the number of operons that are regulated by the Trp repressor. Three of these operons, mtr, aroH, and aroLM, are also regulated by the Tyr repressor (19, 21, 24).

This research was supported by Public Health Service grant GM22131 and by David Ross grant XR G901561 from Purdue Research Foundation. Computer analysis involving the University of Wisconsin Genetic Computer group programs was supported by Public Health Service grant AI27713 from the National Institutes of Health. We are grateful to Rick Westerman for adapting the program Fitconsensus and for invaluable computer advice. We thank Wei Ping Yang for supplying purified tryptophan repressor protein. For their generous contributions of bacterial strains, viruses and plasmids, we thank B. Bachmann, M. Berman, B. Hagewood, J. Pittard, W. Reznikoff, and B. Wanner. We also thank Jisong Cui and Janell Rex for critical reading of the manuscript and Janell Rex for computer advice and many helpful discussions. REFERENCES 1. Argyropoulos, V. P. 1989. Ph.D. thesis. University of Melbourne, Melbourne, Australia. 2. Aronson, B. D., M. Levinthal, and R. L. Somerville. 1989. Activation of a cryptic pathway for threonine metabolism via specific IS3-mediated alteration of promoter structure in Escherichia coli. J. Bacteriol. 171:5503-5511. 3. Bachmann, B. J. 1972. Pedigrees of some mutant strains of Escherichia coli K-12. Bacteriol. Rev. 36:525-557. 4. Bass, S., V. Sorrells, and P. Youderian. 1988. Mutant Trp repressors with new DNA-binding specificities. Science 242: 240-245. 5. Berman, M. L., and D. E. Jackson. 1984. Selection of lac gene fusions in vivo: ompR-lacZ fusions that define a functional domain of the ompR gene product. J. Bacteriol. 159:750-756. 6. Collado-Vides, J., B. Magasanik, and J. D. Gralla. 1991. Control site location and transcriptional regulation in Escherichia coli. Microbiol. Rev. 55:371-394. 7. DeFeyter, R. C., B. E. Davidson, and J. Pittard. 1986. Nucleotide sequence of the transcriptional unit containing the aroL and aroM genes from Escherichia coli K-12. J. Bacteriol. 165:233239. 8. DeFeyter, R. C., and J. Pittard. 1986. Genetic and molecular analysis of aroL, the gene for shikimate kinase II in Escherichia coli K-12. J. Bacteriol. 159:226-232. 9. Devereux, J., P. Haiberli, and 0. Smithies. 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res. 12:387-395. 10. Elledge, S. J., and R. W. Davis. 1989. Position and density effects on repressor by stationary and mobile DNA-binding proteins. Genes Dev. 3:185-197. 11. Ely, B., and J. Pittard. 1979. Aromatic amino acid biosynthesis: regulation of shikimate kinase in Escherichia coli K-12. J. Bacteriol. 138:933-943. 12. Golding, A., M. J. Weickert, J. P. E. Tokeson, S. Garges, and S. Adhya. 1991. A mutation defining ultrainduction of the Escherichia coli gal operon. J. Bacteriol. 173:6294-6296. 13. Heatwole, V. M., and R. L. Somerville. 1991. Cloning, nucleotide sequence, and characterization of mtr, the structural gene for a tryptophan-specific permease of Escherichia coli K-12. J.

Bacteriol. 173:108-115.

14. Heatwole, V. M., and R. L. Somerville. 1991. The tryptophanspecific permease gene, mtr, is differentially regulated by the tryptophan and tyrosine repressors in Escherichia coli K-12. J. Bacteriol. 173:3601-3604. 15. Ish-Horowicz, D., and J. Burke. 1981. Rapid and efficient cosmid cloning. Nucleic Acids Res. 9:2989-2998. 16. Lanzer, M., and H. Bujard. 1988. Promoters largely determine the efficiency of repressor action. Proc. Natl. Acad. Sci. USA

85:8973-8977.

17. Millar, G., A. Lewendon, M. G. Hunter, and J. R. Coggins. 1986. The cloning and expression of the aroL gene from

Escherichia coli K-12. Purification and complete amino acid sequence of shikimate kinase II, the aroL gene product. Biochem. J. 237:427-437. 18. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. 19. Muday, G. K., D. I. Johnson, R. L. Somerville, and K. M.

VOL. 174, 1992

Herrmann. 1991. The tyrosine repressor negatively regulates aroH expression in Escherichia coli. J. Bacteriol. 173:39303932. 20. Pittard, A. J. 1987. Biosynthesis of the aromatic amino acids, p. 368-394. In F. C. Neidhardt, J. L. Ingraham, K. B. Low, B. Magasanik, M. Schaechter, and H. E. Umbarger (ed.), Escherichia coli and Samonella typhimurium: cellular and molecular biology, vol. 1. American Society for Microbiology, Washington, D.C. 21. Pittard, A. J., and B. E. Davidson. 1991. TyrR protein of Escherichia coli and its role as repressor and activator. Mol. Microbiol. 5:1585-1592. 22. Rex, J. H., B. D. Aronson, and R. L. Somerville. 1991. The tdh and serA operons of Escherichia coli: mutational analysis of the regulatory elements of leucine-responsive genes. J. Bacteriol.

NOTES

335

173:5944-5953. 23. Sarsero, J. P., P. J. Wookey, and A. J. Pittard. 1991. Regulation of expression of the Escherichia coli K-12 mtr gene by TyrR protein and Trp repressor. J. Bacteriol. 173:4133-4143. 24. Somerville, R. L. Trp repressor, a ligand-activated regulatory protein. Prog. Nucleic Acid Res. Mol. Biol., in press. 25. Vogel, H. J., and D. M. Bonner. 1956. Acetylornithinase of Escherichia coli: partial purification and some properties. J. Biol. Chem. 218:97-106. 26. Wanner, B. 1986. Novel regulatory mutants of the phosphate regulon in Escherichia coli K-12. J. Mol. Biol. 191:39-58. 27. Yu, X. M., and W. S. Reznikoff. 1984. Deletion analysis of the CAP-cAMP binding site of the Escherichia coli lactose promoter. Nucleic Acids Res. 12:5449-5464.

Synergism between the Trp repressor and Tyr repressor in repression of the aroL promoter of Escherichia coli K-12.

Computer analysis identified a potential Trp repressor operator 56 nucleotides downstream of the transcriptional start point of aroL, the gene that en...
952KB Sizes 0 Downloads 0 Views