JOURNAL OF CELLULAR PHYSIOLOGY 144333-344 (1990)

Synthesis of Basic Fibroblast Growth Factor Upon Differentiation of Rat Mammary Epithelial to Myoepithelial-Like Cells in Culture ROGER BARRACLOUCH, DAVID C. FERNIC, PHILIP S. RUDLAND, AND JOHNA. SMITH* Cancer dnd Polio Reiedrch Fund Laboratories, Department of Biocherni,try, Unweriily of Liverpool, Liverpool, L69 3BX, England Acidic fibroblast growth factor (aFGF) mRNA was detected in a rat mammary fibroblastic cell line, but not in rat mammary epithelial cell lines or myoepitheliallike cell lines. Basic FGF (bFGF) mRNA was detected in both the fibroblasts and the myoepithelial-like cells, but was absent from the epithelial cells. A series of cell lines representing stages in the differentiation pathway of epithelial cells to a myoepithelial-like morphology showed an increase in the amount of bFGF mRNA and activity present and the FGF from the myoepithelial-like rat mammary 29 cells was able to displace ["'I]-bFGF specifically bound to rat mammary fibroblasts. FGF activity was also present in an extract of rat mammary gland. Analysis of cell extracts and conditioned medium indicated that FGF activity was cellassociated. The cell-associated bFGF was resistant to degradation by trypsin. Extraction of myoepithelial-like cells with Triton X-100 and 2 M NaCl showed that 5 0 4 5 % of the cell-associated bFGF was in a detergent-resistan( but 2 M NaCI-labile structure. Thus, the synthesis of bFCF is developmentally regulated in rat mammary cell lines, and at least 50% i s present in the extracellular matrix.

Endocrine ablation and hormone replacement experiments indicate t h a t the growth of the mammary gland is controlled by systemic agents released from a variety of endocrine glands (Lyons et al., 1958; Nandi, 1958). However, these agents have little o r no effect on the growth of mammary stromal fibroblasts and epithelial and myoepithelial-like cells in culture (Rudland et al.; 1979; Smith et al., 1984). I n contrast, growth factors are potent stimulators of mammary cell growth in culture (Kano-Sueoka, 1983; Smith et al., 1984; Dembinski and Shiu, 1987; Fernig et al., 1990a). The growth factors which stimulate mammary cell growth include prostaglandin E,, secreted by some stromal cells (Rudland et al., 1984), transforming growth factor alpha (a-TGF) secreted by the myoepithelial-like cells (Smith e t al., 1989), and two pituitary factors, pituitary mammary growth factor (Smith et al., 1984) and basic fibroblast growth factor (bFGF) (Rudland et al., 1979; Smith et al., 1984). bFGF is a member of a family of growth factors and oncogenes which has six known members a t present: acidic FGF (aFGF), bFGF, int-2, hst/KS53, FGF-5, and FGF-6 (Burgess and Maciag, 1989; Marics e t al.. 1989). bFGF elicits a variety of responses in a wide range of cells (Burgess and Maciag, 1989; Gospodarowicz et al., 1987; Gospodarowicz, 1989). In our rat mammary cell lines, pituitary bFGF stimulates the growth of stromal fibroblasts and myoepithelial-like cells but it has no such effect on the epithelial cells (Rudland et al., 1979; Smith et al., 1984). 0 1990 WILEY-LISS, INC

Our single-cell-cloned rat mammary epithelial cell lines consistently give rise to elongated myoepitheliallike cells in culture (Rudland, 1987). Cell lines representing morphologically and biochemically stable, intermediate stages in the differentiation pathway of epithelial to myoepithelial-like cells in vitro have been isolated and characterized (Rudland e t al., 1986). These intermediate cell lines represent progressive stages of differentiation to myoepithelial-like cells in vitro, in a n analogous fashion to the stages observed at ductal termini in rats (Ormerod and Rudland 1984). Quantification of cell-surface, high-affinity receptors for bFGF suggest that the bFGF-receptor is developmentally regulated: the increase in the number of cell-surface bFGF-receptors correlates with a n increase in the myoepithelial characteristics of the cells (Fernig et al., 1990b). Furthermore, bFGF stimulates only the growth of those cells which possess detectable cell-surface, high-affinity receptors for bFGF (Fernig e t al., 1990b). Thus bFGF may play a n important role in controlling the growth of the myoepithelium and stroma during the development of the mammary gland in vivo. The source of the bFGF i s unknown. It may originate

Received December 29, 1989; accepted April 11, 1990.

*To whom reprint requestsicorrespondence should be addressed.

334

BARRACLOUGH ET AL

TABLE 1. Origins of the mammarv cell lines discussed Mammary tissue Normal rat fast sticking fraction

Cell line Rama 27

Identity Fibroblastic

Reference Rudland et a1 (1984)

Sprague-Dawley rat (outbred), benign 7,12 dimethyl-benzlalanthracene(DMBA) tumor

Rama 25

Epithelial

Bennett et al. (1978)

Rama 25-12 Rama 25-11 Rama 25-14

Cells intermediate between epithelial Rama 25 and myoepithelial-like Rama 29

L Rama29

Myoepithelial-like

Rama 704

Epithelial

Rama 711

Myoepithelial-like

Normal rat

from the pituitary gland, although there is some doubt as to whether bFGF is present in the circulation (Burgess and Maciag, 1989). Alternatively it may be produced by cells within the mammary gland, in a n analogous fashion to the FGF-like molecule int-2, which induces relatively benign tumors in mice infected with mouse mammary tumor virus (Moore et al., 1986) and to bFGF synthesized by cultured endothelial cells (Rifkin and Moscatelli, 1989). To help elucidate whether bFGF is a locally produced trophic agent for the mammary gland, we have investigated the possibility that stromal fibroblasts and epithelial and myoepithelial-like cells produce aFGF or bFGF.

1 1

Rudland et al. (1986) Bennett et al. (1978) Ormerod and Rudland (1985)

Keynes, UK). The incubation mixture was diluted 10fold with a solution of 1 mM EDTA, 10 mM Tris-HC1, pH 7.6 and passed through a small column of DEAE cellulose (Whatman, Maidstone, UK). Unreacted nucleoside triphosphate was removed by washing the column with the same buffer containing 0.2 M NaC1, and the 32P-labeled oligodeoxyribonucleotide was eluted with the same buffer containing 1 M NaC1.

Isolation and fractionation of mRNA Bovine pituitary glands were obtained from Imperial Laboratories (Salisbury, UK) and frozen in dry ice immediately after removal from the animals. Rat brain tissue was obtained from female OLAC Furth-Wistar MATERIALS AND METHODS rats and snap-frozen in liquid N2. Tissues were stored in liquid N2 until used for RNA isolation. Total cellular Cells RNA was isolated from tissues using both the method The derivation of the rat mammary (Rama) cell lines of Han et al., (1987) and the CsCl centrifugation used in this study and the routine culture of these cell method of Chirgwin et al. (3979). Both methods gave lines have been described in detail previously (Table 1). identical results. RNA was isolated from rat mammary cell lines using a modification of the method of ChirgSynthetic oligodeoxyribonucleotides win et al. (1979; Barraclough et al., 1987). RNA prepOligodeoxyribonucleotides complementary to part of arations were enriched for poly(A)-containing RNA by the the mRNAs for aFGF and bFGF were chemically two cycles of affinity chromatography on oligodeoxsynthesized using a Cyclone DNA synthesizer (Milli- ythymidylic acid-cellulose gel (oligo(dT)-cellulose) gen, Watford, UK) and P-cyanoethyl phosphoramidite (Aviv and Leder, 1972). The integrity of the resulting chemistry. An oligonucleotide, 5’ (ACTCGGCCGT- poly(A)-containing RNA was verified by its translation CGGGGTGGATGCGCAGGAAGAAGCCCCCGTT) 3’, in the reticulocyte lysate system of cell-free protein complementary to 41 nucleotides of the region of the synthesis (Hunt and Jackson, 1974, Pelham and JackmRNA coding for amino acids 27-40 of bovine bFGF son, 1976) or by the presence of a n undegraded pattern (Abraham et al., 1986a) was selected since this oligo- of Northern hybridization to radioactive cloned DNA nucleotide has the same sequence in cattle and humans molecules corresponding to a range of cellular mRNAs. (Abraham e t al., 198613). An oligonucleotide, 5’(CADetection of aFGF and bFGF mRNAs by GGAAGTAGCCCCCGTTGCTGCAGTAGAGGAGCTfilter hybridization TGGGl 3 ’ , complementary to 39 nucleotides of the reThe precise hybridization conditions for the specific gion of the mRNA coding for amino acids 11-23 of bovine aFGF (Jaye et al., 1986) was used for the detec- detection of rat and bovine bFGF and aFGF mRNAs, tion of aFGF mRNA. The synthetic oligodeoxyribonu- by the bovine bFGF and aFGF synthetic oligonuclecleotides were purified by electrophoresis into a urea otides, respectively, were determined by incubating filacrylamide sequencing gel (Sanger and Coulson, 1978) ters containing restriction-enzyme-digested, size-fracand after the bands had been visualized by UV shad- tionated bovine and rat DNA with radioactively owing, the appropriately-sized bands of DNA were elec- labeled synthetic DNA under a variety of conditions, troeluted in dialysis tubing. Electrophoresis buffer was until the hybridization pattern corresponded to previremoved by dialysis against water. Prior t o being hy- ously published results with bovine DNA (Abraham et bridized, oligodeoxyribonucleotideswere radioactively al., 1986a) or corresponded to the detection of a single labeled at their 5‘ termini with [Y-~~PI-ATP, to the spe- copy aFGF or bFGF gene with rat DNA. To detect mRNA molecules corresponding to acidic cific activities specified in the figure legends, using polynucleotide kinase under reaction conditions de- and basic FGF in RNA isolated from normal tissues scribed by the manufacturer (Pharmacia, Milton and mammary cell lines, samples of poly(A)-containing

bFGF SYNTHESIS IN RAT MAMMARY CELL LINES

RNA were subjected to electrophoresis through 1.1% agarose gels in the presence of methylmercury hydroxide (Bailey and Davidson, 1976). A 1kilobase (Kb) ladder (GIBCO-BRL, Paisley, UK) and bacteriophage lambda DNA, digested with restriction enzyme Hind 111, were used a s molecular size markers. The gels were pretreated as described by Alwine et al. (1977) and the RNA was transferred to Hybond nylon filters (Amersham International, Amersham, UK) using the protocol supplied by the manufacturer. The filters were preincubated in 5 x SSC, 20 mM sodium phosphate buffer pH 7.0, 10 x Denhardt's solution, 7% (wiv) SDS, and 100 pgiml denatured salmon sperm DNA for a t least 4 h a t the temperature for hybridization (1 x SSC contains 0.15 M NaC1, 0.015 M trisodium citrate; 1 x Denhardt's solution contains 0.02% (wiv) BSA, 0.02% (wiv) polyvinylpyrrolidone, 0.02% (w/v) Ficoll). Labeled synthetic oligonucleotides were incubated with the filters containing bound RNA a t the predetermined optimum conditions in 5 x SSC, 20 mM sodium phosphate buffer, pH 7.0,lO x Denhardt's solution, 7% (wiv) SDS, 10% (wiv) dextran sulfate, 100 pgiml denatured sheared salmon sperm DNA, and 10 ngiml of 32P-labeled oligodeoxyribonucleotide for a t least 16 h. Filters were washed twice with 3 x SSC, 0.1% (wiv) SDS, and once with 1 x SSC, 0.1% (wiv) SDS. Filters were incubated with the bFGF oligonucleotide a t 635°C and washed at 62°C. Filters were incubated with the aFGF oligonucleotide at 62°C and were washed a t 60°C. In some experiments a synthetic gene corresponding to the coding region of human bFGF mRNA (British Biotechnology, Ltd, Oxford, UK) was used for the detection of rat bFGF mRNA. The synthetic gene was propagated in pUC 18 using standard methods (Maniatis et al., 1982). Plasmid DNA was isolated (Birnboim and Doly, 1979) and purified by CsCl gradient centrifugation (Radloff et al., 1967). The synthetic gene was excised by digesting the plasmid with restriction enzymes EcoRl and Hind 111, and purified by agarose gel electrophoresis (Maniatis et al., 1982). The bFGF DNA was labeled with la-32Pl-dCTPto a specific activity of 6 x 108-1 x 10" dpmipg DNA using random primed synthesis (Feinberg and Vogelstein, 1984). Precise hybridization conditions were chosen that yielded the minimum number of bands of hybridization to gel-fractionated EcoR1-digested rat DNA. For the detection of FGF mRNA, filters containing RNA were preincubated in 5 x SSPE, 50% (viv) deionised formamide, 5 x Denhardt's solution, 0.5% (wiv) SDS, and 100 pgiml denatured, sheared salmon sperm DNA a t 42°C for a t least 4 h (1 x SSPE is 0.15 M NaC1, 10 mM NaH,PO,, 1mM EDTA). The filters were incubated with 5 ngiml 32P-labeled DNA in 5 ml of the above buffer containing 10% (wiv) dextran sulfate for 16 h a t 42°C. The filters were washed twice in 1 x SSPE, 0.1% (wiv) SDS at room temperature and once a t 65°C. DNA which hybridized was detected by autoradiography a t -70°C using Kodak X-AR5 o r X-0-mat S film. Under the hybridization and washing conditions employed, the bFGF-derived oligonucleotide hybridized to aFGF mRNA in bovine pituitary at a level of only 16% of that to the bovine bFGF, and did not hybridize to the aFGF mRNA in r a t brain. The aFGFderived oligonucleotide did not hybridize to bovine or

335

rat bFGF mRNA. The specificity of the human gene

probes was less stringent. The human bFGF gene probe hybridized to bovine pituitary and rat brain aFGF mRNA, but at only 16% and 10% of the level to the bFGF mRNA. In contrast, the human aFGF gene hybridized to bovine pituitary and rat brain bFGF mRNA at 44% and 18% of the level to aFGF mRNA. Radioactive DNA bound to the filters was allowed to decay. All filters were then incubated with a r a t actin cDNA (Barraclough et al., 1987) as a constitutive probe under conditions described for the human synthetic FGF genes, except that the filters were washed twice with 2 x SSPE, 0.1% (wiv) SDS at room temperature, once with 1 x SSPE, 0.1% (wiv) SDS a t 60"C, and once with 0.1 x SSPE, 0.1% (wiv) SDS a t 60°C. In some experiments, increasing amounts from 0.05 to 1 pg of either poly(A)-containing RNA or total RNA were spotted onto filters (Hybond, Amersham International, Amersham, UK or Zeta-probe, BioRad, Watford, UK) using a dot-blot apparatus (BioRad). The filters were incubated with radioactive DNA corresponding to bFGF or actin cDNA and then washed as described above or according to the manufacturers' instructions. The filters were subjected to autoradiography. Duplicate filters were incubated with the radioactive actin cDNA. In some experiments the dot-blot filters were incubated with radioactive actin cDNA after being incubated with bFGF DNA. Radioactivity bound to the filters was quantified by scanning the autoradiographic images using a chromatogram scanner (Carl Zeiss, Oberkochen, FRG) and measuring the peakheight of the absorption of reflected light. For the dotblot experiments, the best-fit straight line of peak height against the amount of DNAidot, over the linear part of a plot, was calculated by linear regression (Dunn, 1977).

Extraction of FGF from cells Cells were grown to 80% confluency on three 15 cm diameter culture dishes. The cells (approximately 5 x lo6) were then collected by scraping in 6 ml phosphate buffered saline (PBS), followed by centrifugation at 1,000 gavmin. The cell pellet was resuspended in 500 pl PBS, pH 4.5, a t 4"C, and sonicated at 20%maximum power for a total of 1 min at 4°C with a Dawe soniprobe (Dawe, London, UK). Five hundred microliters of 4 M NaC1, 100 mM Tris-HC1, pH 7.4, at 4°C was added to the disrupted cells. After a 30 min incubation on a rotary shaker at 4"C, 500 pl of H20, a t 4°C was added to the disrupted cells which were then centrifuged for 6 x lo6 g,, min at 4°C. The extraction of r a t mammary gland tissue (3.4 g wet weight) was performed in the same way. The supernatants, called the cell extracts, were stored a t -70°C. Cell extracts were diluted with H 2 0 to 0.5 M NaCl and loaded onto a 250 p1 column of heparin sepharose (Pharmacia). The column was washed with 1 ml of 0.6 M NaC1, 10 mM Tris-HC1 pH 6.5 and then sequentially eluted with 1 ml of 1.1M NaC1, 10 mM Tris-HC1 pH 6.5, and 1 ml of 2 M NaC1, 10 mM Tris-HC1 pH 6.5. The unbound fraction, 0.6 M NaCl wash and the two eluates were assayed for their ability to stimulate the incorporation of f3H1-thymidine into the DNA of the fibroblastic Rama 27 cells exactly as described previously (Smith et al., 1984).

336

RARRACLOUGII

Displacement of [12511-bFGFbound to Rama 27 cells Pure bovine pituitary bFGF was iodinated using carrier-free 12'1 (Amersham) and IODOGEN (Pierce Warriner, Chester, UK) as the oxidant, and free "'1 was removed by centrifugal desalting a s described previously (Fernig et al., 1990b). Bioassays indicated that 100% of the bFGF was recovered after iodination. Displacement binding was performed essentially as described for saturation binding (Fernig et al., 1990b). Rama 27 cells were plated out into 24-multiwell dishes at 5 x lo4 cells per 1.5 cm well, and 24 h later were prepared for binding by washing three times with PBS at room temperature and once with Binding Medium (M199 (Sigma) supplemented with 10 mM HEPES, pH 7.4 and 0.1% BSA (wiv) a t 4°C). Then 200 pl Binding Medium was added, followed by 112511-bFGFand increasing volumes of either the 1.1 M or 2 M NaCl heparin sepharose fractions of Rama 29 cells extracted as described above. After 120 min on a n orbital shaker a t 4°C binding had reached equilibrium (Fernig e t al.. 1990b) and the cells were washed twice with Binding Medium and three times with PBS at 4°C. Cell-associated radioactivity was solubilized with 0.2 M NaOH and determined in a Wilj gamma counter. Localization of cell-associated FGF Rama 29 cells in three 15 cm diameter culture dishes were grown to 80% confluency (about 5 x lo6 cells) and then were incubated with one of the following solutions (5ml per dish): 0.05% (wiv) Triton x-100, 10 mM Tris-HC1, pH 7.4; 2 M NaC1, 10 mM Tris-HC1 pH 6.5; 0.59 (wiv) trypsin, 0.2% (wiv) ethylenediamine tetra-acetic acid (EDTA) in PBS; 0.2% (wiv) EDTA in PBS. The Triton X-100 and 2 M NaCl incubations were carried out on a rotary shaker a t room temperature, and after 5 min incubation, the solutions (the cell washes) were collected and the cell residues remaining on the dishes were collected by scraping in 6 ml of PBS per dish, followed by centrifugation a t 15,OOOg,, min. The incubations with trypsiniEDTA and EDTA alone were performed at 37°C for 5 min and 30 min, respectively, following the protocols routinely employed to passage cells. After the incubation, trypsin was inactivated by the addition of 500 pl of fetal calf serum, and the detached cells were collected by centrifugation. The supernatants and the cell washes from the Triton X100 and 2 M NaCl incubations were fractionated on 250 p1 columns of heparin sepharose as described above. The cell pellets and the Triton X-100 and 2 M NaCl cell residues were extracted as described for whole cells, before being fractionated on 250 p1 columns of heparin sepharose.

m AL.

A

1

2

3

4

5

234.4-

2.0Kb

2 Kb-

B Fig. 1. bFGF transcripts in rat mammary cell lines, and in rat and bovine tissue. A: Samples of poly(A1-containing RNA preparations (10 pgj were subjected t o agarose gel electrophoresis, transferred to nylon filtcrs, and incubated with the bFGF-specific oligonucleotide radioactively labeled at the 5' end to a specific activity of 7.5 x 10' cpmi pmole. The autoradiogram exposed against Kodak X-0-mat S film for 14 days shows the bFGF mRNA in poly[A)-containing RNA from bovine brain (lane 1);Rama 27 fibroblastic cells (lane 2); Rama 25 epithelial cells (lane 3); Rama 29 myoepithelial-like cells (lane 4); and rat brain (lane 5). B: The filter was then incubated with actin cDNA labeled to a specific activity of 6 x 10' dpmipg. The bands of hybridization to actin mRNA after 4 h autoradiographic exposure are shown. The rat actin cDNA hybridizes poorly to bovine actin mRNA (lane 1).

RESULTS Stromal and myoepithelial-like cells express mRNAs for aFGF and bFGF in culture The synthetic oligonucleotide corresponding to bovine bFGF and the synthetic gene corresponding to human bFGF (bFGF mobes) hybridized to mRNA molecules of 6.950.4 Kb and 4.0k0.4 Kb in size-fractionated poly(A)-containing RNA from bovine pituitary gland (not shown) and to molecules of7.1+0 Kb and 3.820.1 Kb from bovine brain (Fig. 1).These molecular sizes

corresponded to previously reported values of 7 Kb and 3.5 to 3.7 Kb for bFGF in these tissues (Abraham et al., 1986a; Alterio et al., 1988). The bFGF probes also hybridized, under appropriate conditions, to size-fractionated poly(A)-containing RNA isolated from rat brain. The hybridization band corresponded in size to mRNA of5.7t0.2 Kb (Fig. 11, in agreement with that o f 6 Kb found by Shimasaki et al. (1988) in rat brain and hypothalamus. A single mRNA of the same size as that above is also

337

b F G F SYNTHESIS IN RAT MAMMARY CELL LINES

TABLE 2. Quantification of the relative levels of aFGF and bFGF transcripts in rat brain and mammary cell lines

Cell line or tissue Rat brain Rama 29 myoepithelial-like Rama 25-14 intermediate myoepithelial-likeiepithelial Rama 25-11 intermediate myoepithelial-likeiepithelial Rama 25-12 intermediate myoepithelial-likeiepithelial Rama 25 epithelial Rama 27 fibroblastic

Basic FGF Quantification of Quantification by dot-blot hybridization‘ Northern hybridization’ 2.2 i 0.6 (3) 1.9 2 0.4 (3) 1.0 (41 1.0 (5) 0.21 2 0.2 ( 3 ) 0.29 i 0.03 (3) 0.37 t 0.1 (3) 0.2 i 0.1 (4) 0.3 0.1 15) 0.4 0.2 ( 3 ) n.d.

*

*

Acidic FGF: Quantification of Northern hybridization’ 10 ? 6.0 (3) 1.0 (3) -

0.6 6

?

i-

0.2 (3) 5.0 (3)

‘RNA was fractionated by agarose gel electrophoresis, transferred to nylon filters, and incubated with the bFGF oligonucleotide or the human bFGF synthetic gene labeled to high specific activities with [w3*P1-dCTP (“Materials and Methods”). DNA which hybridized was detected by autoradiography and the autoradiographic image was scanned using a chromatogram scanner. The filters were subsequently incubated with a 3’P-labeled constitutive actin-specific DNA and the bands of hybridization detected and quantitated as for the bFGF. The hybridization to the bFGF mRNA for each sample was corrected for variation in the actin mRNA content, and for cach experiment a ratio of the corrected hybridization of each sample to that or the Rama 29 cell line RNA was established. The results show the mean +SD of the ratios obtained in the no, o f indepcndent experiments indicated in parentheses. ’Increasing amounts of poly(AJ-containing RNA or total RNA were spotted onto Hyhond or Zeta-probe filter membranes. The filters were incubated with the human bFGF or aFGF synthetic genes labeled to a high specific activity with [u-.”Pl-dCTP (“Materials and Methods”). Radioactivity which hybridized was detected by autoradiography and the autoradiographic images were scanned using a chromatogram scanner. The same filter: or duplicates prepared a t the same time, were incubated with a “2P-laheledconstitutive actin-specific cDNA and the hybridized DNA detected and scanned as for the bFGF. The best-fit straight line of peak absorbanceldot plotted against p.g RNNdot was obtained by linear regression (Dunn, 1977). The gradient for each RNA sample is corrected for variation in the hybridization to the actin cDNA, and the resultant corrected gradient expressed relative to that of Rama 29 cells for each experiment. The results are the mean of the ratiosiSD obtained in the no. of independent expcriments shown in parentheses.

present in poly(A)-containing RNA isolated from the rat mammary fibroblast cell line, Rama 27, and from the rat mammary myoepithelial-like cell line, Rama 29 (Fig. 1).An additional, minor mRNA of 1.1Kb was also observed in the Rama 27 cells (Fig. 1).In contrast, bFGF mRNA was present a t a lower, almost undetectable level in the epithelial cell line, Rama 25 (Fig. 1). The relative levels of bFGF mRNA, quantified from the Northern hybridizations and additional dot-blot hybridization experiments, and corrected for hybridization to actin cDNA, gave very similar results (Table 2). The level of bFGF mRNA in the myoepithelial-like Rama 29 cell line was 2.5 times that in the fibroblastic Rama 27 cell line and half that in rat brain, but 4- to 5-fold greater than in the epithelial Rama 25 cells. This result is not specific for the Rama 29iRama 25 cell system since the relative levels of bFGF mRNA in a myoepithelial-like cell line from normal rat mammary gland, Rama 711 (Ormerod and Rudland, 19851, was 3to 7-fold greater than in its parental Rama 704 epithelial cells (result not shown). In cell lines morphologically and biochemically intermediate between the parental Rama 25 cells and the Rama 29 cells, the increase in the level of bFGF mRNA observed in Northern hybridization experiments apparently occurred mainly between the intermediate Rama 25-12 cells and the Rama 25-11 cells (Fig. 2A). However, when the filters were subsequently hybridized with a cDNA for non-muscle actin (Fig. 2B), it became clear that less Rama 25-12 RNA had been loaded onto the gel than had Rama 25 epithelial of Rama 25-11 RNA. Thus, it is likely that the increase in the mRNA for bFGF occurred between Rama 25 epithelial cells and the Rama 25-12 cells. The actin signal for the RNA from the Rama 29 cells was also low (Fig. 2B, lane 51, suggesting that less Rama 29 mRNA had been loaded than for the Rama 25-14 RNA, and that after correction for hybridization to actin, there may also be a large increase in bFGF mRNA expression between the Rama 25-14 cells and Rama 29 cells. Quantification by dot-blot experiments (Table 2) supports the deduction of a n increase in expression of bFGF

mRNA between the epithelial Rama 25 and the myoepithelial-like Rama 29 cells. However, the low levels of bFGF mRNA in the Rama 25 and Rama 25-12 cells is very close to the limit of sensitivity of the hybridization procedures and the results are not precise enough to quantify the differences between these particular cell lines. The apparent decrease in the transition from Rama 25-11 to Rama 25-14 in the Northern blot experiments (Fig. 3) was due to a slightly higher level of degradation of this particular sample of RNA. When the dot-blot hybridization results are corrected for variation in mRNA loading (Table 2) the reduction in mRNA levels in the Rama 25-14 cells was due to the previously reported fact that the level of actin is increased in Rama 25-14 cells compared to the other cells in the series (Rudland et al., 1986) and that it is likely that the increase in actin protein is reflected by increased levels of actin mRNA. The oligonucleotide corresponding to aFGF, and the human synthetic aFGF gene (aFGF probes) hybridized to mRNA molecules of 4.4r0.4 Kb in bovine pituitary gland RNA and to mRNA molecules of 8.1,3.7,2.3, and 1.2 Kb in bovine brain mRNA (of which that at 3.7 Kb was the major band) (Fig. 3). These values corresponded approximately to those previously reported by Alterio e t al. (1988) of 9.9,4.2, and 2.5 Kb (4.2 Kb being the major band). In the present experiments, the aFGF probes hybridized to a single mRNA a t 3.820.5 Kb in rat brain poly(A)-containing RNA and to a mRNA of 3.9+0.4 Kb in poly(A)-containing RNA from the fibroblastic Rama 27 cell line. Only very low levels of hybridization were detectable to the RNA from either the myoepithelial-like Rama 29 or the epithelial Rama 25 cell lines (Fig. 3; Table 21, the level of mRNA being 1710 and 10%of the levels in the fibroblastic Rama 27 cells, respectively.

Identification of FGF synthesized by stromal and myoepithelial-likecells The aFGF and bFGF bind strongly to heparin such that they are eluted from heparin sepharose by 1.1M and 2 M NaC1, respectively (Burgess and Maciag,

338

BARRACLOUGH ET AL.

A

A

1

2

3

4

2

1

5

3

4

5

23-

23 9.4 6.6-

4.4-

4.4 -

2.0 -

2.0-

Kb

2 KbKb

B

2Kb-

B Fig. 2. bFGF transcripts in rat mammary cell lines of morphology intermediate between the epithelial and myoepithelial-like cells. A. Samples of poly(A)-containing RNA preparations (10 p,g) were subjected to asarose gel electrophoresis, transferred to nylon filters, and incubated with the bFGF-specific oligonucleotide radioactively 1abeled at the 5' end to a specific activity of 8 x lo6 cpdpmol. The autoradiogram exposed against Kodak X-AR 5 film for 13 days shows the bFGF mRNA in poly(A)-containingRNA from Rama 25 epithelial cells (lane 1); Rama 25-12 intermediate cells (lane 2); Rama 25-11 intermediate cells (lane 3); Rama 25-14 intermediate cells (lane 4); Rama 29 myoepithelial-like cells (lane 5). B: The filter was then incubated with rat actin cDNA as described in the legend to Figure 1.

1989). This fact was used to establish whether epithelial cells Rama 25, myoepithelial-like cells Rama 29, and fibroblastic cells Rama 27 contained aFGF or bFGF. The 1.1 M and 2 M NaCl heparin sepharose

Fig. 3 . aFGF transcripts in rat mammary cell lines and in rat and bovine tissue. A Samples of poly(A)-containingRNA preparations (10 kg) were subjected to agarose gel electrophoresis, transferred to nylon filters, and incubated with the aFGF-specific oligonucleotide radioactively labeled at the 5' end to a specific activity of 3.6 x lo6 cpm/pmol. The autoradiogram exposed against Kodak X-AR 5 film for 9 days shows the aFGF mRNA in poly(A)-containingRNA from bovine brain (lane l),Rama 27 fibroblastic cells (lane 2), Rama 25 epithelial cells (lane 3), Rama 29 myoepithelial-like cells (lane 4), and rat brain (lane 5). B: The filter was then incubated with rat actin cDNA as described in the legend to Figure 1. The rat actin cDNA hybridizes poorly to bovine actin mRNA (lane 1).

eluates, but neither the unbound fraction nor the 0.6 M NaCl wash of the extracts of myoepithelial-like and fibroblastic cells stimulated the synthesis of 13Hl-DNA in Rama 27 cells (Fig. 4). In contrast none of the fractions of the extract of the epithelial Rama 25 cells contained any stimulator activity (Fig. 4). When medium conditioned by 5 x 10 Rama 25, Rama 29, or Rama 27 cells was fractionated on heparin sepharose, no ['HIDNA stimulatory activity was observed in either the 1.1M or 2 M NaCl fractions (not shown). bFGF activity was also found in extracts of the myoepithelial-like Rama 711 cells but not in their parental epithelial Rama 704 cells (not shown). Both the 1.1 M and 2 M NaCl heparin sepharose eluates from an extract prepared from lo8 Rama 29 cells displaced 112511-bFGF

z

339

bFGF SYNTHESIS IN RAT MAMMARY CELL LINES

120

J

T T

-

0 0

8

unbound 0.6M 1.1M heparin sepharose fraction

2M

1

2 4 6 8 1 volume eluate (pl)

0

BI

control

Fig. 4. Stimulation of DNA synthesis in Rama 27 cells by epithelial Rama 25 (Hr, myoepithelial-like Rama 29 (@I, and fibroblastic Rama 27 cell extracts fractionated on heparin sepharose, as described in “Materials and Methods.” Twenty microliters of each fraction was assayed in triplicate, and the results are expressed as the mean percentage of the maximum stimulation (observed in the presence of 5% fetal calf serum) 2SD. Control is the mean percentage of the maximum stimulation i S D observed in the absence of any additions.

(m)

0 0

from the surface of Rama 27 cells (Fig. 5). It has previously been shown that the fibroblastic Rama 27 cells possess both high- and low-affinity receptors specific for bFGF (Fernig e t al., 1990b). Volumes of the eluates larger than those used in the displacement assay were found to interfere with the binding of [lZ51]-bFGFin control experiments. Thus it was not possible to construct a full displacement curve. The amount of displacement observed in Figure 5 with both the 1.1M and 2 M NaCl heparin sepharose eluates was consistent with the amount of bFGF activity present in the two eluates estimated from a bioassay (100-400 ngi ml). In view of the relatively low concentration of [1251]bFGF used (5 ngiml), the data in Figure 5 were also consistent with the majority of the displacement being from high-affinity receptors which have a K, of 46k 12 pM (Fernig et al., 1990b) rather than from low-affinity receptors which have a Kd of the order of 100 mM (Fernig et al., 1990b). These observations indicated that myoepithelial-like and fibroblastic cell lines synthesized FGF which remained associated with the cultured cells, whilst the epithelial cells failed to synthesize FGF. Quantification of the FGF synthesized by myoepithelial-like and stromal cells To quantify the amount of FGF synthesized by the rat mammary cell lines, dose-response curves were constructed and compared to a standard dose-response curve (not shown) of pure bovine pituitary bFGF (Fernig et al., 1990b). Since aFGF is about 100 times less potent in this assay than bFGF (Smith, J.A., unpublished), amounts of FGF are expressed in terms of ng of bFGF for purposes of simplicity. A total of 18 ng

2 4 6 8 1 volume eluate (PI)

0

Fig. 5. Displacement of [‘251]-bFGF(5 ngiml) from Rama 27 cell monolayers by heparin sepharose eluates from Rama 29 cells extracted as described in “Materials and Methods.” A scaled-up preparation of 10” myoepithelial-like Rama 29 cells was extracted and fractionated on a 3 ml column of heparin sepharose as described in “Materials and Methods” in order to provide the necessary quantities of FGF for analysis. Displacement by (A) 1.1 M NaCl and (B) 2 M NaCl eluates are shown. Non-specific binding was determined by the inclusion of a 1,000-fold excess of unlabeled pure bovine pituitary bFGF and did not exceed 30% of the total binding. Displacement data were determined in quadruplicate and expressed a s the mean cps i SD of the [‘2511-bFGFspecifically bound.

FGF was recovered from 5 x lo6 fibroblastic Rama 27 cells (Table 3; Fig. 6e), and a total of 35 ng FGF per 5 x lo6 myoepithelial-like Rama 29 cells (Table 3; Fig. 6a). The cell lines intermediate between the epithelial Rama 25 and myoepithelial-like Rama 29 all synthesized cell-associated FGF. Rama 25-12 cells which are developmentally closest to the epithelial Rama 25 cells produced significantly less FGF than the myoepithelial Rama 29 cells, a total of about 14 ng per 5 x lo6 cells (Table 3; Fig. 6d). Rama 25-11 cells which have considerably more myoepithelial-like characteristics produced 19 ng FGF per 5 x lo6 cells (Table 3; Fig. 612). Rama 25-14 cells which are the most myoepithelial-like of the intermediate cell lines produced a similar amount of FGF to that produced by Rama 29 cells (Table 3; Fig. 6b). A total of 170 ng of FGF was detected in a n extract of virgin rat mammary gland (Table 3; Fig. 6f). This is a relatively low figure when compared to the amount of FGF recovered from the rat mammary cell lines. However, the extraction procedure was optimized for cells in culture rather than in tissue, and thus it is possible that not all the FGF was extracted.

340

BARRACLOUGH ET AL.

TABLE 3. Quantification of FGF recovered from rat mammary cells in culture and virgin rat mammary gland Cell line or tissue’ Rama 27 fibroblasts Rama 29 myoepithelial-like Rama 25-14 intermediate myoepithelial-like/epithelial Rama 25-11 intermediate myoepithelial-likdepithelial Rama 25-12 intermediate myoepithelial-likeiepithelial Rama 25 epithelial Virgin rat mammary gland

FGF recovered from heparin sepharose columns 1.1 M NaCl eluate’ 2 M NaCl eluate2 6 i 0.9 13 -c 5.6 10 i 8.1 25 -C 14 13 i 6.0 25 i 11 7.7 3.4 11 -+ 5.6 9 i 5.7 4.8 i 1.5 0 0 56 ? 29 110 36

*

*

’The amounts of activity correspond to that extracted from either 5 x lo6 cells or 3.4 g (wet weight) rat mammary gland. One extraction of r a t mammary gland tissue and two independent extractions of the cells were carried out. ‘Dose-response curves were constructed for each eluate and were compared to a standard dose-response curve for pure bovine pituitary bFGF which has a n ED,, of40 pgiml in this assay. The total amount of bFGF activity in 1ml oieluate was t h e n calculntcd. For purposes of simplicity the activity eluting a t 1.1 M NaCl from heparin sepharose is described in terms of ng of bFGF, although aFCF is about 100-fold less potent in this assay. Results are expressed as the mean total nanograms bFGF activity recovered +SE.

Localization of cell-associated bFGF in Rama 29 cells To localise the bFGF associated with Rama 29 cells, the cells were treated with Triton X-100, 2 M NaC1, trypsiniEDTA, or EDTA as described in “Materials and Methods.” The incubation of cells with 0.05% Triton X-100 extracts the cytoplasm and nucleoplasm, leaving a cellular residue on the culture dish which consists not only of extracellular matrix (Folkman et al., 1989), but also of actin-containing cytoskeletons (Heuser and Kirshner, 1980). When 5 x lo6 Rama 29 cells were incubated with 0.05% Triton X-100, 50-90% of the total cell-associated bFGF, eluting at 2 M NaCl from heparin sepharose, was present in the Triton X-100resistant cellular residue (Table 4). The bFGF which was extracted by Triton X-100 (Table 4) may be localized either in the cytoplasm or in the nucleoplasm or may be associated with a readily soluble membrane component. Incubation of cells with 2 M NaCl will release bFGF from heparin-like molecules (Burgess and Maciag, 1989).This treatment removed 50-65% of the cell-associated FGF, suggesting that it is associated with heparin-like molecules (Table 4). Detaching Rama 29 cells from the substratum with trypsiniEDTA had no effect on the total amount of bFGF activity recovered (not shown). However 10-24% of the bFGF that was originally associated with the cells was now recovered in the supernatant (Table 4). The detachment of cells with EDTA did not partition the bFGF into the cell supernatant or the substratum remaining on the culture dish (Table 4).

DISCUSSION The aFGF probes detected mRNAs identical with those reported in the literature for r a t and bovine brain (Fig. 3). In the fibroblastic cell line Rama 27, hybridization to aFGF mRNA was clearly visible (Fig. 3), but hybridization to aFGF mRNA was a t a much lower level in both Rama 25 and Rama 29 cells (Fig. 3). Thus the pattern of synthesis of aFGF mRNA in cells derived from the mammary stroma (Rama 27) is different from t h a t in cells derived from the mammary epithelium. The extracts of the myoepithelial-like Rama 29 and the stromal Rama 27 cells (Figs. 4,6) contained some FGF activity which eluted from heparin sepharose a t 1.1 M NaC1, which is characteristic of aFGF. This ac-

tivity was absent from extracts of Rama 25 cells (Fig. 4). However, aFGF mRNA was only detected in any significant amount in the fibroblastic Rama 27 cells. There are three possible explanations for this result. First, in the myoepithelial-like Rama 29 cell line, the low level of aFGF mRNA may be translated at high efficiency compared to the bFGF mRNA. However, since aFGF is 100-fold less active on a molar basis than bFGF in stimulating DNA synthesis in Rama 27 (Smith, J.A., unpublished) and other cells (Burgess and Maciag, 1989) the translational efficiency of the aFGF mRNA would have to be considerably greater than that of the bFGF mRNA. Second, the myoepithelial-like cells may synthesize a heparin-binding growth factor which is distinct from either aFGF or bFGF, which is also associated with the cells and binds to the FGF receptors. Third, the activity eluting from heparin sepharose at 1.1 M NaCl may be a modified form of bFGF with a reduced affinity for heparin. This modification may arise from the isolation procedure (Seno et al., 1988), or it may result from a posttranslational modification of bFGF in vivo such a s phosphorylation (Feige and Baird, 1989). At present we cannot distinguish between these possibilities, and therefore we are unable to determine whether aFGF may be a local growth factor specifically produced by cells from the mammary stroma. The bFGF probes detected mRNAs identical with those reported in the literature for r a t brain, bovine brain, and pituitary (Fig. 1). bFGF mRNA was present in the fibroblastic Rama 27 and myoepithelial-like Rama 29 cells, but was virtually absent from the epithelial Rama 25 cells (Table 2, Fig. 1). bFGF activity, eluting from heparin sepharose at 2 M NaCl, was only present in the fibroblastic Rama 27 cells and in the cells of the myoepithelial differentiation pathway in vitro (Figs. 4,6). Quantification of the bFGF activity of the cuboidal epithelial Rama 25 and elongated myoepithelial-like Rama 29 cells (Table 3, Fig. 6) indicated that the level of bFGF activity present in the cells broadly reflected the relative level of its mRNA. Quantification of the relative levels of the bFGF mRNAs and activity in the cells of intermediate morphology was not precise enough t o determine the exact stages at which these increases occurred. Studies in vitro indicate that bFGF activity is susceptible to proteolysis, unless the protein is bound to heparin (Sommer and Rifkin, 1989; Saksela et al.,

341

bFGF SYNTHESIS IN RAT MAMMARY CELL LINES

120

80

40

0 .1

10

1

100

.1

-

.?

120-

m -

1

100

10

E

.

3

E 80._

40E 1

E

.-" 0

1

100 m

10

.1

1

10

100

1

10

100

E

s 120

C

1

80

40

0

.1

1

10 l o g

100

v o l u m e

.1 e l u a t e

(PI)

Fig. 6. Concentration dependence of the stimulation of L"H]-DNA synthesis in Rama 27 cells by the 1.1 M NaCl ( 0 ) and 2 M NaCl (A)heparin sepharose eluates from (A) myoepithelial-like Rama 29 (B) intermediate epithelial-myoepithelialRama 25-14: C, intermediate Rama 25-11; D, intermediate Rama 25-I2, (E)fibroblastic Rama 27, (F) virgin rat mammary gland. Results are expressed as the mean percentage of the maximum stimulation (observed in the presence of 5% fetal calf serum) i S D of triplicate determinations.

1988). Thus the observation that Rama 29 cell-associated bFGF was resistant to inactivation by trypsin suggests that the bFGF was either associated with a heparin-like molecule on the cell exterior or was in a n intracellular compartment which is thus inaccessible to trypsin. The result obtained by extracting cells with Triton X-100 suggests a similar conclusion: 50-90% of the bFGF was associated with Triton X-100-resistant structures such as the extracellular matrix or cytoskeleton; 10-50% was in a detergent labile compartment such a s the cytosol. Since 50%-65% of the cell-associated bFGF was removed by treating Rama 29 cells with

2 M NaCl (Table 4), it would seem reasonable to suggest that the Triton X-100 and trypsin-resistant bFGF are the same pool of molecules which are associated with heparin-like molecules of the extracellular matrix. Since treatment with EDTA neither released bFGF from the cells nor partitioned bFGF into the substratum, such heparin-like molecules must be closely associated with the cell-surface. The observation that 35-50% of the cell-associated bFGF was refractory to extraction by 2 M NaCl (Table 4)may indicate t h a t this proportion of the bFGF is unable to be released from its association with a heparin-like molecule for steric rea-

342

BARRACLOUGH ET AL.

Two classes of receptors for bFGF are present in rat mammary stromal and myoepithelial-like cells, a highaffinity site, probably responsible for signal transduc% total Treatment’ Fraction’ activity present3 tion, and a low-affinity site which does not appear to be directly involved in signal transduction (Fernig et al., Cellular residue 50-90 Triton-X-100 (3) 1990b). Both are developmentally regulated as are the 10-50 Cell extract bFGF mRNA, and the bFGF described in this study (Fernig et al., 1990b). Therefore a potential autocrinei Cellular residue 50-65 paracrine loop is created when cuboidal epithelial cells 2 M NaCl (2) 35-50 Cell extract differentiate in vitro to myoepithelial cells, e.g., the Rama 25 line (Paterson and Rudland, 1985; Rudland et Detached cells 76-90 al., 1986; Barraclough et al., 1987). However, myoepiTrypsimEDTA (3) thelial-like convertants do not grow in a n uncontrolled Supernatant 10-24 manner (Rudland, 1987; Fernig et al., 1990a), a fact Detached cells 100 which suggests that the bFGF is sequestered in a comEDTA Supernatant 0 (1) partment (extracellular matrix or cytoplasm) separate Cellular residue 0 from the cell-surface high-affinity receptors. The acti‘The extraction of 3 x lo6 Rama 29 cells by Triton X-100, 2 M NaC1, trypsin: vation of this autocrineiparacrine loop would require EDTA or EDTA was carried out as described i n “Materials and Methods.” the bFGF to be released from the structures in which it ‘The fractions obtained after the diferent treatments correspond to those described in “Materials and Methods.” is sequestered. The differentiation of cuboidal epithe3Dose-response curves for the 2 M eluate from a 250 ~1 column of heparin lial cells to myoepithelial cells in vitro through a series sepharose were constructed and the percentage of the total bFGF activity recovered partitioned into each fraction was calculated. When more than one indeof morphological intermediates (Paterson and Rudpendent experiment was carried out, the range is given, with the no. of experiland, 1985, Rudland et al., 1986; Barraclough e t al., ments in parentheses. 1987) is also observed in vivo (Ormerod and Rudland, 1984).Thus the detection of FGF in r a t mammary tissue (Table 3; Fig. 6) suggests that the above considersons or remains in the cell interior. Although treat- ations may apply in vivo as well as in vitro. In endothelial cells the low-affinity receptor is ment of cells with trypsiniEDTA did not appear to cause a decrease in the total amount of bFGF activity thought to be a heparin-like molecule (Moscatelli, recovered, i t did release 10-24% of the bFGF from the 1987; Saksela et al., 1988) which appears to have the Rama 29 cells. Thus it is possible that a proportion of potential to modulate the release of bFGF (Flaumenthe bFGF is associated with a trypsin labile structure haft et al., 1989; Presta et al., 1989) and hence moduwhich nevertheless has heparin-like properties. In late the autocrinelparacrine loop described above. Dursummary, it seems likely that a t least 50-65% of the ing the normal growth of the mammary gland, the Rama 29 bFGF is associated with the extracellular ma- remodeling of the basement membrane that occurs trix, but that the intracellular localization of a sub- with the extension of the mammary ductal tree into the stantial amount of Rama 29 bFGF cannot be dis- fatty stroma may release bFGF from the basement counted. Studies on other cell systems such as membrane and this bFGF could act on the intermediosteoblasts (Globus et al., 1989), endothelial cells (Vlo- ate cells of the terminal ductal structures or end buds. davsky et al., 1987), and cardiac myocytes (Weiner and Similar considerations apply during local invasion of Swain, 1989) have also suggested t h a t the bFGF syn- mammary tissue by benign tumors. This suggests t h a t thesized by these cells is sequestered and stored by the FGF may play a major role in normal mammary develextracellular matrix, In murine skeletal muscle (Di- opment and in the growth of mammary tumors. Mario et al., 1989), the Englebreth Holm Swarm sarACKNOWLEDGMENTS coma (Vigny et al., 1988) and Descemet’s membrane We thank Shanez Anandappa, Sarah Bottomley, (Folkman et al., 1989), bFGF has been localized on the basement membrane, and in the latter two tissues i t Helen Cox, Inge Holm, and Sian Hudson for expert has been shown t o bind heparan sulfate glycosamino- technical assistance and the Cancer Research Camglycans. However, bFGF lacks a conventional secretory paign and the North West Cancer Research Fund for signal sequence (Gospodarowicz e t al., 1987; Gospo- generous financial support. darowicz, 1989; Burgess and Maciag, 19891, so the LITERATURE CITED mechanism whereby newly synthesized bFGF reaches Abraham, J.A., Mergia, A., Whang, J.L., Tumulo, A,, Friedman, J., the cell exterior is unclear. It has been suggested t h a t Hjerrid, K.A., Gospodarowicz, D., and Fiddes, J.C. (1986a) Nuclesome bFGF is localized in the cell interior of endotheotide sequence of a bovine clone encoding the angiogenic protein, lial cells, although this has not been demonstrated unbasic fibroblast growth factor. Science, 233545-548. equivocally (Rifkin and Moscatelli, 1989). Myoepithe- Abraham, J.A., Whang, J.L., Tumulo, A., Mergia, A,, Friedman, J., Gospodarowicz, D.: and Fiddes, J.C. (1986b) Human basic fibroblast lial-like cells secrete basement membrane components growth factor: Nucleotide sequence and genomic organisation. in vitro (Rudland et al., 1982, 1986; Warburton et al., EMBO J.,59523-2528. 1982a; Barraclough et al., 1987), whilst in the mam- Alterio, J., Halley, C., Brou, C., Soussi, T., Courtois, Y., and Laurent, M. (1988) Characterisation of a bovine acidic FGF cDNA clone and mary gland basement membrane is associated with its expression in brain and retina. FEBS Letts., 242r41-46. myoepithelial cells (Warburton et al., 1982b). This J.C., Kemp, D.J., and Stark, G. (1977) Method for the detecraises the possibility that the bFGF, synthesized by the Alwine, tion of specific RNAs in agarose gels by transfer to diazobenzymyoepithelial-like cells, is stored on a heparan sulfate loxymethyl-paper and hybridization with DNA probes. Proc. Natl. Acad. Sci. U.S.A., 12.5350-5354. glycosaminoglycan which is secreted by these cells Aviv, H.: and Leder, P. (1972) Purification ofbiologically active globin along with other basement membrane components.

TABLE 4. Partitioning of Rama 29 bFGF into cell extracts and residues after different treatments

bFGF SYNTHESIS IN RAT MAMMARY CELL LINES

mRNA by chromatography on oligothymidylic acid-cellulose. Proc. Natl. Acad. Sci. U.S.A., 69:1408-1412. Bailey, J.M., and Davidson, N. (1976) Methylmercury as a reversible denaturing agent for agarose gel electrophoresis. Anal. Biochem., 70t75-85. Barraclough, R., Kimbell, R., and Rudland, P.S. (1987) Differential control of mRNA levels for Thy-1 antigen and laminin in rat mammary epithelial and myoepithelial-like cells. J. Cell. Physiol., 132: 393-401. Bennett, D.C., Peachy, L.A., Durbin, H., and Rudland, P.S. (1978) A possible mammary stem cell line. Cell, 15r283-298. Birnboim, H.C., and Doly, J. (1979) A rapid alkaline extraction procedure for screening recombinant plasmid DNA. Nucleic Acids Res., 7r1513-1523. Burgess, W.H., and Maciag, T. (1989)The heparin-binding (fibroblast) growth factor family of proteins. Annu. Rev. Biochem., 58:575-606. Chirgwin, J.M., Przybyla, A.E., MacDonald, R.J., and Rutter, W.J. (1979) Isolation of biologically active ribonucleic acid sources enriched in ribonuclease. Biochemistry, 18r5294-5299. Dembinski, T.C., and Shiu, R.P.C. (1987) Growth factors in mammary gland development and function. In: The Mammary Gland. M.C. Neville and C.W. Daniel eds. Plenum Press, New York, pp. 355381. DiMario, J., Buffinger, N., Yamada, S., and Strohman, R.C. (1989) Basic fibroblast growth factor in the extracellular matrix of dystrophic (mdx) mouse muscle. Science, 244t688-690. Dunn, O.J. (1977) Basic Statistics, 2nd Ed. John Wiley and Sons, New York. Fcige, J.J.,and Baird, A. (1989) Basic fibroblast growth factor is a substrate fur protein phosphorylation and is phosphorylated by capillary endothelial cells in culture. Proc. Natl. Acad. Sci. U.S.A., 86:3174-3178. Feinberg, A.P., and Vogelstein, B. (1984) A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem., 137366,267. Fernig, D.G., Smith, J.A., and Rudland, P.S. (1990a) Relationship of growth factors and differentiation in normal and neoplastic development of the mammary gland. In: Cell and Molecular Biology of Breast Cancer. M.E. Lippmann and R. Dickson, eds. Kluwer Nijhoff, Norwell MA, (in press). Fernig-, D.G., Smith, J.A., and Kudland, P.S. (1990bi Appearance of basic fibroblast growth factor receptors upon differentiation of rat mammarv eaithelial to mvoeaithelial-like cells in culture. J . Cell. “ I Physiol., “142:108-116. Flaumenhaft, R., Moscatelli, D., Saksela, O . , and Rifkin, D.B. (1989) Role of extracellular matrix in the action of basic fibroblast growth factor: Matrix as a source of growth factor for long-term stimulation of plasminogen activator production and DNA synthesis. J. Cell. Physiol., 14Ot75-81, Folkman, J., Klagsbrun, M., Sasse, J., Waszinski, M., Ingber, D., and Vlodavsky, I. (1989) A heparin binding protein-basic fibroblast growth factor-is stored within basement membrane. Am. J. Pathol., 130t393-400. Globus, R.K., Plouet, J., and Gospodarowicz, D. (1989) Cultured bovine bone cells synthesize basic fibroblast growth factor and store it in their extracellular matrix. Endocrinology, 124:1539-1547. Gospodarowicz, D. (1989) Expression and control of vascular endothelial cells: Proliferation and differentiation by fibroblast growth factors. J. Invest. Dermatol., 93~395-475. Gospodarowicz, D., Neufeld, G., and Schweigerer, R. (1987) Fibroblast growth factor: Structural and biological properties. J. Cell. Physiol., (Suppl. 5)t15-26. Han, J.H., Stratowa, C., and Rutter, W.J. (1987) Isolation of fulllength putative rat lysophospholipase cDNA using improved methods for mRNA isolation and cDNA cloning. Biochemistry, 26:16171625. Heuser, J.E., and Kirshner, M.W. (1980) Filament organization revealed in platinum replicas of freeze-dried cytoskeletons. J. Cell Biol., 86:212-232. Hunt, T., and Jackson, R.J. (1974) The rabbit reticulocyte lysate as a system for studying mRNA. Blut, 14:300-307. Jaye, M., Howk, R., Burgess, W., Ricca, G.A., Chiu, I.-M., Ravera, M., OBrien, S.J., Modi, W.S., Maciag, T., and Drohon, W.N. (1986) Human endothelial cell growth factor: Cloning, nucleotide sequence and chromosome localization. Science, 233t541-545. Kano-Sueoka, T. (1983) Factors affecting mammary cells in culture. In: Hiochemical Actions of Hormones. G. Litwack, ed. Academic Press, New York, vol. 10, pp. 163-185. Lyons, R.W., Li, C.H., and Johnson, R.E. (1958) The hormonal control of mammary growth and lactation and the growth of tumours. Recent Prog. Horm. Res., 94:219-254.

343

Maniatis, T., Fritsch, E.F., and Sambrook, J. (1982) Molecular Cloning: A laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Marics, I., Adelaide, J., Raybaud, F., Mattei, M.-G., Coulier, F., Planche, J.,de Lapeyriere, O., and Birnbaum, D. (1989) Characterization of the HST-related FGF.6 gene, a new member of the fibroblast growth factor family. Oncogene, 4:335--340. Moore, R., Casey, G., Brookes, S., Dixon, M . , Peters, G., and Dickson, C. (1986) Sequence, topography and protein coding potential of mouse int-2: A putative oncogene activated by mouse mammary tumor virus. EMBO J., 5r919-924. Moscatelli, D. (1987) High and low affinity binding sites for basic fibroblast growth factor on cultured cells: Absence of a role for low affinity binding in the stimulation of plasminogen activator production by bovine capillary endothelial cells. J. Cell. Physiol., 131: 123-130. Nandi, S.J. (1958) Endocrine control of mammary gland development and function in the C3HI He Crgl mouse. J.N.C.I., 21r1039-1055. Ormerod, E.J., and Rudland, P.S. (1984) Cellular composition and organisation of ductal buds in developing rat mammary glands: Evidence for morphological intermediates between epithelial and myoepithelial cells. Am. J . Anat., 17Ot631-652. Ormerod, E.J., and Rudland, P.S. (1985) Isolation and characterisation of cloned epithelial cell lines from normal rat mammary glands. In Vitro., 21t143-153. Paterson, F.C., and Rudland, P.S. (1985) Microtubule-disrupting drugs increase the frequency of conversion of a rat mammary epithelial stem cell to elongated myoepithelial-like cells in culture. J . Cell. Physiol., 125:135-150. Pelham, H.R.B., and Jackson, R.J. (1976) An efficient mRNA-dependent translation system from reticulocyte lysates. Eur. J. Biochem., 67t247-256. Presta, M., Maier, J.A.M., Rusnati, M., and Ragnotti, G. (1989) Basic fibroblast growth factor is released from endothelial extracellular matrix in a biologically active form. J. Cell. Physiol., 140:68-74. Radloff, R., Bauer, W., and Vinograd, J. (1967) A dye-bouyant-density method for the detection and isolation of cloned circular duplex DNA. The closed circular DNA in HeLa cells. Proc. Natl. Acad. Sci. U.S.A., 57t1514-1521. Rifkin, D.B., and Moscatelli, D. (1989) Recent developments in the cell biology of basic fibroblast growth factor. J. Cell Biol., 109:l-6. Kudland, P.S. (1987) Stem cells and the development of mammary cancers in experimental rats and in humans. Cancer Metastasis Rev., 6t55-83. Rudland, P.S., Bennett, D.C., and Warburton, M.J. (1979) Hormonal control of growth and differentiation of cultured rat mammary gland epithelial cells. Cold Spring Harbor Conf. Cell Prolif., 6:677699. Rudland, P.S., Paterson, F.C., Monaghan, P., Twiston Davis, A.C., and Warburton, M.J. (1986) Isolation and properties of rat cell lines morphologically intermediate between cultured mammary epithelial and myoepithelial-like cells. Dev. Biol., 113r388-405. Rudland, P.S., Twiston Davis, A.C., and Tsao, S.-W. (1984) Rat mammary preadipocytes in culture produce a trophic agent for mammary epithelia-Prostaglandin E,. J . Cell. Physiol., 120t364-376. Rudland, P.S. Warburton, M.J., Monaghan, P., and Ritter, M.A. (1982) Thy-1 antigen on normal and neoplastic rat mammary tissue: Changes in location and amount of antigen during differentiation of cultured stem cells. J.N.C.I., 68:799-811. Sanger, F., and Coulson, A.R. (1978) The use of thin acrylamide gels for DNA sequencing. FEBS Letts., 87:107-110. Saksela, O., Moscatelli, D., and Rifkin, D.B. (1988) The opposing effects of basic fibroblast growth factor and transforming growth factor Beta on the regulation of plasniinogen activator in capillary endothelial cells. J. Cell Biol., 105:957-963. Scno, M., Sasada, R., Iwane, M., Sudo, K., Kurokawa, T., Ito, K., and Igarashi, K. (1988) Stabilizing basic fibroblast growth factor using protein engineering. Biochem. Biophys. Res. Commun., 151:701708. Shimasaki, S., Emoto, N., Koba, A,, Mercado, M., Shibata, F., Cooksey, K., Baird, A., and Ling, N. (1988) Complementary DNA cloning and sequencing of rat ovarian basic fibroblast growth factor and tissue distribution study of its mRXA. Biochem. Biophys. Res. Commun., 157t256-263. Smith, J.A. Barraclough, B.R., Fernig, D.G., and Rudland, P.S. (1989) Identification of alpha transforming growth factor (aTGF) as a possible local trophic agent for the mammary gland. J. Cell. Physiol., 141t363-372. Smith, J.A., Winslow, D.P., and Rudland, P.S. (1984)Different growth factors stimulate cell division of rat mammary epithelial, myoepi-

344

BARRACLOl JGH ET AL.

thelial and stromal cell lines in culture. J. Cell. Physiol., 119r320326. Sommer, A,, and Rifkin, D.B. (1989) Interaction of heparin with human basic fibroblast growth factor: Protection of the angiogenic protein from proteolytic degradation by a glycosaminoglycan. J. Cell. Physiol., 138:215-220. Vigny, M., Ollier-Hartmann, M.P., Lavigne, M., Fayein, N., Jeanny, J.C., Laurent, M., and Courtois, Y. (1988) Specific binding of basic fibroblast growth factor to basement membrane-like structures and to purified heparan sulfate proteoglycan of the EHS tumor. J . Cell. Physiol., 13 7,321-328. Vlodavsky, I., Folkman, J.,Sullivan, R., Fridman, R., Ishai-Michaeli, R., Sasse, J., and Klagsbrun, M. (1987) Endothelial cell-derived basic fibroblast growth factor: Synthesis and deposition into suben-

dothelial extracellular matrix. Proc. Natl Acad. Sci. U.S.A., 84: 2292-2296. Warburton, M.J., Ferns, S.A., and Rudland, P.S. (1982a) Enhanced synthesis of basement membrane proteins during the differentiation of rat mammary epithelial cells into myoepithelial-like cells in vitro. Exp. Cell Res., 137:373-380. Warburton, M.J., Mitchell, D., Ormerod, E.J., and Rudland, P.S. (198213) Distribution of myoepithelial cells and basement membrane proteins in the resting, pregnant, lactating and involuting rat mammary gland. J. Histochem. Cytochem., 30567-676. Weiner, H.L., and Swain, J.L. 11989) Acidic fibroblast growth factor mRNA is expressed by cardiac myocytes in culture and the protein is localized to the extracellular matrix. Proc. Natl. Acad. Sci. U.S.A., 86:2683-2687.