Toxicology in Vitro 29 (2015) 1166–1171
Contents lists available at ScienceDirect
Toxicology in Vitro journal homepage: www.elsevier.com/locate/toxinvit
T-2 toxin inhibits gene expression and activity of key steroidogenesis enzymes in mouse Leydig cells Jian Ying Yang a,1, Yong Fa Zhang a,b,⇑,1, Xiang Ping Meng a, Yuan Xiao Li c, Kai Wang Ma a, Xue Fei Bai a a
College of Medical Technology and Engineering, Henan University of Science and Technology, Luoyang, Henan 471003, China College of Food and Bioengineering, Henan University of Science and Technology, Luo Yang, Henan 471023, China c College of Animal Science & Technology, Henan University of Science and Technology, Luo Yang, Henan 471003, China b
a r t i c l e
i n f o
Article history: Received 15 May 2014 Accepted 25 April 2015 Available online 8 May 2015 Keywords: T-2 toxin 3b-HSD-1 p450scc StAR CYP17A1 17b-HSD Enzyme activity Mouse Leydig cells
a b s t r a c t T-2 toxin is one of the mycotoxins, a group of type A trichothecenes produced by several fungal genera including Fusarium species, which may lead to the decrease of the testosterone secretion in the primary Leydig cells derived from the mouse testis. The previous study demonstrated the effects of T-2 toxin through direct decrease of the testosterone biosynthesis in the primary Leydig cells derived from the mouse testis. In this study, we further examined the direct biological effects of T-2 toxin on steroidogenesis production, primarily in Leydig cells of mice. Mature mouse Leydig cells were purified by Percoll gradient centrifugation and the cell purity was determined by 3b-hydroxysteroid dehydrogenase (3b-HSD) staining. To examine T-2 toxin-induced testosterone secretion decrease, we measured the transcription levels of 3 key steroidogenic enzymes and 5 enzyme activities including 3b-HSD-1, P450scc, StAR, CYP17A1, and 17b-HSD in T-2 toxin/human chorionicgonadotropin (hCG) co-treated cells. Our previous study showed that T-2 toxin (107 M, 108 M and 109 M) significantly suppressed hCG (10 ng/ml)-induced testosterone secretion. The studies demonstrated that the suppressive effect is correlated with the decreases in the levels of transcription of 3b-HSD-1, P450scc, and StAR (P < 0.05) and also in enzyme activities of 3b-HSD-1, P450scc, StAR, CYP17A1, and 17b-HSD (P < 0.05). Ó 2015 Elsevier Ltd. All rights reserved.
1. Introduction T-2 toxin is one of the mycotoxins, a group of type A trichothecenes produced by several fungalgenera including the Fusarium species (Cortinovis et al., 2013; IARC, 1993). It has been acknowledged as an unavoidable contaminant in human food, animal feed and agricultural products such as maize, wheat and oats, and has been reported in many parts of the world (WHO, 1990). Upon acute exposure to high dose of trichothecenes, animals exhibit clinical signs such as diarrhea, vomiting, leukocytosis and haemorrhage (Ueno, 1984). At extremely high dose, trichothecenes can cause shock-like syndromes that can result in death. Chronic exposure to trichothecenes can cause anorexia, weight loss, diminished nutritional efficiency, neuro-endocrine changes and immune modulation (Rotter et al., 1996). Among the trichothecenes, T-2 toxin is the most toxic compound (Gutleb et al., 2002). Studies have demonstrated the ⇑ Corresponding author at: College of Food and Bioengineering, Henan University of Science and Technology, Luo Yang, Henan 471023, China. Tel.: +86 379 64282342. E-mail address: [email protected] (Y.F. Zhang). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.tiv.2015.04.020 0887-2333/Ó 2015 Elsevier Ltd. All rights reserved.
negative effects of exposure to T-2 toxin on the immune system and digestive system, including the oral cavity, esophagus, and stomach (Canady et al., 2001). In addition, Studies have demonstrated the toxic effects of T-2 toxin on the semen quality, fertility and serum testosterone concentration in mice (Yang et al., 2010). However, these reproductive toxicities of T-2 toxin for testicular function have mostly relied on the in vivo approach of using animal models. Complications in pharmacokinetic distribution and secondary effects attributed to other unidentified factors may make it difficult to decipher the direct mechanistic toxicities of T-2 toxin to the cells. It is well known that Leydig cells play a crucial role in synthesizing testosterone and regulating the process of spermatogenesis. The alteration of Leydig cell function can lead to adverse effects on testicular functions. Therefore, we researched Leydig cells in mice to determine direct biological effects of T-2 toxin to validate the in vivo findings, and the results showed a direct suppression of testosterone secretion (Yang et al., 2014). However, no detailed data concerning the effects of exposure to this toxin on the molecular mechanism of decreasing the testosterone secretion are available. In this study, the aim was to elucidate the effects of T-2 toxin on hCG-stimulated steroidogenesis in Leydig cells of mice. To determine the molecular mechanism, the effect of T-2
J.Y. Yang et al. / Toxicology in Vitro 29 (2015) 1166–1171
toxin on hCG-stimulated mRNA levels and activities of key steroidogenic enzymes were measured. 2. Materials and methods T-2 toxin was obtained from Sigma Chemical Company (St Louis, MO). A stock solution was prepared in dimethyl sulfoxide and was stored at 20 °C. The working solution was prepared by dispensing the stock solution into fresh sterilized peanut oil. All experimental animal use and experimental design for this study was approved by the Chinese Association for Laboratory Animal Sciences. 2.1. Cell culture Leydig cells were isolated from the testis of 60–90 day-old Kunming mice. The cells were cultured for 2 days according to Biegel et al. (1995). The testis was decapsulated, and digested in Erlenmyer flasks within an oscillating incubator (100 r.p.m and 34 °C) for 15 min by M199 medium containing 0.05% collagenase and 1% BSA. The suspension cells were transferred to a 50 ml tube and kept on ice for 2 min to allow the tubules to settle. The supernatant containing Leydig cells was filtered through a 70 lm nylon cell strainer (BD Biosciences). The cells were centrifuged at 350 g for 20 min at 4 °C. The pellet was re-suspended in 10 ml M199 and loaded onto the top of a Percoll gradient (5%, 30%, 58% and 70%) (Sigma) and centrifuged at 800 g for 30 min at 4 °C. The cells in the third layer were collected, washed twice with M199 medium, and were re-suspended in phenol red free-DMEM/F12 (1:1) containing 10% charcoal stripped fetal calf serum (GeminiBio-Products, Woodland, CA, USA), 50 U/ml penicillin and 50 lg/ml streptomycin (GIBCO/BRL, Carlsbad, CA, USA). The cells were plated at a density of 105 cells/cm2 in 24-well plates (Nunc, Nalge Nunc International, Rochester, NY, USA) at 0.5 ml/well and maintained at 37 °C with 5% CO2. 2.2. Histochemical staining of 3b-HSD and testosterone induction assay Following 2 days of incubation, the purity of Leydig cells was examined by histochemical staining for 3b-hydroxysteroid dehydrogenase, according to the histochemical method reported by Mendelson with some modifications (Mendelson et al., 1975). In brief, Leydig cells were incubated in a 24-well plate with 0.4 ml/well staining solution containing 0.05 M PBS, pH 7.4 supplemented with 0.2 mg/ml nitro-blue tetrazolium (Sigma Chemical Co.), 1 mg/ml NAD and 0.12 mg/ml dehydroepiandrosterone (Sigma Chemical Co) for 90 min at 34 °C. The positive cells were stained a dark blue color and the purity of the Leydig cells was observed to be over 90%. Secondly, in the testosterone induction assay, Leydig cells were exposed to 10 ng/ml human chorionic gonadotrop (hCG) (Sigma Chemical Co) for 24 h. 2.3. Cell treatment Two-day cultured Leydig cells grown in phenol red-free DMEM/F12 medium supplemented with 10% charcoal stripped fetal calf serum and antibiotics (50 U/mL penicillin and 50 lg/mL streptomycin) were washed three times in 0.05 M PBS pH 7.4. The conditioned media (phenol red-free DMEM/F12 medium supplemented with 50 U/mL penicillin and 50 lg/mL streptomycin and the corresponding leveled-drugs and 10 ng/mL hCG) were added to the 24-well plates at 0.3 mL/well. The Leydig cells were
1167
exposed for 24 h to one of the following four treatments: (i) 10 ng/mL hCG (Sigma) + dimethyl sulfoxide (DMSO) (Sigma) solvent control; (ii)10 ng/mL hCG + 107 M T-2 toxin (Sigma, St. Louis, Mo.); (iii) 10 ng/mL hCG + 108 M T-2 toxin; (iv) 10 ng/mL hCG + 109 M T-2 toxin. The Cell viability was determined by the trypan blue dye-exclusion test, according to Gurina in 2011 (Gurina et al., 2011). The viability of the control and treated cells was over 90%. At the end of the incubation, the treated cells were used for the measurement of mRNA in steroidogenic acute regulatory protein (StAR), cytochrome P450 side-chain cleavage enzyme (P450scc) and 3b-HSD-1. 2.4. Total RNA extraction and semi-quantitative reverse transcriptionpolymerase chain reaction (RT-PCR) Total RNA was extracted from different treatment groups using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and was followed by deoxyribonuclease I (Life Technologies, Inc.) treatment to remove DNA contamination. One microgram of total RNA isolated from Leydig cells or the ovaries was reverse transcribed using 200 U of Superscript II RNase H-Reverse Transcriptase (Gibco BRL, Bethesda, MD) in a 50 ml reaction volume in the presence of 25 g/ml Oligo (dT), first strand buffer (50 mM Tris-HCl, 75 mM KCl, 3 mM MgCl2), 0.01 M dithiothreitol, and 10 mM of each dATP, dGTP, dCTP, and dTTP. The RNA and Oligo (dT) mix were heated at 65 °C for 10 min and then cooled to 4 °C. The other reagents were added and the reverse-transcription (RT) was performed at 42 °C for 1 h. The PCR of 3b-HSD-1, P450scc, StAR and HPRT (hypoxanthine phosphoribosyl transferase, housekeeping gene) was carried out by utilizing primer-pairs as described by Akingbemi in 2003 (Akingbemi et al., 2003) and Jin in 2000 (Jin et al., 2000) (Table 1). 3b-HSD-1, P450scc and StAR cDNAs were amplified by PCR for 35 cycles (94 °C for 40 s, 55 °C for 30 s, and 72 °C for 1 min); HPRT cDNAs were amplified by PCR for 28 cycles (94 °C for 30 s, 50 °C for 30 s, and 72 °C for 40 s). The sizes of the PCR products (3b-HSD-1, P450scc, StAR and HPRT) were determined by comparison with a gene marker (100 bp DNA, Promega) run in a parallel fashion with RT-PCR products in 1.2% agarose gels containing ethidium bromide. The relative band intensity was quantified using a computer-assisted image analysis system (Visage 2000, BioImage, Ann Arbor, MI). The integrated optical density (IOD) values for 3b-HSD-1, P450scc, StAR and HPRT in each band were normalized with the corresponding HPRT expression. 2.5. Measurement of enzyme activities Enzyme activities were determined after 24 h of treatment. Fresh medium was added, and all cultures were washed for 1 h to remove treatment agents and to deplete endogenous substrates before the determination of enzyme activities. After the washing period, enzyme activities were determined by incubating dishes for 1 h with a saturating concentration of the appropriate 3 H-labeled substrate (5 lM; 0.5 lCi) dissolved in 100 mM dimethylsulfoxide in 1 ml culture medium at 32 °C. 3b-HSD-1, P450scc, StAR, CYP17A1, and 17b-HSD activities were determined according to previously described procedures (Georgiou et al., 1987; Agular et al., 1992; O’Shaughnessy, 1991; Luu-The et al., 1990). 2.6. Calculation of enzyme activity results To facilitate the comparison of the effects of treatment at different doses of T-2 toxin, the results of enzyme activity determinations at 24 h were expressed as the ratio (%) of the respective activities of hCG-stimulated cultures at different doses of T-2 toxin
1168
J.Y. Yang et al. / Toxicology in Vitro 29 (2015) 1166–1171
Table 1 Primer sequences of PCR and expected amplified fragment length.
3b-HSD-1 P450scc StAR HPRT
Sense (50 –30 )
Antisense (30 –50 )
Product size
Reference
ACTGCAGGAGGTCAGAGCT AGGTGTAGCTCAGGACTTCA TGTCAAGGAGATCAAGGTCCTG CTTGCTCGAGATGTCATGAAG
GCCAGTAACACACAGAATACC AGGAGGCTATAAAGGACACC CGATAGGACCTGGTTGATGAT GTTTGCATTGTTTTACCAGTG
565bp 370bp 310bp 290bp
Akingbemi et al. (2003) Akingbemi et al. (2003) Akingbemi et al. (2003) Jin et al. (2000)
to the activity of hCG-stimulated (control) cultures which is set to 100%. The values for control 3b-HSD-1, P450scc, StAR, CYP17A1, and 17b-HSD activities (nanomoles per h/106 Leydig cells; mean ± SEM) were 3.33 ± 0.23, 1.18 ± 0.04, 1.88 ± 0.13, 4.70 ± 0.32, and 3.00 ± 0.23, respectively. There were significant differences in activity for all enzymes assayed between control cultures and cultures at different doses of T-2 toxin (P < 0.05). Therefore, differences in enzyme activities reflect the effects of the treatments on each enzyme exposed to different doses of T-2 toxin. 2.7. Statistical analysis Drug treatments were performed in triplicate in the same experiments and individual experiments were repeated at least three times. All data are represented as mean ± SEM. Statistical significance was tested by the ANOVA test. Groups were considered significantly different if P < 0.05. 3. Results 3.1. Highly purified Leydig cells can be prepared by percoll gradient centrifugation The four-step Percoll gradient centrifugation yielded cells of three major populations. The top layer (layer-1, q 1.035 g/ml) consisted of small round cells and cell debris. Layer-2 (q 1.076 g/ml) was composed of spermatozoa and a small fraction of Leydig cells. The cells in the third layer (q 1.085 g/ml) consisted of over 90% Leydig cells, as they were positively stained by the 3b-HSD method (Fig. 1). According to the 3b-HSD staining, the layer-3 cells were confirmed as Leydig cells and were used for the latter part of this study. 3.2. Inhibitory effects of T-2 toxin on mRNA levels of key steroidogenesis enzymes RT-PCR was used to investigate whether 3b-HSD-1, p450scc and StAR mRNA expressions were altered in mouse Leydig cells exposed to hCG + T-2 toxin. The results are shown in Fig. 2A–C. PCR products around the predicted sizes of 565 bp, 370 bp and 310 bp had 100% homology in mouse Leydig cells with those of mouse ovaries 3b-HSD-1, p450scc and StAR cDNA, respectively. In addition, comparisons between 3b-HSD-1, p450scc and StAR mRNA expressions with different T-2 toxin treated groups by semi-quantitative PCR were examined. The 3b-HSD-1 mRNA level relative to that of HPRT decreased significantly at doses of 10 ng/ml hCG + 108 M and 10 ng/ml hCG + 107 M T-2 toxin (lanes 5–6, Fig. 2A and D, P < 0.05). There were significant decreases in the p450scc mRNA level relative to that of HPRT in Leydig cells exposed to T-2 toxin at doses of 10 ng/ml hCG + 108 M and 10 ng/ml hCG + 107 M (lanes 5–6, Fig. 2B and E, P < 0.05). Significant decreases in the StAR mRNA level relative to that of HPRT were observed at doses of 10 ng/ml hCG + 108 M and 10 ng/ml hCG + 107 M T-2 toxin (lanes 5–6, Fig. 2C and F, P < 0.05).
Fig. 1. Histochemical staining of mouse Leydig cells. Purified adult Leydig cells were cultured for 2 days. After the medium was changed, Leydig cells were stained with 3b-HSD. The positive cells were stained with a dark blue color. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
3.3. Inhibitory effects of T-2 toxin on activities of key steroidogenesis enzymes In order to elucidate the mechanism of inhibition of testosterone biosynthesis exposed to T-2 toxin, the key steroidogenesis enzyme activities in this pathway were determined. The results are shown in Fig. 3A–E. The 3b-HSD-1enzyme activity decreased significantly at a dose of 10 ng/ml hCG + 107 M T-2 toxin (Fig. 3A, P < 0.05). There were significant decreases in the p450scc and 17b-HSD enzyme activities in Leydig cells exposed to T-2 toxin at doses of 10 ng/ml hCG + 108 M and 10 ng/ml hCG + 107 M (Fig. 3B and E, P < 0.05). Significant decreases in the StAR and CYP17A1 enzyme activities were observed at doses of 10 ng/ml hCG + 109 M, 10 ng/ml hCG + 108 M and 10 ng/ml hCG + 107 M T-2 toxin (Fig. 3C and D, P < 0.05). 4. Discussion In the adult, testosterone supports spermatogenesis, sperm maturation, and sexual function (Ewing and Keeney, 1993). Therefore, disruption of testosterone biosynthesis in Leydig cells can adversely affect male fertility. Previous research has demonstrated the negative effects of T-2 toxin on male fertility and other reproductive pathologies in male animals (Yang et al., 2010), as well as direct inhibitory effects of T-2 toxin on testosterone synthesis in mouse hCG-stimulated Leydig cell in vitro (Yang et al., 2014). These findings suggest that T-2 toxin exposure can interfere with the process of spermatogenesis, and they also have prompted the present investigation to examine possible mechanistic effects of T-2 toxin on Leydig cell functions, in particular for the synthesis and secretion of testosterone.
J.Y. Yang et al. / Toxicology in Vitro 29 (2015) 1166–1171
1169
Fig. 2. RT-PCR analysis of 3b-HSD-1 (A), p450scc (B), and StAR (C) expression in the mouse ovary (lane 2, positive controls) and mouse Leydig cells (lane 1, negative control; lanes 3–6) after 24 h incubation with hCG (10 ng/ml) and hCG (10 ng/ml) + T-2 toxin (107 M, 108 M, or 109 M). (A–C) show 565 bp, 370 bp and 310 bp DNA fragments for 3b-HSD-1; P450scc, and StAR respectively. Lanes 3–6: 10 ng/ml hCG, 10 ng/ml hCG + 109 M T-2 toxin, 10 ng/ml hCG + 108 M T-2 toxin, and 10 ng/ml hCG + 107 M T-2 toxin respectively. HPRT (290 bp) was used as an internal control. The densitometry analysis shows the ratio (%) of 3b-HSD-1, p450scc, and StAR: HPRT mRNA expression post-treatment in (D–F), respectively. Values are expressed as the mean ± SEM of three separate experiments performed in triplicates in each treatment; Histograms within experiments with different letters denote significantly different ratios (P < 0.05).
In these experiments, basal testosterone synthesis was very low and no significant inhibitory effects of T-2 toxin were found in unstimulated cells (without hCG Stimulation). The study is in agreement with the result reported by Caprio (Caprio et al., 1999). Steroid hormones are synthesized from cholesterol in the gonads in response to pituitary hormones, such as hCG via the classical first messenger/second messenger pathway. Conversion of cholesterol to biologically active steroids is a multi-step enzymatic process. Along with some important enzymes, like cholesterol side-chain cleavage enzyme (P450scc) and 3b-hydroxysteroid dehydrogenase/isomerase (3b-HSD), several proteins play key roles in steroidogenesis. Among these, the role of steroidogenic acute regulatory (StAR) protein appears to transfer cholesterol from cellular stores to the inner mitochondrial membrane, where cholesterol is enzymatically converted to pregnenolone by P450scc (Ojo et al., 2013; Anuka et al., 2013; Stocco and Clark, 1996; Stocco, 1999; Strauss et al., 1999; Bose et al., 2002). The conversion of pregnenolone to progesterone is a step metabolized by 3b-HSD. CYP17A1 then catalyzes the conversion of progesterone into androstenedione which is critical for androgen biosynthesis. The 3b-HSD-1 enzyme complex plays a crucial role in the conversion of D5-3b-hydroxysteroids to D4-3-oxosteroids, which is an essential step in the production of all active steroid hormones (Payne and Hales, 2004). Considering the importance of 3b-HSD-1, P450scc, StAR, CYP17A1, and 17b-HSD in regulating steroidogenesis and to delineate the underlying mechanism of hCG-mediated induction of testosterone synthesis, the changes of 3b-HSD-1, P450scc, StAR, CYP17A1, and 17b-HSD expression in mouse Leydig cells were measured.
Disruption of androgen biosynthesis in Leydig cells has been associated with factors that cause decreases in steroidogenic enzyme gene transcriptional levels and enzyme activity, especially in the cytochrome P450 enzymes (Luu-The, 2013). The results of the present study showed that T-2 toxin inhibition of hCG-stimulated mouse Leydig cells was attributed to the down-regulation of P450scc, which catalyzes the first reaction in the testosterone biosynthetic pathway, as well as the down-regulation of 3b-HSD-1 and StAR (Figs. 2 and 3). Our results are in agreement with the results previously reported by Adedara (Adedara et al., 2014). In addition, this is the first report of T-2 toxin-induced decreases in 3b-HSD-1, P450scc, StAR, CYP17A1, and 17b-HSD enzyme activities in the mice Leydig cell. Therefore, the results of the present study are consistent with the hypothesis that T-2 toxin inhibits testosterone production in hCG-stimulated Leydig cells by inhibiting the expression of 3b-HSD-1, P450scc, and StAR at the mRNA levels as well as 3b-HSD-1, P450scc, StAR, CYP17A1, and 17b-HSD enzyme activities. In summary, this study demonstrates that T-2 toxin impairs the abundance of essential rate-limiting enzymes, including 3b-HSD-1, P450scc, and StAR transcription as well as 3b-HSD-1, P450scc, StAR, CYP17A1, and 17b-HSD enzyme activities. It also inhibits the testosterone synthesis in mouse hCG-stimulated Leydig cells in vitro. The results indicate that the regulatory pathways are targets of T-2 toxin actions. Therefore, the T-2 toxin could influence gene expression at the transcription level and enzyme activities. Whether T-2 toxin may also perturb other mechanisms in testosterone synthesis, like HMG-Co reductase, remains under further investigation.
1170
J.Y. Yang et al. / Toxicology in Vitro 29 (2015) 1166–1171
Fig. 3. Effects of T-2 toxin on 3b-HSD-1 (A), p450scc (B), StAR (C), CYP17A1 (D), and 17b-HSD (E) enzymatic activities in mouse Leydig cells. Leydig cell cultures were treated for 24 h with 10 ng/ml hCG, (Control), or hCG (10 ng/ml) + T-2 toxin (107 M, 108 M, or 109 M). After that, cultures were washed to remove treatment agents, and then the above enzymatic activities were determined, as described in Section 2. Results are expressed as the mean ± SEM of five separate experiments performed in triplicates in each treatment; Histograms within experiments with different letters denote significant different ratios (P < 0.05).
J.Y. Yang et al. / Toxicology in Vitro 29 (2015) 1166–1171
Conflict of Interest The authors declare that there are no conflicts of interest. Transparency Document The Transparency document associated with this article can be found in the online version.
Acknowledgments This work was supported by the Natural Science Foundation of China (31201119 & 51203044), the He0 nan Science and Technique Foundation (112102310144), He0 nan Educational Committee Foundation (2011B310004 & 14A310026), He0 nan Youth Backbone Teacher of University Foundation (2013GGJS-067) and the Innovation Cultivation Foundation in Henan University of Science and Technology (2012ZCX026). A special thanks to Dr. Carine Tossou (at Chinese Academy of Sciences) and Oliver Wang (St. Robert Catholic High School, Thornhill, Ontario, Canada) for correction of the English in the manuscript. References Adedara, I.A., Nanjappa, M.K., Farombi, E.O., Akingbemi, B.T., 2014. Aflatoxin B1 disrupts the androgen biosynthetic pathway in rat Leydig cells. Food Chem. Toxicol. 65, 252–259. Agular, B.M., Vinggaard, A.M., Vind, C., 1992. Regulation by dexamethasone of the 3 beta-hydroxysteroid dehydrogenase activity in adult rat Leydig cells. J. Steroid Biochem. Mol. Biol. 43, 565–571. Akingbemi, B.T., Ge, R., Rosenfeld, C.S., Newton, L.G., Hardy, D.O., Catterall, J.F., Lubahn, D.B., Korach, K.S., Hardy, M.P., 2003. Estrogen receptor-alpha gene deficiency enhances androgen biosynthesis in the mouse Leydig cell. Endocrinology 144, 84–93. Anuka, E., Yivgi-Ohana, N., Eimerl, S., Garfinkel, B., Melamed-Book, N., Chepurkol, E., Aravot, D., Zinman, T., Shainberg, A., Hochhauser, E., Orly, J., 2013. Infarctinduced steroidogenic acute regulatory protein: a survival role in cardiac fibroblasts. Mol. Endocrinol. 27, 1502–1517. Biegel, L.B., Liu, R.C., Hurtt, M.E., Cook, J.C., 1995. Effects of ammonium perfluorooctanoate on Leydig cell function: in vitro, in vivo, and ex vivo studies. Toxicol. Appl. Pharm. 134, 18–25. Bose, H.S., Lingappa, V.R., Miller, W.L., 2002. The steroidogenic acute regulatory protein, StAR, works only at the outer mitochondrial membrane. Endocr. Res. 28, 295–308. Canady, R.A., Coker, R.D., Egan, S.K., 2001. T-2 and HT-2 toxins. In: Joint FAO/WHO Expert Committee on Food Additives (JECFA) (Eds.), Safety Evaluation of Certain Mycotoxins in Food, International Program on Chemical Safety (IPCS), WHO Food Additives Series 47, Geneva, pp. 557–597. Caprio, M., Isidori, A.M., Carta, A.R., Moretti, C., Dufau, M.L., Fabbri, A., 1999. Expression of functional leptin receptors in rodent Leydig cells. Endocrinology 140, 4939–4947.
1171
Cortinovis, C., Pizzo, F., Spicer, L.J., Caloni, F., 2013. Fusarium mycotoxins: effects on reproductive function in domestic animals – a review. Theriogenology 80, 557– 564. Ewing, L.L., Keeney, D.S., 1993. Leydig cells: structure and function. In: Desjardins, C., Ewing, L.L. (Eds.), Cell and Molecular Biology of the Testis. Oxford University Press, New York, pp. 137–165. Georgiou, M., Perkins, L.M., Payne, A.H., 1987. Steroid synthesis-dependent, oxygenmediated damage of mitochondrial and microsomal cytochrome P-450 enzymes in rat Leydig cell cultures. Endocrinology 121, 1390–1399. Gurina, T.M., Pakhomov, A.V., Kyryliuk, A.L., Bozhok, G.A., 2011. Development of a cryopreservation protocol for testicular interstitial cells with the account of temperature intervals for controlled cooling below 60 °C. Cryobiology 62, 107–114. Gutleb, A.C., Morrison, E., Albertina, J.M., 2002. Cytotoxicity assays for mycotoxins produced by Fusarium strains: a review. Environ. Toxicol. Pharmacol. 11, 309– 320. IARC (International Agency for Research on Cancer), 1993. Some naturally occurring substances: food items and constituents, heterocyclic aromatic amines and mycotoxins. IARC Monographs on the Evaluations on the Carcinogenic Risk of Chemicals to Humans, vol. 56. IARC, Lyon, pp. 397–444. Jin, L., Zhang, S., Burguera, B.G., Couce, M.E., Osamura, R.Y., Kulig, E., Lloyd, R.V., 2000. Leptin and leptin receptor expression in rat and mouse pituitary cells. Endocrinology 141, 333–339. Luu-The, V., 2013. Assessment of steroidogenesis and steroidogenic enzyme functions. J. Steroid Biochem. Mol. Biol. 137, 176–182. Luu-The, V., Labrie, C., Zhao, H.F., Couët, J., Lachance, Y., Simard, J., Côté, J., Leblanc, G., Lagacé, L., Bérubé, D., 1990. Purification, cloning, complementary DNA structure, and predicted amino acid sequence of human estradiol 17 betadehydrogenase. Ann. NY Acad. Sci. 595, 40–52. Mendelson, C., Dufau, M., Catt, K., 1975. Gonadotropin binding and stimulation of cyclic adenosine 30 :50 -monophosphate and testosterone production in isolated Leydig cells. J. Biol. Chem. 250, 8818–8823. Ojo, O.O., Bhadauria, S., Rath, S.K., 2013. Dose-dependent adverse effects of salinomycin on male reproductive organs and fertility in mice. PLoS One 8, e69086. O’Shaughnessy, P.J., 1991. Steroidogenic enzyme activity in the hypogonadal (hpg) mouse testis and effect of treatment with luteinizing hormone. J. Steroid Biochem. Mol. Biol. 39, 921–928. Payne, A.H., Hales, D.B., 2004. Overview of steroidogenic enzymes in the pathway from cholesterol to active steroid hormones. Endocr. Rev. 25, 947–970. Rotter, B.A., Prelusky, D.B., Pestka, J.J., 1996. Toxicology of deoxynivalenol (vomitoxin). J. Toxicol. Environ. Health 48, 1–34. Stocco, D.M., 1999. Steroidogenic acute regulatory protein. Vitam. Horm. 55, 399– 441. Stocco, D.M., Clark, B.J., 1996. Role of the steroidogenic acute regulatory protein (StAR) in steroidogenesis. Biochem. Pharmacol. 51, 197–205. Strauss 3rd., J.F., Kallen, C.B., Christenson, L.K., Watari, H., Devoto, L., Arakane, F., Kiriakidou, M., Sugawara, T., 1999. The steroidogenic acute regulatory protein (StAR): a window into the complexities of intracellular cholesterol tracking. Recent Prog. Horm. Res. 54, 369–394. Ueno, Y., 1984. Toxicological features of T-2 toxin and related mycotoxins. Fund. Appl. Toxicol. 4, S124–S132. World Health Organization (WHO), 1990. Selected mycotoxins: ochratoxins, trichothecenes, ergot. Environmental Health Criteria, vol. 105. World Health Organization, Geneva. Yang, J.Y., Zhang, Y.F., Liang, A.M., Kong, X.F., Li, Y.X., Ma, K.W., Jing, A.H., Feng, S.Y., Qiao, X.L., 2010. Toxic effects of T-2 toxin on reproductive system in male mice. Toxicol. Ind. Health 26, 25–31. Yang, J.Y., Zhang, Y.F., Jing, A.H., Ma, K.W., Gong, Q., Qin, C.L., 2014. Effects of T-2 toxin on testosterone biosynthesis in mouse Leydig cells. Toxicol. Ind. Health 30, 873–877.
Contents lists available at ScienceDirect
Toxicology in Vitro journal homepage: www.elsevier.com/locate/toxinvit
T-2 toxin inhibits gene expression and activity of key steroidogenesis enzymes in mouse Leydig cells Jian Ying Yang a,1, Yong Fa Zhang a,b,⇑,1, Xiang Ping Meng a, Yuan Xiao Li c, Kai Wang Ma a, Xue Fei Bai a a
College of Medical Technology and Engineering, Henan University of Science and Technology, Luoyang, Henan 471003, China College of Food and Bioengineering, Henan University of Science and Technology, Luo Yang, Henan 471023, China c College of Animal Science & Technology, Henan University of Science and Technology, Luo Yang, Henan 471003, China b
a r t i c l e
i n f o
Article history: Received 15 May 2014 Accepted 25 April 2015 Available online 8 May 2015 Keywords: T-2 toxin 3b-HSD-1 p450scc StAR CYP17A1 17b-HSD Enzyme activity Mouse Leydig cells
a b s t r a c t T-2 toxin is one of the mycotoxins, a group of type A trichothecenes produced by several fungal genera including Fusarium species, which may lead to the decrease of the testosterone secretion in the primary Leydig cells derived from the mouse testis. The previous study demonstrated the effects of T-2 toxin through direct decrease of the testosterone biosynthesis in the primary Leydig cells derived from the mouse testis. In this study, we further examined the direct biological effects of T-2 toxin on steroidogenesis production, primarily in Leydig cells of mice. Mature mouse Leydig cells were purified by Percoll gradient centrifugation and the cell purity was determined by 3b-hydroxysteroid dehydrogenase (3b-HSD) staining. To examine T-2 toxin-induced testosterone secretion decrease, we measured the transcription levels of 3 key steroidogenic enzymes and 5 enzyme activities including 3b-HSD-1, P450scc, StAR, CYP17A1, and 17b-HSD in T-2 toxin/human chorionicgonadotropin (hCG) co-treated cells. Our previous study showed that T-2 toxin (107 M, 108 M and 109 M) significantly suppressed hCG (10 ng/ml)-induced testosterone secretion. The studies demonstrated that the suppressive effect is correlated with the decreases in the levels of transcription of 3b-HSD-1, P450scc, and StAR (P < 0.05) and also in enzyme activities of 3b-HSD-1, P450scc, StAR, CYP17A1, and 17b-HSD (P < 0.05). Ó 2015 Elsevier Ltd. All rights reserved.
1. Introduction T-2 toxin is one of the mycotoxins, a group of type A trichothecenes produced by several fungalgenera including the Fusarium species (Cortinovis et al., 2013; IARC, 1993). It has been acknowledged as an unavoidable contaminant in human food, animal feed and agricultural products such as maize, wheat and oats, and has been reported in many parts of the world (WHO, 1990). Upon acute exposure to high dose of trichothecenes, animals exhibit clinical signs such as diarrhea, vomiting, leukocytosis and haemorrhage (Ueno, 1984). At extremely high dose, trichothecenes can cause shock-like syndromes that can result in death. Chronic exposure to trichothecenes can cause anorexia, weight loss, diminished nutritional efficiency, neuro-endocrine changes and immune modulation (Rotter et al., 1996). Among the trichothecenes, T-2 toxin is the most toxic compound (Gutleb et al., 2002). Studies have demonstrated the ⇑ Corresponding author at: College of Food and Bioengineering, Henan University of Science and Technology, Luo Yang, Henan 471023, China. Tel.: +86 379 64282342. E-mail address: [email protected] (Y.F. Zhang). 1 These authors contributed equally to this work. http://dx.doi.org/10.1016/j.tiv.2015.04.020 0887-2333/Ó 2015 Elsevier Ltd. All rights reserved.
negative effects of exposure to T-2 toxin on the immune system and digestive system, including the oral cavity, esophagus, and stomach (Canady et al., 2001). In addition, Studies have demonstrated the toxic effects of T-2 toxin on the semen quality, fertility and serum testosterone concentration in mice (Yang et al., 2010). However, these reproductive toxicities of T-2 toxin for testicular function have mostly relied on the in vivo approach of using animal models. Complications in pharmacokinetic distribution and secondary effects attributed to other unidentified factors may make it difficult to decipher the direct mechanistic toxicities of T-2 toxin to the cells. It is well known that Leydig cells play a crucial role in synthesizing testosterone and regulating the process of spermatogenesis. The alteration of Leydig cell function can lead to adverse effects on testicular functions. Therefore, we researched Leydig cells in mice to determine direct biological effects of T-2 toxin to validate the in vivo findings, and the results showed a direct suppression of testosterone secretion (Yang et al., 2014). However, no detailed data concerning the effects of exposure to this toxin on the molecular mechanism of decreasing the testosterone secretion are available. In this study, the aim was to elucidate the effects of T-2 toxin on hCG-stimulated steroidogenesis in Leydig cells of mice. To determine the molecular mechanism, the effect of T-2
J.Y. Yang et al. / Toxicology in Vitro 29 (2015) 1166–1171
toxin on hCG-stimulated mRNA levels and activities of key steroidogenic enzymes were measured. 2. Materials and methods T-2 toxin was obtained from Sigma Chemical Company (St Louis, MO). A stock solution was prepared in dimethyl sulfoxide and was stored at 20 °C. The working solution was prepared by dispensing the stock solution into fresh sterilized peanut oil. All experimental animal use and experimental design for this study was approved by the Chinese Association for Laboratory Animal Sciences. 2.1. Cell culture Leydig cells were isolated from the testis of 60–90 day-old Kunming mice. The cells were cultured for 2 days according to Biegel et al. (1995). The testis was decapsulated, and digested in Erlenmyer flasks within an oscillating incubator (100 r.p.m and 34 °C) for 15 min by M199 medium containing 0.05% collagenase and 1% BSA. The suspension cells were transferred to a 50 ml tube and kept on ice for 2 min to allow the tubules to settle. The supernatant containing Leydig cells was filtered through a 70 lm nylon cell strainer (BD Biosciences). The cells were centrifuged at 350 g for 20 min at 4 °C. The pellet was re-suspended in 10 ml M199 and loaded onto the top of a Percoll gradient (5%, 30%, 58% and 70%) (Sigma) and centrifuged at 800 g for 30 min at 4 °C. The cells in the third layer were collected, washed twice with M199 medium, and were re-suspended in phenol red free-DMEM/F12 (1:1) containing 10% charcoal stripped fetal calf serum (GeminiBio-Products, Woodland, CA, USA), 50 U/ml penicillin and 50 lg/ml streptomycin (GIBCO/BRL, Carlsbad, CA, USA). The cells were plated at a density of 105 cells/cm2 in 24-well plates (Nunc, Nalge Nunc International, Rochester, NY, USA) at 0.5 ml/well and maintained at 37 °C with 5% CO2. 2.2. Histochemical staining of 3b-HSD and testosterone induction assay Following 2 days of incubation, the purity of Leydig cells was examined by histochemical staining for 3b-hydroxysteroid dehydrogenase, according to the histochemical method reported by Mendelson with some modifications (Mendelson et al., 1975). In brief, Leydig cells were incubated in a 24-well plate with 0.4 ml/well staining solution containing 0.05 M PBS, pH 7.4 supplemented with 0.2 mg/ml nitro-blue tetrazolium (Sigma Chemical Co.), 1 mg/ml NAD and 0.12 mg/ml dehydroepiandrosterone (Sigma Chemical Co) for 90 min at 34 °C. The positive cells were stained a dark blue color and the purity of the Leydig cells was observed to be over 90%. Secondly, in the testosterone induction assay, Leydig cells were exposed to 10 ng/ml human chorionic gonadotrop (hCG) (Sigma Chemical Co) for 24 h. 2.3. Cell treatment Two-day cultured Leydig cells grown in phenol red-free DMEM/F12 medium supplemented with 10% charcoal stripped fetal calf serum and antibiotics (50 U/mL penicillin and 50 lg/mL streptomycin) were washed three times in 0.05 M PBS pH 7.4. The conditioned media (phenol red-free DMEM/F12 medium supplemented with 50 U/mL penicillin and 50 lg/mL streptomycin and the corresponding leveled-drugs and 10 ng/mL hCG) were added to the 24-well plates at 0.3 mL/well. The Leydig cells were
1167
exposed for 24 h to one of the following four treatments: (i) 10 ng/mL hCG (Sigma) + dimethyl sulfoxide (DMSO) (Sigma) solvent control; (ii)10 ng/mL hCG + 107 M T-2 toxin (Sigma, St. Louis, Mo.); (iii) 10 ng/mL hCG + 108 M T-2 toxin; (iv) 10 ng/mL hCG + 109 M T-2 toxin. The Cell viability was determined by the trypan blue dye-exclusion test, according to Gurina in 2011 (Gurina et al., 2011). The viability of the control and treated cells was over 90%. At the end of the incubation, the treated cells were used for the measurement of mRNA in steroidogenic acute regulatory protein (StAR), cytochrome P450 side-chain cleavage enzyme (P450scc) and 3b-HSD-1. 2.4. Total RNA extraction and semi-quantitative reverse transcriptionpolymerase chain reaction (RT-PCR) Total RNA was extracted from different treatment groups using Trizol reagent (Invitrogen, Carlsbad, CA, USA) and was followed by deoxyribonuclease I (Life Technologies, Inc.) treatment to remove DNA contamination. One microgram of total RNA isolated from Leydig cells or the ovaries was reverse transcribed using 200 U of Superscript II RNase H-Reverse Transcriptase (Gibco BRL, Bethesda, MD) in a 50 ml reaction volume in the presence of 25 g/ml Oligo (dT), first strand buffer (50 mM Tris-HCl, 75 mM KCl, 3 mM MgCl2), 0.01 M dithiothreitol, and 10 mM of each dATP, dGTP, dCTP, and dTTP. The RNA and Oligo (dT) mix were heated at 65 °C for 10 min and then cooled to 4 °C. The other reagents were added and the reverse-transcription (RT) was performed at 42 °C for 1 h. The PCR of 3b-HSD-1, P450scc, StAR and HPRT (hypoxanthine phosphoribosyl transferase, housekeeping gene) was carried out by utilizing primer-pairs as described by Akingbemi in 2003 (Akingbemi et al., 2003) and Jin in 2000 (Jin et al., 2000) (Table 1). 3b-HSD-1, P450scc and StAR cDNAs were amplified by PCR for 35 cycles (94 °C for 40 s, 55 °C for 30 s, and 72 °C for 1 min); HPRT cDNAs were amplified by PCR for 28 cycles (94 °C for 30 s, 50 °C for 30 s, and 72 °C for 40 s). The sizes of the PCR products (3b-HSD-1, P450scc, StAR and HPRT) were determined by comparison with a gene marker (100 bp DNA, Promega) run in a parallel fashion with RT-PCR products in 1.2% agarose gels containing ethidium bromide. The relative band intensity was quantified using a computer-assisted image analysis system (Visage 2000, BioImage, Ann Arbor, MI). The integrated optical density (IOD) values for 3b-HSD-1, P450scc, StAR and HPRT in each band were normalized with the corresponding HPRT expression. 2.5. Measurement of enzyme activities Enzyme activities were determined after 24 h of treatment. Fresh medium was added, and all cultures were washed for 1 h to remove treatment agents and to deplete endogenous substrates before the determination of enzyme activities. After the washing period, enzyme activities were determined by incubating dishes for 1 h with a saturating concentration of the appropriate 3 H-labeled substrate (5 lM; 0.5 lCi) dissolved in 100 mM dimethylsulfoxide in 1 ml culture medium at 32 °C. 3b-HSD-1, P450scc, StAR, CYP17A1, and 17b-HSD activities were determined according to previously described procedures (Georgiou et al., 1987; Agular et al., 1992; O’Shaughnessy, 1991; Luu-The et al., 1990). 2.6. Calculation of enzyme activity results To facilitate the comparison of the effects of treatment at different doses of T-2 toxin, the results of enzyme activity determinations at 24 h were expressed as the ratio (%) of the respective activities of hCG-stimulated cultures at different doses of T-2 toxin
1168
J.Y. Yang et al. / Toxicology in Vitro 29 (2015) 1166–1171
Table 1 Primer sequences of PCR and expected amplified fragment length.
3b-HSD-1 P450scc StAR HPRT
Sense (50 –30 )
Antisense (30 –50 )
Product size
Reference
ACTGCAGGAGGTCAGAGCT AGGTGTAGCTCAGGACTTCA TGTCAAGGAGATCAAGGTCCTG CTTGCTCGAGATGTCATGAAG
GCCAGTAACACACAGAATACC AGGAGGCTATAAAGGACACC CGATAGGACCTGGTTGATGAT GTTTGCATTGTTTTACCAGTG
565bp 370bp 310bp 290bp
Akingbemi et al. (2003) Akingbemi et al. (2003) Akingbemi et al. (2003) Jin et al. (2000)
to the activity of hCG-stimulated (control) cultures which is set to 100%. The values for control 3b-HSD-1, P450scc, StAR, CYP17A1, and 17b-HSD activities (nanomoles per h/106 Leydig cells; mean ± SEM) were 3.33 ± 0.23, 1.18 ± 0.04, 1.88 ± 0.13, 4.70 ± 0.32, and 3.00 ± 0.23, respectively. There were significant differences in activity for all enzymes assayed between control cultures and cultures at different doses of T-2 toxin (P < 0.05). Therefore, differences in enzyme activities reflect the effects of the treatments on each enzyme exposed to different doses of T-2 toxin. 2.7. Statistical analysis Drug treatments were performed in triplicate in the same experiments and individual experiments were repeated at least three times. All data are represented as mean ± SEM. Statistical significance was tested by the ANOVA test. Groups were considered significantly different if P < 0.05. 3. Results 3.1. Highly purified Leydig cells can be prepared by percoll gradient centrifugation The four-step Percoll gradient centrifugation yielded cells of three major populations. The top layer (layer-1, q 1.035 g/ml) consisted of small round cells and cell debris. Layer-2 (q 1.076 g/ml) was composed of spermatozoa and a small fraction of Leydig cells. The cells in the third layer (q 1.085 g/ml) consisted of over 90% Leydig cells, as they were positively stained by the 3b-HSD method (Fig. 1). According to the 3b-HSD staining, the layer-3 cells were confirmed as Leydig cells and were used for the latter part of this study. 3.2. Inhibitory effects of T-2 toxin on mRNA levels of key steroidogenesis enzymes RT-PCR was used to investigate whether 3b-HSD-1, p450scc and StAR mRNA expressions were altered in mouse Leydig cells exposed to hCG + T-2 toxin. The results are shown in Fig. 2A–C. PCR products around the predicted sizes of 565 bp, 370 bp and 310 bp had 100% homology in mouse Leydig cells with those of mouse ovaries 3b-HSD-1, p450scc and StAR cDNA, respectively. In addition, comparisons between 3b-HSD-1, p450scc and StAR mRNA expressions with different T-2 toxin treated groups by semi-quantitative PCR were examined. The 3b-HSD-1 mRNA level relative to that of HPRT decreased significantly at doses of 10 ng/ml hCG + 108 M and 10 ng/ml hCG + 107 M T-2 toxin (lanes 5–6, Fig. 2A and D, P < 0.05). There were significant decreases in the p450scc mRNA level relative to that of HPRT in Leydig cells exposed to T-2 toxin at doses of 10 ng/ml hCG + 108 M and 10 ng/ml hCG + 107 M (lanes 5–6, Fig. 2B and E, P < 0.05). Significant decreases in the StAR mRNA level relative to that of HPRT were observed at doses of 10 ng/ml hCG + 108 M and 10 ng/ml hCG + 107 M T-2 toxin (lanes 5–6, Fig. 2C and F, P < 0.05).
Fig. 1. Histochemical staining of mouse Leydig cells. Purified adult Leydig cells were cultured for 2 days. After the medium was changed, Leydig cells were stained with 3b-HSD. The positive cells were stained with a dark blue color. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)
3.3. Inhibitory effects of T-2 toxin on activities of key steroidogenesis enzymes In order to elucidate the mechanism of inhibition of testosterone biosynthesis exposed to T-2 toxin, the key steroidogenesis enzyme activities in this pathway were determined. The results are shown in Fig. 3A–E. The 3b-HSD-1enzyme activity decreased significantly at a dose of 10 ng/ml hCG + 107 M T-2 toxin (Fig. 3A, P < 0.05). There were significant decreases in the p450scc and 17b-HSD enzyme activities in Leydig cells exposed to T-2 toxin at doses of 10 ng/ml hCG + 108 M and 10 ng/ml hCG + 107 M (Fig. 3B and E, P < 0.05). Significant decreases in the StAR and CYP17A1 enzyme activities were observed at doses of 10 ng/ml hCG + 109 M, 10 ng/ml hCG + 108 M and 10 ng/ml hCG + 107 M T-2 toxin (Fig. 3C and D, P < 0.05). 4. Discussion In the adult, testosterone supports spermatogenesis, sperm maturation, and sexual function (Ewing and Keeney, 1993). Therefore, disruption of testosterone biosynthesis in Leydig cells can adversely affect male fertility. Previous research has demonstrated the negative effects of T-2 toxin on male fertility and other reproductive pathologies in male animals (Yang et al., 2010), as well as direct inhibitory effects of T-2 toxin on testosterone synthesis in mouse hCG-stimulated Leydig cell in vitro (Yang et al., 2014). These findings suggest that T-2 toxin exposure can interfere with the process of spermatogenesis, and they also have prompted the present investigation to examine possible mechanistic effects of T-2 toxin on Leydig cell functions, in particular for the synthesis and secretion of testosterone.
J.Y. Yang et al. / Toxicology in Vitro 29 (2015) 1166–1171
1169
Fig. 2. RT-PCR analysis of 3b-HSD-1 (A), p450scc (B), and StAR (C) expression in the mouse ovary (lane 2, positive controls) and mouse Leydig cells (lane 1, negative control; lanes 3–6) after 24 h incubation with hCG (10 ng/ml) and hCG (10 ng/ml) + T-2 toxin (107 M, 108 M, or 109 M). (A–C) show 565 bp, 370 bp and 310 bp DNA fragments for 3b-HSD-1; P450scc, and StAR respectively. Lanes 3–6: 10 ng/ml hCG, 10 ng/ml hCG + 109 M T-2 toxin, 10 ng/ml hCG + 108 M T-2 toxin, and 10 ng/ml hCG + 107 M T-2 toxin respectively. HPRT (290 bp) was used as an internal control. The densitometry analysis shows the ratio (%) of 3b-HSD-1, p450scc, and StAR: HPRT mRNA expression post-treatment in (D–F), respectively. Values are expressed as the mean ± SEM of three separate experiments performed in triplicates in each treatment; Histograms within experiments with different letters denote significantly different ratios (P < 0.05).
In these experiments, basal testosterone synthesis was very low and no significant inhibitory effects of T-2 toxin were found in unstimulated cells (without hCG Stimulation). The study is in agreement with the result reported by Caprio (Caprio et al., 1999). Steroid hormones are synthesized from cholesterol in the gonads in response to pituitary hormones, such as hCG via the classical first messenger/second messenger pathway. Conversion of cholesterol to biologically active steroids is a multi-step enzymatic process. Along with some important enzymes, like cholesterol side-chain cleavage enzyme (P450scc) and 3b-hydroxysteroid dehydrogenase/isomerase (3b-HSD), several proteins play key roles in steroidogenesis. Among these, the role of steroidogenic acute regulatory (StAR) protein appears to transfer cholesterol from cellular stores to the inner mitochondrial membrane, where cholesterol is enzymatically converted to pregnenolone by P450scc (Ojo et al., 2013; Anuka et al., 2013; Stocco and Clark, 1996; Stocco, 1999; Strauss et al., 1999; Bose et al., 2002). The conversion of pregnenolone to progesterone is a step metabolized by 3b-HSD. CYP17A1 then catalyzes the conversion of progesterone into androstenedione which is critical for androgen biosynthesis. The 3b-HSD-1 enzyme complex plays a crucial role in the conversion of D5-3b-hydroxysteroids to D4-3-oxosteroids, which is an essential step in the production of all active steroid hormones (Payne and Hales, 2004). Considering the importance of 3b-HSD-1, P450scc, StAR, CYP17A1, and 17b-HSD in regulating steroidogenesis and to delineate the underlying mechanism of hCG-mediated induction of testosterone synthesis, the changes of 3b-HSD-1, P450scc, StAR, CYP17A1, and 17b-HSD expression in mouse Leydig cells were measured.
Disruption of androgen biosynthesis in Leydig cells has been associated with factors that cause decreases in steroidogenic enzyme gene transcriptional levels and enzyme activity, especially in the cytochrome P450 enzymes (Luu-The, 2013). The results of the present study showed that T-2 toxin inhibition of hCG-stimulated mouse Leydig cells was attributed to the down-regulation of P450scc, which catalyzes the first reaction in the testosterone biosynthetic pathway, as well as the down-regulation of 3b-HSD-1 and StAR (Figs. 2 and 3). Our results are in agreement with the results previously reported by Adedara (Adedara et al., 2014). In addition, this is the first report of T-2 toxin-induced decreases in 3b-HSD-1, P450scc, StAR, CYP17A1, and 17b-HSD enzyme activities in the mice Leydig cell. Therefore, the results of the present study are consistent with the hypothesis that T-2 toxin inhibits testosterone production in hCG-stimulated Leydig cells by inhibiting the expression of 3b-HSD-1, P450scc, and StAR at the mRNA levels as well as 3b-HSD-1, P450scc, StAR, CYP17A1, and 17b-HSD enzyme activities. In summary, this study demonstrates that T-2 toxin impairs the abundance of essential rate-limiting enzymes, including 3b-HSD-1, P450scc, and StAR transcription as well as 3b-HSD-1, P450scc, StAR, CYP17A1, and 17b-HSD enzyme activities. It also inhibits the testosterone synthesis in mouse hCG-stimulated Leydig cells in vitro. The results indicate that the regulatory pathways are targets of T-2 toxin actions. Therefore, the T-2 toxin could influence gene expression at the transcription level and enzyme activities. Whether T-2 toxin may also perturb other mechanisms in testosterone synthesis, like HMG-Co reductase, remains under further investigation.
1170
J.Y. Yang et al. / Toxicology in Vitro 29 (2015) 1166–1171
Fig. 3. Effects of T-2 toxin on 3b-HSD-1 (A), p450scc (B), StAR (C), CYP17A1 (D), and 17b-HSD (E) enzymatic activities in mouse Leydig cells. Leydig cell cultures were treated for 24 h with 10 ng/ml hCG, (Control), or hCG (10 ng/ml) + T-2 toxin (107 M, 108 M, or 109 M). After that, cultures were washed to remove treatment agents, and then the above enzymatic activities were determined, as described in Section 2. Results are expressed as the mean ± SEM of five separate experiments performed in triplicates in each treatment; Histograms within experiments with different letters denote significant different ratios (P < 0.05).
J.Y. Yang et al. / Toxicology in Vitro 29 (2015) 1166–1171
Conflict of Interest The authors declare that there are no conflicts of interest. Transparency Document The Transparency document associated with this article can be found in the online version.
Acknowledgments This work was supported by the Natural Science Foundation of China (31201119 & 51203044), the He0 nan Science and Technique Foundation (112102310144), He0 nan Educational Committee Foundation (2011B310004 & 14A310026), He0 nan Youth Backbone Teacher of University Foundation (2013GGJS-067) and the Innovation Cultivation Foundation in Henan University of Science and Technology (2012ZCX026). A special thanks to Dr. Carine Tossou (at Chinese Academy of Sciences) and Oliver Wang (St. Robert Catholic High School, Thornhill, Ontario, Canada) for correction of the English in the manuscript. References Adedara, I.A., Nanjappa, M.K., Farombi, E.O., Akingbemi, B.T., 2014. Aflatoxin B1 disrupts the androgen biosynthetic pathway in rat Leydig cells. Food Chem. Toxicol. 65, 252–259. Agular, B.M., Vinggaard, A.M., Vind, C., 1992. Regulation by dexamethasone of the 3 beta-hydroxysteroid dehydrogenase activity in adult rat Leydig cells. J. Steroid Biochem. Mol. Biol. 43, 565–571. Akingbemi, B.T., Ge, R., Rosenfeld, C.S., Newton, L.G., Hardy, D.O., Catterall, J.F., Lubahn, D.B., Korach, K.S., Hardy, M.P., 2003. Estrogen receptor-alpha gene deficiency enhances androgen biosynthesis in the mouse Leydig cell. Endocrinology 144, 84–93. Anuka, E., Yivgi-Ohana, N., Eimerl, S., Garfinkel, B., Melamed-Book, N., Chepurkol, E., Aravot, D., Zinman, T., Shainberg, A., Hochhauser, E., Orly, J., 2013. Infarctinduced steroidogenic acute regulatory protein: a survival role in cardiac fibroblasts. Mol. Endocrinol. 27, 1502–1517. Biegel, L.B., Liu, R.C., Hurtt, M.E., Cook, J.C., 1995. Effects of ammonium perfluorooctanoate on Leydig cell function: in vitro, in vivo, and ex vivo studies. Toxicol. Appl. Pharm. 134, 18–25. Bose, H.S., Lingappa, V.R., Miller, W.L., 2002. The steroidogenic acute regulatory protein, StAR, works only at the outer mitochondrial membrane. Endocr. Res. 28, 295–308. Canady, R.A., Coker, R.D., Egan, S.K., 2001. T-2 and HT-2 toxins. In: Joint FAO/WHO Expert Committee on Food Additives (JECFA) (Eds.), Safety Evaluation of Certain Mycotoxins in Food, International Program on Chemical Safety (IPCS), WHO Food Additives Series 47, Geneva, pp. 557–597. Caprio, M., Isidori, A.M., Carta, A.R., Moretti, C., Dufau, M.L., Fabbri, A., 1999. Expression of functional leptin receptors in rodent Leydig cells. Endocrinology 140, 4939–4947.
1171
Cortinovis, C., Pizzo, F., Spicer, L.J., Caloni, F., 2013. Fusarium mycotoxins: effects on reproductive function in domestic animals – a review. Theriogenology 80, 557– 564. Ewing, L.L., Keeney, D.S., 1993. Leydig cells: structure and function. In: Desjardins, C., Ewing, L.L. (Eds.), Cell and Molecular Biology of the Testis. Oxford University Press, New York, pp. 137–165. Georgiou, M., Perkins, L.M., Payne, A.H., 1987. Steroid synthesis-dependent, oxygenmediated damage of mitochondrial and microsomal cytochrome P-450 enzymes in rat Leydig cell cultures. Endocrinology 121, 1390–1399. Gurina, T.M., Pakhomov, A.V., Kyryliuk, A.L., Bozhok, G.A., 2011. Development of a cryopreservation protocol for testicular interstitial cells with the account of temperature intervals for controlled cooling below 60 °C. Cryobiology 62, 107–114. Gutleb, A.C., Morrison, E., Albertina, J.M., 2002. Cytotoxicity assays for mycotoxins produced by Fusarium strains: a review. Environ. Toxicol. Pharmacol. 11, 309– 320. IARC (International Agency for Research on Cancer), 1993. Some naturally occurring substances: food items and constituents, heterocyclic aromatic amines and mycotoxins. IARC Monographs on the Evaluations on the Carcinogenic Risk of Chemicals to Humans, vol. 56. IARC, Lyon, pp. 397–444. Jin, L., Zhang, S., Burguera, B.G., Couce, M.E., Osamura, R.Y., Kulig, E., Lloyd, R.V., 2000. Leptin and leptin receptor expression in rat and mouse pituitary cells. Endocrinology 141, 333–339. Luu-The, V., 2013. Assessment of steroidogenesis and steroidogenic enzyme functions. J. Steroid Biochem. Mol. Biol. 137, 176–182. Luu-The, V., Labrie, C., Zhao, H.F., Couët, J., Lachance, Y., Simard, J., Côté, J., Leblanc, G., Lagacé, L., Bérubé, D., 1990. Purification, cloning, complementary DNA structure, and predicted amino acid sequence of human estradiol 17 betadehydrogenase. Ann. NY Acad. Sci. 595, 40–52. Mendelson, C., Dufau, M., Catt, K., 1975. Gonadotropin binding and stimulation of cyclic adenosine 30 :50 -monophosphate and testosterone production in isolated Leydig cells. J. Biol. Chem. 250, 8818–8823. Ojo, O.O., Bhadauria, S., Rath, S.K., 2013. Dose-dependent adverse effects of salinomycin on male reproductive organs and fertility in mice. PLoS One 8, e69086. O’Shaughnessy, P.J., 1991. Steroidogenic enzyme activity in the hypogonadal (hpg) mouse testis and effect of treatment with luteinizing hormone. J. Steroid Biochem. Mol. Biol. 39, 921–928. Payne, A.H., Hales, D.B., 2004. Overview of steroidogenic enzymes in the pathway from cholesterol to active steroid hormones. Endocr. Rev. 25, 947–970. Rotter, B.A., Prelusky, D.B., Pestka, J.J., 1996. Toxicology of deoxynivalenol (vomitoxin). J. Toxicol. Environ. Health 48, 1–34. Stocco, D.M., 1999. Steroidogenic acute regulatory protein. Vitam. Horm. 55, 399– 441. Stocco, D.M., Clark, B.J., 1996. Role of the steroidogenic acute regulatory protein (StAR) in steroidogenesis. Biochem. Pharmacol. 51, 197–205. Strauss 3rd., J.F., Kallen, C.B., Christenson, L.K., Watari, H., Devoto, L., Arakane, F., Kiriakidou, M., Sugawara, T., 1999. The steroidogenic acute regulatory protein (StAR): a window into the complexities of intracellular cholesterol tracking. Recent Prog. Horm. Res. 54, 369–394. Ueno, Y., 1984. Toxicological features of T-2 toxin and related mycotoxins. Fund. Appl. Toxicol. 4, S124–S132. World Health Organization (WHO), 1990. Selected mycotoxins: ochratoxins, trichothecenes, ergot. Environmental Health Criteria, vol. 105. World Health Organization, Geneva. Yang, J.Y., Zhang, Y.F., Liang, A.M., Kong, X.F., Li, Y.X., Ma, K.W., Jing, A.H., Feng, S.Y., Qiao, X.L., 2010. Toxic effects of T-2 toxin on reproductive system in male mice. Toxicol. Ind. Health 26, 25–31. Yang, J.Y., Zhang, Y.F., Jing, A.H., Ma, K.W., Gong, Q., Qin, C.L., 2014. Effects of T-2 toxin on testosterone biosynthesis in mouse Leydig cells. Toxicol. Ind. Health 30, 873–877.
