Ultrasonics Sonochemistry 21 (2014) 1482–1488
Contents lists available at ScienceDirect
Ultrasonics Sonochemistry journal homepage: www.elsevier.com/locate/ultson
Targeted and ultrasound-triggered drug delivery using liposomes co-modified with cancer cell-targeting aptamers and a thermosensitive polymer Kazuaki Ninomiya a, Takahiro Yamashita b, Shinya Kawabata b, Nobuaki Shimizu a,⇑ a b
Institute of Nature and Environmental Technology, Kanazawa University, Kanazawa 920-1192, Japan Division of Material Engineering, Graduate School of Natural Science and Technology, Kanazawa University, Kanazawa 920-1192, Japan
a r t i c l e
i n f o
Article history: Received 11 November 2013 Received in revised form 24 December 2013 Accepted 24 December 2013 Available online 3 January 2014 Keywords: Drug delivery Temperature-sensitive liposomes Thermosensitive polymer Aptamers Ultrasound Cavitation
a b s t r a c t In this study, we demonstrated the feasibility of targeted and ultrasound-triggered drug delivery using liposomes co-modified with single stranded DNA aptamers that recognized platelet-derived growth factor receptors (PDGFRs) as targeting ligands for breast cancer cells and poly(NIPMAM-co-NIPAM) as the thermosensitive polymer (TSP) to sensitize these liposomes to high temperature. TSP-modified liposomes (TSP liposomes) released encapsulated calcein under 1 MHz ultrasound irradiation for 30 s at 0.5 W/cm2 as well as the case under incubation for 5 min at 42 °C. Ultrasound-triggered calcein release from TSP liposomes was due to an increased local temperature, resulting from cavitation bubble collapse induced by ultrasound, and not due to an increase in the bulk medium temperature. Liposomes modified with PDGFR aptamers (APT liposomes) bound to MDA-MB-231 human breast cancer cells through PDGFR aptamers; however, they did not bind to primary human mammary epithelial cells (HMECs). The binding of APT liposomes was greatest for MDA-MB-231 cells, followed by MCF-7, WiDr, and HepG2 cancer cells. In a cell injury assay using doxorubicin (DOX)-loaded APT/TSP liposomes and ultrasound irradiation, cell viability of MDA-MB-231 at 24 h after ultrasound irradiation (1 MHz for 30 s at 0.5 W/cm2) with DOX-loaded APT/TSP liposomes was 60%, which was lower than that with ultrasound irradiation and DOX-loaded TSP liposomes or with DOX-loaded APT/TSP liposomes alone. Ó 2014 Elsevier B.V. All rights reserved.
1. Introduction Drug delivery systems (DDSs) using lipid- or polymer-based nanoparticles have been intensively investigated to improve the pharmacological properties of administered drugs [1]. Especially, liposomes, which were first proposed in the 1970s and are self-assembled structures of phospholipids that form a single continuous phospholipid bilayer, have a long history as carriers for delivering therapeutic and diagnostic agents to cancerous lesions [2]. Strategies for drug delivery to solid tumors using liposomes are divided into passive targeting and active targeting. For passive solid tumor targeting, liposomes modified with polyethylene glycol (PEG) have been used because they can evade reticuloendothelial system surveillance and circulate in the blood stream for long time [3], which results in their accumulation at tumor tissues due to an ‘‘enhanced permeability and retention’’ (EPR) effect [4]. However, the release of encapsulated drugs from liposomes depends on drug diffusion or slow degradation of these lipid bilayers. ⇑ Corresponding author. Tel.: +81 76 234 4807; fax: +81 76 234 4829. E-mail address: [email protected] (N. Shimizu). 1350-4177/$ - see front matter Ó 2014 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.ultsonch.2013.12.023
For active solid tumor targeting, liposomes have been engineered to have mechanisms of triggered drug release in the region of a tumor and/or have an affinity to bind to cancer cells. With regard to triggered drug release, a number of studies have been reported on liposomes that could release encapsulated drugs in response to environmental stimuli such as acidic pH, light, and high temperature [5]. The most promising liposomes are temperature-sensitive liposomes (TSLs) that use dipalmitoylphosphatidylcholine (DPPC) as the primary lipid [6]. TSLs release encapsulated drugs near the melting phase transition temperature (Tm) of the lipid bilayer, at which the structure of lipid membrane changes concomitant with its transition from a gel to a liquid crystalline phase. Drug release from TSLs had been induced by mild hyperthermia at 39–40 °C, a few degrees above physiological temperature [7]. As a source of hyperthermia to trigger drug release from TSLs, Dromi et al. [8] employed high intensity, focused ultrasound that was more advantageous in terms of its non-invasiveness as compared with other methods to induce hyperthermia such as microwave, IR laser, and radio frequency heating that require an interstitial needle or insertion of an antenna. With regard to liposomes that have binding affinity for tumors, several investigators have studied liposomes that were modified
K. Ninomiya et al. / Ultrasonics Sonochemistry 21 (2014) 1482–1488
with targeting ligands such as antibody and non-antibody molecules (e.g., RGD peptides to target integrins, folate to target its receptors, and others; [5,9]). TSLs have also been modified with cancer cell targeting ligands (antibodies or peptides), which exhibited binding affinity for cancer cells and triggered drug release induced by hyperthermia [10,11]. Another strategy for designing TSLs was reported by Kono et al. [12]. Liposomes were modified with a thermosensitive polymer (TSP) such as poly(N-isopropylacrylamide), which had a lower critical solution temperature (LCST) and aggregated at temperatures above the LCST due to hydrophobic interactions [13]. These TSP-modified liposomes (TSP liposomes) released their encapsulated drugs above the LCST, at which the liposomes were destabilized concomitant with a transition of the TSP from a hydrophilic to a hydrophobic state, although the hydrophilic TSP extended into solution and stabilized these liposomes below the LCST [14]. To date, many studies have demonstrated that drug release from TSP liposomes had been induced by mild hyperthermia at 39–40 °C using an incubator for in vitro studies [12,15] and by radio frequency for in vivo studies [16,17]. However, so far as we know, there have been no reports on ultrasound-triggered drug release from TSP liposomes, except for our previous report [18]. Moreover, there have been no reports regarding TSP liposomes that were co-modified with affinity ligands for targeting cancer cells. Therefore, in this study, we demonstrated the feasibility of targeted, ultrasound-mediated drug delivery using TSP liposomes that were co-modified with aptamers as targeting ligands for cancer cells (APT/TSP liposomes). We evaluated both ultrasoundtriggered drug release from TSP liposomes and the binding affinity of APT liposomes for cancer cells. We also demonstrated that ultrasound-mediated cancer cell injury was induced in the presence of APT/TSP liposomes.
2. Materials and methods 2.1. Materials A freeze-dried lipid mixture comprising dimyristoylphosphatidic acid, dipalmitoylphosphatidylcholine, and cholesterol at a molar ratio of 1:4:5 (COATSOMEÒ PL-1614KS; NOF Corporation, Tokyo, Japan) was used as the starting material to prepare APT/TSP liposomes. A copolymer of N-isopropylmethacrylamide (NIPMAM) and N-isopropylacrylamide (NIPAM) with two dodecyl groups at the chain end of the copolymer [2C12-poly(NIPMAM-co-NIPAM)] (number-average molecular weight = 4850, weight-average molecular weight = 7550, and composition of comonomer NIPMAM: NIPAM = 46: 54) was synthesized according to the method reported previously [19], and used as a TSP to provide liposomes with temperature sensitivity. PEGylated phospholipids and distearoylphosphatidylethanolamine–polyethylene glycol–N-hydroxysuccinimide (DSPE–PEG–NHS), synthesized by NOF Corporation, were used to introduce the functional groups into liposomes. Avidin was purchased from Nakarai Tesque, Kyoto, Japan. Single stranded DNA (ssDNA) aptamers that recognized the platelet-derived growth factor receptor (PDGFR; 50 - CAGGCTACGGCACGTAGAGCATCACCAT GATCCTG -30 ) [20] were used as targeting ligands for cancer cells. 50 -biotinylated aptamers for PDGFRs were synthesized and purified by reverse phase high-performance liquid chromatography (HPLC) (Operon Biotechnologies, Tokyo, Japan). Doxorubicin (DOX; AdriacinÒ; Kyowa Hakko Kirin Co., Ltd., Tokyo, Japan) was used as an anticancer drug, and 3,30 -Bis[N,N-bis(carboxymethyl)aminomethyl]fluorescein (Calcein; Wako Pure Chemical Industries Ltd., Osaka, Japan) was used as a model drug. The chemicals used in this study were of guaranteed reagent grade and did not require further purification.
1483
2.2. Cell cultures and media Human breast cancer cells MDA-MB-231, used as target cells, were purchased from the RIKEN cell bank, Tsukuba, Japan. Primary human mammary epithelial cells (HMECs), used as a control for MDA-MB-231 cells, were purchased from Life Technologies Corporation, Carlsbad, CA, USA. For some experiments, other human breast cancer cell line (MCF-7), human liver cancer cells (HepG2), and human colon cancer cells (WiDr), purchased from the RIKEN cell bank, were also used. MDA-MB-231, MCF-7, HepG2, and WiDr cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Nakarai Tesque) supplemented with 10% (v/v) fetal bovine serum (FBS; Life Technologies Corporation). HMEC cells were cultured in Medium 171 with Mammary Epithelial Growth Supplement (MEGS; Life Technologies Corporation). For HepG2 cells only, collagen type I coated culture dishes (AGC Techno Glass Co., Ltd., Tokyo, Japan) were used to ensure cell attachment to the dish. All culture media were supplemented with 100 U/mL of penicillin, 100 lg/mL of streptomycin, and 0.25 lg/mL of amphotericin B (Nakarai Tesque). Cells were maintained at 37 °C in a 5% CO2 atmosphere. 2.3. Preparation of APT/TSP liposomes To prepare APT/TSP liposomes, 10 mg of the freeze-dried lipid mixture and 0–20 mg of 2C12-poly(NIPMAM-co-NIPAM), 1.6 mg of DSPE–PEG–NHS, and 0.5 mg of avidin were added to a 1.5-mL tube containing 1 mL of a calcein solution (10 mM) or a DOX solution (2 mM) in saline. The weight ratios of TSP per lipid mixture (TSP/lipid ratio) were set at 0, 0.5, 1, and 2. After vortexing and incubation for 8 h at 4 °C in the dark, the 1.5-mL tube was centrifuged (15,000 rpm) for 40 min at 4 °C and the supernatant was removed. The recovered liposomes were washed three times with Dulbecco’s phosphate buffered saline without calcium chloride and magnesium chloride [D-PBS()], and finally suspended in 3.5 mL of D-PBS() to obtain liposomes co-modified with avidin and TSP. This liposome suspension was mixed with 1 mL of a PDGFR aptamer solution (100 nM) in D-PBS() and incubated for 5 h at 4 °C in the dark to immobilize the biotinylated aptamers on the liposomes by avidin–biotin coupling. After washing 3 times (15,000 rpm for 40 min at 4 °C) to remove the free aptamers, the precipitate was suspended in 3.5 mL of D-PBS() to obtain APT/TSP liposomes. As a control, liposomes modified with APT alone (APT liposomes) were prepared as mentioned above but without using 2C12-poly(NIPMAM-co-NIPAM). Liposomes modified with TSP alone (TSP liposomes) were prepared without using avidin and PDGFR aptamers. Naked liposomes, without modification, were prepared without using 2C12-poly(NIPMAM-co-NIPAM), avidin, and PDGFR aptamers. The concentrations of calcein-loaded liposomes and DOX-loaded liposomes in the prepared suspensions were evaluated by measuring the optical density at wavelengths of 540 nm (OD540) and 480 nm (OD480), respectively. 2.4. Assay for ultrasound-mediated drug release from TSP liposomes Two milliliters of a calcein-loaded TSP liposome suspension in D-PBS() at OD540 = 0.5 was added to a 35-mm culture dish, and incubated at 37 °C for 15 min. The culture dish was placed on the transducer of an ultrasonic apparatus (Sonic Master ES-2, OG Giken Co., Ltd., Okayama, Japan) after the transducer surface was covered with 3 mL of water. Ultrasound (frequency = 1 MHz; duty ratio = 100%) was then irradiated from the bottom of the dish under the following conditions: reading output intensity = 0 and 0.5 W/cm2 which correspond to 0 and 0.252 W/cm2 based on calorimetry [21]; irradiation time = 0–120 s at room temperature. As a control experiment, a 1.5-mL tube containing 1 mL of a
1484
K. Ninomiya et al. / Ultrasonics Sonochemistry 21 (2014) 1482–1488
calcein-loaded TSP liposome suspension (OD540 = 0.5) was heated using a block incubator at 37 or 42 °C for 0–15 min. After ultrasound irradiation or heating, 980 lL aliquot of the calcein-loaded liposome suspension was mixed with 20 lL of CoSO4 solution (10 mM) to quench any free calcein released from the liposomes. To evaluate ultrasound-mediated calcein release from liposomes, the fluorescent signals from 200 lL of the liposome suspension were measured with a microplate spectrofluorometer (Gemini XPS, Molecular devices, Sunnyvale, CA, USA) at excitation and emission wavelengths of 485 and 530 nm, respectively. Fluorescence derived from calcein, entrapped in the liposomes, (FC) was determined from the difference between the fluorescent signal of calcein-loaded liposome suspension and background signal from calcein-unloaded liposome suspension. Ultrasound-mediated calcein release from the liposomes was calculated by the following equation:
Calcein release ½% ¼
F C;0 F C;t 100 F C;0
ð1Þ
where FC,0 and FC,t were the FC values before and after ultrasound irradiation or heating, respectively, for a specified time, t. 2.5. Assay for binding of APT-liposome to cancer cells Prior to performing this assay, 4 105 cancer cells (MDA-MB231, MCF-7, WiDr, or HepG2 cells) suspended in 2 mL of culture medium were seeded in a 35-mm culture dish and incubated for 48 h to ensure confluent growth. For HMECs, 5 104 cells suspended in 2 mL of culture medium were seeded in 35-mm culture dishes and incubated for 96–144 h. Subsequently, calcein-loaded APT liposome suspension was added to the cell cultures for a liposome concentration equivalent to OD540 = 0.5. After further incubation for 60 min, the culture dishes were washed three times with 2 mL of D-PBS() to remove floating liposomes. For microscopy, cell monolayers were observed using a fluorescence microscope (BZ-8000, KEYENCE, Osaka, Japan). For microplate spectrofluorometry, cell monolayers were detached using 1 mL of a non-enzymatic cell dissociation solution (Takara Bio Inc., Otsu, Japan). After adjusting the cell concentration to 2 105 cells/mL in D-PBS(), the fluorescent signals from 200 lL of a cell suspension were measured with a microplate spectrofluorometer (Gemini XPS) at excitation and emission wavelengths of 485 and 530 nm, respectively. 2.6. Assay for cancer cell injury due to ultrasound-mediated DOX release from APT/TSP liposomes Semi-confluent MDA-MB-231 cells were prepared in 35-mm culture dishes as described above. Subsequently, a DOX-loaded APT/TSP liposome suspension was added to the cell cultures for a liposome concentration equivalent to OD480 = 0.2, which was approximately equivalent to 20 lM DOX in the medium. The culture dish was placed on the transducer of an ultrasonic apparatus (Sonic Master ES-2) after the transducer surface was covered with 3 mL of water. Ultrasound was then irradiated from the bottom of the dish under the following conditions: frequency = 1 MHz; duty ratio = 100%; output power = 0.5 W/cm2; and irradiation time = 30 s at room temperature. After ultrasound irradiation, the culture dishes were incubated for 60 min and then washed three times with 2 mL of D-PBS() to remove floating cells and liposomes. The cells were then assessed for cellular injury. To evaluate cancer cell injury, 2 mL of culture medium was added to the culture dish and incubated for 24 h. Cells were harvested by enzymatic treatment using a solution with 2.5 g/L of trypsin and 1 mM EDTA (Nakarai Tesque). Subsequently, viable
cells were counted using a hemocytometer by the trypan blue exclusion test. Cell viability was expressed as the percentage of viable cells to the control condition without liposomes and ultrasound irradiation. 2.7. Statistical analysis Results are given as means ± standard errors. Statistical comparisons were made by one-way analysis of variance (one-way ANOVA) followed by a Bonferroni multiple-range test. A p-value of
Contents lists available at ScienceDirect
Ultrasonics Sonochemistry journal homepage: www.elsevier.com/locate/ultson
Targeted and ultrasound-triggered drug delivery using liposomes co-modified with cancer cell-targeting aptamers and a thermosensitive polymer Kazuaki Ninomiya a, Takahiro Yamashita b, Shinya Kawabata b, Nobuaki Shimizu a,⇑ a b
Institute of Nature and Environmental Technology, Kanazawa University, Kanazawa 920-1192, Japan Division of Material Engineering, Graduate School of Natural Science and Technology, Kanazawa University, Kanazawa 920-1192, Japan
a r t i c l e
i n f o
Article history: Received 11 November 2013 Received in revised form 24 December 2013 Accepted 24 December 2013 Available online 3 January 2014 Keywords: Drug delivery Temperature-sensitive liposomes Thermosensitive polymer Aptamers Ultrasound Cavitation
a b s t r a c t In this study, we demonstrated the feasibility of targeted and ultrasound-triggered drug delivery using liposomes co-modified with single stranded DNA aptamers that recognized platelet-derived growth factor receptors (PDGFRs) as targeting ligands for breast cancer cells and poly(NIPMAM-co-NIPAM) as the thermosensitive polymer (TSP) to sensitize these liposomes to high temperature. TSP-modified liposomes (TSP liposomes) released encapsulated calcein under 1 MHz ultrasound irradiation for 30 s at 0.5 W/cm2 as well as the case under incubation for 5 min at 42 °C. Ultrasound-triggered calcein release from TSP liposomes was due to an increased local temperature, resulting from cavitation bubble collapse induced by ultrasound, and not due to an increase in the bulk medium temperature. Liposomes modified with PDGFR aptamers (APT liposomes) bound to MDA-MB-231 human breast cancer cells through PDGFR aptamers; however, they did not bind to primary human mammary epithelial cells (HMECs). The binding of APT liposomes was greatest for MDA-MB-231 cells, followed by MCF-7, WiDr, and HepG2 cancer cells. In a cell injury assay using doxorubicin (DOX)-loaded APT/TSP liposomes and ultrasound irradiation, cell viability of MDA-MB-231 at 24 h after ultrasound irradiation (1 MHz for 30 s at 0.5 W/cm2) with DOX-loaded APT/TSP liposomes was 60%, which was lower than that with ultrasound irradiation and DOX-loaded TSP liposomes or with DOX-loaded APT/TSP liposomes alone. Ó 2014 Elsevier B.V. All rights reserved.
1. Introduction Drug delivery systems (DDSs) using lipid- or polymer-based nanoparticles have been intensively investigated to improve the pharmacological properties of administered drugs [1]. Especially, liposomes, which were first proposed in the 1970s and are self-assembled structures of phospholipids that form a single continuous phospholipid bilayer, have a long history as carriers for delivering therapeutic and diagnostic agents to cancerous lesions [2]. Strategies for drug delivery to solid tumors using liposomes are divided into passive targeting and active targeting. For passive solid tumor targeting, liposomes modified with polyethylene glycol (PEG) have been used because they can evade reticuloendothelial system surveillance and circulate in the blood stream for long time [3], which results in their accumulation at tumor tissues due to an ‘‘enhanced permeability and retention’’ (EPR) effect [4]. However, the release of encapsulated drugs from liposomes depends on drug diffusion or slow degradation of these lipid bilayers. ⇑ Corresponding author. Tel.: +81 76 234 4807; fax: +81 76 234 4829. E-mail address: [email protected] (N. Shimizu). 1350-4177/$ - see front matter Ó 2014 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.ultsonch.2013.12.023
For active solid tumor targeting, liposomes have been engineered to have mechanisms of triggered drug release in the region of a tumor and/or have an affinity to bind to cancer cells. With regard to triggered drug release, a number of studies have been reported on liposomes that could release encapsulated drugs in response to environmental stimuli such as acidic pH, light, and high temperature [5]. The most promising liposomes are temperature-sensitive liposomes (TSLs) that use dipalmitoylphosphatidylcholine (DPPC) as the primary lipid [6]. TSLs release encapsulated drugs near the melting phase transition temperature (Tm) of the lipid bilayer, at which the structure of lipid membrane changes concomitant with its transition from a gel to a liquid crystalline phase. Drug release from TSLs had been induced by mild hyperthermia at 39–40 °C, a few degrees above physiological temperature [7]. As a source of hyperthermia to trigger drug release from TSLs, Dromi et al. [8] employed high intensity, focused ultrasound that was more advantageous in terms of its non-invasiveness as compared with other methods to induce hyperthermia such as microwave, IR laser, and radio frequency heating that require an interstitial needle or insertion of an antenna. With regard to liposomes that have binding affinity for tumors, several investigators have studied liposomes that were modified
K. Ninomiya et al. / Ultrasonics Sonochemistry 21 (2014) 1482–1488
with targeting ligands such as antibody and non-antibody molecules (e.g., RGD peptides to target integrins, folate to target its receptors, and others; [5,9]). TSLs have also been modified with cancer cell targeting ligands (antibodies or peptides), which exhibited binding affinity for cancer cells and triggered drug release induced by hyperthermia [10,11]. Another strategy for designing TSLs was reported by Kono et al. [12]. Liposomes were modified with a thermosensitive polymer (TSP) such as poly(N-isopropylacrylamide), which had a lower critical solution temperature (LCST) and aggregated at temperatures above the LCST due to hydrophobic interactions [13]. These TSP-modified liposomes (TSP liposomes) released their encapsulated drugs above the LCST, at which the liposomes were destabilized concomitant with a transition of the TSP from a hydrophilic to a hydrophobic state, although the hydrophilic TSP extended into solution and stabilized these liposomes below the LCST [14]. To date, many studies have demonstrated that drug release from TSP liposomes had been induced by mild hyperthermia at 39–40 °C using an incubator for in vitro studies [12,15] and by radio frequency for in vivo studies [16,17]. However, so far as we know, there have been no reports on ultrasound-triggered drug release from TSP liposomes, except for our previous report [18]. Moreover, there have been no reports regarding TSP liposomes that were co-modified with affinity ligands for targeting cancer cells. Therefore, in this study, we demonstrated the feasibility of targeted, ultrasound-mediated drug delivery using TSP liposomes that were co-modified with aptamers as targeting ligands for cancer cells (APT/TSP liposomes). We evaluated both ultrasoundtriggered drug release from TSP liposomes and the binding affinity of APT liposomes for cancer cells. We also demonstrated that ultrasound-mediated cancer cell injury was induced in the presence of APT/TSP liposomes.
2. Materials and methods 2.1. Materials A freeze-dried lipid mixture comprising dimyristoylphosphatidic acid, dipalmitoylphosphatidylcholine, and cholesterol at a molar ratio of 1:4:5 (COATSOMEÒ PL-1614KS; NOF Corporation, Tokyo, Japan) was used as the starting material to prepare APT/TSP liposomes. A copolymer of N-isopropylmethacrylamide (NIPMAM) and N-isopropylacrylamide (NIPAM) with two dodecyl groups at the chain end of the copolymer [2C12-poly(NIPMAM-co-NIPAM)] (number-average molecular weight = 4850, weight-average molecular weight = 7550, and composition of comonomer NIPMAM: NIPAM = 46: 54) was synthesized according to the method reported previously [19], and used as a TSP to provide liposomes with temperature sensitivity. PEGylated phospholipids and distearoylphosphatidylethanolamine–polyethylene glycol–N-hydroxysuccinimide (DSPE–PEG–NHS), synthesized by NOF Corporation, were used to introduce the functional groups into liposomes. Avidin was purchased from Nakarai Tesque, Kyoto, Japan. Single stranded DNA (ssDNA) aptamers that recognized the platelet-derived growth factor receptor (PDGFR; 50 - CAGGCTACGGCACGTAGAGCATCACCAT GATCCTG -30 ) [20] were used as targeting ligands for cancer cells. 50 -biotinylated aptamers for PDGFRs were synthesized and purified by reverse phase high-performance liquid chromatography (HPLC) (Operon Biotechnologies, Tokyo, Japan). Doxorubicin (DOX; AdriacinÒ; Kyowa Hakko Kirin Co., Ltd., Tokyo, Japan) was used as an anticancer drug, and 3,30 -Bis[N,N-bis(carboxymethyl)aminomethyl]fluorescein (Calcein; Wako Pure Chemical Industries Ltd., Osaka, Japan) was used as a model drug. The chemicals used in this study were of guaranteed reagent grade and did not require further purification.
1483
2.2. Cell cultures and media Human breast cancer cells MDA-MB-231, used as target cells, were purchased from the RIKEN cell bank, Tsukuba, Japan. Primary human mammary epithelial cells (HMECs), used as a control for MDA-MB-231 cells, were purchased from Life Technologies Corporation, Carlsbad, CA, USA. For some experiments, other human breast cancer cell line (MCF-7), human liver cancer cells (HepG2), and human colon cancer cells (WiDr), purchased from the RIKEN cell bank, were also used. MDA-MB-231, MCF-7, HepG2, and WiDr cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Nakarai Tesque) supplemented with 10% (v/v) fetal bovine serum (FBS; Life Technologies Corporation). HMEC cells were cultured in Medium 171 with Mammary Epithelial Growth Supplement (MEGS; Life Technologies Corporation). For HepG2 cells only, collagen type I coated culture dishes (AGC Techno Glass Co., Ltd., Tokyo, Japan) were used to ensure cell attachment to the dish. All culture media were supplemented with 100 U/mL of penicillin, 100 lg/mL of streptomycin, and 0.25 lg/mL of amphotericin B (Nakarai Tesque). Cells were maintained at 37 °C in a 5% CO2 atmosphere. 2.3. Preparation of APT/TSP liposomes To prepare APT/TSP liposomes, 10 mg of the freeze-dried lipid mixture and 0–20 mg of 2C12-poly(NIPMAM-co-NIPAM), 1.6 mg of DSPE–PEG–NHS, and 0.5 mg of avidin were added to a 1.5-mL tube containing 1 mL of a calcein solution (10 mM) or a DOX solution (2 mM) in saline. The weight ratios of TSP per lipid mixture (TSP/lipid ratio) were set at 0, 0.5, 1, and 2. After vortexing and incubation for 8 h at 4 °C in the dark, the 1.5-mL tube was centrifuged (15,000 rpm) for 40 min at 4 °C and the supernatant was removed. The recovered liposomes were washed three times with Dulbecco’s phosphate buffered saline without calcium chloride and magnesium chloride [D-PBS()], and finally suspended in 3.5 mL of D-PBS() to obtain liposomes co-modified with avidin and TSP. This liposome suspension was mixed with 1 mL of a PDGFR aptamer solution (100 nM) in D-PBS() and incubated for 5 h at 4 °C in the dark to immobilize the biotinylated aptamers on the liposomes by avidin–biotin coupling. After washing 3 times (15,000 rpm for 40 min at 4 °C) to remove the free aptamers, the precipitate was suspended in 3.5 mL of D-PBS() to obtain APT/TSP liposomes. As a control, liposomes modified with APT alone (APT liposomes) were prepared as mentioned above but without using 2C12-poly(NIPMAM-co-NIPAM). Liposomes modified with TSP alone (TSP liposomes) were prepared without using avidin and PDGFR aptamers. Naked liposomes, without modification, were prepared without using 2C12-poly(NIPMAM-co-NIPAM), avidin, and PDGFR aptamers. The concentrations of calcein-loaded liposomes and DOX-loaded liposomes in the prepared suspensions were evaluated by measuring the optical density at wavelengths of 540 nm (OD540) and 480 nm (OD480), respectively. 2.4. Assay for ultrasound-mediated drug release from TSP liposomes Two milliliters of a calcein-loaded TSP liposome suspension in D-PBS() at OD540 = 0.5 was added to a 35-mm culture dish, and incubated at 37 °C for 15 min. The culture dish was placed on the transducer of an ultrasonic apparatus (Sonic Master ES-2, OG Giken Co., Ltd., Okayama, Japan) after the transducer surface was covered with 3 mL of water. Ultrasound (frequency = 1 MHz; duty ratio = 100%) was then irradiated from the bottom of the dish under the following conditions: reading output intensity = 0 and 0.5 W/cm2 which correspond to 0 and 0.252 W/cm2 based on calorimetry [21]; irradiation time = 0–120 s at room temperature. As a control experiment, a 1.5-mL tube containing 1 mL of a
1484
K. Ninomiya et al. / Ultrasonics Sonochemistry 21 (2014) 1482–1488
calcein-loaded TSP liposome suspension (OD540 = 0.5) was heated using a block incubator at 37 or 42 °C for 0–15 min. After ultrasound irradiation or heating, 980 lL aliquot of the calcein-loaded liposome suspension was mixed with 20 lL of CoSO4 solution (10 mM) to quench any free calcein released from the liposomes. To evaluate ultrasound-mediated calcein release from liposomes, the fluorescent signals from 200 lL of the liposome suspension were measured with a microplate spectrofluorometer (Gemini XPS, Molecular devices, Sunnyvale, CA, USA) at excitation and emission wavelengths of 485 and 530 nm, respectively. Fluorescence derived from calcein, entrapped in the liposomes, (FC) was determined from the difference between the fluorescent signal of calcein-loaded liposome suspension and background signal from calcein-unloaded liposome suspension. Ultrasound-mediated calcein release from the liposomes was calculated by the following equation:
Calcein release ½% ¼
F C;0 F C;t 100 F C;0
ð1Þ
where FC,0 and FC,t were the FC values before and after ultrasound irradiation or heating, respectively, for a specified time, t. 2.5. Assay for binding of APT-liposome to cancer cells Prior to performing this assay, 4 105 cancer cells (MDA-MB231, MCF-7, WiDr, or HepG2 cells) suspended in 2 mL of culture medium were seeded in a 35-mm culture dish and incubated for 48 h to ensure confluent growth. For HMECs, 5 104 cells suspended in 2 mL of culture medium were seeded in 35-mm culture dishes and incubated for 96–144 h. Subsequently, calcein-loaded APT liposome suspension was added to the cell cultures for a liposome concentration equivalent to OD540 = 0.5. After further incubation for 60 min, the culture dishes were washed three times with 2 mL of D-PBS() to remove floating liposomes. For microscopy, cell monolayers were observed using a fluorescence microscope (BZ-8000, KEYENCE, Osaka, Japan). For microplate spectrofluorometry, cell monolayers were detached using 1 mL of a non-enzymatic cell dissociation solution (Takara Bio Inc., Otsu, Japan). After adjusting the cell concentration to 2 105 cells/mL in D-PBS(), the fluorescent signals from 200 lL of a cell suspension were measured with a microplate spectrofluorometer (Gemini XPS) at excitation and emission wavelengths of 485 and 530 nm, respectively. 2.6. Assay for cancer cell injury due to ultrasound-mediated DOX release from APT/TSP liposomes Semi-confluent MDA-MB-231 cells were prepared in 35-mm culture dishes as described above. Subsequently, a DOX-loaded APT/TSP liposome suspension was added to the cell cultures for a liposome concentration equivalent to OD480 = 0.2, which was approximately equivalent to 20 lM DOX in the medium. The culture dish was placed on the transducer of an ultrasonic apparatus (Sonic Master ES-2) after the transducer surface was covered with 3 mL of water. Ultrasound was then irradiated from the bottom of the dish under the following conditions: frequency = 1 MHz; duty ratio = 100%; output power = 0.5 W/cm2; and irradiation time = 30 s at room temperature. After ultrasound irradiation, the culture dishes were incubated for 60 min and then washed three times with 2 mL of D-PBS() to remove floating cells and liposomes. The cells were then assessed for cellular injury. To evaluate cancer cell injury, 2 mL of culture medium was added to the culture dish and incubated for 24 h. Cells were harvested by enzymatic treatment using a solution with 2.5 g/L of trypsin and 1 mM EDTA (Nakarai Tesque). Subsequently, viable
cells were counted using a hemocytometer by the trypan blue exclusion test. Cell viability was expressed as the percentage of viable cells to the control condition without liposomes and ultrasound irradiation. 2.7. Statistical analysis Results are given as means ± standard errors. Statistical comparisons were made by one-way analysis of variance (one-way ANOVA) followed by a Bonferroni multiple-range test. A p-value of
