DEVELOPMENTAL GENETICS 112-14 (1990)

Temporal and Spatial Expression of a Cytoskeletal Actin Gene in the Ascidian Styela clava REBECCA L. BEACH AND WILLIAM R. JEFFERY Center for Developmental Biology, Department of Zoology, University of Texas, Austin ABSTRACT We have cloned and characterized the temporal and spatial expression of ScCAl5, a cDNA clone encoding an actin gene in the ascidian Styela clava. The partial nucleotide and derived amino acid sequences of this singlecopy gene suggest that it is a cytoskeletal actin. Northern analysis shows that ScCAl5 corresponds to a 1.8-kb mRNA that is transcribed during oogenesis, during embryonic development, and in the adult. In situ hybridization shows that maternal ScCA15 mRNA is distributed uniformly in the cytoplasm of the oocyte and unfertilized egg. During the period of ooplasmic segregation following fertilization, however, ScCAl5 mRNA appears to be translocated into the ectoplasm, a specialized cytoplasmic region of the egg. During the early cleavages, the ectoplasmic transcripts are partitioned to ectodermal cells in the animal hemisphere, which are precursors of the epidermis and nervous system of the larva. Maternal ScCA15 mRNA is degraded just before gastrulation and replaced by zygotic transcripts which begin to accumulate between the neurula and mid-tailbud stages. Zygotic ScCAl5 mRNA accumulates primarily in the epidermal and neural cells, although lower levels of these transcripts may also be present in tail muscle cells. These results show that two mechanisms are used to concentrate ScCA15 mRNA in the ectodermal cells during development: 1 ) localization and differential segregation of maternal transcripts and 2) specific expression of the ScCA15 gene. ScCAl5 mRNA is detected by in situ hybridization in the testes, ovaries, alimentary tract, and endostyle of adults. In the testes, ScCA15 mRNA is present in developing sperm, whereas in the ovary, these transcripts are present in the germinal epithelium and developing oocytes. In the alimentary tract, ScCAl5 mRNA is confined to the gastric epithelium of the esophagus, stomach, and intestine. Since the ScCA15 gene is expressed in embryonic and adult tissues that are undergoing rapid cell division, this actin is likely to function in some aspect of cell proliferation. Key words: Gene expression, mRNA localization, ascidian embryos

0 1990 WILEY-LISS, INC.

INTRODUCTION Actin is a ubiquitous protein that is encoded by a multigene family in higher eukaryotes [see Firtel, 19811. Although actins are similar in amino acid sequence, they are usually distinguishable by twodimensional gel electrophoresis [Garrels and Gibson, 1976; Whalen et al., 1976; Rubenstein and Spudich, 19771. Based on their isoelectric points, the various actin isoforms are designated a s a,p, or y actins. In vertebrates, p and y actins are found in many different cell types, where they presumably function in processes related to the cytoskeleton and are designated as cytoplasmic or cytoskeletal actins. In contrast, the a actins are restricted to muscle cells and are designated as muscle actins [see Vandekerckhove et al., 19831. The acliri genes exhibit differential temporal and spatial expression in a wide variety of organisms, including Drosophila [Zulauf et al., 1981; Fyrberg et al., 1983; Sanchez et al., 1983; Courchesne-Smith and Tobin, 19891, sea urchins [Garcia et al., 1984; Cox et al., 19861, Xenopus [Mohun et al., 19841, and chickens [Schwartz and Rothblum, 19811. Although the function of multiple actin genes is unknown, the gene family may have evolved either to satisfy a requirement of large amounts of actin or to supply particular cell types with functionally different actins. The existence of different patterns of actin gene expression seems to favor the latter possibility. The ascidian embryo is particularly attractive for examining the pattern of gene expression during development. The small size of the ascidian genome [Mirsky and Ris, 1951; Atkin and Ohno, 1967; Lambert and Laird, 19711 facilitates gene cloning. Ascidian development is rapid, and the larva contains only a few thousand cells and a limited number of different tissues. Ascidian tadpole larvae exhibit typical chordate features, including a dorsal nervous system and notochord, and have a locomotory tail containing longitu-

~

____________

Received for publication June 28, 1989; accepted October 12, 1989. Address reprint requests to Rebecca L. Beach, Department of Zoology, University of Texas, Austin, TX 78712.

TEMPORAL AND SPATIAL EXPRESSION OF ScCA15

3

dinal bands of differentiated muscle cells. Considerable 6 hr, the mid-tailbud stage was a t 7-10 hr, the late information exists concerning the cell lineage of ascid- tailbud stage was a t 10-14 hr, and the larva hatched at ian embryos [Nishida, 1987; Nicol and Meinertzhagen, 14 h r after insemination. 19881, and in Styela embryos these lineages are distinSperm, oocytes, and unfertilized mature eggs for guished by different colors [Conklin, 19051. The colored RNA or DNA isolation were obtained from dissected cytoplasmic regions of Styela oocytes segregate to pre- gonads [Jeffery et al., 19831 and washed several times determined regions of eggs after fertilization [Jeffery in MFSW. and Bates, 19891 and are partitioned to specific embryRNA Isolation onic cell lineages during cleavage. Because of these and other features ascidian embryos have served a s a model Total RNA was isolated by the method of March et al. system for examining the role of cytoplasmic localiza- [1985]. Polyadenylated RNA was selected by oligo (dT) cellulose chromatography [Aviv and Leder, 19721. tion in the determination of cell fate [Jeffery, 19851. Like vertebrates, ascidians contain distinct cytoskelPreparation and Screening of the Oocyte etal and muscle actins [Vanderkerckhove and Weber, cDNA Library 1984; Tomlinson et al., 1987al. Little is known about the ascidian cytoskeletal actins. However, the expresPoly (A)+ RNA from oocytes was used to synthesize sion of a muscle actin gene has recently been examined cDNA following the method of Huynh et al. [1984]. by in situ hybridization with SpMA3C, a cDNA iso- Double-stranded cDNA was ligated to Eco RI arms of lated from the ascidian Styela plicata [Tomlinson et al., X g t l O via Eco RI linkers and packaged in vitro by using 1987bl..Although low levels of muscle actin transcripts Packagene (Promega, Madison, WI). The oocyte cDNA are detectable in the unfertilized egg, zygotic muscle library was screened with 32P-labelled transcripts preactin gene expression begins during gastrulation and pared from the Styela plicata actin cDNA clone, occurs in the muscle cell lineage. Muscle actin mRNA SpMA3C [Tomlinson et al., 1987bl. SpMA3C consists of continues to accumulate in the larval tail muscle cells a 666-base-pair insert containing 481 base pairs of the during embryogenesis [Tomlinson et al., 1987bl. In protein coding region and 185 base pairs of the 3' unadults, the muscle actin gene is expressed in body wall translated region of a n S . plicata muscle actin cDNA muscle and mesenchymal cells. Muscle actin gene ex- cloned into the Eco RI site of the vector Bluescribe pression in S . plicata mirrors that of the myosin heavy [Tomlinson et al., 1987bl. Selected clones were purified chain gene, whose embryonic expression recently has by two or more rounds of screening, and DNA was subbeen characterized in the ascidian Halocynthia roretzi sequently isolated from the purified A g t l O clones for subcloning [Maniatis et al., 19821. [Makabe and Satoh, 19891. The purpose of the present investigation was to isoSubcloning and Sequencing of cDNA Clones late and characterize a n ascidian cytoskeletal actin DNA from purified cDNA clones was digested with gene and compare its temporal and spatial expression to that of muscle actin. Here we describe the isolation the restriction enzyme Eco RI and cDNA inserts were of ScCA15, a cDNA clone corresponding to a cytoskel- separated from the vector arms on a 1%agarose gel. etal actin gene in the ascidian Styela claua. We dem- Insert DNA was recovered from gels by using NA-45 onstrate that ScCA15 represents a single-copy gene ex- paper (Schleicher and Schuell, Keene, NH) followed by pressed in oocytes, embryos, and adults in a pattern ligation into the Eco RI site of the vector Bluescript M13 + (Stratagene, San Diego, CA). The E. coli strain suggesting that it may function in cell proliferation. JM109 was transformed with the ligated DNA and recombinant subclones were identified by using blue/ MATERIALS AND METHODS white color selection on X-gal/IPTG-containing plates. Animals, Gametes, and Embryos Subclones were sequenced by using 35S-dATP (-800 The ascidian Styela clava was collected at Woods Ci/mmole; New England Nuclear, Boston, MA) and a Hole, MA, or purchased from Marinus, Inc. (Long Sequenase DNA Sequencing Kit (United States BioBeach, CA). Animals were maintained a s described chemical Corporation, Cleveland, OH) in the dideoxy previously [Tomlinson et al., 1987al. Cultures of syn- chain termination procedure [Sanger et al., 19771 by chronously developing embryos were obtained by using using Bluescript primers. Samples were run on denagametes spawned from animals subjected to a light/ turing 6% polyacrylamide gels. dark cycle [West and Lambert, 19751. Eggs were fertilPreparation of RNA Probes ized by mixing the gametes from two or more individRNA probes were synthesized from Bluescript subuals. Fertilized eggs were washed with Milliporefiltered seawater (MFSW) and cultured in MFSW at clones by using T3 or T7 RNA polymerase following the 17°C a s described previously [Jeffery et al., 19831. At accompanying protocol (Stratagene) [Melton et al., this temperature, the yellow crescent formed at 40 min, 19841. Probes for filter blot hybridizations were made first cleavage was a t 60 min, gastrulation was a t 3.5 hr, by using 32P-CTP (800-3,000 Ciimmole). Probes used neurulation was a t 5 hr, the early tailbud stage was at for in situ hybridization were synthesized in the pres-

4

BEACH AND JEFFERY

ence of either 35S-ATP (-1,200 Ciimmole) or 100 pCi each of two or more 3H-labelled nucleotide triphosphates. All radioactive nucleotides used in RNA probe synthesis were purchased from New England Nuclear.

Southern and Northern Blot Hybridization Genomic DNA was isolated from sperm dissected from individual adult animals according to the method of Davis et al. [1986]. The purified DNA was digested with restriction enzymes and fractionated on 1% agarose gels by using 0.04 M Tris-acetate, pH 8.2,O.OOl M EDTA as the running buffer [Maniatis et al., 19821. The DNA was subsequently transferred to Zeta-Probe membrane (Bio-Rad, Richmond, CA) by using the alkaline Southern blotting technique [Reed and Mann, 19851. For Northern analysis, total RNA was size fractionated on 1% agarose-formaldehyde gels [Maniatis et al., 19821 with the addition of 3% formaldehyde to the running buffer. RNA was transferred from the gel to Hybond-N membrane (Amersham, Arlington Heights, IL) by using 0.025 M sodium phosphate (pH 7.0) as the transfer buffer. RNA was bound to membranes by exposure to a n ultraviolet transilluminator for 5 min. Blots were prehybridized in 50% formamide, I X Denhardt's solution [Denhardt, 19661, 4 x SET (1x SET is 0.15M NaC1, 0.03 M Tris-HC1, pH 8.0, 0.002 M EDTA), 25 mM sodium phosphate (pH 7.0), 0.2% sodium pyrophosphate, 100 pg/ml poly (A), 250 pg/ml sheared and denatured salmon sperm DNA, 1% SDS a t 42°C for 2-4 hr. Radioactive RNA probe was added to membranes in prehybridization solution and incubated overnight at 42°C. Blots were washed three times in 2 x SET, 0.2% SDS, 0.2% sodium pyrophosphate for 15 min a t room temperature and once in 0.5 x SET, 0.2% SDS, 0.2% sodium pyrophosphate for 30-45 rnin a t 50°C for low-stringency conditions. An additional wash in 0.1 x SET, 0.2% SDS, 0.2% sodium pyrophosphate for 30-45 min at 55°C was performed for high-stringency conditions. In Situ Hybridization In situ hybridization with RNA probes and autoradiography were carried out a s described by Tomlinson et al. [ 1987133with a hybridization buffer containing 50% formamide, 2 x SET, 1x Denhardt's, 500 pgiml tRNA, 500 pg/ml poly (A), and 10% dextran sulfate. The slides were washed successively in 4 x SSC, 2 x SSC, and 1 x SSC. The final wash was in 0 . 2 ~SSC for 45 min at 45°C. Hybridizations with 35S-labelled probes included 100 mM DTT in the hybridization buffer, and 10 mM DTT in the 4 x SSC washes. Serial sections adjacent to those hybridized in situ were stained with Milligan's trichrome [Jeffery, 19891 to identify different cytoplasms of the egg, various cell types of the embryo, and different tissues of the adult. Milligan's trichrome stains the myoplasm of eggs and embryos dark red, the ectoplasm magenta, and the endoplasm blue-green.

RESULTS Isolation and Characterization of a Cytoskeletal Actin cDNA The cDNA clone ScCA15 was obtained from a n S . claua cDNA library screened with the S . plicata actin cDNA clone SpMA3C [Tomlinson et al., 1987bl. The partial nucleotide sequence and derived amino acid sequence of ScCA15 are shown in Figure 1. The derived amino acid sequence was compared to vertebrate and invertebrate cytoskeletal and muscle actin protein sequences [Akhurst et al., 1987; Crain et al., 1987; Cross et al., 1988; Files et al., 1983; Kost et al., 1983; Nude1 et al., 1983; Sanchez et al., 1983; Schwartz et al., 1984; Stutz and Spohr, 1986; Vandekerckhove and Weber, 19841, and was determined to most closely resemble a vertebrate p actin. In particular, the identity of residues 6, 10, 16, 17, 76, 103, 287, 297, 358, and 365 are diagnostic for vertebrate cytoskeletal (p and y) isoforms a s opposed to muscle (a)actin isoforms (Table 1). However, the amino acid sequence also has some characteristics of invertebrate actins. For instance, the sequence of N-terminal residues 2 through 5-Asp-AspGlu-Val-has only been reported in invertebrate cytoskeletal and muscle actin isoforms. Similarly, residues number 318 (Ser) and 323 (Pro) share amino acid identities at their positions with sea urchin cytoskeletal actins [Akhurst et al., 19871, and residue number 319 (Thr) shares identity with a Drosophila actin [Sanchez et al., 19831. These amino acids are not found a t these positions in vertebrate cytoskeletal or muscle actins. In addition, the identity of residues number 18 (Asn) and 291 (Pro) appear to be unique to this sequence; residue 81 is Asp and 291 is Lys in all other actins that have been examined so far. Figure 2 shows the structure of the ScCA15 subclone used in the experiments that follow. The 1.2 kb Eco RI insert of ScCA15 contains the entire protein coding region, 23 nucleotides of the 5' untranslated region, and 200 nucleotides of the 3' untranslated region of the mRNA. The stretch of seven adenylic acid residues a t the 3' end of this clone, the position of a putative polyadenylation site -90 nucleotides upstream from the oligo(A) stretch (Fig. l ) , and the size and sequence of other clones representing the same transcript (data not shown) suggest that the entire 3' untranslated portion of 195 nucleotides is contained within this clone. To generate 3' specific probes, the Bluescript subclone was digested with the restriction enzyme Dde I, which cuts a t the termination codon, separating the coding region from the 3' untranslated portion of the clone. The Dde I-digested DNA was then used in in vitro transcription reactions with T3 RNA polymerase to generate a probe (ScCA15IDde) complementary to the 3' untranslated region of the gene. The specificity of the 3' probe was confirmed by hybridization to genomic Southern blots. Hybridization of 32P-labelled ScCA15/Dde probe to genomic DNA iso-

TEMPORAL AND SPATIAL EXPRESSION OF ScCA15

5

5' CAAATTAAAGTTAATAAATAATC ATG GAT GAT GAA GTT GCT GCT CTC GTT GTA GAT AAT GGA TCA m e t asp asp glu val 1

a

ala leu val

a s p a s n g l y ser 10

GGA ATG TGC AAA GCC GGT TTT GCC GTT GAC GAC GCC CCA AGG GCC GTT TTC CCA TCA ATT gly

m&]

l y s a l a g l y phe a l a g l y a s p a s p a l a p r o a r g a l a v a l phe p r o s e r i l e

30

20

GTA GGA CGA CCA AGA CAT CAG GGC GTC ATG GTT GGA ATG GGA CAA AAA GAC AGC TAC GTT v a l g l y a r g p r o a r g h i s g l n g l y v a l m e t v a l g l y m e t g l y g l n l y s a s p ser t y r v a l 50 40

GGC GAT GAA GCT CAG AGC AAA AGA GGT ATC TTG ACG TTG AAA TAC CCA ATC GAG CAC GGA g l y a s p g l u a l a g l n ser l y s a r g g l y i l e l e u t h r l e u l y s t y r p r o i l e g l u h i s gly 70 60 ATC GTG ACC AAC TGG GAT AAC ATG GAA AAG ATT TGG CAT CAC ACC TTC TAC AAT GAG CT-T ile

t h r a s n t r p a s p a s n m e t g l u l y s i l e t r p h i s h i s t h r phe t y r a s n g l u l e u 90

80

CGT GTC GCT CCC GAG GAA CAC CCA GTT CTT CTT ACA GAA GCC CCA TTG AAT CCA AAG C a r g v a l a l a p r o g l u g l u h i s p r o m l e u l e u t h r g l u a l a pro l e u a s n p r o l y s 110

100

_ _ _ _ -

-

AC GAA ACC ACA TAC AAC TCC ATC ATG AAA TGT GAT GTC GAT ATT CGT CCG g l u t h r t h r t y r a s n ser i l e m e t l y s c y s a s p I v a l ] a s p i l e a r g p r o 290

280

GAC TTG TAC GCA AAT ACC GTC TTG TCA GGC GGA ACC ACC ATG TAC CCT GGT ATC GCC GAT a s p l e u t y r a l a a s n m v a l l e u ser g l y g l y t h r t h r m e t t y r p r o g l y i l e a l a a s p 310

300

CGT ATG CAG AAA GAA ATA TCT ACT CTT GCG CCA CCA ACC ATG AAG ATC AAG ATC ATT GCC a r g m e t g l n l y s g l u i l e ser t h r l e u a l a p r o p r o t h r m e t l y s i l e l y s i l e i l e a l a 320

330

CCG CCT GAA AGA AAA TAT TCT GTA TGG ATC GGA GGA TCT ATC CTT GCT TCG CTT TCG ACC p r o p r o g l u a r g l y s t y r ser v a l t r p i l e g l y g l y s e r i l e l e u a l a ser l e u s e r t h r 350

340

TTC CAG CAG ATG TGG ATC TCC AAA CAA GAA TAC GAT GAA TCT GGC CCT TCG ATT GTA CAT p h e gln gln m e t t r p i l e m l y s g l n g l u t y r a s p g l u m g l y p r o ser i l e v a l h i s 360

310

AGA AAA TGT TTC TAA GTGTTTATTTTTATTTCTATTGCTAGTATCAGTCCCACTTTGACCCTATGCGGATGTCA a r g l y s c y s phe ---

375

ACCAGATCGATTCTGTGTAACTCTGCTGACACACAACTAAATATATACAT~ACACATTAA~AAA 3'

Fig. 1. The partial nucleotide and derived amino acid sequences of ScCA15. Boxes indicate amino acids that are diagnostic for mammalian cytoskeletal (nonmuscle)actins (see text and Table 1).The puta-

tive polyadenylation signal in the 3' noncoding region is underlined. Short dashed lines represent the portion of the cDNA that has not been sequenced.

6

BEACH AND JEFFERY TABLE 1. Comparison of Diagnostic Amino Acid Positions in the Coding Region of ScCA15 With Vertebrate Cvtoskeletal Actins*

Position" 5 6 10 16 17 76 103 279 287 297 358 365

Amiro acid' Val Ala Val Met CYS Val Val TYr Val Thr Ser Ser

Type' N CY CY CY CY CY CY M CY CY CY CY

*The identity of amino acids 113 through 275 is not available. (The nucleotide sequence has not been determined.) aAmino acid positions that differentiate vertebrate cytoskeleta1 from skeletal muscle actins [Cross et al., 1988; Schwartz et al., 1984; Stutz and Spohr, 1986; Vandekerckhove and Weber, 19841. 'Amino acid identity derived from the partial nucleotide sequence of cDNA clone ScCA15. 'The correspondence of ScCA15 amino acids to vertebrate cytoskeletal actins (Cy), muscle actins (MI, or neither (N).

Fig. 2. The structure of the Styela clava cytoskeletal actin cDNA subclone, ScCA15. The hatched region corresponds to the translated portion of the mRNA; the unhatched regions indicate the 5' and 3' nontranslated regions represented in the cDNA. To synthesize probe complementary to the 3' nontranslated end of the transcript, the Bluescript subclone was digested with the restriction enzyme Dde I and transcribed in vitro with T3 RNA polymerase in the presence of a radioactive nucleotide.

lated from two individuals detected only one or two restriction fragments in each animal (Fig. 3A). Individual 1 showed two restriction fragments in the Eco RI and Hind 111digests, whereas individual 2 appeared homozygous for the smaller of two restriction fragments generated by digestion with Eco RI (Fig. 3A-a) and Hind I11 (Fig. 3A-b). The number of fragments generated by Pst I digestion was unclear (Fig. 3A-c): the faint larger bands present in both DNA preparations may represent restriction fragments containing ScCA15 sequences that transferred inefficiently during the blotting procedure due to their large size (resulting in a weaker signal); or, they may represent incomplete digestion of the DNA by the restriction enzyme. In either case, only one or two restriction fragments were detected in the Pst I digests a s well. Hybridization of a similar blot of DNA isolated from two S. plicata individuals with the coding region of ScCA15 washed a t

Fig. 3. Southern blot hybridizations of Styela genomic DNA. Panel A DNA was isolated from the sperm of two S. clava individuals (indicated by 1and 2),digested with Eco RI (a), Hind I11 (b),and Pst I ( c ) , transferred to Zeta-Probe membrane, and hybridized with 32Plabelled ScCA15iDdeprobe. Panel B DNA isolated from the sperm of two S. plicata individuals (indicated by 1and 21, digested with Eco RI (a) and Hind I11 (b), and hybridized with coding region probe synthesized from the complete ScCA15 subclone.

lower stringency detects many restriction fragments containing actin sequences (Fig. 3B), suggesting that there may be as many as 10 to 15 actin genes in the Styela genome [Humphries et al., 19811. These results suggest that the gene corresponding to ScCA15 is a single-copy gene represented once per haploid genome.

Temporal Expression of ScCA15 mRNA During Embryogenesis Because the ScCA15 clone was isolated from a n oocyte cDNA library it was expected to represent a maternal actin mRNA. Thus, i t was of interest to determine if the maternally transcribed ScCA15 mRNA persisted in the mature egg and early embryo, and whether the ScCA15 gene was expressed during embryogenesis. Figure 4A shows a Northern blot of RNA isolated from S. clava eggs and embryos a t various stages of development hybridized with the ScCA15lDde probe. This blot shows that ScCA15lDde recognizes a 1.8-kb transcript that is present in eggs, early cleaving embryos, and later embryos engaged in tail morphogenesis. For comparison, the same blot was subse-

TEMPORAL AND SPATIAL EXPRESSION OF ScCA15

7

mulate between the neurula and mid-tailbud stage rather than during the early gastrula stage. The simplest interpretation of these results is that ScCA15 encodes a gene that is expressed during oogenesis with maternal transcripts being stored in the egg. The maternal transcripts are degraded before gastrulation, and new transcription from this gene is not detectable until the neurula and tailbud stages. Alternatively, the total hybridization of ScCA15lDde seen in the early cleavage stages may be due to zygotic transcripts synthesized in the early embryo a s well a s maternal transcripts synthesized during oogenesis. Both classes of mRNA would then be degraded prior to gastrulation.

Fig. 4. Northern blot hybridization of ScCA15iDde (A) and SpMA3C (B) probes to different developmental stages of S. claua embryos. Each lane (a-p) represents 5 pg of total RNA. a: Unfertilized egg. b Uncleaved zygote a t 20 min after insemination. c: Uncleaved zygote a t 40 min after insemination (yellow crescent stage). d: Twocell embryo. e: four-cell embryo. fi eight-cell embryo. g: sixteen-cell embryo. h thirty-two-cell embryo. i: sixty-four-cell embryo. j: Early gastrula (3 hr after insemination). k midgastrula (3.5hr after insemination). 1: Late gastrula (4.5 hr after insemination). m: Neurula. n: Mid-tailbud. 0: Late tailbud. p: Hatched tadpole. The filter in A was washed in 0.1 x SET at 55°C; the same filter was stripped of probe and rehybridized in B, with a final wash in 0.5 x SET a t 50°C.

quently stripped and rehybridized with SpMA3C (Fig. 4B), a probe that recognizes muscle actin mRNA restricted to the tail muscle cells of Styela embryos [Tomlinson et al., 1987bl. Relatively low levels of the 2-kb muscle actin mRNA were detectable in eggs and early cleaving embryos, probably representing the maternal transcripts described previously [Tomlinson et al., 1987al. Zygotic muscle actin expression commenced at the early gastrula stage, and transcripts accumulated to relatively high levels during gastrulation, neurulation, and tail formation (Fig. 4B). The expression of the ScCA15 mRNA was different from the muscle actin mRNA. ScCA15 mRNA was detected in eggs and early embryos up to the 64-cell stage, after which transcripts were apparently degraded and not detectable again until after gastrulation (Fig. 4A). In contrast to muscle actin mRNA, new ScCA15 transcripts began to accu-

Spatial Distribution of Maternal ScCA15 mRNA Styela eggs contain three different cytoplasmic regions, the ectoplasm, myoplasm, and endoplasm, which are distributed differentially to various cell types during embryogenesis [Conklin, 19051. Previous studies had shown that maternal actin mRNA is localized in the ectoplasm and myoplasm in S. plicata eggs [Jeffery et al., 19831. To determine if maternal ScCA15 is localized, sections of s. claua eggs and cleaving embryos were subjected to in situ hybridization with 3HScCAl5lDde. Figure 5A shows the hybridization pattern in a n unfertilized egg in which ScCA15 mRNA appears to be distributed uniformly throughout the oocyte cytoplasm. Unlike total actin mRNA [Jeffery et al., 19831, ScCA15 mRNA does not appear to accumulate in the oocyte germinal vesicle [GV; data not shown, but see Fig. 8B). The distribution of ScCA15 mRNA changed after fertilization, however. Figure 5B shows that by the yellow crescent stage ScCA15 mRNA was detected primarily in the ectoplasm. In situ hybridized sections were stained with Harris hematoxylin to facilitate identification of the different egg cytoplasms. In addition, adjacent sections not subjected to hybridization were stained with Milligan’s trichrome [Jeffery, 19891 to more clearly distinguish the myoplasm from the ectoplasm (see Materials and Methods; data not shown). At the yellow crescent stage, the ectoplasm forms a spherical region of cytoplasm just interior to the myoplasmic crescent. However, it is difficult to determine a t this stage whether transcripts are also present in the myoplasm because of the close association of this region with ectoplasm. Therefore, in situ hybridization was performed on sections of eggs stratified by centrifugation. Stratification results in the formation of sharp boundaries between the three cytoplasms of the egg [Jeffery and Meier, 19841. During centrifugation, the endoplasm is forced to the centrifugal pole of the egg, the myoplasm is displaced to the centripetal pole, and the ectoplasm forms a layer between the myoplasm and the endoplasm. Figure 5C shows hybridization of 35Slabelled ScCA15iDde probe to sections of stratified eggs. ScCA15 mRNA was seen primarily in the ecto-

8

BEACH AND JEFFERY

Fig. 5. In situ hybridization of the ScCA15iDde probe to sections of (A) a n unfertilized egg, (B) an uncleaved zygote a t the yellow crescent stage, (C) a stratified egg, and (D) a 16-cell embryo. ec: ectoplasm. m: myoplasm or yellow crescent. en: endoplasm. In C the upper zone (above the upper dashed line) represents the centripetal myoplasm,

the middle zone (between the upper and lower dashed lines) represents the ectoplasm, and the lower zone (below the lower dashed line) represents the centrifugal endoplasm; the arrow indicates the direction of centrifugal force. x 500.

plasmic layer; the signal in the myoplasmic and endoplasmic zones was not above background. The results suggest that maternal ScCA15 mRNA is uniformly distributed in unfertilized eggs but becomes enriched in the ectoplasm after fertilization when significant translocations of cytoplasm are known to occur [see Jeffery and Bates, 19891. Localization of ScCA15 mRNA to the ectoplasm is maintained during the early cleavage stages when the ectoplasm is partitioned to two cells of the two-cell embryo, four cells of the four-cell embryo, the four animal

hemisphere cells of the eight-cell embryo, and eventually into the ectodermal lineages [Conklin, 19051. At these stages, blastomeres can be identified by their staining characteristics with Harris hematoxylin and with Milligan’s trichrome (data not shown), as well a s by their position in the embryo. For example, Figure 5D shows ScCA15 mRNA localized in animal hemisphere cells of a 16-cell embryo. Therefore, the enrichment of maternal ScCA15 mRNA in the ectoplasm results in its preferential distribution to ectodermal cells of the embryo.

TEMPORAL AND SPATIAL EXPRESSION OF ScCA15

9

Fig. 6. In situ hybridization of the ScCA15iDde probe to sections of mid-tailbud-stage embryos. A A cross-section showing grains in the epidermal cells (ep, arrowheads) surrounding the head (above) and tail (below). The endodermal cells (en) and notochord (n) are unlabelled; the muscle cells (m) show fewer grains than epidermal cells.

B An oblique section. The arrowheads show grains in epidermal cells. C: A mid-sagittal section. Grains are present in the epidermis (ep) and neural tube (nt, arrow). The endodermal (en) and notochord (n) are unlabelled; the muscle cells show fewer grains than epidermal cells. x 500.

Spatial Distribution of Zygotic ScCA15 mRNA Since ScCA15 transcription is also activated in the embryo it was of interest to determine the spatial distribution of the zygotic transcripts. In these studies, sections of tailbud-stage embryos were hybridized in situ with 3H-ScCA15/Dde. Consistent with the Northern analysis (Fig. 4),ScCA15 mRNA first accumulated to detectable levels between the neurula and midtailbud stages. Figure 6 shows the results obtained for mid-tailbud embryos, the latest stage of development in which each larval tissue can be conveniently visualized in a single section. Figure 6A shows a crosssection of a mid-tailbud embryo, whereas Figure 6C

shows a mid-sagittal section at the same stage of development. It is evident from these sections that ScCA15 is present primarily in the thin layer of epidermal cells that covers the head and tail of the embryo and in the neural tube (Fig. 6C). The enrichment of ScCA15 transcripts in these ectodermal derivatives is most clearly distinguished in oblique sections which cut through a portion of the surface of the embryo (Fig. 6B). In contrast, ScCA15 transcripts were undetectable in the large endodermal and notochord cells, although there may be low levels present in the tail muscle cells (Fig. 6A). Similar results were obtained for late tailbud-stage embryos (data not shown); ScCA15 mRNA

10

BEACH AND JEFFERY

Fig. 7. In situ hybridization of the ScCA15iDde probe to sections of adult stomach. A,B: Sections showing grains located in the inner (gastric) epithelial layer (ie). The matrix (m) and outer epithelium (oe) are labelled a t background levels. A, x 130. B, X 500.

was expressed most strongly in the epidermal and neural cells. It is concluded that zygotic ScCA15 mRNA accumulates primarily in ectodermal cells during tail formation.

Fig. 8. In situ hybridization of the ScCA15iDde probe to adult sections containing ovaries (o), mantle (m), and branchial sac (b); the tunic has been removed. A: The dark areas represent intensely labelled germinal epithelium (arrows) containing small oocytes. The mantle is composed of a n outer epidermis ( e , arrowheads) and muscle fibers (m). x 130. B: A higher-magnification photograph showing the labelled germinal epithelium (arrowheads) and an oocyte (arrow).The germinal vesicle is the unlabelled area in the oocyte. x 1,250.

linson et al., 1987b] (Swalla and Jeffery, in preparation). ScCA15 accumulated in restricted tissues within the To determine whether ScCA15 is transcribed in adults and the location of transcript accumulation, sec- gonads and the alimentary tract. Figure 7 shows sections of young adults (0.6 cm-0.8 cm in length) were tions through the stomach. It can be seen that labelling hybridized in situ with 3H-ScCA15/Dde. The results is confined to endodermally derived cells of the gastric showed that ScCA15 is expressed strongly in the ali- epithelium, which lines the lumen of the esophagus, mentary tract (esophagus, stomach, and intestine; Fig. stomach, and intestine. There was no signal detected in 7), the ovaries (Fig. S), the testes (Fig. 91, and the en- the matrix, which contains mesenchymal cells, or in dostyle (data not shown). Control hybridizations using the thin outer epithelium of the alimentary tract (Fig. the coding region of ScCA15 a s a probe show signal in 7A). Figure 8A shows a section through the adult body all tissues of the adult (data not shown), especially in showing parts of the ovary, branchial sac, and mantle. the mantle where muscle and mesenchymal cells are In this section, signal above background is restricted to known to accumulate high levels of actin mRNA [Tom- the germinal epithelium and developing oocytes within

Spatial Distribution of ScCA15 mRNA in Adults

TEMPORAL AND SPATIAL EXPRESSION OF ScCA15

11

DISCUSSION

Fig. 9. In situ hybridization of the ScCA15iDde probe to a section through the testes showing label over developing sperm. The photograph in A was focused to show the silver grains; the photograph in B was focused on the specimen to show developing sperm (arrows). x 1,250.

the ovary (Fig. 8B). There was no detectable signal in other areas of the ovary, the branchial sac, or in the epidermal or muscular layers of the mantle (Fig. 8A). Figure 9 shows a section through the testes. In this section, signal above background was observed only in the developing sperm. It is concluded that the ScCA15 gene shows spatially restricted expression in the adult. Hybridization in the ovary (Fig. 8B) also reveals the spatial distribution of ScCA15 mRNA in immature oocytes. Signal is apparent throughout the oocyte cytoplasm, but appears to be low or absent in the GV. This distribution suggests that ScCA15 mRNA is transcribed early during oogenesis and stored in the oocyte cytoplasm. The reduced concentration of grains in the cytoplasm of unfertilized eggs relative to immature oocytes (compare Figs. 5A and 8B) suggests that ScCA15 mRNA is gradually diluted during oocyte growth.

We have isolated and characterized the expression of the S. clava cDNA clone ScCA15. Our sequence data suggest that ScCA15 corresponds to a single-copy gene encoding a cytoskeletal actin. Northern analysis indicates that maternal ScCA15 mRNA is present in the unfertilized egg and persists through the 64-cell stage, after which time it is degraded. In situ hybridization to eggs and early cleavage stages shows t h a t maternal ScCA15 mRNA is enriched in the ectoplasm, a n egg cytoplasmic region that is inherited by the ectoderm cells. Northern analysis and in situ hybridization indicate that maternal ScCA15 mRNA is replaced by zygotic ScCA15 transcripts, which are first detected between the neurula and mid-tailbud stages. Accumulation of zygotic ScCA15 mRNA occurs primarily in the epidermis and neural tube of tailbud embryos, indicating that the ScCA15 gene exhibits tissue specific expression during embryogenesis. Finally, in situ hybridization shows that expression of the ScCA15 gene is confined to specific tissues and organs in adults. The derived amino acid sequence of ScCA15 shows t h a t i t is related to both vertebrate @ actin and various invertebrate actins [Akhurst et al., 1987; Crain et al., 1987; Cross et al., 1988; Files et al., 1983; Kost et al., 1983; Nude1 et al., 1983; Sanchez et al., 1983; Schwartz et al., 1984; Stutz and Spohr, 1986; Vandekerckhove and Weber, 19841. Although diagnostic amino acid residues indicate the similarity of ScCA15 and vertebrate p cytoskeletal actins, i t should be noted that vertebrate cytoskeletal actins share identity with invertebrate actin sequences a t many of these positions, whereas vertebrate muscle actins differ at these positions. In addition, the existence of Asp-Asp-Glu-Val at the Nterminus of the derived protein sequence indicates a relationship of ScCA15 with invertebrate actins. Neither vertebrate cytoskeletal @ nor y actins examined thus far show this sequence of N-terminal amino acids. In contrast to ScCA15, i t should be emphasized that the derived amino acid sequence of ascidian muscle actins [Tomlinson et al., 1987bl (White and Jeffery, in preparation; and unpublished results) resemble vertebrate muscle actins rather than invertebrate muscle or cytoskeletal actins a t these and other diagnostic amino acid positions. Ascidians are considered to be the extant chordates t h a t most closely resemble the ancestral vertebrate [Berrill, 19551. Therefore, comparison of ascidian actin sequences to other invertebrate and vertebrate actin sequences is of interest with respect to determining the ancestry of vertebrate actins. The different vertebrate muscle and nonmuscle actin isoforms are very highly conserved, suggesting that there are functional constraints on their protein sequences. Based on the degree of similarity at the various diagnostic amino acid positions in the sequenced portion of ScCA15, we have determined that this gene encodes a protein similar to

12

BEACH AND JEFFERY

a vertebrate p-actin. However, because vertebrate nonmuscle actin protein sequences are more like invertebrate actins than vertebrate muscle actins, and because the entire nucleotide sequence of ScCA15 is not available, i t is difficult to determine whether this gene is more closely related to a vertebrate nonmuscle actin gene or a n invertebrate actin gene. Clearly, more sequence data, as well as data on gene structure and intron positions, will be necessary before we can determine the relationship between ascidian actin genes and those of other invertebrates and vertebrates. Two-dimensional gel electrophoresis of in vivo-labelled proteins detects at least two, and possibly a s many a s three, distinct nonmuscle actin isoforms present in S. clava eggs and embryos [Tomlinson et al., 1987al. Presumably, maternal actin transcripts specific for each of these actin isoforms are present in the egg and early embryo. Indeed, previous in situ hybridization experiments using a Drosophila actin probe revealed maternal actin mRNA localization in the myoplasm a s well as the ectoplasm of the fertilized egg [Jeffery et al., 19831. Because maternal ScCA15 mRNA is localized exclusively to the ectoplasm, a t least one other maternal actin mRNA must also be present and localized in the myoplasm of the fertilized Styela egg. Muscle actin mRNA has been shown to be present a t low levels in Styela eggs [Tomlinson et al., 1987a1, and thus it is a possible candidate for the actin mRNA localized in the myoplasm. However, additional actin sequences isolated from the egg cDNA library show that at least one other actin transcript distinct from both ScCA15 and muscle actin mRNA is present in the egg (Beach and Jeffery, unpublished). Given the number of actin protein isoforms present in the egg, as well as the existence of 10-15 actin genes in the Styela genome, i t seems likely that two or more additional cytoskeletal actin mRNAs are present in the egg. Presumably, a t least one of these cytoskeletal actin mRNAs, or muscle actin mRNA, is localized in the myoplasm. The spatial pattern of maternal ScCA15 mRNA shown in the present investigation was unexpected based on what was previously known about maternal actin mRNA localization in Styela eggs. As described above, in situ hybridization with a Drosophila actin probe showed that actin mRNA was located primarily in the myoplasm and GV of immature oocytes [Jeffery et al., 19831. During maturation, the actin transcripts localized in the GV are released into the ectoplasm, the cytoplasmic region that is derived from the nucleoplasm of the GV [Conklin, 19051. During the extensive cytopl.ssmic rearrangments that occur after fertilization, the relative distribution of total actin mRNA remains the same in the ectoplasm, myoplasm, and endoplasm, suggesting that actin transcripts are fixed in position during ooplasmic segregation. In contrast, the present results indicate that ScCA15 actin mRNA, which is uniformly distributed in the cytoplasm of the unfertilized egg, becomes enriched in the ectoplasm

during ooplasmic segregation. The reason for the lack of ScCA15 localization in the ectoplasm of unfertilized eggs is obvious: Since this transcript is absent or present a t relatively low levels in the GV i t is not released into the ectoplasm a t maturation. In contrast, the mechanism of maternal ScCA15 mRNA localization in the ectoplasm during ooplasmic segregation is currently unresolved. One possibility is t h a t ScCA15 mRNA is degraded in cytoplasmic regions other than the ectoplasm. Regionalized degradation of maternal mRNA encoding the caudal gene product has recently been described in Drosophila embryos [Mlodzik et al., 1985; Macdonald and Struhl, 19861. In the case of S . clava embryos, regional ScCA15 mRNA degradation would be supported by our Northern data, which show that the amount of ScCA15 mRNA decreases during the first phase of ooplasmic segregation. However, another possible mechanism for ScCA15 mRNA localization is the translocation of transcripts into the ectoplasm from other parts of the egg during ooplasmic segregation. In either case, i t is likely that the localization of ScCA15 transcripts in the ectoplasm of early cleavage stages is maintained through their association with cytoskeletal elements specific for the ectoplasm. Although the ScCA15 gene shows differential expression in embryos and adults, it may not accumulate in a cell-lineage- or even a germ-layer-specific pattern. Embryonic expression occurs primarily in the epidermis and neural tube, both ectodermal derivatives, but some accumulation may also occur in tail muscle cells, a mesodermal derivative. Furthermore, ScCA15 is expressed in several different ectodermal and endoderma1 derivatives in adults. Therefore, the pattern of expression suggests that ScCA15 function is not related to cell type or embryonic ancestry. Rather, we feel that the ScCA15 actin is likely to function in all rapidly dividing cells. This possibility is supported by the following lines of evidence. First, ScCA15 mRNA localization in the ectoplasm of eggs and early embryos ensures that these transcripts will be distributed to precursors of the epidermal and neural cells during cleavage. The epidermal and neural precursors are characterized by rapid cell division, which continues after this process has ceased in most other parts of the embryo [Conklin, 1905; Nishida, 1986,1987; Nicol and Meinertzhagen, 19881. Second, zygotic expression of the ScCA15 gene also occurs primarily in the rapidly dividing epidermal and neural cells of the tailbud embryo. Third, ScCA15 expression is confined to the germinal epithelium, germ cells, gastric epithelium, and endostyle of adults. These are tissues known to be undergoing rapid cell division and continuous renewal in S. clava adults [Ermak, 1975, 19761. For example, a s part of the digestive process, cells proliferate in the folds of the gastric epithelium, migrate laterally, and are extruded into the gut lumen every 60 days [Ermak, 1975,1978).Thus the ScCA15 actin gene may function

TEMPORAL AND SPATIAL EXPRESSION OF ScCA15 similarly to the CyI and CyIIb actin genes of sea urchin embryos, which are expressed exclusively in rapidly dividing cell lineages [Cox et al., 19861. The present results illustrate the different strategies used to accumulate a specific mRNA in a particular cell type or tissue during embryonic development. The specific accumulation of ScCA15 mRNA in the epidermal and neural cells of S. claua embryos appears to be achieved by two processes: localization and differential segregation of maternal mRNA during cleavage, and the activation of gene transcription in particular cells during subsequent embryogenesis.

ACKNOWLEDGMENTS We thank Dr. Akif Uzman for help in preparing the cDNA library and Dr. Billie Swalla for assistance with histology. This research was supported by grants from the NIH (HD-13970) and NSF (DCB-84116763).

REFERENCES Akhurst RJ, Calzone FJ, Lee JJ, Britten RJ, Davidson EH (1987): Structure and organization of the CyIII actin gene subfamily of the sea urchin, Strongylocentrotus purpuratus. J Mol Biol 194:193203. Atkin NB, Ohno S (1967): DNA values of four primitive chordates. Chromosoma 23: 10-13. Aviv H, Leder P (1972): Purification of biologically active globin messenger RNA by chromatography on oligothymidilic acid-cellulose. Proc Natl Acad Sci USA 69:1408-1412. Berrill NJ (1955): “The Origin of Vertebrates.” Oxford: Clarendon. Conklin EG (1905): The organization and cell lineage of the ascidian egg. J Acad Nat Sci Phila 13:l-119. Courchesne-Smith CL, Tobin SL (1989): Tissue-specific expression of the 79B actin gene during Drosophila development. Dev Biol 133: 313-321. Cox KH, Angerer LM, Lee J J , Davidson EH, Angerer RC (1986): Cell lineage-specific programs of expression of multiple actin genes during sea urchin embryogenesis. J Mol Biol 188:159-172. Crain WR, J r , Boshar MF, Cooper AD, Durica DS, Nagy A, Steffen D (1987): The sequence of a sea urchin muscle actin gene suggests a gene conversion with a cytoskeletal actin gene. J Mol Evol 25:3745. Cross GS, Wilson C, Erba HP, Woodland HR (1988): Cytoskeletal actin gene families of Xenopus borealis and Xenopus laeuis. J Mol Evol 27:17-28. Davis LG, Dibner MD, Battey JF (1986): “Basic Methods in Molecular Biology.” New York: Elsevier. Denhardt DT (1966):A membrane filter technique for the detection of complementary DNA. Biochem Biophys Res Commun 23:641-646. Ermak TH (1975): Cell proliferation in the digestive tract of Styela claua (Urochordata: Ascidiacea) as revealed by autoradiography with tritiated thymidine. J Exp Zoo1 194:449-466. Ermak TH (1976): Renewal of the gonads in Styela claua (Urochordata: Ascidiacea) as revealed by autoradiography with tritiated thymidine. Tissue Cell 8:471-478. Ermak TH (1978): Cell migration kinetics in the stomach of Styela cluua (Urochordata: Ascidiacea). J Exp Zoo1 197:339-346. Files JG, Carr S, Hirsch D (1983): Actin gene family of Caenorhabdztis elegans. J Mol Biol 164:355-375. Firtel R (1981): Multigene families encoding actin and tubulin. Cell 243-7. Fyrberg EA, Mahaffey JW, Bond BJ, Davidson N (1983): Transcripts of the six Drosophzla actin genes accumulate in a stage- and tissuespecific manner. Cell 33:115-123. Garcia R, Paz-Aliaga B, Ernst SG, Crain WR, J r (1984):Three sea

13

urchin actin genes show different patterns of expression: Muscle specific, embryo specific, and constitutive. Mol Cell Biol 4340845. Garrels JI, Gibson W (1976): Identification and characterization of multiple forms of actin. Cell 9:793-805. Humphries SE, Whittall R, Minty A, Buckingham M, Williamson R (1981): There are approximately 20 actin genes in the human genome. Nucleic Acids Res 9:4895-4909. Huynh TV, Young RA, Davis RW (1984): Constructing and screening cDNA libraries in hgtl0 and hgtll. In Glover D (ed): “DNA Cloning: A Practical Approach.” Oxford: IRL Press, pp 49-78. Jeffery WR (1985): Specification of cell fate by cytoplasmic determinants in ascidian embryos. Cell 41:ll-12. Jeffery WR (1989): Requirement of cell division for muscle actin expression in the primary muscle cell lineage of ascidian embryos. Development 105:75-84. Jeffery WR, Bates WR (1989): Ooplasmic segregation in the ascidian Styela. In Schatten H, Schatten G (eds): “Molecular Biology of Fertilization.” New York: Academic, pp 341-367. Jeffery WR, Meier S (1984):Ooplasmic segregation of the myoplasmic actin network in stratified ascidian eggs. W Roux Arch Dev Biol 193:257-262. Jeffery WR, Tomlinson CR, Brodeur RD (1983): Localization of actin messenger RNA during early ascidian development. Dev Biol 99: 408-417. Kost TA, Theodorakis N, Hughes SH (1983):The nucleotide sequence of the chick cytoplasmic 8-actin gene. Nucleic Acids Res 11:82878301. Lambert CC, Laird C (1971): Molecular properties of tunicate DNA. Biochim Biophys Acta 240:39-45. Macdonald PM, Struhl G (1986):A molecular gradient in early Drosophila embryos and its role in specifying the body pattern. Nature 324537-545. Makabe KW, Satoh N (1989): Temporal expression of myosin heavy chain gene during ascidian embryogenesis. Dev Growth Differ 31: 71-77. Maniatis T, Fritsch EF, Sambrook J (1982): “Molecular Cloning: A Laboratory Manual.” Cold Spring Harbor: Cold Spring Harbor Laboratory. March CJ, Mosley B, Larsen A, Cerretti DP, Braedt G, Price V, Gillis S, Henney CS, Kronheim SR, Grabstein K, Colon PJ, Hopp TP, Cosman D (1985): Cloning, sequence and expression of two distinct human interleukin-1 complementary DNAs. Nature (London) 315: 641-6347, Melton DA, Krieg PA, Rebagliati MR, Maniatis T, Zinn K, Green MR (1984): Efficient in uitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter. Nucleic Acids Res 12:7035-7056. Mirsky AE, Ris H (1951): The desoxyribonucleic acid content of animal cells and its evolutionary significance. J Gen Physiol 34:451462. Mlodzik M, Fjose A, Gehring WJ (1985): Isolation of caudal, a Drosophila homeobox containing gene with maternal expression, whose transcripts form a concentration gradient at the pre-blastoderm stage. EMBO J 4:2961-2969. Mohun TJ, Brennan S, Dathan N, Fairman S, Gurdon J B (1984): Cell type-specific activation of actin genes in the early amphibian embryo. Nature (London) 311:716-721. Nicol D, Meinertzhagen IA (1988): Development of the central nervous system of the larva of the ascidian, Ciona intestznalzs L. 11. Neural plate morphogenesis and cell lineages during neurulation. Dev Biol 130:737-766. Nishida H (1986): Cell division pattern during gastrulation of the ascidian, Halocynthia roretzi. Dev Growth Differ 28:191-201. Nishida H (1987):Cell lineage analysis in ascidian embryos by intracellular injection of a tracer enzyme. 111. Up to the tissue restricted stage. Dev Biol 121:526-541. Nude1 U, Zakut R, Shani M, Neuman S, Levy 2, Yaffe D (1983):The nucleotide sequence of the rat cytoplasmic @-actingene. Nucleic Acids Res 11:1759-1771.

14

BEACH AND JEFFERY

Reed KC, Mann DA (1985): Rapid transfer of DNA from agarose gels to nylon membranes. Nucleic Acids Res 13:7207-7221. Rubenstein PA, Spudich JA (1977):Actin microheterogeneity in chick embryo fibroblasts. Proc Natl Acad Sci USA 74:120-123. Sanchez F, Tobin SL, Rdest U, Zulauf E, McCarthy BJ (1983):Two Drosophila actin genes in detail: Gene structure, protein structure and transcription during development. J Mol Biol 163:533-551. Sanger F, Nicklen S, Coulson AR (1977): DNA sequencing with chainterminating inhibitors. Proc Natl Acad Sci USA 74:5463-5467. Schwartz RJ, Rothblum KN (1981): Gene switching in myogenesis: Differential expression of the chicken actin multigene family. Biochemistry 20:4122-4129. Schwartz RJ, Chang KS, Zimmer WE, J r , Bergsma DJ (1984): Characterization of the chicken actin multigene family. In Borisy GG, Cleveland DW, Murphy DB (eds): “Molecular Biology of the Cytoskeleton.” Cold Spring Harbor: Cold Spring Harbor Laboratory, pp 465-477. Stutz F, Spohr G (1986): Isolation and characterization of sarcomeric actin genes expressed in Xenopus laevis embryos. J Mol Biol 187: 349-361. Tomlinson CR, Bates WR, Jeffery WR (1987a): Development of a mus-

cle actin specified by maternal and zygotic mRNA in ascidian embryos. Dev Biol 123:470-482. Tomlinson CR, Beach RL, Jeffery WR (1987b):Differential expression of a muscle actin gene in muscle cell lineages of ascidian embryos. Development 101:751-765. Vandekerckhove J , Weber K (1984): Chordate muscle actins differ distinctly from invertebrate muscle actins. J Mol Biol 179:391-413. Vandekerckhove J, de Couet H-G, Weber K (1983): Molecular evolution of muscle-specific actins: A protein-chemical analysis. In dos Remedios CG, Barden J A (eds): “Actin: Structure and Function in Muscle and Non-Muscle Cells.” Sydney, Australia: Academic, pp 241-248. West AB, Lambert CC (1975): Control of spawning in the tunicate Styela plicata by variations in a natural light regime. J Exp Zoo1 195:265-270. Whalen RG, Butler-Browne GS, Gros F (1976):Protein synthesis and actin heterogeneity in calf muscle cells in culture. Proc Natl Acad Sci USA 73:2018-2022. Zulauf E, Sanchez F, Tobin SL, Rdest U, McCarthy BJ (1981):Developmental expression of a Drosophila actin gene encoding actin I. Nature (London) 292:556-558.