Res. MicrobioL 1991, 142, 893.900
~) iNSTITUTPASTEUR/ELSEVIER Paris 1991
Termination of chromosome replication in Bacillus subtilis P.J. Lewis and R . G . Wake
The Department o f Biochemlstty, The Universily of Sydney, Sydney, N S W 2006 (Australia)
Introduction
Chronmsome replication in bacterial cells can be divided into 3 dist'.net stages: initiation, elongation and termination. Until recently, very little was known about the final stage, termination, or completion of the cycle. Much of what is now known about termination has arisen out o f the initial work of 3 laboratories: Kuempel's group in the United States and Louarn's group in France worked with '------------------Eseheriehia eoli, and our own group concentrated on Bacillus subtilis. Overall, the findings with each organism have complemented one another. Termination involves fusion of approaching replication forks in a region approximately opposite the origin, oriC. This is followed by deeateantion of the daughter chromosomes (Steck and Drliea, 1984) mad segregation prior to cell division. It is only since 1980 that significant advances in understanding termination have been made, but now a quite detailed understanding of the process, at least of the first stage, is starting to emerge. The occurrence of sporulation and spore germination in B. subtilis has provided unique opportunities for addressing the problem in this organism. Thus, since the early classic studies by Yoshikawa and Sueoka (1963a,b), who used B. subtilis to first establish the existence of a unique origin of reptication on the bacterial chromosome, this organism has continued to provide essential information on the replication process. This brief review concentrates largely on termination in B. subtilis. The initial problem in studying term(nation was the identification of the si~eor region of fork fusion. Did replication forks simply fuse when they met at a non-defined site on the chromosome, or was there a specific site? The process of sporulation in B. sutJtills could be exploited to specifically label the terminus region, as was done independently in 2 laboratories (Adams and Wake, 1980; Sargent, 1980).
Extension of this approach showed that replication fork fusion did occur at a specific site on the chromosome, terC lWeiss et hi.. 1981), and that it involved an initial stage o f clockwise fork arrest at this site (Weiss and Wake, 1983 ; lismaa et al., 1984). The terC region has now been extensively charactcrised and the elements necessary for fork arrest have been identified. A model for clockwise fork arrest has been propos~:d and partially te~ted. Two key players in this model are ao (imperfect) inverted repeat region (If.R) of DNA within which fork arrest occurs, and an adjoining gene r:; (for replication terminator protein) whose product (RTP) binds to the IRR (Lewis el hi., 1989). Termination in E. colt is somewhat analogous to that in B, sublilis except that replication forks meet within a 350-kb region of the chromosome (rather than a < 200-bp region in B. subtifis; Kuempel et aL, 1989). The equivalent protein to RTP in E. colt has been called Tus (terminator utilization substance; Hill et aL, t989). A brief account of the earlier work prior to the identification of the rlp gene and the IRR wilt be given before describing in mole detail how they are involved in termination of chromosome replication in B. subtilis.
ldcnlificatlnn of the terminus region and an assay [or tile first singe o f termination
That there was a fixed point of replication fork arrest was established by labelling DNA for progressively shorter times prior to termination in the last cycle of replication leading to sporulation. A single restriction fragment was identified in the spore DNA with the shortest Iabelling time (Weiss et hi., 1981). On construction of a restriction map for a more extensively labelled region, it became clear that for the last few minutes (< 5) only the anticlockwise replication fork was moving (Weiss and, Wake, 1983; fisman et aL, 1984). Presumably the clockwise fork had
P.J. L E W I S A N D R.G. WAKE
894
1984), This has provided a convenient assay for the functionin 8 of zerC, at least as a replication fork arrest site. It is important to remember that clockwise fork arrest is only the first stage o f the termination process, and it remains to be established definitively that there is complete arrest o f the clockwise fork at terC. M a r k e r frequency analysis experiments have given results that are at least consistent with there being a complete block to replication fork movement at terC (Hanley et aL, 1987).
already reached terC and slopped; terC was found to be Iocaled within a 24,8-kb BamHI fragment. Whilst the clockwise replication fork was arrested at terC, il was expected that a forked structure within the 24.8-kb BamH] segment would persist until fusion occurred on arrival o f the anticlockwise fork. G e r m i n a l m g spores were used to provide synchrony in a cycle of replication, and arrested forks were identified around the time o f termination as a slowly migrating species on agarose gel electrophorests and hybridization to a specific probe (Weiss and Wake, 1984). The forked structure was conf~rmed by electron microscopy (Weiss et al., 1986).
Sequence features of lhe lerC r e g i o n
The merodlploid strain GSY 1127 (Schneider et al.. 1982) was very useful in subsequent work. Due to non-tandem duplication o f part o f the anlie|ockwise arm o f the chromosome in this strain, terC was effectively offset to a grossly asymmetric location. A clockwise fork remains arrested at terC for much longer in ~his strain than in the wild type, so enhanced levels o f the arrested fork can be obtained from exponentially growing cultures (Weiss and Wake,
600 L
800 I
Sequencing 1.3 kb o f the region spanning terC (the site of arrest) showed it to comprise an (imperfeel) inverted repeat region (IRR) containing the two halves IR-I (47 nt) and IR-II (48 nt) separated by 59 nt, and an open reading frame (ORF) capable of encoding a small basic protein (see fig. 1). Measurement o f the single-strand products o f smaller deriva-
1000 I
1200 I
IRR I IR ]
II -35-10
IR II
~%~,~C~
I ----
-Ttts
SD
9 Clockwise replication fork approach
Fig. l . Sequence features from B. suOtilis terC region (Carrigan et aL, 1987). Ihe line numbered 600-1200 represents the sequence numbers (in bp); - to and 35 define a putative promoter; SD represents a putative Shine-Dalgamo rlbosome-blnding site; the inverted repeat region, l RR, contains IR-I and IR-I l ; a possible coding region for a small basic protein (now known as RTP) is represented by the shaded box, and a putative transcription terminator sequence {Its) is underlined. All ~equenee features are drawn to scale. The large arrow at the bottonl of the figure ~hows the direction of clockwise replication fork approach.
IR IRR IPTG nt
= = = =
inverled repea~, IR region. isopropyl thiosalactosidc. nucleotideJ
i ' [
t
OaF RqP Tus
= o1~en reading frame. = replication terminalor protein. = terminator utilization substance.
T E R M I N A T I O N OF 8. SUBTILIS CHROMOSOME REPLICA TION tives of the arrested forked molecule showed that fork arrest occurred just upstream of the ORF within the IRR (Carrigan et al., 1997). Deletion experl. ments confirmed the importance of these featlires (Smith and Wake, 1988). When DNA up to 80 bp to the left of IR-L was deleted, there was no effect on fork arrest. On removal of a further 130 bp. which encompassed IR-I, fork arrest was no longer observed. Furthermore, removal of the bulk o f the ORF, or disruption of the reading frame by the insertion o f 4 bp, alga abolished fork arrest. These results suggested a role in fork arrest for both the IRR and the product of the ORF. The small basic protein product of the ORF has been named the replication terminator protein (RTP) and the gene rip. Because of its basic nature it was thought that RTP could be a DNA-binding protein, and the IRR was considered to be a potentla[ binding site for it. In addition, there also apl~eared to be a potential promoter for rip just upstream of IR-1, raising the possibility that RTP might regulate its own transcription. This will be discussed in more detail below.
Replication fork arrest is dependent on rlp espre~ion Attempts to detect rip mRNA from exponentially growing cells failed, indicating that if rrp was expressed in viva it was at very low levels (Williams and Wake, unpublished). Also, terC- strains were isolated and appeared morphologically identical to terC ÷ strains (lismaa and Wake, 1987). Growth and sporulation also appeared normal in the deletion strains, However, on sequencing the terminus of a divergent strain of Bacillus (B. subtilis W23 ; all previous work had been performed with B, subtilis 168 derivatives) there was good conservation of the IRR and exact conservation of RTP sequence at the amino acid level, despite 22 nueleotide changes at the DNA level (Lewis and Wake, 1989). When assays were carried our to see if forked termination intermediates could be detected in exponentially growing cultures of B. subtilis W2~, results showed that terC functions in an identical way in both strains, correlating conservation of sequence features with an in viva function. Clearly there has been concerted retention of protein sequence and terC function over a period of evolutionary divergence, which would indicate that gTP does perform some useful function Jn viva, To directly establish the need for rip expression for replication fork arrest to occur, a strain was constructed in which rip expression was placed under the control of the IPTG-inducibIe spar-1 promoter (Smith and Wake, 1989/. Replication fork arrest, as monitored by the level of a new forked DNA molecule of predicted dinaensl.ons, was shown to be dependent on [PTG-induced expression of rip in this
g95
strain. Also, the very low levels of IPTG required to induce fork arrest suggested that relatively lit,tie RTP was needed.
RTP and the IRR For in vitro studies on the activity of RTP it was desirable to have a pure preparation of the protein. To this end, the rip gene was cloned into an expression vector and produced at a relatively high level in E. coll. Exploitation of the basic nature of this 14.5-kDa protein enabled it to be obtained at > 90 % purity in a single cation exchange FPLC step from a nucleic-acid-free cell extract (Lewis ef aL, 1989). Baud retardation studies indicated that RTP was a DNA-binding protein and that it bound specifically to sites within the IRR. When assays were performed with the whole IRR over a range of RTP concentrations, a series o f 4 retarded species could be identified suggesting that there were 4 RTPbinding sites within the IRR (Lewis el aL, 1989). The use of progressively smaller fragments of DNA established that RTP bound to 2 sites in IR-i and to 2 in IR-II (Lewis el at., 1990}. DNase-l-footprinting studies, using the IRR and a "core" sequence coiltaining a single gTP-biading site, confirmed that RTP bound to sequences within IR-[ and IR-ll and identified the sequence regions. F0otprinting studies also established that RTP bound to IR-I with a greater affinity than it did to IR-I1, as protection of sequences in IR-I was observed at concentrations of RTF' that do not cause pioteetion of sequences in IR-II, Experiments performed with 3H-labelled RTP and 3-p-labelLed IRR, along with data obtained from analyses of RTP in the ultracentrifuge, showed that RTP binds to DNA as a dimer and that 4 dlmers of RTP bind to the IRR. This confirmed the presence of 4 RTP-binding sites per IRR (Lewis et td., 1990). Measurement of the apparent average dissociation constant for the interaction between RTP and the 1RR has shown that the interaction is at least as strong as the interaction between the trp repressor of E. coli and its operator. Also, there appears to be positive cooperativity of binding to the two adjacent sites within an I g to form a fully saturated RTP/]R complex (2 RTP dimcrs hound), but there does not appear to be any cooperative effect between the [R. Therefore, [R-I and iR-II are considered to be independent of each other as RTP bindlng to one does not appear to affect binding to the other. How does RTP cause fork arrest? RTP is a DNA-binding protein, hut how does its binding to the 1RR cause replication fork arrest?
896
P.J. LEWIS A N D R.G. W A t f E
There are many DNA-binding proteins in a cell, but replication fork arrest is not observed at those protein-binding sites. This raises the possibility that the interaction of RTP with DNA per se is not responsible for blocking the movement of the DNA replication machinery. Replication fork movement is dependent on the activity of a heliease situated at its apex (Baker et aL, 1987). A helicase moves unidirectionally along a strand of DNA unwinding the duptex (for a review see Matson and Kaiser-Rogers, 1990). In a replication fork, helicase activity serves a 2-fold function, to allow progression of the replication fork around the chromosome, and to generate single-stranded templates for DNA polymerase 111 holoenzyme (pol-lll). In E. colt, the major heliease involved in replication fork movement is DnaB (LeBowitz and McMacken, 1986). Recently, the E, colt terminator protein Tus has been shown to inhibit DnaB activity, providing a possible explanation for how terminator proteins might effect replication fork arrest (Khatrl et at.; Lee et aL, 1989). Furthermore, Tus appears to be polar in its inhibition of DnaB hellcase activity. A Tus/DNA complex that inhibited DnaB activity when it was facing in one orientation did not cause inhibition of activity when its orientation, with respect to DnaB approach, was reversed. In essence, a clockwise-moving replication fork capable of passing through a Tus/DNA complex on the clockwise arm of the chromosome, would not move through a similar, but oppositely oriented, complex on the antietockwise arm (and vice versa for the antieloekwise-moving fork). This ensures that termination in E. coli will always occur within a defined region of the chromosome (Le, between oppositely oriented terminator,= situated on the clockwise and anticlockwise arms). This is known as the termination trap model (see Kuempel el el., 1989), To date no helicases have been identified in B. sublilis, but since they appear to he ubiquitous, it is certain that they do exist. Also, due to the similarity of a nnmber of components of the ,'epli-
cation apparatus of B. subtilis and E. coil (see Wang et at., 1985; Ogasawara et at., 1990), it is probable that replication fork movement in B. subtilia will be dependent on the activity of an equivalent of DnaB heliease in E. coil This seems particularly likely when two of the proteins with which the DnaB helicase is known to be closely associated, DnaA and DnaG. share 50 % and 3 1 % identity, respectively, between E. colt and B. sub:ills. Work is in progress to attempt to identify the B. subtilis equivalem of the E. colt DnaB helicase. If this is successful the $ene will be cloned, overeapressed and the product purified so that helicase experiments can be performed on R T P / D N A complexes using the B. subtitis enzyme. Our prediction would be that RTP, like Tus, would cause fork arrest by inhibiting helicase activity in a polar manner. A model fo¢ replication fork arrest at terC A model describing replication fork arrest is shown in figure 2. There are 2 RTP-binding sites (shown as short arrows) in [R-I and 2 in IR-[L These arrows correspond to 8-bp imperfect direct repeats that have been proposed to be involved in RTP binding (Lewis el el., 1990). in part A, the rio gone is transcribed and translated. RNA polymerase binds to promoter sequences just downstream of IR-t, and the position of a putative - 10 regiort is shown. There is good reason to believe that the putative promoter identified is the real promoter as it is close to the consensus for the major vegetative sigma factor (Moran, 1989), and it is essentially conserved in B. sublilis W23 (Lewis and Wake, 1989). On translation and dimerization, RTP binds first to IR-I, preventing further transcription of the rip gent, as the area of [R-I covered by RTP also covers the - 10 region (part B and fig. 3). It is not known if IR-I1 is also saturated by RTP in rive 3x. when lerC is relocated into the chromosome in an orientation opposite to that in which it normally faces, no clockwise fork arrest is observed (Carrigan, Pack,
Fig, 2, A model describing replication fork arrest at ~erC in B. subtiiis. Part A shows the structure of the rerC region with Ilt-[ and IR.1I lying upstream of the rip gone. The - l0 region of a putative promoter is also shown. The rip mRNA, produced by RNA polymeraxe, is shown as a wavy line, with the direction of transcription indicated. RTP dimer~are rap! esented by dosed fists so that the relative orientation of dimers bound to DNA can be easily seen. The proposed 8-bp KTP-binding sites are shown as short arrows underneath lR-l and IR-ii. The region of DNA protee~.ed from ONasc I digestion at low levels of RTP i8 marked in part B above lg-I and is bracketed. RTP dimers, through which a replication fork has passed, are represented as open hands in parts C and D. Details of the figure are described in the text.
T E R M I N A T I O N OF B. SUBTILIS CHROMOSOME REPLICATION
A
LZ~bp I IR I
IR II
t-.-
-10
~
RTP Synthesis a ~ l
~
"rmnr,cr~p~on
I
Preened
-10
i
d~Dn
I ° II
FITP binds to ~ e ~ at IN I befOfO btnerlng to ERII
l -~
rathe terCt~, movl~ lh,'eucJh IR El, ~¢',d is-
movB8 tlwough I1=1I. F~-ks f u ~ , f ~ l ~ e d by d schemata1 and cell di'~sio m.
I
i
~Z
_11o -..C~,~e r,a~Jrm~ beck Io
897
P.J. L E W I S A N D R.G. WAKE
898
Leading strandsynthtmis
01 s
_--
.... ,o,.
(~CTATAATAG/xACTAA(}AAAACTATGTACCAAATGTTCA(~TCO~AIf'iT I"tCCGCTACAC~ATMT
10
A
B
Clockwise replication fork approach Fig. 3. Features of [R-I important in replication fork arrest. The sequen2 numbers correspond to those defined previously (Carrigan et at., 1987). The large rightwards arrow underneath the sequence defines IR-I. The region of IR-I protected from digestion by DNase t is shown as a stippled box. The region protected overlaps the - tO region of the putative promoter. The proposed 8-bp RTP-hinding sites are shown as short arrows beneath the IR-i sequence. The sites of arrest of leading strand synthesis sre shown above the sequence, with the sequences at which strand arrest occurs most frequently shown as a heavier line. The direction of clockwise fork approach is shown as the arrow at the bottom of the figure.
Smith and Wak-, unpublished). Experimems are currently in progress to obtain in vine footprints o f the RTP/IRR complex. It should be clear from these whether or not IR-II is saturated with RTP. The "0nodei presented here assumes that the IRR (therefore IR-II) is fully saturated with RTP. In part C, as the clockwise replication fork enters the terrninn~ region, the RTP/tR-II complex is facing in tile wrong orientation to inhibit replication fork helicase actiwty, The fork will move through this complex. The RTP/IR.I complex is facing in the correct orientation to inhibit helicese activity and so clockwise replication fork arrest will occur in the vicinity of IR-L Recent e~periments using a B, subtiIts plasmid containing the IRK-rip segment of the chronaosome have shown that, in the arrested re#i•.~tion fork, leading strand synthesis stops within IR-] (Bruaud, Ehr.'.ich and Janniere, personal communie,~tion; fig. 3)- The positions which correspond to peak arrest sites lie directly adjacent to one of the 8-bp direct repeats in IR-I. It is assumed in this model that when the helicase moves through the IR./RTP complex, 12.TP is displaced. Part D shows tom when the anticloekwise replication fork arrives in the terminus region a few minutes later, it is able to move through the ATP/I R-I complex as it is facing in the wrong direc-
tion to inhibit helicase activity in that fork. Subsequently, the replication forks fuse and the daughter chromosomes can then be decatenated and segregated prior to cell division. In part E there is transcription of the rip gene by RNA polymerase in the newly segregated chromosomes as the cycle returns to part A. Should, for s o m e reason, the antictoekwise-moving replication fork arrive at the terminus first, fork fusion would occur on arrival of the clockwise-moving fork. Such a system ensures that termination will always occur within a very specific ( < 200 bp) region of the chromosome.
Future perspectives and unsolved problems It seems likely that RTP, llke Tus, functions in rive as a eoatra-helicase inhibiting the activity of the cell's major replicative helicase in a polar fashion. This hypothesis needs to be confirmed using the appropriate heliease isolated from B. subtilis. An unusual feature of RTP/DNA interaction is that homodimers appear to bind to non-symmetrical DNA sites in such a way that the dimer has polarity of function. Although most humodimers are symmetrical (in terms of gross overall structure ; they ma'~
TERMINATION
O F B. SUBTILIS C H R O M O S O M E
be quasisymmetrical with regards to the regions of protein/protein interaction) there are a number of examples of homodimcric proteins that bind 1o nonsymmetrical sequences. Proteins of the Arc and Mnt represser family bind as dimer~ to half of an inverted repeat, therefore to an asymmetric sequertce (Breg ef al., 1990), and the O¢t-2 homodimer hinds to an asymmetric octameric sequence as welt as to an apparently unrelated, and asymmetric, heptameric sequence (Poeilinger et al., 1989). We have proposed that RTP dimers will function in a similar manner to Tus monomers, yet sequence analysis reveals no similarity between RTP and Tus, A more detailed study of RTP interaction with the IRR is planned. Experiments will be curried out to establish if RTP binds to IR-II as welt as I Rd in rive, and to ascertain the contacts that RTP makes with DNA. Also, studies are underway to establish whether or not the I R g - r t p ~egment functions to arrest a fork in E. co!L A positive result would be evidence for R T P functioning in a similar way to Tus. Why should a cell have such a relatively sophisticated mechanism as part of the termination process when it is not essential for viability7 It seems unlikely that such a system, operative in bacteria and piasraids, does not serve a function that is advantageous. It has been suggested that a terminus, or fork arrest site, located on circular chromosomes, may serve a role in ensuring that a rolling circle mode of DNA replication is not entered (Lee et aL, 1989). The terminus may be situated in a I~articular topological domain of the chromosome to permit more efficient 4ecatenation of daughter chromosomes after the replication cycle has been completed. Clearly, the reason for the existence of a specific termination mechanism has yet to be explained. Key-words: Bacillus subttlis, Replication, Chromosome; Termination ; Review.
Aekanwledgement~ "l'hgwork of the:authors ropert¢d in this reviewwas sttpnortcd by the Australian Research Council and the Sir Zelman Cowen UnivetsiUe~Fund. We would like to thank Dr L. Janniere for the ¢ommunig~.tion of rf~uiu prior to publicmion.
References Adams, R.T. & Wake, R.G. (1980}, Highly specific labeling of the Bacillus subtilis chromosome terminus. J, Beet., 143. 1036-103g. Baker, T.A., Funnel B.E. & Kornberg, A. (1987), Hell ca*e action of DnaB protein during replication from the Esckerichia colt chromosomal origin ia vitro. J. biol. Chem., 262, 6870-6885.
REPLICATION
899
Breg, J.N.. van Opheusden, J,H.J., Burgering. M.LM,. Boelens, R. & Kaptein. R. (199~), Structure of Arc represser in solut ion : evidence for a rurally of (3-sheet DNA-binding pr~'.eins, Nature (Load.), 346, 586-589. Carrigan, C.M.. iiaarsma, J.A., Smith, M.T. & Wake, R.G. (1987), Sequence features of the replication terminus o? the Bacillus subtilis chromosome. NucL Acids Res., 15, 8501-8509. Hanley, P..I.B., Carrigau, C.M., Rowe, D.B. & Wake, R.G. (1987L Breakdown and quantitation of the forked termination of replication intermediate of Baeillug subtitls. Y. raoL BioL, 196, 721-727. Hill, T.M., T¢cklenl0erg, M,L., Pelletier, A.J. & Kuem. pel, P,L. (19fl9), tun, the trans-aetlng gene required for termination of DNA replication in Escherirhi¢ coli, encodes a DNA-binding protein. Proc, nut. Aend. SoL (Wash.), 86, 1593-1597. lismaa, T.O., Smith, M,T. & Wake, R.G. (1984), Phv!;ical map of the Bacillus subtilfs replication termirtu~, region : its con firmation, extension and genetic orientation. Oene, 32, 171-180. lismaa, T.P. & Wake, R.G. (1987), The normal replication terminus of the Bacillus subtilis chromosome, fete, is fli°,peiasablefor vegetative grow:h and sporulation. 1. TeL BioL, 195,299-310. Khatri, G.S., MaeAllister, T., Sista, P.R. & Rastia, D. (1989), The replication terminator protein of •. colt is a sequenee-specific eontra-hellcase. Cell, 59, 667-674. Kaempel, P.L., Pelletiet, A.J. & Hill, T.M. (1989), Tus and the terminators: the arrest of replication in prokaryotes. Cell, 59, 581-583. LeBowitz, J.H. & McMaeken, R. (1986), TheEscherichia coli DnaB replication protein is a DNA helicase. J. bioL Chem,, 261, 4738-4748. Lee, E_H,, Knrnherg. A~, Hidaka, M., Kobayashi, T. & Horiucbi, T. (1989), The E. cuff rePlica(tort termination protein impedes Ihe action of believes. Prec. net. Aead. Sci. (Wash.), 86, 9104-91fl8. Lewis, P.J. & Wake, R.G. (1989), DNA and protein sequence conservation at the r~plie.~tion terminus in Bacillus subtills 168 and W23. J. Bocl., 171, 1402-1408. Lewis, P.J., Smith, M.T, & Wake, P,..G. (1989), A protein involved in ~erminallon of chromosome replication in BacillussuBtilis bin:q specifically to the lerC site. J. Baei., 171, 3564-3567. Lewis, P-,L. Ralston, G,B.. Christopkerson, R.1. & '~o'ake, R.G. (1990), ldentB'ication or the replication terminator protein binding sites in ~iheterminus region of the Baetllus sa~tdis chromosome and s'toiehinmetry of the f0indlng. Z ,'no/. BioL, 2i4, 73-84. Matson, S,W. & Kaiser-Rogers, K.A. (1990), DNA helicasez. Ann. Rer. Biochem., 59, 289-329. Moran, Jr., C. P. (1989), Sigma factors and the regulation of transcriptiott, in 'Regulation of procaryotic development'" (Smith, I,, Slelx:ky, R.A. & Setlow, P.) (pp. 167-184). American Society for Microbiology, Washington, D.C. Ogasawara, N., Fujlta, M.O., Moriya, S., Fukuoka, T., Hirano, M. & Yoshikawa, H. (1990), Comparative anatomy of eriC of eubaeteria, in "'The bacterial chromosome" (Drlica, K. & Riley, M.) (pp. 287-296). American Society for Microbiology, Washington, D.C.
900
P.d. L E W I S A N D R . G . W A K E
Pocllinger, L,. Yoza, B.K. & Reader, R.G. (1989), Functional cooperat~vity between protein molecutes hound at two dislinet sequence elenmntg of the immnuoglobulin he0.vy-chain promoter, Nature (Load,), 337, 573-576. Sargent, M.G. 0980), Specific labeling of the Bacillus sublilis chromosome terminus. J. Beet., 143, 1033-1035. Schneider, A.-M., Gaisn¢, M. & Anugnostopoulos, C. (1982). Genetic structure and internal rearrangements of stable merodiploids from Bacillus subtilis strains carrying the trpF_.26 mutation. Geae, 101, 189-210. Smith, M.T. & Wake, R.G. (19gg~,,DNA sequence requiremeats for replication fork arrest at terC in Bacillus subtilis. J. Beet., 170, 4083.-4090. Smith, M.T. & Wake, R.G. (1989), Expression of the rip gene of Badllus subtilis is required for replication fork any:st at the chromosome terminus. Gene, 85, 187-192. Stcck, T.R. & DrIica, K. (1984). Bacterial chromosome segregation: evidence for DNA gyrase invoIvement in decatenation. Cell, 36, 1081-108g. Wang, L.-F., Price, C.W. & Doi, R.H. (1985), Bacillus subtllis dnaEencodes a protein homologous to DNA primase of Escherichia cull. J. bioL Chem., 260, 336g-3372.
Weiss, A.S., Harih~.ran, I.K. & Wake, R.G. (1981), Analysis of the terminus region of the Bacillus subtilis chromosome. Nature (Lend.), 293,673-6"15. Wei~s, A,S. & Wake, R.G. (1953). Reswiction map of the DNA spanning the replication terminus of the Bacillus subtilis chromosome. J. reel Biol., 171, 119-137. Weiss, A,S. & Wake. R.G. (1984), A unique DNA intermediate associated with termination of chromosome replication in Bacillus subtilis. Cell. 39. 693689. Wei~s, A.S.. Wake. R.G. &Inman. R.B. (1996), An Jarmobilized fork as a termination of replication intermediate in Bacillus subtilis. J. reel BioL, lg8, |99-205. Yoshikawa, H. & Sueoka, N. (1963a). Sequential replica. tioa of the Bacillus ~ubtili.r chromosome. - - L Comparison of marker frequencies in exponential and stationary growth phases. Prec. nat. Acad. 8ei. (Wash.), 49, 559-566. Yoshikawa, H. & Su¢oka, N. (1963b), Sequential replication of the Bacillussubtills chromosome. - - if. Ist~topie transfer experiments. Prec. nat. Aeod. SeL (Wash.), 49, g06-813.
~) iNSTITUTPASTEUR/ELSEVIER Paris 1991
Termination of chromosome replication in Bacillus subtilis P.J. Lewis and R . G . Wake
The Department o f Biochemlstty, The Universily of Sydney, Sydney, N S W 2006 (Australia)
Introduction
Chronmsome replication in bacterial cells can be divided into 3 dist'.net stages: initiation, elongation and termination. Until recently, very little was known about the final stage, termination, or completion of the cycle. Much of what is now known about termination has arisen out o f the initial work of 3 laboratories: Kuempel's group in the United States and Louarn's group in France worked with '------------------Eseheriehia eoli, and our own group concentrated on Bacillus subtilis. Overall, the findings with each organism have complemented one another. Termination involves fusion of approaching replication forks in a region approximately opposite the origin, oriC. This is followed by deeateantion of the daughter chromosomes (Steck and Drliea, 1984) mad segregation prior to cell division. It is only since 1980 that significant advances in understanding termination have been made, but now a quite detailed understanding of the process, at least of the first stage, is starting to emerge. The occurrence of sporulation and spore germination in B. subtilis has provided unique opportunities for addressing the problem in this organism. Thus, since the early classic studies by Yoshikawa and Sueoka (1963a,b), who used B. subtilis to first establish the existence of a unique origin of reptication on the bacterial chromosome, this organism has continued to provide essential information on the replication process. This brief review concentrates largely on termination in B. subtilis. The initial problem in studying term(nation was the identification of the si~eor region of fork fusion. Did replication forks simply fuse when they met at a non-defined site on the chromosome, or was there a specific site? The process of sporulation in B. sutJtills could be exploited to specifically label the terminus region, as was done independently in 2 laboratories (Adams and Wake, 1980; Sargent, 1980).
Extension of this approach showed that replication fork fusion did occur at a specific site on the chromosome, terC lWeiss et hi.. 1981), and that it involved an initial stage o f clockwise fork arrest at this site (Weiss and Wake, 1983 ; lismaa et al., 1984). The terC region has now been extensively charactcrised and the elements necessary for fork arrest have been identified. A model for clockwise fork arrest has been propos~:d and partially te~ted. Two key players in this model are ao (imperfect) inverted repeat region (If.R) of DNA within which fork arrest occurs, and an adjoining gene r:; (for replication terminator protein) whose product (RTP) binds to the IRR (Lewis el hi., 1989). Termination in E. colt is somewhat analogous to that in B, sublilis except that replication forks meet within a 350-kb region of the chromosome (rather than a < 200-bp region in B. subtifis; Kuempel et aL, 1989). The equivalent protein to RTP in E. colt has been called Tus (terminator utilization substance; Hill et aL, t989). A brief account of the earlier work prior to the identification of the rlp gene and the IRR wilt be given before describing in mole detail how they are involved in termination of chromosome replication in B. subtilis.
ldcnlificatlnn of the terminus region and an assay [or tile first singe o f termination
That there was a fixed point of replication fork arrest was established by labelling DNA for progressively shorter times prior to termination in the last cycle of replication leading to sporulation. A single restriction fragment was identified in the spore DNA with the shortest Iabelling time (Weiss et hi., 1981). On construction of a restriction map for a more extensively labelled region, it became clear that for the last few minutes (< 5) only the anticlockwise replication fork was moving (Weiss and, Wake, 1983; fisman et aL, 1984). Presumably the clockwise fork had
P.J. L E W I S A N D R.G. WAKE
894
1984), This has provided a convenient assay for the functionin 8 of zerC, at least as a replication fork arrest site. It is important to remember that clockwise fork arrest is only the first stage o f the termination process, and it remains to be established definitively that there is complete arrest o f the clockwise fork at terC. M a r k e r frequency analysis experiments have given results that are at least consistent with there being a complete block to replication fork movement at terC (Hanley et aL, 1987).
already reached terC and slopped; terC was found to be Iocaled within a 24,8-kb BamHI fragment. Whilst the clockwise replication fork was arrested at terC, il was expected that a forked structure within the 24.8-kb BamH] segment would persist until fusion occurred on arrival o f the anticlockwise fork. G e r m i n a l m g spores were used to provide synchrony in a cycle of replication, and arrested forks were identified around the time o f termination as a slowly migrating species on agarose gel electrophorests and hybridization to a specific probe (Weiss and Wake, 1984). The forked structure was conf~rmed by electron microscopy (Weiss et al., 1986).
Sequence features of lhe lerC r e g i o n
The merodlploid strain GSY 1127 (Schneider et al.. 1982) was very useful in subsequent work. Due to non-tandem duplication o f part o f the anlie|ockwise arm o f the chromosome in this strain, terC was effectively offset to a grossly asymmetric location. A clockwise fork remains arrested at terC for much longer in ~his strain than in the wild type, so enhanced levels o f the arrested fork can be obtained from exponentially growing cultures (Weiss and Wake,
600 L
800 I
Sequencing 1.3 kb o f the region spanning terC (the site of arrest) showed it to comprise an (imperfeel) inverted repeat region (IRR) containing the two halves IR-I (47 nt) and IR-II (48 nt) separated by 59 nt, and an open reading frame (ORF) capable of encoding a small basic protein (see fig. 1). Measurement o f the single-strand products o f smaller deriva-
1000 I
1200 I
IRR I IR ]
II -35-10
IR II
~%~,~C~
I ----
-Ttts
SD
9 Clockwise replication fork approach
Fig. l . Sequence features from B. suOtilis terC region (Carrigan et aL, 1987). Ihe line numbered 600-1200 represents the sequence numbers (in bp); - to and 35 define a putative promoter; SD represents a putative Shine-Dalgamo rlbosome-blnding site; the inverted repeat region, l RR, contains IR-I and IR-I l ; a possible coding region for a small basic protein (now known as RTP) is represented by the shaded box, and a putative transcription terminator sequence {Its) is underlined. All ~equenee features are drawn to scale. The large arrow at the bottonl of the figure ~hows the direction of clockwise replication fork approach.
IR IRR IPTG nt
= = = =
inverled repea~, IR region. isopropyl thiosalactosidc. nucleotideJ
i ' [
t
OaF RqP Tus
= o1~en reading frame. = replication terminalor protein. = terminator utilization substance.
T E R M I N A T I O N OF 8. SUBTILIS CHROMOSOME REPLICA TION tives of the arrested forked molecule showed that fork arrest occurred just upstream of the ORF within the IRR (Carrigan et al., 1997). Deletion experl. ments confirmed the importance of these featlires (Smith and Wake, 1988). When DNA up to 80 bp to the left of IR-L was deleted, there was no effect on fork arrest. On removal of a further 130 bp. which encompassed IR-I, fork arrest was no longer observed. Furthermore, removal of the bulk o f the ORF, or disruption of the reading frame by the insertion o f 4 bp, alga abolished fork arrest. These results suggested a role in fork arrest for both the IRR and the product of the ORF. The small basic protein product of the ORF has been named the replication terminator protein (RTP) and the gene rip. Because of its basic nature it was thought that RTP could be a DNA-binding protein, and the IRR was considered to be a potentla[ binding site for it. In addition, there also apl~eared to be a potential promoter for rip just upstream of IR-1, raising the possibility that RTP might regulate its own transcription. This will be discussed in more detail below.
Replication fork arrest is dependent on rlp espre~ion Attempts to detect rip mRNA from exponentially growing cells failed, indicating that if rrp was expressed in viva it was at very low levels (Williams and Wake, unpublished). Also, terC- strains were isolated and appeared morphologically identical to terC ÷ strains (lismaa and Wake, 1987). Growth and sporulation also appeared normal in the deletion strains, However, on sequencing the terminus of a divergent strain of Bacillus (B. subtilis W23 ; all previous work had been performed with B, subtilis 168 derivatives) there was good conservation of the IRR and exact conservation of RTP sequence at the amino acid level, despite 22 nueleotide changes at the DNA level (Lewis and Wake, 1989). When assays were carried our to see if forked termination intermediates could be detected in exponentially growing cultures of B. subtilis W2~, results showed that terC functions in an identical way in both strains, correlating conservation of sequence features with an in viva function. Clearly there has been concerted retention of protein sequence and terC function over a period of evolutionary divergence, which would indicate that gTP does perform some useful function Jn viva, To directly establish the need for rip expression for replication fork arrest to occur, a strain was constructed in which rip expression was placed under the control of the IPTG-inducibIe spar-1 promoter (Smith and Wake, 1989/. Replication fork arrest, as monitored by the level of a new forked DNA molecule of predicted dinaensl.ons, was shown to be dependent on [PTG-induced expression of rip in this
g95
strain. Also, the very low levels of IPTG required to induce fork arrest suggested that relatively lit,tie RTP was needed.
RTP and the IRR For in vitro studies on the activity of RTP it was desirable to have a pure preparation of the protein. To this end, the rip gene was cloned into an expression vector and produced at a relatively high level in E. coll. Exploitation of the basic nature of this 14.5-kDa protein enabled it to be obtained at > 90 % purity in a single cation exchange FPLC step from a nucleic-acid-free cell extract (Lewis ef aL, 1989). Baud retardation studies indicated that RTP was a DNA-binding protein and that it bound specifically to sites within the IRR. When assays were performed with the whole IRR over a range of RTP concentrations, a series o f 4 retarded species could be identified suggesting that there were 4 RTPbinding sites within the IRR (Lewis el aL, 1989). The use of progressively smaller fragments of DNA established that RTP bound to 2 sites in IR-i and to 2 in IR-II (Lewis el at., 1990}. DNase-l-footprinting studies, using the IRR and a "core" sequence coiltaining a single gTP-biading site, confirmed that RTP bound to sequences within IR-[ and IR-ll and identified the sequence regions. F0otprinting studies also established that RTP bound to IR-I with a greater affinity than it did to IR-I1, as protection of sequences in IR-I was observed at concentrations of RTF' that do not cause pioteetion of sequences in IR-II, Experiments performed with 3H-labelled RTP and 3-p-labelLed IRR, along with data obtained from analyses of RTP in the ultracentrifuge, showed that RTP binds to DNA as a dimer and that 4 dlmers of RTP bind to the IRR. This confirmed the presence of 4 RTP-binding sites per IRR (Lewis et td., 1990). Measurement of the apparent average dissociation constant for the interaction between RTP and the 1RR has shown that the interaction is at least as strong as the interaction between the trp repressor of E. coli and its operator. Also, there appears to be positive cooperativity of binding to the two adjacent sites within an I g to form a fully saturated RTP/]R complex (2 RTP dimcrs hound), but there does not appear to be any cooperative effect between the [R. Therefore, [R-I and iR-II are considered to be independent of each other as RTP bindlng to one does not appear to affect binding to the other. How does RTP cause fork arrest? RTP is a DNA-binding protein, hut how does its binding to the 1RR cause replication fork arrest?
896
P.J. LEWIS A N D R.G. W A t f E
There are many DNA-binding proteins in a cell, but replication fork arrest is not observed at those protein-binding sites. This raises the possibility that the interaction of RTP with DNA per se is not responsible for blocking the movement of the DNA replication machinery. Replication fork movement is dependent on the activity of a heliease situated at its apex (Baker et aL, 1987). A helicase moves unidirectionally along a strand of DNA unwinding the duptex (for a review see Matson and Kaiser-Rogers, 1990). In a replication fork, helicase activity serves a 2-fold function, to allow progression of the replication fork around the chromosome, and to generate single-stranded templates for DNA polymerase 111 holoenzyme (pol-lll). In E. colt, the major heliease involved in replication fork movement is DnaB (LeBowitz and McMacken, 1986). Recently, the E, colt terminator protein Tus has been shown to inhibit DnaB activity, providing a possible explanation for how terminator proteins might effect replication fork arrest (Khatrl et at.; Lee et aL, 1989). Furthermore, Tus appears to be polar in its inhibition of DnaB hellcase activity. A Tus/DNA complex that inhibited DnaB activity when it was facing in one orientation did not cause inhibition of activity when its orientation, with respect to DnaB approach, was reversed. In essence, a clockwise-moving replication fork capable of passing through a Tus/DNA complex on the clockwise arm of the chromosome, would not move through a similar, but oppositely oriented, complex on the antietockwise arm (and vice versa for the antieloekwise-moving fork). This ensures that termination in E. coli will always occur within a defined region of the chromosome (Le, between oppositely oriented terminator,= situated on the clockwise and anticlockwise arms). This is known as the termination trap model (see Kuempel el el., 1989), To date no helicases have been identified in B. sublilis, but since they appear to he ubiquitous, it is certain that they do exist. Also, due to the similarity of a nnmber of components of the ,'epli-
cation apparatus of B. subtilis and E. coil (see Wang et at., 1985; Ogasawara et at., 1990), it is probable that replication fork movement in B. subtilia will be dependent on the activity of an equivalent of DnaB heliease in E. coil This seems particularly likely when two of the proteins with which the DnaB helicase is known to be closely associated, DnaA and DnaG. share 50 % and 3 1 % identity, respectively, between E. colt and B. sub:ills. Work is in progress to attempt to identify the B. subtilis equivalem of the E. colt DnaB helicase. If this is successful the $ene will be cloned, overeapressed and the product purified so that helicase experiments can be performed on R T P / D N A complexes using the B. subtitis enzyme. Our prediction would be that RTP, like Tus, would cause fork arrest by inhibiting helicase activity in a polar manner. A model fo¢ replication fork arrest at terC A model describing replication fork arrest is shown in figure 2. There are 2 RTP-binding sites (shown as short arrows) in [R-I and 2 in IR-[L These arrows correspond to 8-bp imperfect direct repeats that have been proposed to be involved in RTP binding (Lewis el el., 1990). in part A, the rio gone is transcribed and translated. RNA polymerase binds to promoter sequences just downstream of IR-t, and the position of a putative - 10 regiort is shown. There is good reason to believe that the putative promoter identified is the real promoter as it is close to the consensus for the major vegetative sigma factor (Moran, 1989), and it is essentially conserved in B. sublilis W23 (Lewis and Wake, 1989). On translation and dimerization, RTP binds first to IR-I, preventing further transcription of the rip gent, as the area of [R-I covered by RTP also covers the - 10 region (part B and fig. 3). It is not known if IR-I1 is also saturated by RTP in rive 3x. when lerC is relocated into the chromosome in an orientation opposite to that in which it normally faces, no clockwise fork arrest is observed (Carrigan, Pack,
Fig, 2, A model describing replication fork arrest at ~erC in B. subtiiis. Part A shows the structure of the rerC region with Ilt-[ and IR.1I lying upstream of the rip gone. The - l0 region of a putative promoter is also shown. The rip mRNA, produced by RNA polymeraxe, is shown as a wavy line, with the direction of transcription indicated. RTP dimer~are rap! esented by dosed fists so that the relative orientation of dimers bound to DNA can be easily seen. The proposed 8-bp KTP-binding sites are shown as short arrows underneath lR-l and IR-ii. The region of DNA protee~.ed from ONasc I digestion at low levels of RTP i8 marked in part B above lg-I and is bracketed. RTP dimers, through which a replication fork has passed, are represented as open hands in parts C and D. Details of the figure are described in the text.
T E R M I N A T I O N OF B. SUBTILIS CHROMOSOME REPLICATION
A
LZ~bp I IR I
IR II
t-.-
-10
~
RTP Synthesis a ~ l
~
"rmnr,cr~p~on
I
Preened
-10
i
d~Dn
I ° II
FITP binds to ~ e ~ at IN I befOfO btnerlng to ERII
l -~
rathe terCt~, movl~ lh,'eucJh IR El, ~¢',d is-
movB8 tlwough I1=1I. F~-ks f u ~ , f ~ l ~ e d by d schemata1 and cell di'~sio m.
I
i
~Z
_11o -..C~,~e r,a~Jrm~ beck Io
897
P.J. L E W I S A N D R.G. WAKE
898
Leading strandsynthtmis
01 s
_--
.... ,o,.
(~CTATAATAG/xACTAA(}AAAACTATGTACCAAATGTTCA(~TCO~AIf'iT I"tCCGCTACAC~ATMT
10
A
B
Clockwise replication fork approach Fig. 3. Features of [R-I important in replication fork arrest. The sequen2 numbers correspond to those defined previously (Carrigan et at., 1987). The large rightwards arrow underneath the sequence defines IR-I. The region of IR-I protected from digestion by DNase t is shown as a stippled box. The region protected overlaps the - tO region of the putative promoter. The proposed 8-bp RTP-hinding sites are shown as short arrows beneath the IR-i sequence. The sites of arrest of leading strand synthesis sre shown above the sequence, with the sequences at which strand arrest occurs most frequently shown as a heavier line. The direction of clockwise fork approach is shown as the arrow at the bottom of the figure.
Smith and Wak-, unpublished). Experimems are currently in progress to obtain in vine footprints o f the RTP/IRR complex. It should be clear from these whether or not IR-II is saturated with RTP. The "0nodei presented here assumes that the IRR (therefore IR-II) is fully saturated with RTP. In part C, as the clockwise replication fork enters the terrninn~ region, the RTP/tR-II complex is facing in tile wrong orientation to inhibit replication fork helicase actiwty, The fork will move through this complex. The RTP/IR.I complex is facing in the correct orientation to inhibit helicese activity and so clockwise replication fork arrest will occur in the vicinity of IR-L Recent e~periments using a B, subtiIts plasmid containing the IRK-rip segment of the chronaosome have shown that, in the arrested re#i•.~tion fork, leading strand synthesis stops within IR-] (Bruaud, Ehr.'.ich and Janniere, personal communie,~tion; fig. 3)- The positions which correspond to peak arrest sites lie directly adjacent to one of the 8-bp direct repeats in IR-I. It is assumed in this model that when the helicase moves through the IR./RTP complex, 12.TP is displaced. Part D shows tom when the anticloekwise replication fork arrives in the terminus region a few minutes later, it is able to move through the ATP/I R-I complex as it is facing in the wrong direc-
tion to inhibit helicase activity in that fork. Subsequently, the replication forks fuse and the daughter chromosomes can then be decatenated and segregated prior to cell division. In part E there is transcription of the rip gene by RNA polymerase in the newly segregated chromosomes as the cycle returns to part A. Should, for s o m e reason, the antictoekwise-moving replication fork arrive at the terminus first, fork fusion would occur on arrival of the clockwise-moving fork. Such a system ensures that termination will always occur within a very specific ( < 200 bp) region of the chromosome.
Future perspectives and unsolved problems It seems likely that RTP, llke Tus, functions in rive as a eoatra-helicase inhibiting the activity of the cell's major replicative helicase in a polar fashion. This hypothesis needs to be confirmed using the appropriate heliease isolated from B. subtilis. An unusual feature of RTP/DNA interaction is that homodimers appear to bind to non-symmetrical DNA sites in such a way that the dimer has polarity of function. Although most humodimers are symmetrical (in terms of gross overall structure ; they ma'~
TERMINATION
O F B. SUBTILIS C H R O M O S O M E
be quasisymmetrical with regards to the regions of protein/protein interaction) there are a number of examples of homodimcric proteins that bind 1o nonsymmetrical sequences. Proteins of the Arc and Mnt represser family bind as dimer~ to half of an inverted repeat, therefore to an asymmetric sequertce (Breg ef al., 1990), and the O¢t-2 homodimer hinds to an asymmetric octameric sequence as welt as to an apparently unrelated, and asymmetric, heptameric sequence (Poeilinger et al., 1989). We have proposed that RTP dimers will function in a similar manner to Tus monomers, yet sequence analysis reveals no similarity between RTP and Tus, A more detailed study of RTP interaction with the IRR is planned. Experiments will be curried out to establish if RTP binds to IR-II as welt as I Rd in rive, and to ascertain the contacts that RTP makes with DNA. Also, studies are underway to establish whether or not the I R g - r t p ~egment functions to arrest a fork in E. co!L A positive result would be evidence for R T P functioning in a similar way to Tus. Why should a cell have such a relatively sophisticated mechanism as part of the termination process when it is not essential for viability7 It seems unlikely that such a system, operative in bacteria and piasraids, does not serve a function that is advantageous. It has been suggested that a terminus, or fork arrest site, located on circular chromosomes, may serve a role in ensuring that a rolling circle mode of DNA replication is not entered (Lee et aL, 1989). The terminus may be situated in a I~articular topological domain of the chromosome to permit more efficient 4ecatenation of daughter chromosomes after the replication cycle has been completed. Clearly, the reason for the existence of a specific termination mechanism has yet to be explained. Key-words: Bacillus subttlis, Replication, Chromosome; Termination ; Review.
Aekanwledgement~ "l'hgwork of the:authors ropert¢d in this reviewwas sttpnortcd by the Australian Research Council and the Sir Zelman Cowen UnivetsiUe~Fund. We would like to thank Dr L. Janniere for the ¢ommunig~.tion of rf~uiu prior to publicmion.
References Adams, R.T. & Wake, R.G. (1980}, Highly specific labeling of the Bacillus subtilis chromosome terminus. J, Beet., 143. 1036-103g. Baker, T.A., Funnel B.E. & Kornberg, A. (1987), Hell ca*e action of DnaB protein during replication from the Esckerichia colt chromosomal origin ia vitro. J. biol. Chem., 262, 6870-6885.
REPLICATION
899
Breg, J.N.. van Opheusden, J,H.J., Burgering. M.LM,. Boelens, R. & Kaptein. R. (199~), Structure of Arc represser in solut ion : evidence for a rurally of (3-sheet DNA-binding pr~'.eins, Nature (Load.), 346, 586-589. Carrigan, C.M.. iiaarsma, J.A., Smith, M.T. & Wake, R.G. (1987), Sequence features of the replication terminus o? the Bacillus subtilis chromosome. NucL Acids Res., 15, 8501-8509. Hanley, P..I.B., Carrigau, C.M., Rowe, D.B. & Wake, R.G. (1987L Breakdown and quantitation of the forked termination of replication intermediate of Baeillug subtitls. Y. raoL BioL, 196, 721-727. Hill, T.M., T¢cklenl0erg, M,L., Pelletier, A.J. & Kuem. pel, P,L. (19fl9), tun, the trans-aetlng gene required for termination of DNA replication in Escherirhi¢ coli, encodes a DNA-binding protein. Proc, nut. Aend. SoL (Wash.), 86, 1593-1597. lismaa, T.O., Smith, M,T. & Wake, R.G. (1984), Phv!;ical map of the Bacillus subtilfs replication termirtu~, region : its con firmation, extension and genetic orientation. Oene, 32, 171-180. lismaa, T.P. & Wake, R.G. (1987), The normal replication terminus of the Bacillus subtilis chromosome, fete, is fli°,peiasablefor vegetative grow:h and sporulation. 1. TeL BioL, 195,299-310. Khatri, G.S., MaeAllister, T., Sista, P.R. & Rastia, D. (1989), The replication terminator protein of •. colt is a sequenee-specific eontra-hellcase. Cell, 59, 667-674. Kaempel, P.L., Pelletiet, A.J. & Hill, T.M. (1989), Tus and the terminators: the arrest of replication in prokaryotes. Cell, 59, 581-583. LeBowitz, J.H. & McMaeken, R. (1986), TheEscherichia coli DnaB replication protein is a DNA helicase. J. bioL Chem,, 261, 4738-4748. Lee, E_H,, Knrnherg. A~, Hidaka, M., Kobayashi, T. & Horiucbi, T. (1989), The E. cuff rePlica(tort termination protein impedes Ihe action of believes. Prec. net. Aead. Sci. (Wash.), 86, 9104-91fl8. Lewis, P.J. & Wake, R.G. (1989), DNA and protein sequence conservation at the r~plie.~tion terminus in Bacillus subtills 168 and W23. J. Bocl., 171, 1402-1408. Lewis, P.J., Smith, M.T, & Wake, P,..G. (1989), A protein involved in ~erminallon of chromosome replication in BacillussuBtilis bin:q specifically to the lerC site. J. Baei., 171, 3564-3567. Lewis, P-,L. Ralston, G,B.. Christopkerson, R.1. & '~o'ake, R.G. (1990), ldentB'ication or the replication terminator protein binding sites in ~iheterminus region of the Baetllus sa~tdis chromosome and s'toiehinmetry of the f0indlng. Z ,'no/. BioL, 2i4, 73-84. Matson, S,W. & Kaiser-Rogers, K.A. (1990), DNA helicasez. Ann. Rer. Biochem., 59, 289-329. Moran, Jr., C. P. (1989), Sigma factors and the regulation of transcriptiott, in 'Regulation of procaryotic development'" (Smith, I,, Slelx:ky, R.A. & Setlow, P.) (pp. 167-184). American Society for Microbiology, Washington, D.C. Ogasawara, N., Fujlta, M.O., Moriya, S., Fukuoka, T., Hirano, M. & Yoshikawa, H. (1990), Comparative anatomy of eriC of eubaeteria, in "'The bacterial chromosome" (Drlica, K. & Riley, M.) (pp. 287-296). American Society for Microbiology, Washington, D.C.
900
P.d. L E W I S A N D R . G . W A K E
Pocllinger, L,. Yoza, B.K. & Reader, R.G. (1989), Functional cooperat~vity between protein molecutes hound at two dislinet sequence elenmntg of the immnuoglobulin he0.vy-chain promoter, Nature (Load,), 337, 573-576. Sargent, M.G. 0980), Specific labeling of the Bacillus sublilis chromosome terminus. J. Beet., 143, 1033-1035. Schneider, A.-M., Gaisn¢, M. & Anugnostopoulos, C. (1982). Genetic structure and internal rearrangements of stable merodiploids from Bacillus subtilis strains carrying the trpF_.26 mutation. Geae, 101, 189-210. Smith, M.T. & Wake, R.G. (19gg~,,DNA sequence requiremeats for replication fork arrest at terC in Bacillus subtilis. J. Beet., 170, 4083.-4090. Smith, M.T. & Wake, R.G. (1989), Expression of the rip gene of Badllus subtilis is required for replication fork any:st at the chromosome terminus. Gene, 85, 187-192. Stcck, T.R. & DrIica, K. (1984). Bacterial chromosome segregation: evidence for DNA gyrase invoIvement in decatenation. Cell, 36, 1081-108g. Wang, L.-F., Price, C.W. & Doi, R.H. (1985), Bacillus subtllis dnaEencodes a protein homologous to DNA primase of Escherichia cull. J. bioL Chem., 260, 336g-3372.
Weiss, A.S., Harih~.ran, I.K. & Wake, R.G. (1981), Analysis of the terminus region of the Bacillus subtilis chromosome. Nature (Lend.), 293,673-6"15. Wei~s, A,S. & Wake, R.G. (1953). Reswiction map of the DNA spanning the replication terminus of the Bacillus subtilis chromosome. J. reel Biol., 171, 119-137. Weiss, A,S. & Wake. R.G. (1984), A unique DNA intermediate associated with termination of chromosome replication in Bacillus subtilis. Cell. 39. 693689. Wei~s, A.S.. Wake. R.G. &Inman. R.B. (1996), An Jarmobilized fork as a termination of replication intermediate in Bacillus subtilis. J. reel BioL, lg8, |99-205. Yoshikawa, H. & Sueoka, N. (1963a). Sequential replica. tioa of the Bacillus ~ubtili.r chromosome. - - L Comparison of marker frequencies in exponential and stationary growth phases. Prec. nat. Acad. 8ei. (Wash.), 49, 559-566. Yoshikawa, H. & Su¢oka, N. (1963b), Sequential replication of the Bacillussubtills chromosome. - - if. Ist~topie transfer experiments. Prec. nat. Aeod. SeL (Wash.), 49, g06-813.
