© 1992 Oxford University Press
Human Molecular Genetics, Vol. 1, No. 2 137
Tetranucleotide repeat polymorphism at the human thyroid peroxidase (hTPO) locus R.Anker, T.Steinbrueck and H.Donis-Keller* Department of Genetics, Washington University School of Medicine, St Louis, MO 63110, USA
Source/Description: A tetranucleotide repeat (AATG) was identified within intron 10 of the human thyroid peroxidase gene (hTPO) (GenBank accession number M68651). The resulting STS, sRA-1, was found to detect polymorphism in the Caucasian CEPH reference pedigrees.
References: 1) Kimura et al. (1987) PNAS USA 84, 5555. 2) de Vijlder et al. (1988) Cytogenet. Cell Genet. 47, 170. 3) Lothe et al. (1986) Am. J. Hum. Genet. 50, 361. 4) Donis-Keller et al. (1987) Cell 51, 319-337.
Allele Frequencies: Determined from 73 parents from the CEPH reference pedigree primary panel. Alleles (bp) Frequency Heterozygosity P.I.C. 130 0.01 67% .61 126 0.34 122 0.10 118 0.10 114 0.44 106 0.01
K 1418
126 126 126 126 126 114 122 122 '.14126 126 122 122 118 114 114114122114114114114114114122114 114 114 126 122
Mendelian Inheritance: Figure 1 illustrates co-dominant inheritance of sRA-1 alleles in CEPH pedigree 1418. Chromosomal Localization: The hTPO gene has been localized to 2p by Southern blot hybridization of somatic cell hybrids (1, 2). We have further subregionally localized hTPO to 2p23-2pter by genetic linkage to D2S1, previously mapped to 2p23-2pter by in situ hybridization (3). Figure 2 shows a multipoint genetic linkage map constructed with the CRI-MAP program package (4), genotypes from 8 CEPH pedigrees for sRA-1 (TPO) and genotype data for 3 additional markers from the CEPH database (release 5). Other Comments: PCR reactions were performed in a total volume of 10 jil containing PCR buffer (10 mM Tris-HCl pH: 8.3, 50 mM KC1, 1.5 mM MgCl2), 100 ng genomic DNA, 1 tiM each unlabeled primer, 800 jtM dNTPs, 0.5 U Taq polymerase (Boehringer Mannheim GmbH). In addition, the AATG strand primer was 5' 32P end-labelled and added to the reaction mixture at a concentration of 0.1 jtM. The reaction mixture was incubated for 22 cycles with denaturation at 94°C for 1 min, annealing at 63°C for 30 sec, and extension at 72°C for 90 sec.
* To whom correspondence should be addressed
118 114
Figure 1.
S«x Average
Figure 2.
Downloaded from http://hmg.oxfordjournals.org/ at New York University on June 17, 2015
Primer Sequences: AATG strand: 5' CACTAGCACCCAGAACCGTC 3' TTAC strand: 5' CCTTGTCAGCGTTTATTTGCC 3'
Acknowledgement: This work was supported by NIH grant HG00469 (to H.D-K.).