k.) 1990 Oxford University Press
4634 Nucleic Acids Research, Vol. 18, No. 15
The 3' ends of
alu
repeats are highly polymorphic
Neal Epstein, Orit Nahor1 and Jonathan Silver 1* Clinical Hematology Branch, Heart, Lung and Blood Institute and 'Laboratory of Molecular Microbiology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892??, USA Submitted April 13, 1990
Tandem repeats of short sequence motifs are frequently polymorphic for the number of repeats in different individuals (1, 2, 3). The 3' ends of alu sequences are rich in short sequence repeats (4). To see if these sequences are also polymorphic, we used polymerase chain reaction (PCR) to amplify, from ten unrelated individuals, segments of genomic DNA from 8 different loci which contain alu sequences (alu repeats # 1, 12, 19, 25, 31, 32, 39 and 40 in ref. 4). The size of the 3' flanking regions of the amplified alu repeats was determined by primer extension with a radiolabelled consensus alu primer. Two of the eight loci examined were polymorphic (one from the gastrin gene and one from the beta tubulin gene, alu's # 1 and 32, ref. 4). The polymorphisms were inherited in a Mendelian fashion in three families (figure 1). Two alleles were detected at each locus. Seven of the 10 unrelated individuals examined were heterozygous at the gastrin locus, and 6 of 10 were heterozygous at the beta tubulin locus. Direct sequencing of PCR products from homozygotes confirmed the reported 3' tail sequences (5, 6), and showed that the polymorphisms were due to 9 versus 7 TAA repeats in the 3' tail of the alu in the beta tubulin gene, and the sequence GTTTGTTT versus GTTT in the 3' tail of the alu in the gastrin gene. These results provide evidence that the 3' tails of alu sequences are a rich source of 'micro-satellite' polymorphisms which could be useful in genetic mapping (see also ref. 7). Since alu repeats occur, on average, once every 6 kb in human DNA, many cosmids and almost all YACs would be predicted to contain such micro-satellite polymorphisms. Screening for these polymorphisms requires obtaining short sequences flanking alu repeats to make unique sequence PCR primers. This could be accomplished by subcloning and sequencing fragments containing alu repeats or by direct sequencing of flanking segments obtained by inverse PCR (8). The use of two flanking primers for PCR amplification, as described here, has the advantage of producing a large amount of specific product; an alternative procedure (7) which uses one radiolabelled flanking primer and one alu consensus primer is technically more difficult due to competing amplification of inter-alu sequences by the alu consensus primer alone.
ACKNOWLEDGEMENTS We thank Ingrid Svenson for technical assistance and Prescott Deininger for helpful discussions.
REFERENCES 1. 2. 3. 4. 5.
6. 7.
8.
Jeffreys,A.J., Wilson,V. and Thein,S.L. (1985) Nature 314, 67-73. Weber,J.L. and May,P.E. (1989) Am. J. Hum. Genet. 44, 388-396. Litt,M. and Luty,J.A. (1989) Am. J. Hum. Genet. 44, 397-401. Kariya,Y., Kato,K., Hayashizaki,Y., Himeno,S., Tarui,S. and Matsubara,K. (1987) Gene 53, 1 -10. Kariya,Y., Kato,K., Hayashizaki,Y., Himeno,S., Tarui,S. and Matsubara,K. (1986) Gene 50, 345-352. Lee,M.G.-S., Loomis,C. and Cowan,N.J. (1984) Nucl. Acids Res. 12, 5823-5836. Economou,E.P., Bergen,A.W. and Antonarakis,S.E. (1990) Am. J. Hum. Genet. 45, A138. Keerikatte,V. and Silver,J. (1989) J. Virol. 63, 1924-1928.
1
2
3
4
5 6
7
8
9
10 11 12 13 14 15
_~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ . . .
.. ....
---dumb,6. .MMNNL..
qW0
s, :..:;. .:z
W.
Figure 1. Genomic DNAs were amplified by PCR using oligo pairs 5' CAGAGAGGATGGGGGAGAAG 3' and 5' GATGTACATAAAGCGCCCTG 3' for sequences flanking the gastrin alu repeat, and 5' CTCACCAGCACACTGGCTAT 3' and 5' TGGAGGGCCTCTAGTAGTTG 3' for sequences flanking the beta tubulin alu repeat. After 30 thermocycles (94°Cx 1', 65°Cx 1', 72°Cx2'), 5 A1 of the 100 I I PCR was mixed with 0.25 unit fresh Taq polymerase plus 105 cpm of a consensus alu oligo labelled with T4 polynucleotide kinase to 106 cpm/pmol. The sequence of the consensus alu oligo was suggested by Peter de Jong (Lawrence Livermore Laboratory, Livermore, CA): 5' TGAGC (C/T) (G/A) (A/T) GAT (C/T) (G/A) (C/T) (G/A) CCA (C/T)TGCACTCCAGCCTGGG, where (X/Y) indicates an equal mixture of X and Y. One more cycle of PCR was performed (940Cx ', 500Cx 1', 72 °C x 5') and the products run on a sequencing gel. A composite autoradiograph is shown with the gastrin polymorphism above and the beta tubulin polymorphism below. Lanes 5, 10, and 15 were controls derived from the same samples as lanes 1, 9, and 14, respectively.
*
To whom correspondence should be addressed
4634 Nucleic Acids Research, Vol. 18, No. 15
The 3' ends of
alu
repeats are highly polymorphic
Neal Epstein, Orit Nahor1 and Jonathan Silver 1* Clinical Hematology Branch, Heart, Lung and Blood Institute and 'Laboratory of Molecular Microbiology, National Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892??, USA Submitted April 13, 1990
Tandem repeats of short sequence motifs are frequently polymorphic for the number of repeats in different individuals (1, 2, 3). The 3' ends of alu sequences are rich in short sequence repeats (4). To see if these sequences are also polymorphic, we used polymerase chain reaction (PCR) to amplify, from ten unrelated individuals, segments of genomic DNA from 8 different loci which contain alu sequences (alu repeats # 1, 12, 19, 25, 31, 32, 39 and 40 in ref. 4). The size of the 3' flanking regions of the amplified alu repeats was determined by primer extension with a radiolabelled consensus alu primer. Two of the eight loci examined were polymorphic (one from the gastrin gene and one from the beta tubulin gene, alu's # 1 and 32, ref. 4). The polymorphisms were inherited in a Mendelian fashion in three families (figure 1). Two alleles were detected at each locus. Seven of the 10 unrelated individuals examined were heterozygous at the gastrin locus, and 6 of 10 were heterozygous at the beta tubulin locus. Direct sequencing of PCR products from homozygotes confirmed the reported 3' tail sequences (5, 6), and showed that the polymorphisms were due to 9 versus 7 TAA repeats in the 3' tail of the alu in the beta tubulin gene, and the sequence GTTTGTTT versus GTTT in the 3' tail of the alu in the gastrin gene. These results provide evidence that the 3' tails of alu sequences are a rich source of 'micro-satellite' polymorphisms which could be useful in genetic mapping (see also ref. 7). Since alu repeats occur, on average, once every 6 kb in human DNA, many cosmids and almost all YACs would be predicted to contain such micro-satellite polymorphisms. Screening for these polymorphisms requires obtaining short sequences flanking alu repeats to make unique sequence PCR primers. This could be accomplished by subcloning and sequencing fragments containing alu repeats or by direct sequencing of flanking segments obtained by inverse PCR (8). The use of two flanking primers for PCR amplification, as described here, has the advantage of producing a large amount of specific product; an alternative procedure (7) which uses one radiolabelled flanking primer and one alu consensus primer is technically more difficult due to competing amplification of inter-alu sequences by the alu consensus primer alone.
ACKNOWLEDGEMENTS We thank Ingrid Svenson for technical assistance and Prescott Deininger for helpful discussions.
REFERENCES 1. 2. 3. 4. 5.
6. 7.
8.
Jeffreys,A.J., Wilson,V. and Thein,S.L. (1985) Nature 314, 67-73. Weber,J.L. and May,P.E. (1989) Am. J. Hum. Genet. 44, 388-396. Litt,M. and Luty,J.A. (1989) Am. J. Hum. Genet. 44, 397-401. Kariya,Y., Kato,K., Hayashizaki,Y., Himeno,S., Tarui,S. and Matsubara,K. (1987) Gene 53, 1 -10. Kariya,Y., Kato,K., Hayashizaki,Y., Himeno,S., Tarui,S. and Matsubara,K. (1986) Gene 50, 345-352. Lee,M.G.-S., Loomis,C. and Cowan,N.J. (1984) Nucl. Acids Res. 12, 5823-5836. Economou,E.P., Bergen,A.W. and Antonarakis,S.E. (1990) Am. J. Hum. Genet. 45, A138. Keerikatte,V. and Silver,J. (1989) J. Virol. 63, 1924-1928.
1
2
3
4
5 6
7
8
9
10 11 12 13 14 15
_~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ . . .
.. ....
---dumb,6. .MMNNL..
qW0
s, :..:;. .:z
W.
Figure 1. Genomic DNAs were amplified by PCR using oligo pairs 5' CAGAGAGGATGGGGGAGAAG 3' and 5' GATGTACATAAAGCGCCCTG 3' for sequences flanking the gastrin alu repeat, and 5' CTCACCAGCACACTGGCTAT 3' and 5' TGGAGGGCCTCTAGTAGTTG 3' for sequences flanking the beta tubulin alu repeat. After 30 thermocycles (94°Cx 1', 65°Cx 1', 72°Cx2'), 5 A1 of the 100 I I PCR was mixed with 0.25 unit fresh Taq polymerase plus 105 cpm of a consensus alu oligo labelled with T4 polynucleotide kinase to 106 cpm/pmol. The sequence of the consensus alu oligo was suggested by Peter de Jong (Lawrence Livermore Laboratory, Livermore, CA): 5' TGAGC (C/T) (G/A) (A/T) GAT (C/T) (G/A) (C/T) (G/A) CCA (C/T)TGCACTCCAGCCTGGG, where (X/Y) indicates an equal mixture of X and Y. One more cycle of PCR was performed (940Cx ', 500Cx 1', 72 °C x 5') and the products run on a sequencing gel. A composite autoradiograph is shown with the gastrin polymorphism above and the beta tubulin polymorphism below. Lanes 5, 10, and 15 were controls derived from the same samples as lanes 1, 9, and 14, respectively.
*
To whom correspondence should be addressed
