hlllllHllO-

Immunogenetics 35: 378-384, 1992

genetics

© Springer-Verlag 1992

The activation of major histocompatibility complex class I genes by interferon regulatory factor-1 (IRF-1) Cheong-Hee Chang, Juergen Hammer*, Johnson E. Loh, William L. Fodor, and Richard A. Flavell Howard Hughes Medical Institute, Section of Immunobiology, Yale University School of Medicine, 310 Cedar Street, New Haven, CT 06510, USA Received August 14, 1991

Abstract. We have investigated the role of interferon regulatory factor-1 (IRF-I), an interferon-7 (IFN-3,) inducible transcriptional activator, on major histocompatibility complex (MHC) class I gene transcription. IRF-1 alone is sufficient to trans-activate both transfected and endogenous class I genes and the effect of IRF-1 appears to be direct and sequence-specific. These data suggest that IRF-1 is involved in the IFN- 7 mediated induction of MHC class I expression.

Introduction The class I genes of the major histocompatibility complex (MHC) encode the classical transplantation antigens. The highly polymorphic MHC class I heavy chains (44 kd) are noncovalently associated on the cell surface with the nonpolymorphic /32-microglobulin (/32-m) light chain (12 kd). The level of these antigens on the cell surface is increased upon interferon treatment, particularly by interferon-3/ (IFN--y; Revel and Chebath 1986). IFNs activate a set of IFN-inducible genes many of which have the interferon response sequence (IRS) in their promoters (Dinter and Hauser 1987; Friedman and Stark 1985; Fujita et al. 1985, 1988, 1987; Goodbourn et al. 1985; Revel and Chebath 1986; Taniguchi 1988). Previously, two factors which bind to the upstream regulatory region of the human IFNA and IFNB genes have been identified, termed IRF-1 and IRF-2 (Harada et al. 1989; Miyamoto et al. 1988). It seems that these two factors behave as transcriptional activator (IRF-1) and repressor (IRF-2) for IFN genes. More recently, the role of IRF-1 has also been investigated in other IFN-responsive systems (Pine et al. * Present address: F. Hoffmann-La Roche AG, Central Research Units, ZFE/Bio/69/211, CH-4002, Basel, Switzerland. Address correspondence and offprint requests to: R.A. Flavell.

1990; Yu-Lee et al. 1990). The MHC class I gene promoter also contains the IRS sequence which has been shown to mediate the response to interferons (Dinter and Hauser 1987; Israel et al. 1986; Kober et al. 1988; Sugita et al. 1987) and to be the binding site for IRF-1 and a IFN-3~-induced factor from HeLa cells, named IBP-1 (Blanar et al. 1989). However, the role of either IRF-1 or IBP-1 on the regulation of class I gene expression has not been established. In this paper, we show that IBP-1 is probably IRF-1 and that it seems to be sufficient to trans-activate the MHC class I promoter.

Materials and methods Cell and culture. HeLa ceils were maintained in Dulbecco's modified Eagle medium (DMEM) supplemented with 10 % fetal calf serum (FCS) and 2 mM L-glutarnine. A mutant cell line, E2A4, was maintained in the same culture condition as HeLa cells except that G418 was added at 500 rtg/ml. Cultures were maintained at 37 °C in 5% CO 2. Human recombinant IFN-3,, IFN-/3, and IFN-~ were generous gifts from Biogen Research Cooperation (Cambridge, MA), Bioferon (FRG), and Schering-Plough (Kenilworth, NJ) respectively. Induction with IFN-7 and IFN-~ was done at 500 units/ml; IFN-/3 was used at 100 units/ml. Polyclonal antiserum against human IFN-(~,/3) was a gift from Dr. J. Vilcek and antibody against human IFN-/3 was obtained from Boehringer Mannheim (Indianapolis, IN). DNA clones. Two different test plasmids were constructed which have either the human MHC class I HLA-A2 [the 538 base pair (bp) Hind III-Nar I] or the mouse H-2Kb (the 383 bp Xba I-Nru I) promoter fused to the human t3-globin coding sequences from + 4 5 - + 1709 in Bluescript KS (+). A reference plasmid was used which has the same coding sequence as the test plasmid with the exception of a 12 bp insertion in the third exon of the human 13-globm gene. Either the Rous sarcoma virus (RSV; the 446 bp Nde I-Hind III) or the human/3-actin (the 4400 bp Eco RI-Hind III) promoter were used to derive the reference gene. The IRS mutation and the NF-KB binding site mutation were generated as follows: An Xba I-Xho I ( - 3 7 1 - - 14l) fragment of H-21~ was synthesized by polymerase chain reaction [PCR; the Xho I site is identical to the Xho I site of pl90CAT (Blanar et al. 1989)]. Another PCR fragment ofXho I-Nru I ( - 141- + 12) was generated to introduce the mutated residues either in the IRS or NF-•B binding sites. These fragments were

C.-H. Chang et al.: IRF-1 in MHC class I gene expression

379

ligated into the same globin plasmld which was used to construct the test plasmid. These mutations were confirmed by sequencing. The mouse CD4 cDNA was obtained from Dr. S. Hong.

was cloned into the expression vector, pCDM8 (Aruffo and Seed 1987) and used for the functional analyses.

Transtent transfection. 5 gg of each test and reference plasrnid were transfected into HeLa cells using the calcium phosphate method (Wiegler et al. 1978).

Transactivation of the MHC class I promoter by IRF-1. To determine the function of IRF-1 in the regulation of class I gene expression, transient transfection analysis was performed. Test and reference plasmids with or without IRF-1 were introduced into HeLa cells. The RNA was prepared and transcripts were measured by S1 nuclease protection. As shown in Figure 1 there are not detectable transcripts in a promotorless globin test plasmid (Fig. 1, lane 1 and 2). Very low level of transcripts were detected from both the HLA-A2 and H-2K b promoters cotransfected with pCDM8 vector in the absence of IFN-3, treatment (Fig. 1, lane 3 and 5). Cotransfection with the IRF-1 cDNA increased the level of transcription 2-13 fold above the basal level of expression (Fig. 1, lane 4 and 6, and Table 1).

RNA analysis. Cytoplasmic RNA was isolated by the method described previously (Maniatis et al. 1982). Each hybridization consisted of 20 gg RNA and 0.03 pmoles of DNA probe in 10 gl of 80 % formamide-0.4 M NaCI-40 mM 1,4-piperazinediethanesulfonic acid (PIPES; pH 6.4)-1 mM ethylenediaminetetraacetate (EDTA). Hybridization was allowed to take place at 48 °C for at least 16 h. S1 digestion was carried out at 3 0 ° C for 90 min with 300 units of $1 nuclease (Pharmacia, Piscataways, NJ) in 100 gl of 250 m M NaC1-30 mM sodium acetate (pH 4.5 at 0.03 M)-I mM ZnSO 4. The samples were fractionated on 5 % acrylamide-50% urea denaturing gels. Flow cytometric analysis. Flow cytometric analysis was performed by using FACSCAN (Becton Dickinson, Mountain View, CA). A monoclonal antibody (mAb; W6/32) to a common determinant of HLA-A, B, and C Ag was used to determine the expression of HLA Ag. A mAb to murine CD4 Ag (L3T4) fluorescein-conjugated was obtained from PharMingen. Phycoerythrin-conjugated goat anti-mouse Ig (Southern Biotechnology Associates, Birmingham, AL) was used as a secondary antibody.

Results

Cloning oflRF-1. We have previously shown that a DNA binding protein (IBP-1) binds to the IRS of the MHC class I promoter (Blanar et al. 1989). To clone the IBP-1 gene, a Xgtll cDNA expression library was prepared from polyA + RNA of IFN-7 induced (3-7 h) HeLa cells and screened with an oligonucleotide containing multiple copies of the IRS sequence ( - 1 3 4 - - 156) of the mouse class I H-2I(° promoter. After three rounds of screening two potential clones were identified and one of them, H1, was further characterized. The gel shift mobility assay was performed for the IBP-1 activity using an extract prepared from a plate lysate of H 1. The recombinant protein encoded by H1 bound to the IRS element but not to the IRS mutant which conserved G to T transversions at positions - 1 4 4 and - 1 4 6 in the H-2I~ IRS (data not shown). The same mutation abolishes the binding oflBP-1 and the IFN-7 response (Blanar et al. 1989). H1 was further subcloned into Bluescript SK(+) and sequenced. The H1 clone has 880 bp of coding region and the nucleotide sequencing revealed that IBP-1 is identical to the amino terminal region of human IRF- 1 cDNA cloned previously (Maruyama et al. 1989). The rest of the carboxyl terminal region of cDNA was cloned using PCR and subsequently the complete cDNA was constructed by fusing two clones. Since cells transfected with H I encode a protein indistinguishable for IRF-1 by sequence analysis and in gel shift mobility assay (data not shown) we believe IBP-1 is in fact IRF-1. Subsequently, a fulllength IRF-1 cDNA

IRF-1 can upregulate the MHC class I promoter in the presence of antibodies against type I interferons. Type I IFNs are able to induce the level of class I molecules on the cell surface although the induced level is lower than that obtained with IFN-3, induced cells (Revel and Chebath 1986). It has also been shown that IRF-1 is involved in the regulation of type I IFN gene expression (Fujita et al. 1989; Fujita et al. 1988; Harada et al. 1989).

Fig. 1. Activation of the MHC class I promoters by IRF-1. 5 Ixg of each test containing HLA-A2 or H-2K b promoter, and reference plasmid with the RSV promoter were transfected into HeLa cells with either pCDM8 vector (lanes 1, 3, and 5) or IRF-1 cDNA (lanes 2, 4, and 6). 20 ~tg of RNA were hybridized with 0.03 pmoles of 32P-labeled Hin fl probe and subjected to S1 nuclease digestion. Test and reference signals protected by S1 nuclease are marked. P indicates probe alone.

380

C.-H. Chang et al.: IRF-1 in MHC class I gene expression

Table 1. The effect of the IRF-1 on the MHC class I promoter.

'~

H-21~

Number of HLA-A2 experiment -IRF-1

+IRF-1

-IRF-1

+IRF-1

Expt Expt Expt Expt Expt

4.5 13.2 2.9 3.0 -

1.0 1.0 1.0 1.0 1.0

6.8 5.2 2.0 9.1 3.0

~I~ !

'l

I

1 2 3 4 5

1.0 1.0 1.0 1.0 -

A

The level of test transcripts were standarized against the reference transcripts by a densitometry. - , not done.

Therefore, we considered it possible that the effect of IRF-1 is indirect such that IRF-1 could trigger the induction of type I IFNs which could subsequently activate class I gene transcription. To test this possibility, a polyclonal antiserum against human IFN-~, /3 and mAb against human IFN-/3 were used to block the activities of type I IFNs. First, the antisera and antibodies were tested to determine whether they can inhibit the induction of endogenous HLA expression. As shown in Figure 2 the level of endogenous HLA expression is slightly increased upon the induction by either IFNc~ or IFN/3. It is also clear that antibodies against human IFNc~ and IFN/3 inhibit the induction of endogenous human class I molecules on the cell surface when cells were incubated with both type I IFNs and antibodies against them (Fig. 2A). Transient transfections were then carried out to test whether an exogenously introduced class I promoter could be inducible in the presence of antibodies. After transfection cells were incubated with or without interferonspecific antibodies. The level of transcripts from the class I promoter was increased with either IFN--y treatment or IRF-1 cotransfection irrespective of the presence of the antibodies (Fig. 2B, lanes 2, 3, 4, and 5).

The effect of lRF-1 is sequence specific. It has been shown that the binding of IRF- 1 (IBP- 1) is sequence-specific and two nucelotides changes in the IRS element abolishes the binding of IRF-1 and the induction of the MHC class I promoter (Blanar et al. 1989). We have tested this mutant in transient transfection analysis to define further the role of IRF-1 (Fig. 3). Again the wild type IRS containing plasmid responded to IRF-1 and IFN-7 with a specific enhancement of 3-fold or more above the basal level of expression (Fig. 3, lanes 1, 2, and 3). The level was further increased when both IFN-3, and IRF-1 are present (Fig. 3, lane 4). In contrast, the promoter which has the two point mutations in the IRS showed virtually no response to IRF-1 or IFN-7 treatment alone (Fig. 3, lanes 6 and 7). The mutant promoter however, retained a weak activational response when both IFN-'y and IRF-1 are present (Fig. 3, lane 8). The difference in induction level is

B Fig. 2A, B. IRF-1 activity in the presence of antibodies against type I interferons. A Cell surface expression of the HLA molecules. Cells were stained with monoclonal antibody W6/32 followed by phycoerythrin and analyzed by flow cytofluorimetry. Panel a, cells induced with 500 units/ml of IFN-3, (- -). Panel b, cells induced with either 500 units/ml of IFN-a (- -) or IFN-c~ and 1000 units/ml of polyclonal antiserum against IFN-(c~,/3) ( . . . ) . Panel c, cells induced with either 100 units/ml of IFN-/3 (- -) or IFN-/3 and 200 units/ml of mAb against IFN-/3 ( . . . ) . Cells without IFN treatment are indicated with a solid line. Results are expressed as relative cell number (y-axis) vs log fluorescence intensity (x-axis). B HeLa cells were transfected as described in the Figure 1 legend except that the test plasmid contains the HLA-A2 promoter and cells were incubated with 1000 units/ml of polyclonal antiserum against human [IFN-(a,/3); lane 4] or with 200 units/ml of mAb against human IFN-/3 (lane 5).

sequence-specific because an NF-KB binding site mutant at-186--189 (see legend to Figure 3) in the H-2K b promoter responded normally (Fig. 3, lanes 9, 10, 11, and 12).

C.-H. Chang et al.: IRF-1 in MHC class I gene expression

381

A

B H-2K b wild type

-134

AGGTGCAGAAGTGAAACTGTGGA

-156

H-2K b IRS mutant

-134

AGGTGCAGAATTTAAACTGTGGA

-156

H-2K b wild type

-200

GTGAGGTCAGGGGTGGGGAAGCCCA

-176

H-2K b NF-KB mutant

-200

GTGAGGTCAGGGGTTCTCAAGCCCA

-176

IRF-1 is sufficient to activate the transcription of the endogenous M H C class Igene. Though IRF-1 is capable o f transactivating a cotransfected M H C class I gene, a much more direct test o f its role is to examine transactivation o f the chromosomal gene. W e therefore examined whether the expression o f the endogenous class I gene could be induced by IRF-1. Since the efficiency o f transient transfection is low it is possible that the lack o f response in untransfected cells could mask the induction o f class I expression o f transfected cells. To overcome this problem the mouse T-cell marker, CD4, was cotransfected with IRF-1 to select transfected ceils on the assumption that cells transfected with mouse CD4 also obtained IRF-1 gene. When cells were harvested, they were stained with both antibodies against murine CD4 fluorescein-conjugate and human class I followed by

Fig. 3A, B. Sequence specificity of IRF-1 activity. A HeLa cells were transfected with the test and reference plasmids as described in the legend to Figure 1 except the reference plasmid contains the human t3-actin promoter. Lanes 3, 4, 7, 8, 11, and 12 have RNA from cells incubated with 500 umts/rn/ of recombinanthuman IFN-3,for 24 h. B IRS mutant has two nucleotides changes at positions - 144 and - 146 and NF-~Bmutant has four nucleotides substitutions at -186-189 in the H-2Ke promoter.

phycoerythrin. Cells positive for both fluorescein isothiocyanate (FITC) and phycoerythrin (PE) were selected and the level o f class I expression was compared and plotted in histogram form on a logafitlmaic scale. The level o f class I molecules on cell surface of wild type HeLa cells was induced both when cells were treated with IFN-3, or cotransfected with IRF-1 (Fig. 5a and 5b).

IRF-1 activates the endogenous MHC class I gene from mutant cells which do not respond to IFN-3, induction. W e have generated mutants defective in the IFN-q/-MHC class II signal transduction system (J. E. Loh, C.-H. Chang, W. L. Fodor, and R. A. Flavell, manuscript submitted). One category o f mutants were unresponsive to IFN-3, in regard to various I F N - 7 inducible genes, such as M H C class I, li, IRF-1, 9-27, and 1-8 genes in addition to M H C

382

C.-H. Chang et al.: IRF-1 in MHC class I gene expression o

'i

A

Fig. 5. Cell surface expression of the HLA molecules on wild type HeLa cells and mutant cells E2A4. Cells were stained with mAb against murine CD4 FITC-conjugate and mAb against HLA-A, B, and C (W6/32) followed by PE and analyzed by flow cytofluorimetry. Panels a and c represent wild type HeLa cells and mutant E2A4 cells, respectively. Cells were induced with 500 units/ml of human IFN-~(broken line) and the level of class I expression was plotted on a log scale. Cells wathout IFN-,,/treatment are indicated with a solid line. Panels b and d represent cells transfected with either murine CD4 alone (solid line) or murine CD4 and IRF-1 together (broken line). Cells stained with both murine CD4 and human class I antibodies were gated and the level of human class I expression was compared. Results are expressed as relative cell number (y-axis) vs log fluorescence intensity (x-axis). Fig. 4. Expression of exogenous class I promoter in the wild type HeLa cells and mutant cells E2A4. HeLa cells and mutant E2A4 cells were transfected with the test and reference plasmids as described in the legend to Figure 1 except the reference plasmid contains the human ~-actin promoter. Lanes 2 and 5 have RNA from cells induced with 500 units/ml of recombinant human IFN-,y for 24 h.

class II. It has also been shown that these mutants have a trans-defect in the IFN-7 signal transduction pathway (J. E. Loh, C.-H. Chang, W. L. Fodor, and R. A. Flavell, manuscript submitted). Therefore, we tested whether the exogenously transfected IRF-1 could rescue the inducibility of the class I gene in one such mutant, E2A4. The same test and reference plasmids used in the previous section were introduced with or without IRF-1 into wild type HeLa cells and the mutant E2A4. The transfected class I promoter does not respond to IFN-3, treatment in E2A4 cells whereas it shows good induction in wild type HeLa cells (Fig. 4, compare lanes 1, 2 and 4, 5). However, the levels of transcripts of class I were enhanced in both cell lines when IRF-1 was cotransfected although the transcription level of mutant cells is lower than that of wild type (Fig. 4, lane 3 and 6). We also tested whether the expression of the endogenous class I gene could be induced by IRF-1 using the same method described in the previous section. The level of class I molecules on cell surface of the mutant cells E2A4 was induced when cells were cotransfected with IRF-1 although this mutant does not respond to IFN-3, treatment (Fig. 5c and 5d).

Discussion Although it has been suggested that IRF-1 is involved in the expression of IFN genes and other IFN-responsive genes, as many of them contain an IRS (Cohen et al. 1988; Fujita et al. 1988; Kober et al. 1988; Levy et al. 1988; Miyamoto et al. 1988), there is no information available as to whether IRF-1 is directly involved in the regulation of MHC class I genes. Recently, preliminary data were published during the preparation of this manuscript suggesting that a cotransfected mouse class I gene, H-2L d, may be activated by IRF-1 in embryonic carcinoma (EC) cells where MHC class I expression is normally not detectable (Harada et al. 1990; Ozato et al. 1985). However, it was not clear from that study whether the upregulation of H-2L d was a direct effect specifically mediated by IRF-1 through the IRS, or whether it was a secondary effect mediated by other extracellular (such as interferons) or intracellular agents (such as by other transcription factors). Moreover, the effects observed were not on the endogenous chromosomal gene but on a cotransfected g e n e - i t was not clear if this was a peculiarity of transient transfection. Here we demonstrate that IRF-1 acts as a positive transcription factor and seems to be sufficient for the induction of not only a transfected MHC class I gene expression but also the endogenous genes. We also show that the class I gene promoter is inducible by IRF-1 directly, not through type I interferons which could be upregulated by IRF-1.

C.-H. Chang et al.: IRF-1 in MHC class I gene expression

Although it can not be ruled out that other intermediate(s) could be activated by IRF-1, and subsequently induce class I gene transcription, the fact that the mutation of the class I promoter IRS which reduces the IFN-3, induction also reduces the IRF-1 transactivation suggests that the effect of IRF-1 is a direct one. However, for the IRS mutant a small residual transcriptional response to IFN-7 and IRF-1 remains. A previous study showed that two nucleotides changes in IRS abolishes response to IFN-3, completely (Blanar et al. 1989). The small discrepancy between the previous study and the present work could be explained by the different assay systems used in the two studies. It is possible that we could able to detect a small residual level of transcripts by RNA mapping which could be undetectable by measurement at the protein level. Although it is not clear which mechanism mediates the response of the mutated IRS to IFN- 7 and IRF-1, it is possible that factors with a residual binding affinity for the mutated IRS or factors which bind another site are involved in IFN-3, mediated induction of class I gene expression. We also observed that the level of MHC class I expression is highest in the presence of both IRF-1 and IFN-'y. This could be due to the combined effort between endogenous IRF-1 and transfected IRF-1 or to an increased specific activity of transfected IRF-1 by IFN-3,. It has been shown that mutant cells defective in the expression of IRF-1 are also defective in the inducibility of MHC class I upon IFN-3, treatment (J. E. Loh, C.-H. Chang, W. L. Fodor, and R. A. Flavell, manuscript submitted). Interestingly, exogenously introduced IRF-1 can induce MHC class I expression of these cells further suggesting that IRF-1 may play a role in the regulation of MHC class I gene transcription. We do not know the defect of this mutant at this point, but it is clear that IRF-1 is sufficient to induce the expression of the MHC class I genes. The fact that IFN-7 induces large amounts of IRF- 1 coupled with the fact that presence of IRF- 1 induces the transcription of the MHC class I genes is strongly supportive for a role of IRF-1 in MHC class I gene regulation. However, it has not yet been formally shown that IRF-1 is responsible for the IFN-mediated induction of MHC class I expression. This will require 'loss of IRF-1 function' experiments for which several strategies are available. Acknowledgments. We thank Dr. Jan Vilcek for providing antiserum against human IFN-(c~+t3), Dr. Soon-Cheol Hong for murine CD4 plasmid. We also acknowledge laboratory members for their helpful discussion. This work was supported by the Howard Hughes Medical Institute.

References Aruffo, A. and Seed, B. : Molecular cloning of a CD28 cDNA by a highefficiency COS cell expression system. Proc Natl Acad Sci USA 84: 8573-8577, 1987

383 Blanar, M.A., Baldwin, A. S., Jr., Flavell, R. A., and Sharp, P.A.: A gamma interferon-induced factor that binds the interferon response sequence of the MHC class I gene, H-2kb. EMBO J 8: 1139-1144, 1989 Cohen, B., Peretz, D., Vaiman, D., Benech, P., and Chebath, J.: Enhancerlike interferon responsive sequences of the human and murine (2'-5') oligoadenylate synthetase gene promoters. EMBO J 7: 1411-1419, 1988 Dinter, H. and Hauser, H.: Cooperative interaction of multiple DNA elements in the human interferon-/3 promoter. Eur J Biochem 166: 103-109, 1987 Friedman, R. L. and Stark, G. R. : s-interferon induced transcription of HLA and metallothionein genes containing homologous upstream sequences. Nature 314: 637-639, 1985 Fujita, T., Ohno, S., Yasumitsu, H., and Taniguchi, T.: Delimitation and properties of DNA sequences required for the regulated expression of human interferon-~ gene. Cell 41: 489-496, 1985 Fujita, T., Shibuya, H., Hotta, H., Yamanishi, K., and Taniguchi, T. : Interferon-t3 gene regulation: tandemly repeated sequences of a synthetic 6 bp oligomer function as a virus-induced enhancer. Cell 49: 357-367, 1987 Fujita, T., Sakakibara, J., Sudo, Y., Miyamoto, M., Kimura, Y., and Taniguchi, T.: Evidence for a nuclear factor(s), IRF-1, mediating induction and silencing properties to human IFN-beta gene regulatory elements. EMBO J 7." 3397-3405, 1988 Fujita, T., Kimura, Y., Miyamoto, M., Barsoumian, E.L., and Taniguchi, T.: Induction of endogenous IFN-alpha and IFN-beta genes by a regulatory transcription factor, IRF-1. Nature 337." 270-272, 1989 Goodbourn, S., Zinn, K., and Maniatis, T.: Human/3-interferon gene expression is regulated by an inducible enhancer element. Cell 41: 509-520, 1985 Harada, H., Fujita, T., Miyamoto, M., Kimura, Y., Maruyama, M., Furia, A., Miyata, T., and Taniguchi, T.: Structurally similar but functionally distinct factors, IRF-1 and IRF-2, bind to the same regulatory elements of IFN and IFN-inducible genes. Cell 58: 729-739, 1989 Harada, H., Willison, K., Sakakibara, J., Miyamoto, M., Fujita, T., and Taniguchi, T.: Absence of the type I IFN system in EC cells: transcriptional activator (IRF-1) and Repressor (IRF-2) genes are developmentally regulated. Cell 63: 303-312, 1990 Israel, A., Akinori, K., Fournier, A., Fellous, M., and Kourilsky, P. : Interferon response sequence potentiate activaty of an enhancer in the promoter region of a mouse H-2 gene. Nature 322: 743-746, 1986 Kober, B., Mermod, N., Hood, L., and Stroynowski, I.: Regulation of gene expression by interferons: control of H-2 promoter response. Science 239: 1302-1306, 1988 Levy, D.E., Kessler, D. S., Pine, R., Reich, N., and Darnell, J.E.: Interferon-induced nuclear factors that binds a shared promoter element correlate with positive and negative transcriptional control. Genes Dev 2: 383-393, 1988 Maniatis, T., Fritsch, E., and Sambrook, J.: Molecular cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, Cold Spring Harbor, 1982 Maruyama, M., Fujita, T., and Taniguchi, T.: Sequence of a cDNA coding for human IRF-1. Nucleic Acids Res 17: 3292, 1989 Miyamoto, M., Fujita, T., Kimura, Y., Maruyama, M., Harada, H., Sudo, Y., Miyata, M., and Taniguchi, T.: Regulated expression of a gene encoding a nuclear factor, IRF-1, that specifically binds to IFN-t3 gene regulatory elements. Cell 54: 903-913, 1988 Ozato, K., Wan, Y.-J., and Orrison, B. M.: Mouse histocompatibility class I gene expression begins at mldsomite stage and is inducible in earlier-stage embryos by interferon. Proc Natl Acad Sci USA 92: 2427-2431, 1985 Pine, R., Decker, T., Kessler, D. S., Levy, D.E., and Daruell, J. E.: Purification and cloning of interferon-stimulated gene factor 2

384 (ISGF2): ISGF2 (IRF-1) can bind to the promoter of both beta interferon- and interferon-stimulated genes but is not primary transcriptional activator of either. Mol Cell Biol 10: 2448-2457, 1990 Revel, M. and Chebath, J.: Interferon-activated genes. Trends Biochem Sci 11: 166-170, 1986 Sugita, K., Miyazaki, J. I., Appella, E., and Ozato, K. : Interferons increase transcription of a major histocompatibility class I gene via a 5" interferon consensus sequence. Mol Cell Biol 7: 2625-2630, 1987

C.-H. Chang et al.: IRF-1 in MHC class I gene expression Taniguchi, T.: Regulation of cytokine gene expression. Annu Rev Immunol 6: 439-464, 1988 Wiegler, M., Pelicer, A., Silverstein, S., and Axel, R.: Biochemical transfer of single-copy eucaryotic gene using total cellular DNA as donor. Cell 14: 725-731, 1978 Yu-Lee, L.-Y., Hrachovy, J. A., Stevens, A. M., and Schwarz, L. A.: Interferon-regulatory factor 1 is an immediate-early gene under transcriptional regulation by prolactin in Nb2 T cells. Mol Cell Biol 10: 3087-3094, 1990