Toxicology and Applied Pharmacology 285 (2015) 23–31

Contents lists available at ScienceDirect

Toxicology and Applied Pharmacology journal homepage: www.elsevier.com/locate/ytaap

The adverse effects of aldrin and dieldrin on both myometrial contractions and the secretory functions of bovine ovaries and uterus in vitro Michał H. Wrobel ⁎, Marlena Grzeszczyk, Jaroslaw Mlynarczuk, Jan Kotwica Institute of Animal Reproduction and Food Research of the Polish Academy of Sciences, Tuwima Street 10, 10-748 Olsztyn, Poland

a r t i c l e

i n f o

Article history: Received 4 November 2014 Revised 2 March 2015 Accepted 4 March 2015 Available online 11 March 2015 Keywords: Chloroorganic insecticides Uterus Contractions Ovary Cow

a b s t r a c t Aldrin and dieldrin are chloroorganic insecticides which are recognised as endocrine disruptors. The aim of the study was to investigate their effect on the secretory functions of the uterus and ovary and on myometrial contractions. Myometrial strips and uterine and ovarian cells from nonpregnant cows were incubated with the xenobiotics (0.1, 1 or 10 ng/ml) for 24 or 72 h. Next, their effect on viability of myometrial, endometrial, granulosa and luteal cells, myometrial strip contractions, the synthesis and secretion of prostaglandins (PGs: PGF2α and PGE2) from uterine cells, the secretion of oestradiol (E2), testosterone (T) and oxytocin (OT) from granulosa cells and the secretion of progesterone (P4) and OT from luteal cells were determined. Neither of the xenobiotics (10 ng/ml) affected (P N 0.05) the viability of the ovarian and uterine cells, while both (0.1–10 ng/ml) decreased (P b 0.05) the basal and OT-stimulated myometrial contractions. In spite of these effects, neither of the insecticides affected (P N 0.05) the synthesis and the secretion of PGs from the myometrial cells. Although they also did not impair the secretion of the PGs from the endometrial cells, they abolished (P b 0.05) the stimulatory effect of OT (P b 0.05) on the secretion of the PGs and stimulated (P b 0.05) the secretion of OT from the granulosa and luteal cells. Moreover, aldrin and dieldrin stimulated secretion of E2 and T from the granulosa cells, while only dieldrin increased (P b 0.05) the secretion of P4 from luteal cells. The data show that aldrin and dieldrin stimulated the secretory function of the cultured granulosa and luteal cells and inhibited the myometrial contractions of cows in vitro, which may affect on natural parturition. © 2015 Elsevier Inc. All rights reserved.

Introduction Use of a wide variety of synthetic insecticides is an indispensable part of modern agriculture and farming practice. However, unwanted exposure to these synthetic chemicals is still widespread among human and domestic animal populations and presents a potential risk to their health. Aldrin (C12H8Cl6—1,2,3,4,10,10-hexachloro-1,4,4a,5,8,8ahexahydro-1,4-endo-exo-5,8-dimethanonaphthalene) and the more stable but also more expensive, product of its transformation, dieldrin (C12H8Cl6O—1,2,3,4,10,10-hexachloro-6,7-epoxy-1,4,4a,5,6,7,8,8aoctahydro-endo-1,4-exo-5,8-dimethanonaphthalene), belong to the family of cyclodiene organochlorine insecticides. Aldrin and dieldrin are very stable compounds that resist degradation and, because of Abbreviations: Act D, actinomycin D; AA, arachidonic acid; COX-2, cyclooxygenase 2; DDE, dichlorodiphenyldichloroethylene; DDT, dichlorodiphenyltrichloroethane; E2, oestradiol; KRS, Krebs–Ringer's solution; MTT, tetrazolium salt; OT, oxytocin; P4, progesterone; PCBs, polychlorinated biphenyls; PG(s), prostaglandin(s); PGFM, 13,14-dihydro-15keto-PGF2α; PGES, prostaglandin E synthase; PGFS, prostaglandin F synthase; T, testosterone; TBP, TATA box binding protein. ⁎ Corresponding author. Fax: +48 89 5393146. E-mail address: [email protected] (M.H. Wrobel).

http://dx.doi.org/10.1016/j.taap.2015.03.005 0041-008X/© 2015 Elsevier Inc. All rights reserved.

their long half-lives, both are recognised as persistent environmental pollutants (Jorgenson, 2001; Tully et al., 2000). Both were widely used in agriculture in the USA and Europe from the 1950s up to the early 1970s (WHO, 1989) to preserve seeds, crops, forage, and wood and to control populations of termites, with dieldrin being more extensively used for this purpose (Jorgenson, 2001; Tully et al., 2000; Van Amelsvoort et al., 2009). In addition to the intended effects, these insecticides may also have adverse health effects for livestock (Casteel et al., 1993) and humans (Stern, 2014; Stevenson et al., 1999; Tomar et al., 2013; Van Amelsvoort et al., 2009). Therefore, their use became progressively more restricted, and they were gradually withdrawn from use in Western countries (Van Amelsvoort et al., 2009). However, they were still widely used in agriculture and public health programmes in India and some African countries into the beginning of the 21st century (Mustafa et al., 2010). After they penetrated into air and water, they can spread in environment far from sources of their emission. Therefore they were found at levels above the permissible limits in ground water in India (Thakur et al., 2010) as well as in waste sites in USA (Stern, 2014). Moreover, dieldrin was measured in follicular fluid of cows in Greece (Kamarianos et al., 2003) and both are still detected in bovine

24

M.H. Wrobel et al. / Toxicology and Applied Pharmacology 285 (2015) 23–31

meat (Letta and Attah, 2013) and milk samples (Deti et al., 2014) obtained in Africa as well as in the blood of humans in Brazil (Freire et al., 2013) and India (Chillar et al., 2013). Milk-producing animals accumulate insecticides primarily after ingestion of contaminated feed and by inhaling contaminated air (Waliszewski et al., 2003) while in the occupational setting, the most important route for aldrin and dieldrin exposure was skin contact (Van Amelsvoort et al., 2009). After uptake, aldrin is rapidly converted to dieldrin, primarily by the P-450 system of the liver (Van Amelsvoort et al., 2009). Thus, aldrin cannot be detected in animals or humans unless there is current exposure (Stevenson et al., 1999). Dieldrin, by virtue of its lipophilic properties, is initially stored in fat-rich tissues and is subsequently translocated and excreted in milk. Therefore, the consumption of dairy products together with other contaminated food may expose consumers to unexpected doses of organochlorine insecticides (Armendariz et al., 2004; Botella et al., 2004; Waliszewski et al., 2003). After penetration of aldrin and dieldrin into the living bodies, they can disrupt the function of endocrine system by binding to oestrogen receptor and inhibition of the androgen signaling pathway (Aube et al., 2011; Lemaire et al., 2006). This can be followed by alterations in reproductive physiology of human, wildlife, as well as farm animals (Majdic, 2010; McKinlay et al., 2008). Indeed, aldrin belongs to the group of insecticides that have been detected in the blood and placentas of women experiencing spontaneous abortion (Saxena et al., 1981). However, its effect on myometrial contractions and the mechanism for this process has not been described as clearly as for other chlorinated xenobiotics, such as dichlorodiphenyltrichloroethane (DDT) or polychlorinated biphenyls (PCBs; Tsai et al., 1996; Wrobel et al., 2005, 2009b, 2014). Normal regulation of uterine motility is one of the crucial factors for the maintenance of pregnancy and initiation of labour at term. Oestrogens are thought to augment uterine contraction and thereby promote labour (Pepe and Albrecht, 1995; Pinto et al., 1967) by increasing the myometrial expression of the oxytocin (OT) receptor (Welsh et al., 2012) and the output of uterine prostaglandin (PG) F2α (Nakayama et al., 1991). Both PGF2α and OT are major factors that evoke myometrial contractions (Dray and Frydman, 1976; Fuchs et al., 1984; Senior et al., 1993), and the positive feedback loop between them in cows is well documented (Kotwica et al., 1999; Skarzynski et al., 1997). In contrast, increases in the concentration of progesterone (P4) in the pregnant uterus block myometrial activity until parturition (Wood, 1999). Therefore, the aim of this study was to investigate whether aldrin and dieldrin interfere with (a) myometrial contractions, (b) the synthesis and secretion of PGF2α and PGE2 from the uterus and (c) secretion of OT, testosterone (T), oestradiol (E2) and P4 from the granulosa and luteal cells. Material and methods Animals and organ preparation. On days 8–12 of the oestrous cycle (Fields and Fields, 1996), uteri and ovaries from healthy cows and mature heifers were collected in a commercial slaughterhouse within 20 min after slaughter. The organs were placed in ice-cold saline (0.9%

NaCl) and transported to the laboratory within 1 h. All materials used in these studies were purchased from Sigma-Aldrich (PL) unless otherwise stated. Each medium used was supplemented with gentamycin (20 μg/ml) and amphotericin (2 μg/ml). Myometrial strips preparation and incubation. Four strips of longitudinal smooth muscle from each myometrium, 6–7 mm long and 3–4 mm wide, were dissected as previously described (Wrobel et al., 2005). The strips were immediately immersed in 2 ml of aerated (95% air and 5% CO2) physiologic salt solution (116 mM NaCl, 4.6 mM KCl, 1.16 mM NaH2PO4·H2O, 1.16 mM MgSO4·7H2O, 21.9 mM NaHCO3, 1.8 mM CaCl2·2H2O, 11.6 mM dextrose, 0.03 mM CaNaEDTA; pH 7.4), as described by Tsai et al. (1996). They were then incubated with the treatments (24 h, 4 °C) according to Wrobel et al. (2005). After incubation, the contractility of the myometrial strips was measured. Isolation and culture of cells. Myometrial cells were obtained by enzymatic dispersion after the separation of the myometrium from the perimetrium and endometrium. The tissue (7 g from each uterus) was minced with scissors and then digested (2 h at 38 °C) in oxygenated (95% O2 + 5% CO2) medium (20 ml of M199 supplemented with 0.1% BSA) with collagenase IA (1.5 mg/ml) and dispase (0.2 mg/ml Gibco, GB). Endometrial cells were also isolated by enzymatic dispersion. The isolated uterine horns were filled with the digestion mixture of collagenase IA (1.5 mg/ml) and medium (M199 supplemented with 0.1% BSA), and placed in a water bath (38 °C) for 1 h. To obtain pooled luteal cells, corpora lutea (four for each experiment) were perfused with collagenase IA (1 mg/ml) through an ovarian artery branch. Pools of granulosa cells were obtained by vigorous aspiration with the follicular fluid from follicles (10–15 follicles) N 1 cm in diameter. Next, all types of cells were collected and partially purified by centrifugation (1800 ×g for the myometrium, 1200 ×g for the endometrium and granulosa, or 1000 ×g for the luteal cells, 3 times for 10 min, at 4 °C). After each centrifugation, the cells were washed with 10 ml of M199 supplemented with 0.1% BSA. Cell viability was estimated by exclusion of 0.04% trypan blue dye. Only preparations of cells showing viability greater than 80% were used for further studies. Finally, all types of cells were suspended in DMEM/Ham's F-12 culture medium with 5% FCS. The cells were suspended at 2 × 105/ml for use in the studies of the cytotoxic effects of the insecticides and for hormone determinations or at 5 × 105/ml for the measurement of mRNA expression. The suspensions were transferred into plates (48-well plates for the studies of the cytotoxic effect of the insecticides and hormone determinations and 6-well plates for the measurement of mRNA expression; Nunclon Δ-Surface, NUNC, NL) and cultured in a controlled atmosphere (95% air and 5% CO2, 100% humidity, 38 °C; Memmert INCO 180, D). The cells were preincubated for 24 h (granulosa and luteal), 72 h (endometrium) and 96 h (myometrium) to allow them to attach to the bottom of the well. Next, they were washed twice with M199 and the medium was replaced with DMEM/HAM-12 supplemented with 0.1% BSA. For incubations exceeding 24 h, the medium was supplemented with antioxidants: ascorbic acid (20 μg/ml; Merck, USA), sodium selenite (5 ng/ml; INC, USA) and transferrin (5 μg/ml).

Table 1 Primer sequences used to analysis of gene expression in bovine myometrial cells. Gene

Accession no.

Sequence (5′-3′)

Product size (bp)

COX-2

AF004944.1

140

PGES

NM_001166554.1

PGFS

S54973

TBP

NM_001075742.1

Forward: GCCTGATGACTGCCCAACA Reverse: GCAAAGAATGCAAACATCAGATTT Forward: CCGAGATCAAGTTCTCCTCCTACA Reverse: CGCCTTCATGGGTGGATAGT Forward: TGTGGTGCACGTATCACGACA Reverse: AATCACGTTGCCGTCCTCATC Forward: CAGAGAGCTCCGGGATCGT Reverse: ACACCATCTTCCCAGAACTGAATAT

131 160 194

M.H. Wrobel et al. / Toxicology and Applied Pharmacology 285 (2015) 23–31

B

C

D

Viability of myometrial cells (arbitrary unit)

A

25

Fig. 1. The mean (±SEM) viability of granulosa (n = 5; A), luteal (n = 6; B), endometrial (n = 4; C) and myometrial (n = 5; D) cells after incubation (72 h) with aldrin or dieldrin (each at 10 ng/ml). Actinomycin D (Act D; 500 ng/ml) was used as a negative control. a–b (P b 0.01).

60

prolonged the period of treatment for endometrial and ovarian cells up to 72 h, as in our previous studies on PCBs and DDT effect on secretion of steroids and OT from granulosa and luteal cells (Mlynarczuk et al., 2005; Mlynarczuk and Kotwica, 2005, 2006; Wrobel et al., 2009a). Cell viability. Myometrial, endometrial, granulosa and luteal cells were incubated (72 h) with aldrin and dieldrin (10 ng/ml). Actinomycin D (Act D; 500 ng/ml), an inhibitor of RNA synthesis and stimulator of apoptosis that reduces the survival of cells, was used as a negative control. Each experiment was repeated 4 – 6 times for the endometrial, granulosa, myometrial, and luteal cells. Each treatment was performed in quadruplicate. The viability was determined immediately after the incubation was terminated. Myometrial contractions. Myometrial strips (4 from each cow) were incubated for 24 h with aldrin (n = 6 cows) or dieldrin (n = 4 cows), each at 0.1, 1 and 10 ng/ml. Next, the track of spontaneous and OT (10−7 M)-stimulated contractions was recorded.

b

A a

a

a

40

ad

ad cd c

20

0

Force of contractions (mN)

Force of contractions (mN)

Treatments. Aldrin and dieldrin (both, analytical grade purity) were dissolved in DMSO (HPLC purity grade), such that the final concentration of the DMSO in the culture medium did not exceed 0.1%. Therefore, 0.1% of DMSO was added to the control samples. It should be noted, that in follicular fluid of cycling cows 0.2–0.7 ng/ml of dieldrin has been determined (Kamarianos et al., 2003) and in the sera of patients with metabolic syndrome 3.5 ± 5.2 ng/ml of aldrin and 2.2 ± 3.5 ng/ml of dieldrin have been measured (Tomar et al., 2013). Therefore, in the present study we used both insecticides at doses of 0.1, 1 and 10 ng/ml. The range of doses was the same as in our previous studies on the effects DDT and its metabolite dichlorodiphenyldichloroethylene (DDE) on the function of the bovine reproductive tract (Wrobel et al., 2009a, 2012). The period of 24 h treatment the myometrium with insecticides was chosen on the basis of our previous studies. It was the longest time used for measure the chlorinated xenobiotics effect on prostaglandin synthesis (Wrobel et al., 2009b, 2012, 2014) and the shortest time to study their effect on myometrial contractions (Wrobel et al., 2005). Since we have found any effect of both insecticides on mRNA expression of enzymes involved in prostaglandin synthesis and secretion, we

60

B

b e

ae

ae ad

40

c

cd

c

20

0 Ctrl

0.1

1 Aldrin

10

Ctrl

0.1

1

10

Dieldrin

Fig. 2. The mean (±SEM) basal (white bars) and OT (10-7 M)-stimulated (black bars) force of the contraction of the myometrial strips after incubation (24 h) with aldrin (A; n = 6) or dieldrin (B; n = 4; both, 0.1, 1 and 10 ng/ml). a–e (P b 0.05).

26

M.H. Wrobel et al. / Toxicology and Applied Pharmacology 285 (2015) 23–31

5000

A

B b

10

5

a a

a

0

PGE2 (ng/mg protein)

PGFM (ng/mg protein)

15

b

4000 3000 2000

a

a

a

1000 0

Ctrl

Aldrin

Dieldrin

AA

Ctrl

Aldrin

Dieldrin

AA

Fig. 3. The mean (±SEM) concentrations of PGFM (A) and secretion of PGE2 (B) from myometrial cells (n = 4) after incubation (24 h) with aldrin or dieldrin (each at 10 ng/ml). Arachidonic acid (AA; 20 μg/ml) was used as a positive control. a–b (P b 0.05).

PG synthesis by myometrial cells. Myometrial cells from four cows were incubated (24 h) with aldrin or dieldrin (10 ng/ml). After incubation, the medium was removed, and the cells were covered with Phenozol (300 μl for each well; A&A Biotechnology, PL). The plates were stored at −70 °C for subsequent real-time PCR analysis of the mRNA expression of enzymes involved in PG synthesis: cyclooxygenase 2 (COX-2), PGF synthase (PGFS) and PGE synthase (PGES). Hormone secretion from uterine and ovarian cells. The myometrial cells from four cows were incubated (24 h) with aldrin or dieldrin (10 ng/ml); arachidonic acid (AA; 20 μg/ml) was used as a positive control. The endometrial cells from four cows were incubated (72 h) with aldrin or dieldrin (0.1, 1 and 10 ng/ml); AA (20 μg/ml) and OT (10−7 M) were used as positive controls. The granulosa cells were incubated (72 h) with aldrin (n = 4 experiments) or dieldrin (n = 5 experiments), each at doses of 0.1, 1 and 10 ng/ml. FSH (100 ng/ml) was used as the positive control. The luteal cells were incubated (72 h) with aldrin (n = 5 experiments) or dieldrin (n = 4 experiments), each at doses of 0.1, 1 and 10 ng/ml. LH (100 ng/ml) was used as the positive control. Each treatment was performed in duplicate. After the incubation, the medium was collected into tubes containing 10 μl of 0.3 M EDTA in 1% acetylsalicylic acid (Meyer et al., 1989) and stored at − 20 °C for subsequent determination of the concentrations of PGFM and PGE2 in the myometrial and endometrial cell cultures, OT, T and E2 in the granulosa cell cultures and OT and P4 in the luteal cell cultures.

Hormone determination. The concentrations of all hormones were determined by EIA. The concentration of PGFM (13,14-dihydro-15keto-PGF2α, a metabolite of PGF2α) in the culture medium reliably reflects the amount of PGF2α secreted from bovine endometrial cells (Skarzynski et al., 1999). Horseradish peroxidase-labelled PGFM, PGE2, P4, E2, T and the biotinylated OT were used as tracers. Antisera for PGFM, PGE2, P4, E2, T4 and OT were used at final dilutions of 1:120,000, 1:30,000, 1:100,000, 1:100,000, 1:130,000 and 1:25,000, respectively. The standard curves for PGFM, PGE2, P4, E2, T and OT ranged from 0.03 to 8 ng/ml, 0.08 to 20 ng/ml, 0.1 to 25 ng/ml, 2 to 1550 pg/ml, 1.6 to 1400 pg/ml and 3.9 to 1000 pg/ml, respectively.

A

B

Determination of cell viability. The viability of cells after treatment with aldrin or dieldrin was measured by a TOX-1 test (in vitro toxicology assay kit, MTT-based) according to the manufacturer's instructions. This method is based on the ability of mitochondrial dehydrogenases in living cells to convert a tetrazolium salt (MTT; yellow colour) into a formazan (blue colour). The endometrial and luteal cells were incubated with MTT (20 μl/well) for 6 and 2 h, respectively, whereas the myometrial and granulosa cells were incubated with MTT for 4 h (Wrobel et al., 2005, 2009a). The absorbance of the reaction product was measured at λ = 570 nm (ELISA, Multiscan EX, Labsystem, FI). Measurement of smooth muscle contractions. Myometrial strips were individually placed into the chambers of a HSE Schuler Organbath apparatus (March-Hugstetten, DE) connected to a computer. Each chamber contained Krebs–Ringer's solution (KRS; pH = 7.4; 10 ml) composed of NaCl (120.3 mM), KCl (5.9 mM), CaCl2 (2.5 mM), MgCl2 (1.2 mM), NaH2PO4 (1.2 mM), NaHCO3 (15.5 mM) and glucose (11.5 mM) (Kotwica et al., 2003). Each strip was attached to the base with a stationary hook and tied to the isometric contraction transducer (HSE Type 372) with surgical silk. The KRS was maintained at 38 °C and oxygenated (95% O2 and 5% CO2). All preparations were allowed to equilibrate for 2 h. The force of the isometric contractions of the smooth muscle was measured every 2 s for 20 min, as previously described (Wrobel et al., 2005).

C

Fig. 4. The mean (± SEM) mRNA expression of COX-2 (A), PGFS (B) and PGES (C) in myometrial cells (n = 4) after incubation (24 h) with aldrin or dieldrin (each at 10 ng/ml).

M.H. Wrobel et al. / Toxicology and Applied Pharmacology 285 (2015) 23–31

2.5

A

c PGFM (ng/mg protein)

PGFM (ng/mg protein)

2.5 2.0 1.5

b

1.0

a

0.5

a

a

a

a

1

10

a

a

1

10

B

b

b

2.0 1.5 1.0

a

a

a

a

a

10

0.1

a

a

0.5 0.0

0.0 Ctrl 0.1

0.1

OT

Ctrl 0.1

AA

1500

C

PGE2 (ng/mg protein)

d

200 150

b 100

a

50

ac

ac

c

ac ac ac

10

0.1

1

1

10

OT

AA

Dieldrin + OT

Dieldrin

Aldrin + OT

Aldrin

250 PGE2 (ng/mg protein)

27

D

c

500

b

250

a

200 150

a

100

a

a

a

1

10

a

a

0.1

1

50 0

0 Ctrl 0.1

1

1

10

OT

Ctrl 0.1

AA

Dieldrin

Aldrin + OT

Aldrin

10

OT

AA

Dieldrin + OT

Fig. 5. The mean (±SEM) concentrations of PGFM (A, B) and PGE2 (C, D) secretion from endometrial cells (n = 4) after incubation (72 h) with aldrin (A, C) or dieldrin (B, D; each at 0.1, 1, or 10 ng/ml), separately or combined with OT (10−7 M). Arachidonic acid (AA; 20 μg/ml) was used as a positive control. a–d (P b 0.05).

The intra- and inter-assay coefficients of variation for PGFM, PGE2, P4, E2, T and OT were 6.5 and 12%, 7 and 11.5%, 9 and 11%, 8.3 and 10.7%, 9.4 and 12.7%, 9.7% and 11.9%, respectively. Finally, all hormone concentrations were expressed per milligram of cellular protein measured by Bradford method (1976). All hormone concentrations and protein measurements were performed using the ELISA scanner (Epoch BioTek, USA).

Measurement of mRNA expression. Total RNA was isolated using the Total RNA Kit (A&A Biotechnology, PL) according to the manufacturer's instruction. The concentration and purity of the isolated RNA samples were determined using a spectrophotometer (NanoDrop 1000; Thermo Scientific, USA). The absorbance ratio (A260:A280) for all samples was between 1.8 and 2. Total RNA (0.5 μg for each sample) was reverse

A

b b

200

OT (pg/mg protein)

OT (pg/mg protein)

b

250

250

b

150

a

100 50

200

B

150

a 100 50 0

0 Ctrl

0.1

1

Ctrl

10

0.1

10

2500

2500 2000 1500

a

ab

b ab

500

OT (pg/mg protein)

C OT (pg/mg protein)

1 Dieldrin

Aldrin

1000

b

b

2000

D b b

1500 1000

b

a

500 0

0 Ctrl

0.1

1 Aldrin

10

Ctrl

0.1

1

10

Dieldrin

Fig. 6. The mean (±SEM) secretion of OT from granulosa (A, B; n = 4) and luteal cells (C, D; n = 5) after incubation (72 h) with aldrin (A, C) or dieldrin (B, D; each at 0.1, 1 or 10 ng/ml). a–b (P b 0.05).

28

M.H. Wrobel et al. / Toxicology and Applied Pharmacology 285 (2015) 23–31

b

150

B

ab a

T (pg/mg protein)

T (pg/mg protein)

150

b

A 100

50

100

Ctrl

a

1

10

50

0.1

1

Ctrl

10

0.1

Dieldrin

Aldrin

bc

400

500

c

C

bc ab

300

a

200 100

E2 (pg/mg protein)

E2 (pg/mg protein)

b

0

0

500

b a

D

400

bc

c

ab

300

a

a

Ctrl

0.1

200 100 0

0 Ctrl

0.1

1

10

FSH

1

10

FSH

Dieldrin

Aldrin

Fig. 7. The mean (±SEM) secretion of T (A, B) and E2 (C, D) from granulosa cells after incubation (72 h) with aldrin (A, C; n = 4) or dieldrin (B, D; n = 5; each at 0.1, 1 or 10 ng/ml). FSH (100 ng/ml) was used as a positive control.a–c (P b 0.05).

transcribed (42 °C for 1 h) using reverse transcriptase. The primers used for COX-2, PGES and PGFS were those previously described (Slonina et al., 2009; Wrobel et al., 2012). The TATA box-binding protein (TBP) was used as the most stable housekeeping gene to normalise the gene expression in the bovine myometrium (Rekawiecki et al., 2013). The primer sequences, as shown in Table 1, were synthesised (IBB PAN PL). Real-time PCR (25 μl volume) was performed using the APB Prism 7900 sequence detection system (Applied Biosystems, USA). The reaction mixture contained cDNA (5 μl; 200 ng/μl), SYBR Green PCR master mix (12.5 μl; mix-B, lot. 171011; A&A Biotechnology, PL), Hi-ROX (0.4 μl; lot. 41011; A&A Biotechnology, PL), both PCR primers (2.5 μl of each; 200 nM) for each studied gene and water (2.1 μl). The PCR reactions for each pair of primers were performed as follows: initial denaturation (95 °C for 10 min) followed by 40 cycles of denaturation (95 °C for 15 s) and annealing (60 °C for 1 min for annealing and extension). Melting curves were set up using stepped increases from 60 to 95 °C to ensure the specificity of the amplified product. The PCR products were electrophoresed on a 2% agarose gel to confirm their specificity.

550 500 400

In contrast to Act D, neither of the tested insecticides affected (P N 0.05) the viability of myometrial, endometrial, granulosa or luteal cells after 72 h (Fig. 1). Aldrin (10 ng/ml) and dieldrin (0.1–10 ng/ml) decreased (P b 0.05) the basal force of the myometrial contractions after 24 h of treatment. Oxytocin increased (P b 0.05) the contractions for the control strips and the strips pre-treated with dieldrin. At all 800

c

A ab

Results

a

ab

P4 (ng/mg protein)

P4 (ng/mg protein)

800

Statistical analysis. The mean (±SEM) values for contraction force were expressed in mN and calculated using all measurements collected every 2 s for 20 min before and after the OT challenge. These measurements were compared by one-way ANOVA followed by the Newman–Keuls test after testing for normality. All other mean (± SEM) values were compared by one-way ANOVA for repeated measures followed by the Newman–Keuls test after testing for normality. The Prism 5 software (GraphPad Software, Inc., USA) was used to prepare all statistical analyses and figures, and the real-time PCR Miner algorithm was used to analyse the relative mRNA quantification data (Zhao and Fernald, 2005).

b

300 200 100

550 500 400

c

B a

ab

b

b

300 200 100

0

0 Ctrl

0.1

1 Aldrin

10

LH

Ctrl

0.1

1

10

LH

Dieldrin

Fig. 8. The mean (±SEM) secretion of P4 from luteal cells after incubation (72 h) with aldrin (A; n = 5) or dieldrin (B; n = 4; each at 0.1, 1 and 10 ng/ml). LH (100 ng/ml) was used as a positive control. a–c (P b 0.05).

M.H. Wrobel et al. / Toxicology and Applied Pharmacology 285 (2015) 23–31

doses tested, both insecticides decreased (P b 0.05) the force of the OTstimulated contractions compared to the control (Fig. 2). Moreover, there were no differences (P N 0.05) between the basal and OTstimulated force of contractions of strips pretreated with aldrin. The insecticides did not affect (P N 0.05) either PGF2α and PGE2 secretion (Fig. 3) nor the mRNA expression of the enzymes responsible for PG synthesis (Fig. 4) in the myometrial cells after 24 h. Secretion of PGF2α from endometrial cells was not changed after their incubation (72 h) with either insecticide, whereas aldrin (10 ng/ml) decreased (P b 0.05) PGE2 secretion (Fig. 5). Oxytocin increased (P b 0.05) the secretion of both PGF2α and PGE2 from endometrial cells (Fig. 5), and both insecticides inhibited (P b 0.05) the stimulatory effect of OT on PGF2α and PGE2 secretion in these cell cultures (Fig. 5). However, both insecticides at all doses tested increased OT secretion from the granulosa (P b 0.05) cells, and aldrin (10 ng/ml) and dieldrin (0.1– 10 ng/ml) increased (P b 0.05) the secretion of OT from the luteal cells (Fig. 6). Aldrin (0.1 and 1 ng/ml) and dieldrin (1 and 10 ng/ml) increased (P b 0.05) the secretion of T from the granulosa cells (Fig. 7). Moreover, aldrin (0.1 and 10 ng/ml) and dieldrin (10 ng/ml) increased (P b 0.05) the secretion of E2 from the same cells (Fig. 7). Only dieldrin at doses 1 and 10 ng/ml increased (P b 0.05) the secretion of P4 from the luteal cells (Fig. 8). Discussion The viability of the uterine or ovarian cells was not affected by aldrin or dieldrin exposure. Therefore, we assumed that the other changes in the function of the uterine and ovarian cells were not evoked by cytotoxic effects of applied compounds. It should be emphasised that the concentration of dieldrin measured in bovine follicular fluid (Kamarianos et al., 2003) was in the range of the doses used in these studies. Both tested xenobiotics decreased the force of spontaneous myometrial contractions, with dieldrin having a greater effect than aldrin. The insecticides also decreased the OT-stimulated force of the contractions in the same strips but, in this case, aldrin seemed to be more effective. Similarly, lindane, another chlorinated pesticide, has been shown to decrease the spontaneous motility of the smooth muscle of rat uterus in vitro (Criswell and Loch-Caruso, 1999; Wang and Loch-Caruso, 2002). The effects observed for aldrin and dieldrin were opposite of E2 (Wrobel et al., 2005). These results indirectly suggest that neither insecticide showed any oestrogenic activity, consistent with the data of Arcaro et al. (1998), Kim et al. (2011) and Tully et al. (2000). However, most of the chlorinated xenobiotics studied to date, including PCBs as well as DDT and its metabolite DDE, increase the myometrial contractions of cows (Mlynarczuk et al., 2010; Wrobel et al., 2005, 2009b, 2014) or rats (Bae et al., 2001; Juberg et al., 1991; Tsai et al., 1996). Those studies could partially explain why numerous epidemiological observations have indicated that higher levels of organochlorine compounds observed in female blood are correlated with an increased frequency of miscarriages or preterm labour (Gerhard et al., 1998; Korrick et al., 2001; Longnecker et al., 2005; Taylor et al., 1989; Venners et al., 2005). However, the data obtained in vitro suggest that the cyclodienes (aldrin and dieldrin) may delay parturition. Neither of the tested compounds affected either PG synthesis in the myometrium or secretion of PGF2α and PGE2 from the myometrium and endometrium. Untreated myometrial and endometrial cells produced considerably more PGs when the medium was supplemented with AA (a substrate for their synthesis). Hence, our cell cultures had the ability to synthesise PGs. Previous studies have shown that chlorinated xenobiotics can affect the mRNA expression of enzymes involved in PGs synthesis in bovine myometrium or oviduct. It was followed by an increase in PGF2α secretion, which can mediate the adverse effect of chlorinated xenobiotics on bovine myometrial or oviductal contractions (Wrobel et al., 2009b, 2012). Moreover, PCBs affect an initial step in prostaglandin synthesis and also increase the release of AA from the

29

phospholipids of the membranes of rat myometrial cells, which further stimulates the myometrial contractions (Bae et al., 1999). However, this mechanism for the effects of cyclodiene insecticides was not confirmed in the present study. On the other hand, aldrin and dieldrin increased the OT secretion from granulosa and luteal cells, but aldrin had a weaker effect on the luteal cells. It should be noted that the OT secretion from bovine granulosa and luteal cells is also increased by PCBs (Mlynarczuk and Kotwica, 2005, 2006), DDT and DDE (Wrobel et al., 2009a). However, in the present study, the higher secretion of OT was not associated with an increase in the contractions of the myometrial strips treated with the insecticides. Moreover, aldrin and dieldrin diminished the OT-stimulated effect on PG secretion in endometrial cells. Therefore, we can speculate that both chlorinated compounds can desensitise uterine tissues to the influence of OT, and this could be the principal disruptive effect of aldrin and dieldrin on bovine uterine function. Both insecticides increased T and E2 secretion from the granulosa cells, and dieldrin also stimulated the P4 secretion from the luteal cells. A similar effect on the secretion of these steroids was observed after stimulation of porcine ovarian cells by a mixture of persistent organic pollutants, which included as primary constituents 8.24 ng/ml PCB-153 and 11.7 ng/ml DDE (Gregoraszczuk et al., 2008). Hence, the observed stimulation of the follicular steroidogenesis can promote hyperoestrogenisation. However, in contrast to E2, the insecticides tested in the present study inhibited the OT-stimulated contractions of the myometrium. Moreover, they increased the availability of P4. Aldrin was shown to have a higher affinity for the human recombinant P4 receptor than for the E2 receptor (Scippo et al., 2004), and the expression of P4 receptors in rat myometrium was shown to be induced by dieldrin (Hodges et al., 2000). Therefore, it is possible that these insecticides can enhance the progesterone block in the myometrium, which is crucial for successful pregnancy (Lye and Porter, 1978). However, the increase of P4 secretion by dieldrin in late gestation can delay or impair parturition. There is a lack of in vivo studies on the direct effect of aldrin and dieldrin on reproduction in cattle. In these studies we showed that the used pesticides can affect the function, but not viability of cultured cells from bovine reproductive system. We have also showed the disruptive effect of the others chloroorganic xenobiotics on the function of bovine reproductive tract in vitro (Mlynarczuk and Kotwica, 2005, 2006; Mlynarczuk et al., 2005, 2010; Wrobel and Kotwica, 2005; Wrobel et al., 2005, 2009a,b, 2012, 2014), which are in agreement with the epidemiologic studies (Gerhard et al., 1998; Korrick et al., 2001; Longnecker et al., 2005; Taylor et al., 1989; Venners et al., 2005). We hypothesise that sufficiently high in situ concentrations of the cyclodienes studied here may influence pregnancy outcome in cattle. In summary, the low concentrations of aldrin and dieldrin inhibited spontaneous and OT-stimulated myometrial contractions in vitro, which can be followed by delay of natural parturition. The insecticides also retracted the effect of OT on PG secretion in the endometrial cell cultures, while they stimulated ovarian steroidogenesis and the secretion of OT from granulosa and luteal cells. Conflict of interest statement The authors declare that there are no conflicts of interest. Acknowledgments We would like to thank Professors: W.J. Silvia (University of Kentucky, Lexington, KY, USA), W.W. Thatcher (University of Florida, Gainesville, FL, USA), G. Kotwica and S. Okrasa (University of Warmia and Mazury, Olsztyn, PL), and G.L. Williams (A&M Texas University, College Station, USA) for the PGFM, PGE2, OT, P4 and E2 antisera, respectively. This study was supported by the National Science Centre

30

M.H. Wrobel et al. / Toxicology and Applied Pharmacology 285 (2015) 23–31

(Project N N311 082140) and by the Polish Academy of Sciences (ZFiTR/ 2014). Some of these results were presented at the World Congress of Reproductive Biology, 2014 (Edinburgh, UK).

References Arcaro, K.F., Vakharia, D.D., Yang, Y., Gierthy, J.F., 1998. Lack of synergy by mixtures of weakly estrogenic hydroxylated polychlorinated biphenyls and pesticides. Environ. Health Perspect. 106, 1041–1046. Armendariz, C., Perez de Ciriza, J.A., Farre, R., 2004. Gas chromatographic determination of organochlorine pesticides in cow milk. Int. J. Food Sci. Nutr. 55, 215–221. Aube, M., Larochelle, C., Ayotte, P., 2011. Differential effects of a complex organochlorine mixture on the proliferation of breast cancer cell lines. Environ. Res. 111, 337–347. Bae, J., Peters-Golden, M., Loch-Caruso, R., 1999. Stimulation of pregnant rat uterine contraction by the polychlorinated biphenyl (PCB) mixture Aroclor 1242 may be mediated by arachidonic acid release throught activation of phospholipase A2 enzymes. J. Pharmacol. Exp. Ther. 289, 1112–1120. Bae, J., Mousa, M.A., Quensen III, J.F., Boyd, S.A., Loch-Caruso, R., 2001. Stimulation of contraction of pregnant rat uterus in vitro by non-dechlorinated and microbially dechlorinated mixtures of polychlorinated biphenyls. Environ. Health Perspect. 109, 275–282. Botella, B., Crespo, J., Rivas, A., Cerrillo, I., Olea-Serrano, M.F., Olea, N., 2004. Exposure of women to organochlorine pesticides in Southern Spain. Environ. Res. 96, 34–40. Bradford, M.M., 1976. A rapid and sensitive method for the quantification of microgram quantities of protein utilizing the principle of protein-dye binding. Anal. Biochem. 72, 248–254. Casteel, S.W., Satalowich, F.T., Kendall, J.D., Rottinghaus, G.E., Gosser, H.S., Schneider, N.R., 1993. Aldrin intoxication and clearance of associated dieldrin residues in a group of feedlot cattle. J. Am. Vet. Med. Assoc. 202, 83–85. Chillar, N., Singh, N.K., Banerjee, B.D., Bala, K., Mustafa, M., Sharma, D., Chhillar, M., 2013. Organochlorine pesticide levels and risk of Parkinson's disease in north Indian population. ISRN Neurol. 8, 371034. Criswell, K., Loch-Caruso, R., 1999. Lindane-induced inhibition of spontaneous contractions of pregnant rat uterus. Reprod. Toxicol. 13, 481–490. Deti, H., Hymete, A., Bekhit, A.A., Mohamed, A.M.I., Bekhit, A.D., 2014. Persistent organochlorine pesticides residues in cow and goat milks collected from different regions of Ethiopia. Chemosphere 106, 70–74. Dray, F., Frydman, R., 1976. Primary prostaglandins in amniotic fluid in pregnancy and spontaneous labor. Am. J. Obstet. Gynecol. 126, 13–19. Fields, M.J., Fields, P.A., 1996. Morphological characteristic of the bovine corpus luteum during the estrous cycle and pregnancy. Theriogenology 45, 1295–1325. Freire, C., Koifman, R.J., Sarcinelli, P.N., Simões Rosa, A.C., Clapauch, R., Koifman, S., 2013. Long-term exposure to organochlorine pesticides and thyroid status in adults in a heavily contaminated area in Brazil. Environ. Res. 127, 7–15. Fuchs, A.R., Fuchs, F., Husslein, P., Soloff, M.S., 1984. Oxytocin receptors in the human uterus during pregnancy and parturition. Am. J. Obstet. Gynecol. 150, 734–741. Gerhard, I., Daniel, V., Link, S., Monga, B., Runnebaum, B., 1998. Chlorinated hydrocarbons in women with repeated miscarriages. Environ. Health Perspect. 106, 675–681. Gregoraszczuk, E.L., Milczarek, K., Wójtowicz, A.K., Berg, V., Skaare, J.U., Ropstad, E., 2008. Steroid secretion following exposure of ovarian follicular cells to three different natural mixtures of persistent organic pollutants (POPs). Reprod. Toxicol. 25, 58–66. Hodges, L.C., Bergerson, J.S., Hunter, D.S., Walker, C.L., 2000. Estrogenic effects of organochlorine pesticides on uterine leiomyoma cells in vitro. Toxicol. Sci. 54, 355–364. Jorgenson, J.L., 2001. Aldrin and dieldrin: a review of research on their production, environmental deposition and fate, bioaccumulation, toxicology, and epidemiology in the United States. Environ. Health Perspect. 109, 113–139. Juberg, D.R., Webb, R.C., Loch-Caruso, R., 1991. Characterization of o, p′-DDT-stimulated contraction frequency in rat uterus in vitro. Fundam. Appl. Toxicol. 17, 543–549. Kamarianos, A., Karamanlis, X., Goulas, P., Theodosiadou, E., Smokovitis, A., 2003. The presence of environmental pollutants in follicular fluid of farm animals (cattle, sheep, goats and pigs). Reprod. Toxicol. 17, 185–195. Kim, T.S., Kim, C.Y., Lee, H.K., Kang, I.H., Kim, M.G., Jung, K.K., Kwon, Y.K., Nam, H.S., Hong, S.K., Kim, H.S., Yoon, H.J., Rhee, G.S., 2011. Estrogenic activity of persistent organic pollutants and parabens based on the stably transfected human estrogen receptorα transcriptional activation assay (OECD TG 455). Toxicol. Res. 27, 181–184. Korrick, S.A., Chen, C., Damokosh, A.I., Ni, J., Liu, X., Cho, S., Altshul, L., Ryan, L., Xu, X., 2001. Association of DDT with spontaneous abortion: a case–control study. Ann. Epidemiol. 11, 491–496. Kotwica, J., Skarzynski, D., Miszkiel, G., Melin, P., Okuda, K., 1999. Oxytocin modulates the pulsatile secretion of prostaglandin F2alpha in initiated luteolysis in cattle. Res. Vet. Sci. 66, 1–5. Kotwica, G., Kurowicka, B., Franczak, A., Grzegorzewski, W., Wrobel, M., Mlynarczuk, J., Kotwica, J., 2003. The concentrations of catecholamines and oxytocin receptors in the oviduct and its contractile activity in cows during the estrous cycle. Theriogenology 60, 953–964. Lemaire, G., Mnif, W., Mauvais, P., Balaguer, P., Rahmani, R., 2006. Activation of alpha- and beta-estrogen receptors by persistent pesticides in reporter cell lines. Life Sci. 79, 1160–1169. Letta, B.D., Attah, L.E., 2013. Residue levels of organochlorine pesticides in cattle meat and organs slaughtered in selected towns in West Shoa Zone, Ethiopia. J. Environ. Sci. Health 48, 23–32.

Longnecker, M.P., Klebanoff, M.A., Dunson, D.B., Guo, X., Chen, Z., Zhou, H., Brock, J.W., 2005. Maternal serum level of the DDT metabolite DDE in relation to fetal loss in previous pregnancies. Environ. Res. 97, 127–133. Lye, S.J., Porter, D.G., 1978. Demonstration that progesterone 'blocks' uterine activity in the ewe in vivo by a direct action on the myometrium. J. Reprod. Fertil. 52, 87–94. Majdic, G., 2010. Endocrine disrupting chemicals and domestic animals. Slov. Vet. Res. 47, 5–11. McKinlay, R., Plant, J.A., Bell, J.N.B., Voulvoulis, N., 2008. Endocrine disrupting pesticides: implications for risk assessment. Environ. Int. 34, 168–183. Meyer, H.H.D., Enzenhofer, G., Feck, H., 1989. Improvement of radioimmunoassays for prostaglandins in bovine blood plasma and their application to monitor reproductive functions. Theriogenology 31, 701–720. Mlynarczuk, J., Kotwica, J., 2005. Influence of polychlorinated biphenyls on the secretion of oxytocin from bovine luteal cells and from granulosa cells obtained from the follicles of different size. Pol. J. Vet. Sci. 8, 261–267. Mlynarczuk, J., Kotwica, J., 2006. Influence of polychlorinated biphenyls on LH-stimulated secretion of progestereone and oxytocin from bovine luteal cells. Pol. J. Vet. Sci. 9, 101–108. Mlynarczuk, J.J., Niewiadowska, A., Kotwica, J., 2005. Polychlorinated biphenyls impair FSH-stimulated effect on the secretion of steroids and oxytocin from cultured bosine granulosa cells. Bull. Vet. Inst. Pulawy 49, 411–419. Mlynarczuk, J., Wrobel, M.H., Kotwica, J., 2010. Effect of environmental pollutants on oxytocin synthesis and secretion from corpus luteum and on contractions of uterus from pregnant cows. Toxicol. Appl. Pharmacol. 247, 243–249. Mustafa, M.D., Pathak, R., Tripathi, A.K., Ahmed, R.S., Guleria, K., Banerjee, B.D., 2010. Maternal and cord blood levels of Aldrin and Dieldrin in Delhi population. Environ. Monit. Assess. 171, 633–638. Nakayama, R., Yasuda, K., Okumura, T., Saito, K., 1991. Effect of 17 beta-estradiol on PAF and prostaglandin levels in oophorectomized rat uterus. Biochim. Biophys. Acta 1085, 235–240. Pepe, G.J., Albrecht, E.D., 1995. Actions of placental and fetal adrenal steroid hormones in primate pregnancy. Endocr. Rev. 16, 608–648. Pinto, R.M., Lerner, U., Pontelli, H., Rabow, W., 1967. Effect of estradiol-17-β on oxytocin induced contraction of the three separate layers of human pregnant myometrium. Am. J. Obstet. Gynecol. 97, 881–887. Rekawiecki, R., Kowalik, M.K., Kotwica, J., 2013. Validation of housekeeping genes for studying differential gene expression in the bovine myometrium. Acta Vet. Hung. 61, 505–516. Saxena, M.C., Siddiqui, M.K., Seth, T.D., Krishna Murti, C.R., Bhargava, A.K., Kutty, D., 1981. Organochlorine pesticides in specimens from women undergoing spontaneous abortion, premature of full-term delivery. J. Anal. Toxicol. 5, 6–9. Scippo, M.L., Argiris, C., Van De Weerdt, C., Muller, M., Willemsen, P., Martial, J., MaghuinRogister, G., 2004. Recombinant human estrogen, androgen and progesterone receptors for detection of potential endocrine disruptors. Anal. Bioanal. Chem. 378, 664–669. Senior, J., Marshall, K., Sangha, R., Clayton, J.K., 1993. In vitro characterization of prostanoid receptors on human myometrium at term pregnancy. Br. J. Pharmacol. 108, 501–506. Skarzynski, D.J., Bogacki, M., Kotwica, J., 1997. Changes in ovarian oxytocin secretion as an indicator of corpus luteum response to prostaglandin F(2alpha) treatment in cattle. Theriogenology 48, 733–742. Skarzynski, D.J., Bogacki, M., Kotwica, J., 1999. Involvement of ovarian steroids in basal and oxytocin-stimulated prostaglandin (PG) F2α secretion by the bovine endometrium in vitro. Theriogenology 52, 385–397. Slonina, D., Kowalik, M.K., Subocz, M., Kotwica, J., 2009. The effect of ovarian steroids on oxytocin-stimulated secretion and synthesis of prostaglandins in bovine myometrial cells. Prostaglandins Other Lipid Mediat. 90, 69–75. Stern, A.H., 2014. Hazard identification of the potential for dieldrin carcinogenicity to humans. Environ. Res. 131, 188–214. Stevenson, D.E., Walborg, E.F., North, D.W., Sielken Jr., R.L., Ross, C.E., Wright, A.S., Xu, Y., Kamendulis, L.M., Klaunig, J.E., 1999. Reassessment of human cancer risk of aldrin/ dieldrin. Toxicol. Lett. 109, 123–186. Taylor, P.R., Stelma, J.M., Lawrence, C.E., 1989. The relation of polychlorinated biphenyl to birth weight and gestational age in the offspring of occupationally exposed mothers. Am. J. Epidemiol. 129, 395–406. Thakur, S.J., Prinja, S., Singh, D., Rajwanshi, A., Prasad, R., Parwana, H.K., Kumar, R., 2010. Adverse reproductive and child health outcomes among people living near highly toxic waste water drains in Punjab, India. J. Epidemiol. Community Health 64, 148–154. Tomar, L.R., Agarwal, M.P., Avasthi, R., Tyagi, V., Mustafa, M., Banerjee, B.D., 2013. Serum organochlorine pesticide levels in patients with metabolic syndrome. Indian J. Endocrinol. Metab. 17, 342–344. Tsai, M.L., Webb, R.C., Loch-Caruso, R., 1996. Congener-specific effects of PCBs on contractions of pregnant rat uteri. Reprod. Toxicol. 10, 21–28. Tully, D.B., Cox, V.T., Mumtaz, M.M., Davis, V.L., Chapin, R.E., 2000. Six high-priority organochlorine pesticides, either singly or in combination, are nonestrogenic in transfected HeLa cells. Reprod. Toxicol. 14, 95–102. Van Amelsvoort, L.G.P.M., Slangen, J.J.M., Tsai, S.P., De Jong, G., Kant, I.J., 2009. Cancer mortality in workers exposed to dieldrin and aldrin: over 50 years of follow up. Int. Arch. Occup. Environ. Health 82, 217–225. Venners, S.A., Korrick, S., Xu, X., Chen, C., Guang, W., Huang, A., Altshul, L., Perry, M., Fu, L., Wang, X., 2005. Preconception serum DDT and pregnancy loss: a prospective study using a biomarker of pregnancy. Am. J. Epidemiol. 162, 709–716. Waliszewski, S.M., Villalobos-Pietrini, R., Gomez-Arroyo, S., Infanzon, R.M., 2003. Persistent organochlorine pesticide levels in cow's milk samples from tropical regions of Mexico. Food Addit. Contam. 20, 270–275.

M.H. Wrobel et al. / Toxicology and Applied Pharmacology 285 (2015) 23–31 Wang, C.T., Loch-Caruso, R., 2002. Phospholipase-mediated inhibition of spontaneous oscillatory uterine contractions by lindane in vitro. Toxicol. Appl. Pharmacol. 182, 136–147. Welsh, T., Johnson, M., Yi, L., Tan, H., Rahman, R., Merlino, A., Zakar, T., Mesiano, S., 2012. Estrogen receptor (ER) expression and function in the pregnant human myometrium: estradiol via ERα activates ERK1/2 signaling in term myometrium. J. Endocrinol. 212, 227–238. WHO, 1989. Aldrin and dieldrin. Environ. Health Crit. 91, 1–335. Wood, C.E., 1999. Control of parturition in ruminants. J. Reprod. Fertil. 54, 115–126. Wrobel, M., Kotwica, J., 2005. Effect of polychlorinated biphenyls (PCBs) on basal and OTstimulated calcium concentrations in myometrial cells in cows. Reprod. Biol. 5, 321–330. Wrobel, M., Kaminski, K., Kotwica, J., 2005. In vitro effects of polychlorinated biphenyls (PCBs) on the contractility of bovine myometrium from the periovulatory stage of the estrous cycle. Reprod. Biol. 5, 303–319. Wrobel, M., Mlynarczuk, J., Kotwica, J., 2009a. The adverse effect of dichlorodiphenyltrichloroethane (DDT) and its metabolite (DDE) on the secretion of prostaglandins

31

and oxytocin in bovine cultured ovarian and endometrial cells. Reprod. Toxicol. 27, 72–78. Wrobel, M.H., Rekawiecki, R., Kotwica, J., 2009b. Involvement of prostaglandin F2α in the adverse effect of PCB 77 on the force of contractions of bovine myometrium. Toxicology 262, 224–229. Wrobel, M.H., Mlynarczuk, J., Kotwica, J., 2012. The effect of DDT and its metabolite (DDE) on prostaglandin secretion from epithelial cells and on contractions of the smooth muscle of the bovine oviduct in vitro. Toxicol. Appl. Pharm. 259, 152–159. Wrobel, M.H., Bedziechowski, P., Mlynarczuk, J., Kotwica, J., 2014. Impairment of uterine smooth muscle contractions and prostaglandin secretion from cattle myometrium and corpus luteum in vitro is influenced by DDT, DDE and HCH. Environ. Res. 132, 54–61. Zhao, S., Fernald, R., 2005. Comprehensive algorithm for quantitative real-time polymerase chain reaction. J. Comput. Biol. 12, 1045–1062.