ARCHIVES
OF BIOCHEMISTRY
AND
BIOPHYSICS
Vol. 297, No. 1, August 15, pp. 42-45, 1992
The Amino Acid Sequence of Nucleoside Diphosphate Kinase I from Spinach Leaves, as Deduced from the cDNA Sequence Toshiko Nomura, Kimio Yatsunami, Akiko Honda, Yukihiko Jianing Zhang, Jun Yamamoto, and Atsushi Ichikawal Department
of Physiological
Received February
Chemistry, Faculty of Pharmaceutical
Sugimoto, Tetsuya Fukui,
Sciences, Kyoto University,
Sakyo-ku, Kyoto 606, Japan
10, 1992, and in revised form March 30, 1992
The primary structure of nucleoside diphosphate (NDP) kinase from spinach leaves has been deduced from its cDNA sequence. A Xgtl 1 cDNA library derived from spinach leaves was screened using an antibody against NDP kinase I, which we previously purified to electrophoretic homogeneity (T. Nomura, T. Fukui, and A. Ichikawa, 1991, Biochim. Biophys. Acta 1077,47-55). The cDNA sequences of positive clones contained the amino acid coding region (444 base pairs) for NDP kinase I as well as 5’ and 3’ noncoding regions of 33 and 361 base pairs, respectively. The cDNAs hybridized to a l.l-kb mRNA. NDP kinase I contains 148 amino acid residues with a molecular mass of 16,305, which is in excellent agreement with that of the purified enzyme (16 kDa). Homology was found between the sequence of spinach NDP kinase I and those of the rat, lMy~ococc~s xanthus, and Dictyostelium discoideum NDP kinases, as well as the human Nm23-gene product and the awd protein of 0 1992 Academic PRESS, I~C. Drosophila TTW~anOgaStW.
Nucleoside diphosphate (NDP)’ kinase (EC 2.7.4.6.) catalyzes the transfer of the terminal phosphate group of 5’-triphosphate nucleotides to 5’-diphosphate nucleotides, which can be generalized as follows: NiTP + N2DP = NIDP + NzTP (1). NDP kinase has been found, and characterized, in many tissues of animals, plants, and microorganisms (2-7), and the cDNA sequences have been discoidetermined for the enzymes from Dictyostelium deum (8), Myxococcus xanthus (9), and rat liver (10). Recently, NDP kinase has been demonstrated to exhibit i To whom correspondence should be addressed. * Abbreviations; NDP, nucleoside diphosphate; SDS, sodium dodecyl sulfate; PAGE, polyacrylamide gel electrophoresis; kb, kilobase( bp, base pair(s); ARF, ADP ribosylation factor.
striking homology to the Nm23 and awd proteins (ll), which are believed to be involved in mammalian tumor metastasis and the development of Drosophila melunogaster, respectively. Thus, much attention has been focused on a possible new function(s) of NDP kinases, in addition to their role in the synthesis of nucleoside triphosphates. Most recently, it has been shown that the purified bovine liver NDP kinase, recombinant human NDP kinase, or mouse Nm23 protein converts GDPbound ADP ribosylation factor (ARF) to GTP-bound ARF in the absence of nucleotide exchange (12), suggesting that NDP kinases may have regulatory functions such as the activation of GTP-binding proteins. Recently, we purified two types of spinach NDP kinases, with molecular masses of 16 kDa (NDP kinase I) and 18 kDa (NDP kinase II), to electrophoretic homogeneity (13). The discovery of the existence of NDP kinases in a higher plant, spinach, raises the question of whether the spinach NDP kinases have a certain regulatory function(s) in cells. Answering this question will facilitate understanding of the functions of NDP kinases in mammals, plants, etc. In order to clarify this issue, information on the primary structures of the spinach NDP kinases and comparison of them with those of other NDP kinases are indispensable. As a first step, we raised a polyclonal antibody against NDP kinase I and used it as a hybridization probe to isolate cDNA clones for this protein from a spinach cDNA library. We now report the complete amino acid sequence of spinach NDP kinase I, as deduced from its nucleotide sequence. METHODS Preparation of a polyclonal antibody against NDP kinase I. NDP kinases I and II were purified from spinach leaves (Spinucia oleracea) as previously reported (13). The proteins were homogeneous, as judged on SDS/PAGE. Approximately 100 pg of the purified NDP kinase I with an equal volume of complete Freund’s adjuvant was injected into
42 All
Copyright 0 1992 rights of reproduction
0003-9861/92 $5.06 by Academic Press, Inc. in any form reserved.
NUCLEOSIDE
02
0 I
A
DIPHOSPHATE
I
Hi&i III -1
L
w
f=-
KINASE
I FROM
0.4
SPINACH
0.6
I Hcd I Hint II Bb I
I A&I
0.6
‘-O Kb
I
&RI I I I
m
I
w I 1 -33 1
I 444
I mbp
CTTTTTGCACAGATTATCAAAGCAATTTCGAAA
B
43
LEAVES
-1
ATGGAGCAAACTTTCATCATGATCAAGCCCGATGGTGTCCA~GGGGACTGGTTGGTGAGATTATCTCCAGATTT 7s MEQTFIMIKPDGVQRGLVGEIISRF 25 GAGAAGAAGGGTTTCTCATTGAAAGCTTTGAAATTTGTGAATGTGGACCGCCCTTTTGCTGAGAAGCACTACGCT 150 EKKGFSLKALKFVNVDRPFAEKHYA 50 GACTTGTCTGCAAAGCCCTTCTTCAACGGTTTGGTTGAGTACATTGTTTCTGGACCCGTTGTTGCTATGGTCTGG 225 DLSAKPFFNGLVEYIVSGPVVAMVW 75 300 GAGGGTAAGGGAGTTGTTGCTACCGGAAGGAAGCTCATTGGAGCCACCAACCCTCTTGCTTCAGAGCCAGGAACC EGKGVVATGRKLIGATNPLASEPGT 100 375 ATCCGTGGTGATTTCGCCATCGACATTGGCAGAAATGTCATCCATGGCAGTGATGCTGTTGACAGTGCAACAAAG 125 IRGDFAIDIGRNVIHGSDAVDSATK 450 GAGATTGCTCTGTGGTTCCCTGATGGAGTTGTCCACTGGCAAAGCAGCCTACACTCATGGATCTATGAATAGATC 146 I YE. EIALWFPDGVVHWQSSLHSW 525 TTTACCTGCTTGAAATATTTTACTTGCCAAGCCTCTGTAACTCAACTAGCTAAGAGTTGGTATCATCCTTAAGAA 600 ACATGTTTGGCAAAGTAGAACTTATTTTCGCGTTGGTTAAAACTTAGTAGACAGCACTTTTGTTTGCGGAATTCT 675 GTTTACTGTTGTTGCCTTGGTGAGTTTTGCAGGAGAGTTTTGATGACTAGTATTTATAGTAGTTGAATGAAATTT 750 ATGGTTGTTGGTGCGGCCTATTATCCTTAAAGCGAAGTAATCTTAAATGGATGCCATTGTAGTGTTCTGTTTTTA AAATTGGGTTTTATATTATTCTCCTTCGTAAATCGATACTGATATAAAAAAAAAAAAA
608
FIG. 1. Sequence analysis of spinach NDP kinase I. (A) Restriction maps of four cDNA clones. The clones Xsp2,-3, and -4 were isolated using the clone Xspl as a hybridization probe as described under Results. In order to avoid a cloning artifact, DNA sequences of the four overlapping clones at both strands have been determined. The amino acid coding region is shown as a closed bar. (B) Sequences of cDNA and amino acids of spinach NDP kinase I. The nucleotide sequence was determined by the dideoxynucleotide chain-termination method of Sanger et al. (23).
rabbits. Antisera were prepared from whole blood collected after the third booster injection. Preparation of mRNA. Spinach leaves were freshly harvested from plants cultivated in a field. Twenty-five grams of the leaves was frozen in liquid nitrogen and then ground with a pestle and mortar. Total RNA was extracted by homogenization with 50 ml of 50 mM Tris-HCl, pH 8.0, and an equal volume of 90% (v/v) phenol in a Waring blender for 3 min, at maximum speed. Subsequently, 1 ml of 10% Sarcosyl was added to the homogenate, followed by vigorous shaking for another 1 min. The aqueous phase was collected after centrifugation of the homogenate at 15OOgfor 10 min and extracted again with an equal volume of phenol. RNA was precipitated by the addition of 2 vol of ethanol, followed by incubation at -20°C for 1 h. Poly(A)+ RNA was separated from the total RNA by oligo(dT)-cellulose column chromatography (14). Construction of a cDNA library. Double-stranded cDNA was prepared from total poly(A)’ RNA according to Gubler and Hoffman (15), and size-fractionated cDNAs (~500 bp) were inserted into the EcoRI site of Xgtll. Antibody screening of a cDNA library. The spinach cDNA library was screened using the anti-NDP kinase I antibody as a probe, according to the procedure of Young and Davis (16).
RESULTS
The spinach cDNA library constructed in the Xgtll phage was screened with a polyclonal antibody against
the NDP kinase I purified from spinach leaves (13). On screening 660,000 recombinants, one immunologically positive clone (Xspl) was obtained. This clone was ultimately proved to contain the entire coding sequence for the spinach NDP kinase I. To clone a longer cDNA sequence, the cDNA library was screened with the 5’-terminal fragment (621 bp) of the EcoRI digest of cDNA clone Xspl as a probe and hybridization-positive clones were obtained. Figure 1 schematically shows comparison of the sequences present in the different clones and the complete amino acid sequence of the spinach NDP kinase I deduced from its nucleotide sequence. The latter sequence was determined by the dideoxy chain termination method. The open reading frame starts from an ATG codon (nucleotides l-3) and ends with a TGA codon (nucleotides 471-473). There are stretches of 33 and 361 nucleotides in the 5’ and 3’ noncoding regions, respectively. DNA sequence analysis also showed the occurrence of an internal EcoRI site at nucleotide position 621 of cDNA clone Xspl. In order to determine the size of the spinach NDP kinase I, Northern blot analysis was carried out. Total
44
NOMURA
25S---, 16S---,
-1.1
Kb
5.6S-
FIG. 2. Sizing of the mRNA for spinach NDP kinase I. Total spinach RNA (10 rg) was denatured by treatment with glyoxal and then separated on a 1.5% agarose gel.
spinach RNA was treated with glyoxal and then subjected to electrophoresis on a 1.5% agarose gel. After transfer to a nylon membrane, the mRNA was hybridized to the labeled 5’-terminal fragment (621 bp) of the EcoRI digest of cDNA clone Xspl. As shown in Fig. 2, the size of the mRNA encoding the amino acid sequence of the spinach NDP kinase I was estimated to be about 1.1 kb, through a comparison of its mobility with those of marker RNAs. DISCUSSION
By using a polyclonal antibody preparation raised against purified spinach NDP kinase I (13), we have iso-
SNDP
lated a cDNA clone for the enzyme and deduced from it the complete amino acid sequence of this protein. The cDNA-derived amino acid sequence of the enzyme comprises 148 amino acids. Although an attempt at determining the N-terminal amino acid sequence of the purified NDP kinase I was unsuccessful, the ATG codon at nucleotides l-3 in the translation frame was tentatively concluded to be the initiator codon. The presence of adenine at position -3 is consistent with the consensus sequence at the initiation site (17) in eukaryotic messengers. In addition, that the calculated molecular mass, 16,305, for the enzyme is in good agreement with that of the purified NDP kinase I (16 kDa) (13) supports the assignment we made. We cannot rule out the possibility that the ATG codon at nucleotides l-3 is not the initiator codon but an internal ATG codon. However, this is highly unlikely because no in-frame ATG codon was found in the 33 nucleotides upstream from the putative initiator codon, which could specify another 11 amino acid residues at the N-terminal end. A search of the GenBank DNA sequence data base showed that the spinach NDP kinase I was highly homologous with the NDP kinases from rat liver (10) and D. discoideum (8); the homologies (identities) with the amino acid sequence of spinach NDP kinase I being 62.8 and X&8%, respectively (Fig. 3). When similar amino acids are considered (I = L, V; F = Y, W; K = R, H; D = E), the homologies (similarities) were 70.3 and 70.9%, re-
(l-32)
tNDP
(1-W
dNJP lwtm+ll
(l-39) W35)
d Awl
(1-W
SNDP
(33-71)
INDP
W74)
RASEE
bDP
W-78)
VPTKD
tNla+il dAwd
(36-74) (37-75)
sN)P tNDP
(75113)
K/A
L K F]V
NVDRP
QASED VALKFT
WASKE
(72-l 10)
bDP
m-117)
lw@3+ll dAwd
(75113) (76-l 14)
SNW
(111-148)
tNDP
(114152)
drmP
(iiai55)
mm+ll
(114-152) (115153)
dAwd
ET AL.
FIG. 3. Homology between the amino acid sequences of spinach NDP kinase I and other related proteins. Boxes indicate residues identical to those in the amino acid sequence of spinach NDP kinase I. sNDP, spinach NDP kinase I; rNDP, rat NDP kinase; dNDP, Dictyostelium discoideum NDP kinase; hNm23-Hl, human Nm23-Hl; dAwd, Drosophila melanogoster Awd.
NUCLEOSIDE
DIPHOSPHATE
KINASE
spectively. The homology in the primary structure between the spinach NDP kinase I and other kinases provides insight into the sites of ATP binding and catalytic activity. The amino acid residues, Ilen4-His-Gly-SerAsp”‘, in the present sequence are completely identical to those in other NDP kinases (Fig. 3). The histidine residue corresponding to His”’ in spinach NDP kinase I has recently been identified as an ATP-binding site in the NDP kinase purified from human erythrocytes (18). In addition, it has been shown that the consensus sequence, Gly-X-Gly-X-X-Gly, is present in various nucleotide binding proteins as well as protein kinases (19). Therefore, the amino acid sequence, Gly16-Leu-Val-Gly1g or Gly’2-Val-Gln-Arg-G1y-Leu-Val-Gly’g, in the present sequence seems to be the ATP-binding region. On the other hand, residues Ala34-Leu-Lys36 probably play an important role in the catalytic activity of NDP kinase I. Lysine at this position was reported to be directly involved in the phosphotransfer reaction, possibly mediating proton transfer (20). Residues Asplo4-Phelo5 might also be crucial for the catalytic activity, because aspartic acid at this position is highly conserved in various kinases and is proposed to interact with the phosphate groups of ATP through Mg2+ salt bridges (21). In addition, the crosslinking between Aspls4 and Lys7’ in porcine CAMP-dependent protein kinase, which correspond to Asplo and LYS~~ in the present amino acid sequence, respectively, was shown to cause irreversible inhibition of the kinase activity (22), suggesting that these two residues are located close to one another and play essential roles in catalysis. The spinach NDP kinase I also exhibits striking homology with the human Nm23 protein (63.5% identity and 68.9% similarity) and the Awd protein from D. melanogaster (66.9% identity and 72.3% similarity) (11). In addition to the sequence homology, these three proteins exhibit structural similarities in their mRNA sizes (OS 1.1 kb) and protein molecular masses (16-18 kDa). The Nm23 and Awd proteins, which exhibit 78% identity, were proposed to contribute to the normal development of tissue, including cell division, cell-to-cell communication, and signal transduction (11). Therefore, the spinach NDP kinase I could conceivably function in regulation of the development of spinach. Recently, it was reported that the rat NDP kinase can transfer the y-phosphate of ATP directly to GDP bound to ARF, resulting in activation of
I FROM
SPINACH
LEAVES
45
Gs, a stimulatory GTP-binding protein (12). It is thus possible that spinach NDP kinase I can serve as an activator of the GTP-binding protein in cells whose function is unknown. Further studies are required to solve this problem. REFERENCES 1. Parks, R. E., Jr., and Agarwal, R. P. (1973) in The Enzymes (Boyer, P. D., Ed.), Vol. 8, pp. 307-331, Academic Press, New York. 2. Pedersen, P. L. (1968) J. Biol. Chem. 234, 4305-4311. 3 Robinson, J. B., Jr., Brems, D. N., and Stellwagen, E. (1981) J. Biol. Chem. 256, 10,769-10,773. 4. Nikerson, J. A., and Wells, W. W. (1984) J. Btil. Chem. 259,11,29711,304. 5. Kimura, N., and Shimada, N. (1988) J. Biol. Chem. 263, 46474653. 6. Palmieri, R., Yue, R. H., Jacob, H. K., Maland, L., Wu, L., and Kuby, S. A. (1973) J. Biol. Chem. 248, 4486-4499. 7. Sedmak, J., and Ramaley, R. (1971) J. Biol. Chem. 246,5365-5372. 8. Lacombe, M.-L., Wallet, V., Troll, H., and Veron, M. (1990) J. Biol. Chem. 265, 10,012-10,018. 9. Munoz-Dorado, J., Inouye, M., and Inouye, S. (1990) J. Biol. Chem. 265, 2702-2706. 10. Kimura, N., Shimada, N., Nomura, K., and Watanabe, K. (1990) J. Biol. Chem. 265, 15,744-15,749. 11. Wallet, V., Mutzel, R., Troll, H., and Veron, M. (1990) J. Natl. Cancer Inst. 82, 1199-1202. 12. Randazzo, P. A., Northup, J. K., and Kahn, R. A. (1991) Science 254,850-853. 13. Nomura, T., Fukui, T., and Ichikawa, A. (1991) Biochim. Biophys. Acta 1077, 47-55. 14. Aviv, H., and Leder, P. (1972) Proc. N&l. Acad. Sci. USA 69,14081412. 15. Gubler, U., and Hoffman, B. J. (1983) Gene 25, 263-269. 16. Young, R. A., and Davis, R. W. (1983) Proc. Natl. Acad. Sci. USA 80,1194-1198. 17. Kozak, M. (1984) Nucleic Acids Res. 12, 857-872. 18. Gilles, A.-M., Presecan, E., Vonica, A., and Lascu, I. (1991) J. Biol. Chem. 266,8784-8789. 19. Hanks, S. K., Quinn, A. M., and Hunter, T. (1988) Science 241, 42-52. 20. Kamps, M. P., and Sefton, B. M. (1986) Mol. CellBiol. 6, 751-752. 21. Buechler, J. A., and Taylor, S. S. (1988) Biochemistry 27, 73567361. 22. Buechler, J. A., and Taylor, S. S. (1989) Biochemistry 28, 20652070. 23. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467.
OF BIOCHEMISTRY
AND
BIOPHYSICS
Vol. 297, No. 1, August 15, pp. 42-45, 1992
The Amino Acid Sequence of Nucleoside Diphosphate Kinase I from Spinach Leaves, as Deduced from the cDNA Sequence Toshiko Nomura, Kimio Yatsunami, Akiko Honda, Yukihiko Jianing Zhang, Jun Yamamoto, and Atsushi Ichikawal Department
of Physiological
Received February
Chemistry, Faculty of Pharmaceutical
Sugimoto, Tetsuya Fukui,
Sciences, Kyoto University,
Sakyo-ku, Kyoto 606, Japan
10, 1992, and in revised form March 30, 1992
The primary structure of nucleoside diphosphate (NDP) kinase from spinach leaves has been deduced from its cDNA sequence. A Xgtl 1 cDNA library derived from spinach leaves was screened using an antibody against NDP kinase I, which we previously purified to electrophoretic homogeneity (T. Nomura, T. Fukui, and A. Ichikawa, 1991, Biochim. Biophys. Acta 1077,47-55). The cDNA sequences of positive clones contained the amino acid coding region (444 base pairs) for NDP kinase I as well as 5’ and 3’ noncoding regions of 33 and 361 base pairs, respectively. The cDNAs hybridized to a l.l-kb mRNA. NDP kinase I contains 148 amino acid residues with a molecular mass of 16,305, which is in excellent agreement with that of the purified enzyme (16 kDa). Homology was found between the sequence of spinach NDP kinase I and those of the rat, lMy~ococc~s xanthus, and Dictyostelium discoideum NDP kinases, as well as the human Nm23-gene product and the awd protein of 0 1992 Academic PRESS, I~C. Drosophila TTW~anOgaStW.
Nucleoside diphosphate (NDP)’ kinase (EC 2.7.4.6.) catalyzes the transfer of the terminal phosphate group of 5’-triphosphate nucleotides to 5’-diphosphate nucleotides, which can be generalized as follows: NiTP + N2DP = NIDP + NzTP (1). NDP kinase has been found, and characterized, in many tissues of animals, plants, and microorganisms (2-7), and the cDNA sequences have been discoidetermined for the enzymes from Dictyostelium deum (8), Myxococcus xanthus (9), and rat liver (10). Recently, NDP kinase has been demonstrated to exhibit i To whom correspondence should be addressed. * Abbreviations; NDP, nucleoside diphosphate; SDS, sodium dodecyl sulfate; PAGE, polyacrylamide gel electrophoresis; kb, kilobase( bp, base pair(s); ARF, ADP ribosylation factor.
striking homology to the Nm23 and awd proteins (ll), which are believed to be involved in mammalian tumor metastasis and the development of Drosophila melunogaster, respectively. Thus, much attention has been focused on a possible new function(s) of NDP kinases, in addition to their role in the synthesis of nucleoside triphosphates. Most recently, it has been shown that the purified bovine liver NDP kinase, recombinant human NDP kinase, or mouse Nm23 protein converts GDPbound ADP ribosylation factor (ARF) to GTP-bound ARF in the absence of nucleotide exchange (12), suggesting that NDP kinases may have regulatory functions such as the activation of GTP-binding proteins. Recently, we purified two types of spinach NDP kinases, with molecular masses of 16 kDa (NDP kinase I) and 18 kDa (NDP kinase II), to electrophoretic homogeneity (13). The discovery of the existence of NDP kinases in a higher plant, spinach, raises the question of whether the spinach NDP kinases have a certain regulatory function(s) in cells. Answering this question will facilitate understanding of the functions of NDP kinases in mammals, plants, etc. In order to clarify this issue, information on the primary structures of the spinach NDP kinases and comparison of them with those of other NDP kinases are indispensable. As a first step, we raised a polyclonal antibody against NDP kinase I and used it as a hybridization probe to isolate cDNA clones for this protein from a spinach cDNA library. We now report the complete amino acid sequence of spinach NDP kinase I, as deduced from its nucleotide sequence. METHODS Preparation of a polyclonal antibody against NDP kinase I. NDP kinases I and II were purified from spinach leaves (Spinucia oleracea) as previously reported (13). The proteins were homogeneous, as judged on SDS/PAGE. Approximately 100 pg of the purified NDP kinase I with an equal volume of complete Freund’s adjuvant was injected into
42 All
Copyright 0 1992 rights of reproduction
0003-9861/92 $5.06 by Academic Press, Inc. in any form reserved.
NUCLEOSIDE
02
0 I
A
DIPHOSPHATE
I
Hi&i III -1
L
w
f=-
KINASE
I FROM
0.4
SPINACH
0.6
I Hcd I Hint II Bb I
I A&I
0.6
‘-O Kb
I
&RI I I I
m
I
w I 1 -33 1
I 444
I mbp
CTTTTTGCACAGATTATCAAAGCAATTTCGAAA
B
43
LEAVES
-1
ATGGAGCAAACTTTCATCATGATCAAGCCCGATGGTGTCCA~GGGGACTGGTTGGTGAGATTATCTCCAGATTT 7s MEQTFIMIKPDGVQRGLVGEIISRF 25 GAGAAGAAGGGTTTCTCATTGAAAGCTTTGAAATTTGTGAATGTGGACCGCCCTTTTGCTGAGAAGCACTACGCT 150 EKKGFSLKALKFVNVDRPFAEKHYA 50 GACTTGTCTGCAAAGCCCTTCTTCAACGGTTTGGTTGAGTACATTGTTTCTGGACCCGTTGTTGCTATGGTCTGG 225 DLSAKPFFNGLVEYIVSGPVVAMVW 75 300 GAGGGTAAGGGAGTTGTTGCTACCGGAAGGAAGCTCATTGGAGCCACCAACCCTCTTGCTTCAGAGCCAGGAACC EGKGVVATGRKLIGATNPLASEPGT 100 375 ATCCGTGGTGATTTCGCCATCGACATTGGCAGAAATGTCATCCATGGCAGTGATGCTGTTGACAGTGCAACAAAG 125 IRGDFAIDIGRNVIHGSDAVDSATK 450 GAGATTGCTCTGTGGTTCCCTGATGGAGTTGTCCACTGGCAAAGCAGCCTACACTCATGGATCTATGAATAGATC 146 I YE. EIALWFPDGVVHWQSSLHSW 525 TTTACCTGCTTGAAATATTTTACTTGCCAAGCCTCTGTAACTCAACTAGCTAAGAGTTGGTATCATCCTTAAGAA 600 ACATGTTTGGCAAAGTAGAACTTATTTTCGCGTTGGTTAAAACTTAGTAGACAGCACTTTTGTTTGCGGAATTCT 675 GTTTACTGTTGTTGCCTTGGTGAGTTTTGCAGGAGAGTTTTGATGACTAGTATTTATAGTAGTTGAATGAAATTT 750 ATGGTTGTTGGTGCGGCCTATTATCCTTAAAGCGAAGTAATCTTAAATGGATGCCATTGTAGTGTTCTGTTTTTA AAATTGGGTTTTATATTATTCTCCTTCGTAAATCGATACTGATATAAAAAAAAAAAAA
608
FIG. 1. Sequence analysis of spinach NDP kinase I. (A) Restriction maps of four cDNA clones. The clones Xsp2,-3, and -4 were isolated using the clone Xspl as a hybridization probe as described under Results. In order to avoid a cloning artifact, DNA sequences of the four overlapping clones at both strands have been determined. The amino acid coding region is shown as a closed bar. (B) Sequences of cDNA and amino acids of spinach NDP kinase I. The nucleotide sequence was determined by the dideoxynucleotide chain-termination method of Sanger et al. (23).
rabbits. Antisera were prepared from whole blood collected after the third booster injection. Preparation of mRNA. Spinach leaves were freshly harvested from plants cultivated in a field. Twenty-five grams of the leaves was frozen in liquid nitrogen and then ground with a pestle and mortar. Total RNA was extracted by homogenization with 50 ml of 50 mM Tris-HCl, pH 8.0, and an equal volume of 90% (v/v) phenol in a Waring blender for 3 min, at maximum speed. Subsequently, 1 ml of 10% Sarcosyl was added to the homogenate, followed by vigorous shaking for another 1 min. The aqueous phase was collected after centrifugation of the homogenate at 15OOgfor 10 min and extracted again with an equal volume of phenol. RNA was precipitated by the addition of 2 vol of ethanol, followed by incubation at -20°C for 1 h. Poly(A)+ RNA was separated from the total RNA by oligo(dT)-cellulose column chromatography (14). Construction of a cDNA library. Double-stranded cDNA was prepared from total poly(A)’ RNA according to Gubler and Hoffman (15), and size-fractionated cDNAs (~500 bp) were inserted into the EcoRI site of Xgtll. Antibody screening of a cDNA library. The spinach cDNA library was screened using the anti-NDP kinase I antibody as a probe, according to the procedure of Young and Davis (16).
RESULTS
The spinach cDNA library constructed in the Xgtll phage was screened with a polyclonal antibody against
the NDP kinase I purified from spinach leaves (13). On screening 660,000 recombinants, one immunologically positive clone (Xspl) was obtained. This clone was ultimately proved to contain the entire coding sequence for the spinach NDP kinase I. To clone a longer cDNA sequence, the cDNA library was screened with the 5’-terminal fragment (621 bp) of the EcoRI digest of cDNA clone Xspl as a probe and hybridization-positive clones were obtained. Figure 1 schematically shows comparison of the sequences present in the different clones and the complete amino acid sequence of the spinach NDP kinase I deduced from its nucleotide sequence. The latter sequence was determined by the dideoxy chain termination method. The open reading frame starts from an ATG codon (nucleotides l-3) and ends with a TGA codon (nucleotides 471-473). There are stretches of 33 and 361 nucleotides in the 5’ and 3’ noncoding regions, respectively. DNA sequence analysis also showed the occurrence of an internal EcoRI site at nucleotide position 621 of cDNA clone Xspl. In order to determine the size of the spinach NDP kinase I, Northern blot analysis was carried out. Total
44
NOMURA
25S---, 16S---,
-1.1
Kb
5.6S-
FIG. 2. Sizing of the mRNA for spinach NDP kinase I. Total spinach RNA (10 rg) was denatured by treatment with glyoxal and then separated on a 1.5% agarose gel.
spinach RNA was treated with glyoxal and then subjected to electrophoresis on a 1.5% agarose gel. After transfer to a nylon membrane, the mRNA was hybridized to the labeled 5’-terminal fragment (621 bp) of the EcoRI digest of cDNA clone Xspl. As shown in Fig. 2, the size of the mRNA encoding the amino acid sequence of the spinach NDP kinase I was estimated to be about 1.1 kb, through a comparison of its mobility with those of marker RNAs. DISCUSSION
By using a polyclonal antibody preparation raised against purified spinach NDP kinase I (13), we have iso-
SNDP
lated a cDNA clone for the enzyme and deduced from it the complete amino acid sequence of this protein. The cDNA-derived amino acid sequence of the enzyme comprises 148 amino acids. Although an attempt at determining the N-terminal amino acid sequence of the purified NDP kinase I was unsuccessful, the ATG codon at nucleotides l-3 in the translation frame was tentatively concluded to be the initiator codon. The presence of adenine at position -3 is consistent with the consensus sequence at the initiation site (17) in eukaryotic messengers. In addition, that the calculated molecular mass, 16,305, for the enzyme is in good agreement with that of the purified NDP kinase I (16 kDa) (13) supports the assignment we made. We cannot rule out the possibility that the ATG codon at nucleotides l-3 is not the initiator codon but an internal ATG codon. However, this is highly unlikely because no in-frame ATG codon was found in the 33 nucleotides upstream from the putative initiator codon, which could specify another 11 amino acid residues at the N-terminal end. A search of the GenBank DNA sequence data base showed that the spinach NDP kinase I was highly homologous with the NDP kinases from rat liver (10) and D. discoideum (8); the homologies (identities) with the amino acid sequence of spinach NDP kinase I being 62.8 and X&8%, respectively (Fig. 3). When similar amino acids are considered (I = L, V; F = Y, W; K = R, H; D = E), the homologies (similarities) were 70.3 and 70.9%, re-
(l-32)
tNDP
(1-W
dNJP lwtm+ll
(l-39) W35)
d Awl
(1-W
SNDP
(33-71)
INDP
W74)
RASEE
bDP
W-78)
VPTKD
tNla+il dAwd
(36-74) (37-75)
sN)P tNDP
(75113)
K/A
L K F]V
NVDRP
QASED VALKFT
WASKE
(72-l 10)
bDP
m-117)
lw@3+ll dAwd
(75113) (76-l 14)
SNW
(111-148)
tNDP
(114152)
drmP
(iiai55)
mm+ll
(114-152) (115153)
dAwd
ET AL.
FIG. 3. Homology between the amino acid sequences of spinach NDP kinase I and other related proteins. Boxes indicate residues identical to those in the amino acid sequence of spinach NDP kinase I. sNDP, spinach NDP kinase I; rNDP, rat NDP kinase; dNDP, Dictyostelium discoideum NDP kinase; hNm23-Hl, human Nm23-Hl; dAwd, Drosophila melanogoster Awd.
NUCLEOSIDE
DIPHOSPHATE
KINASE
spectively. The homology in the primary structure between the spinach NDP kinase I and other kinases provides insight into the sites of ATP binding and catalytic activity. The amino acid residues, Ilen4-His-Gly-SerAsp”‘, in the present sequence are completely identical to those in other NDP kinases (Fig. 3). The histidine residue corresponding to His”’ in spinach NDP kinase I has recently been identified as an ATP-binding site in the NDP kinase purified from human erythrocytes (18). In addition, it has been shown that the consensus sequence, Gly-X-Gly-X-X-Gly, is present in various nucleotide binding proteins as well as protein kinases (19). Therefore, the amino acid sequence, Gly16-Leu-Val-Gly1g or Gly’2-Val-Gln-Arg-G1y-Leu-Val-Gly’g, in the present sequence seems to be the ATP-binding region. On the other hand, residues Ala34-Leu-Lys36 probably play an important role in the catalytic activity of NDP kinase I. Lysine at this position was reported to be directly involved in the phosphotransfer reaction, possibly mediating proton transfer (20). Residues Asplo4-Phelo5 might also be crucial for the catalytic activity, because aspartic acid at this position is highly conserved in various kinases and is proposed to interact with the phosphate groups of ATP through Mg2+ salt bridges (21). In addition, the crosslinking between Aspls4 and Lys7’ in porcine CAMP-dependent protein kinase, which correspond to Asplo and LYS~~ in the present amino acid sequence, respectively, was shown to cause irreversible inhibition of the kinase activity (22), suggesting that these two residues are located close to one another and play essential roles in catalysis. The spinach NDP kinase I also exhibits striking homology with the human Nm23 protein (63.5% identity and 68.9% similarity) and the Awd protein from D. melanogaster (66.9% identity and 72.3% similarity) (11). In addition to the sequence homology, these three proteins exhibit structural similarities in their mRNA sizes (OS 1.1 kb) and protein molecular masses (16-18 kDa). The Nm23 and Awd proteins, which exhibit 78% identity, were proposed to contribute to the normal development of tissue, including cell division, cell-to-cell communication, and signal transduction (11). Therefore, the spinach NDP kinase I could conceivably function in regulation of the development of spinach. Recently, it was reported that the rat NDP kinase can transfer the y-phosphate of ATP directly to GDP bound to ARF, resulting in activation of
I FROM
SPINACH
LEAVES
45
Gs, a stimulatory GTP-binding protein (12). It is thus possible that spinach NDP kinase I can serve as an activator of the GTP-binding protein in cells whose function is unknown. Further studies are required to solve this problem. REFERENCES 1. Parks, R. E., Jr., and Agarwal, R. P. (1973) in The Enzymes (Boyer, P. D., Ed.), Vol. 8, pp. 307-331, Academic Press, New York. 2. Pedersen, P. L. (1968) J. Biol. Chem. 234, 4305-4311. 3 Robinson, J. B., Jr., Brems, D. N., and Stellwagen, E. (1981) J. Biol. Chem. 256, 10,769-10,773. 4. Nikerson, J. A., and Wells, W. W. (1984) J. Btil. Chem. 259,11,29711,304. 5. Kimura, N., and Shimada, N. (1988) J. Biol. Chem. 263, 46474653. 6. Palmieri, R., Yue, R. H., Jacob, H. K., Maland, L., Wu, L., and Kuby, S. A. (1973) J. Biol. Chem. 248, 4486-4499. 7. Sedmak, J., and Ramaley, R. (1971) J. Biol. Chem. 246,5365-5372. 8. Lacombe, M.-L., Wallet, V., Troll, H., and Veron, M. (1990) J. Biol. Chem. 265, 10,012-10,018. 9. Munoz-Dorado, J., Inouye, M., and Inouye, S. (1990) J. Biol. Chem. 265, 2702-2706. 10. Kimura, N., Shimada, N., Nomura, K., and Watanabe, K. (1990) J. Biol. Chem. 265, 15,744-15,749. 11. Wallet, V., Mutzel, R., Troll, H., and Veron, M. (1990) J. Natl. Cancer Inst. 82, 1199-1202. 12. Randazzo, P. A., Northup, J. K., and Kahn, R. A. (1991) Science 254,850-853. 13. Nomura, T., Fukui, T., and Ichikawa, A. (1991) Biochim. Biophys. Acta 1077, 47-55. 14. Aviv, H., and Leder, P. (1972) Proc. N&l. Acad. Sci. USA 69,14081412. 15. Gubler, U., and Hoffman, B. J. (1983) Gene 25, 263-269. 16. Young, R. A., and Davis, R. W. (1983) Proc. Natl. Acad. Sci. USA 80,1194-1198. 17. Kozak, M. (1984) Nucleic Acids Res. 12, 857-872. 18. Gilles, A.-M., Presecan, E., Vonica, A., and Lascu, I. (1991) J. Biol. Chem. 266,8784-8789. 19. Hanks, S. K., Quinn, A. M., and Hunter, T. (1988) Science 241, 42-52. 20. Kamps, M. P., and Sefton, B. M. (1986) Mol. CellBiol. 6, 751-752. 21. Buechler, J. A., and Taylor, S. S. (1988) Biochemistry 27, 73567361. 22. Buechler, J. A., and Taylor, S. S. (1989) Biochemistry 28, 20652070. 23. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. USA 74, 5463-5467.
