Eur. J. Biochem. 77, 357-366 (1977)
The Binding Site of Ribosomal Protein S8 on the 16-S Ribosomal RNA from Bacillus stearothermophilus John STANLEY and Jean-Pierre EBEL Institut de Biologie Moleculaire et Cellulaire du Centre National de la Recherche Scientifique, Universite Louis Pasteur, Strasbourg (Received February 19, 1977)
The region of Bacillus stearothermophilus strain NCA 1503 16-S ribosomal RNA protected from ribonuclease digestion by the 30-S ribosomal subunit protein S8 from Bacillus stearothermoplzilus has been established. The nucleotide sequence is compared to the analogous region in Escherichia coli and a possible base-pairing scheme proposed that is consistent with the data of ribonuclease susceptibility
The majority of the primary nucleotide sequence of 36-S rRNA from Escherichia coli has now been established [l] and those regions that are involved in the recognition of the tight-binding 3 0 3 subunit proteins S4, S8, S15 and S20 have been described [2]. Furthermore, from the data obtained concerning the regions of susceptibility of the 16-S rRNA molecule to ribonuclease digestion, both for the isolated RNA and when associated with specific proteins, a certain amount of secondary structure throughout the molecule has been proposed [1,2]. Protein binding experiments using the above tightbinding proteins from E. coli and 1 6 3 rRNA from the thermophilic bacterium Bacillus stearothermophilus have shown that heterologous ribonucleoprotein complexes can be obtained [3] suggesting a certain degree of similarity between the protein recognition sites of these bacteria, even though the nucleotide composition is known to vary considerably [4]. In this paper the region within B. stearothermophilus 16-S rRNA which is protected from ribonuclease digestion by the ribosomal protein S8 from B. stearothermophilus (denoted B-SS), analogous to the E. coli ribosomal protein S8, is established. It is discussed in relation to the nucleotide sequence and basepairing scheme proposed for the binding site of the homologous complex between the E. coli ribosomal protein S8 and E. coli 16-S rRNA with the aim of establishing common structural features.
MATERIALS AND METHODS Preparation of 32P-Lahelled16-S rRNA B. stearothermophilus NCA 1503 was grown and labelled as previously described [ 5 ] , routinely using 50 mCi carrier-free 32P. The cells were harvested by centrifugation, the pellet washed with buffer (0.01 M Tris-HC1 pH 7.5, 0.001 M MgClz, 0.1 M KC1, 0.006 M mercaptoethanol) and then ground with glass beads. The ribosomes were extracted with a small volume of the above buffer, layered directly on to a 10 - 30 % sucrose gradient containing the buffer and spun in an SW 25.1 rotor for 15 h at 25000 rev./min at 2 "C to fractionate the subunits. Peak fractions were pooled and the subunits pelleted by centrifugation. The material was redissolved in a second buffer (0.01 M Tris-HC1 pH 7.5, 0.0001 M MgC12, 0.006 M mercaptoethanol) and extracted with phenol by shaking at 4 "C for 1 h. The aqueous layer was removed and the extraction repeated on it twice more before precipitating the RNA with ethanol. The precipitate was redissolved and pelleted through a 10% sucrose cushion, (SW 50 rotor, 20 h, 2 "C) to remove any residual phenol that would otherwise interfere with the formation of the ribonucleoprotein complex. The RNA was dissolved in water to a concentration of 10 mg/ml and stored frozen.
Preparation of Ribonucleoprotein Complexes Enzymes. T1 RNase (EC 3 1.4.8); pancreatic RNase (EC 3.1. 4.22); alkaline phosphatase (EC 3.1.3.1); U2 RNase (EC 3.1.4.-); venom phosphodiesterase (EC 3.1.4.1).
Usually about 50 pg 1 6 3 rRNA was mixed with a fivefold molar excess of protein in Tris/Mg/K buffer
358
(0.03 M Tris-HC1 pH 7.4, 0.02 M MgC12, 0.35 M KCI, 0.006 M mercaptoethanol) and incubated at 42 "C for 1 h. The mixture was cooled to 0 " C , digested for 30min with either T1 RNase (enzyme : substrate 1 : 10) or pancreatic RNase (enzyme : substrate 1 : 5 ) and the resulting digest fractionated by polyacrylamide gel electrophoresis on an 8 % or 10 "/, polyacrylamide gel [ 2 ] . The ribonucleoprotein complexes obtained were dissociated into their component fragments and repurified by electrophoresis on more concentrated gels [6]. The extent of base-pairing between the subfragments within the ribonucleoprotein complex derived by T1 RNase digestion was investigated using polyacrylamide gels containing both Mg2+ ions and sodium dodecyl sulphate [7]. The nucleotide sequences were established using the conventional two-dimensional electrophoresis technique and standard enzymatic analyses [8,9].
Protein S8 Binding Site on B. .stearothermophilus 16-S RNA ORlOlN
8-58
ORIGIN
01%505
__
-A
-0
RNP FRAGMENl10% -C
-D -E
-F -Q --H
RESULTS AND DISCUSSION
Homologous Complex between B. stearothermophilus 16-S rRNA and B. stearothermophilus Ribosomal Protein B-S8 Fig.1 and 2 show the isolation of the complexes between B. stearothermophilus 16-S rRNA and protein B-S8 and the fractionation of the component subfragments as produced by digestion with T1 and pancreatic RNase respectively. The use of two different enzymes with which to isolate the complex had two effects. Firstly it gave a large number of
- H I ,H2
-0 -P
Heterologous Complex between B. stearothermophilus 16-S r R N A and E. coli Ribosomal Protein S8 The initial approach to the problem was an attempt to isolate a resistant fragment of B. stearothermophilus 16-S rRNA after binding it to the E. coli ribosomal protein S8. Under the conditions used to isolate the complex by polyacrylamide gel electrophoresis, however, the resistant ribonucleoprotein complex was not observed. Because the protein S8 preparation used was shown to produce a stable complex with E. coli 16-S rRNA under identical conditions of fractionation and furthermore that the B. stearothermophilus 16-S rRNA could produce a stable complex with its homologous protein B-S8 (as discussed in this paper), it must be concluded that the heterologous interaction between B. stearothermophilus 16-S rRNA and E. coli protein S8 is less strong than either homologous interaction, and that under the relatively harsh conditions of fractionation by polyacrylamide gel electrophoresis the complex dissociates and is consequently not observed.
~
CONTROL
__ BLUE
+
+
Fig. 1. Isolation ofthe rihonuc,l~,oproteiiicomplex berween protein B-SK and B. stearothermophilus 16-S r R N A on an 8 o'u-magnesium-containing polyacrylumide gel ufter digestion with TI RNase (enzyme : substrate; I : 10). The control is a duplicate incubation with thc sole omission of the protein. The pattern of the constituent subfragments of the ribonucleoprotein complex after dissociation on a composite 10:6/15 y,; polyacrylamide gel containing 8 M urea and 0.1 sodium dodecyl sulphate is shown on the right. The nucleotide sequences of these subfragments, given in Fig.3, have the prefix t. R N P , ribonucleoprotein complex
subfragments, which allowed the unambiguous derivation of the major sequences without the need for partial ribonuclease digestion of the subfragments. Secondly, and more importantly, the technique of binding a specific protein to RNA followed by ribonuclease digestion effectively gives those regions of the molecule that are protected from digestion in one of two ways; (a) directly by the protein and (b) indirectly. The latter effect is a result of either the presence of secondary and tertiary structure within the RNA or merely through the lack of the appropriate nucleotide residue (i.e. G : T1 RNase, or C and U : pancreatic RNase) in an exposed position. Consequently any fragments not derived by both ribonuclease digestions were assumed to be only indirectly associated with the protein. The three series of subfragments common to the ribonucleoprotein complexes produced by both T1
359
J. Stanley and J.-P. Ebel
ORIGIN
858
CONTROL
-
-
A ORIGIN
B
-
O.l%SDS
-A
-B -C
BLUE
+
BLUE
+ Fig. 2. Isolation of two resistent fruzment.v on a I 0 ~-mugne,sium-contuininfipolyncrylumide gel u f t w digestion with puncwatic RNusr (enzyme :substrate; 1 :5 ) . The dissociation pattern of the constituent subfragments of each band, as fractionated on a 15 polyacrylamide gel containing 8 M urea and 0.5 "/, sodium dodecyl sulphate is shown on the right. The nucleotide sequences of these subfragments, given in Fig. 3 , have the prefix p. RNP, ribonucleoprotein complex Fragment B
Fragment A
A UCAUUGGAAACUGGGGGACUUGGGAGCAGGAGGGGAGAGAGCGGAAUUC
AAUUAUUGUAAAGCGGGCGCGCAGGCGGUCUCUUAAGUCUGAUGUG tN tM ft K K3 2
f
L2 tJ2
t12 C H 2
tJ1
pL2
pK2
LG
CF
PJ2
PHI pH2
pi2FH3 PKI
pF3
PMI
pE2
PD
Fragment C
[CG.~ICGGCUCUCUGGCCUGCACCUGACGCUGAGGC
Fig. 3. Nucleotide sequences of the subfiugments fractionated us in Fig.I and 2. The complete digestion of each with T I and pancreatic RNase allows the unambiguous placing of all oligonucleotides within their respective sequences with the exception of the sequence (C-Gp,A-A-Gp,Gp) in fragment C. The sequence in fragment C , in addition to that of the largest subfragment obtained within the ribonucleoprotein complex, (subfragment pE,), was derived from a fragment obtained by the partial digestion of the total 16-S rRNA using T I RNase. The sequences of the underlined oligonucleotides (A-Gp,Gp,)Cp and (A-A-Gp,Gp)Cp in fragment C are unknown. The nucleotide composition of the pancreatic-RNase-derived oligonucleotide at the 5' end of fragment B (shown by a dotted line) is unknown as it remained at the origin of the second dimension of' the fingerprint together with the other long oligonucleotides from the subfragments in question. It must, however, contain at least 5 G p residues, which makes it significantly different from the analogous region seen in E. coli (Fig. 5). The subfragment pD occurs twice within fragment B, both oligonucleotides A-A-U and A-A-U-U-C appearing on the fingerprint, implying a mixture. At the 5' end of fragment B heterogeneity occurs, the T1 -RNase-derived dephosphorylated oligonucleotide Hyphens representing the phosphate linkages U-C-A-U-U-G being replaced by A-C-A-U-U-G with a frequency of approximately 10 between nucleosides have been omitted to save space
'x.
360
Protein SX Binding Site on B. stearothermophih~s16-S RNA
Table 1. Sequence determination of the oligonucleotidesfrom f r a , p e n t s A , B and Cproduced by digestion nith either combined TI RNase and alkaline phosphatase or pancreatic RNase Only the data for those oligonucleotides for which the sequence cannot be directly deduced by either simple analysis using TI or pancreatic RNase (as appropriate) or by the position on the fingerprint are given. The extensive run of purine nucleotides A-G-G-A-G-G-G-G-A-G-A-GA-G-Cp in fragment B was derived from the sequence analysis of subfragments tJz, tIz, tH2 and pL2. The sequences of the pancreatic KNase oligonucleotides A-G-G-Cp (fragment A), G-A-A-A-G-Cp and A-G-G-A-Up (fragment C) were deduced from a knowledge of the TI RNase plus alkaline phosphatase digestion products. Products in bold type indicate that they were found in 2 or more mol/oligonucleotide. Complete modification of the oligonucleotidewith kethoxal was followed by digestion using UZ RNase according to the conditions of Min Jou and Fiers [I31 Oligonucleotide origin
Proposed sequence
Fragment A A-A-U-U-A-U-U-G” U-C-U-C-U-U-A-A-G
Pancreatic RNase products
UZ RNase products
A-A-Up A-Up, 2Up A-A-G, 2Up, 4Cp
U-U-Ap, U-U-G, Ap
Partial venom phosphodiesterase digestion products
T1 RNase products
UZ RNase products after kethoxal modification
A-Gp, 3Gp, Cp
G-G-G-Ap, G-Cp
A-Gp, 2Gp, Cp
G-Ap, G-G-Cp
u-c-u-C-u-u U-C-U-c-u u-C-u-C
u-c-u u-c
U-C-A-U-U-G A-C-A-U-U-G A-A-A-C-U-G A-C-U-U-G A-A-U-U-C G-G-G-A-G-Cp Fragment C C-U-C-U-C-U-G
Fragment B
C-A-C-C-U-G C-A-A-A-C-A-G A-U-U-A-G G-A-G-G-Cp
A-UP, UP, CP A-Up, A-Cp, Up A-A-A-G, Up A-Cp, 2Up A-A-Up, Up
U-C-Ap, U-U-G C-Ap, U-U-G, Ap C-U-G, Ap C-U-U-G, Ap
c-u-c-u-C-U C- u -c-U -C c-u-C-u c-u-C C-U
3UP, 3CP
A-Cp, IJp, 2Cp A-A-A-Cp, A-G, Cp A-Up, A-G. Up
C-Ap, C-C-U-G C-AQ,AP U-U-Ap, Ap
a The sequence of this oligonucleotide was completed from the partial hydrolysis products A-A-U-Up and A-U-U-G frequently observed on the fingerprint. In addition, the tetranucleotide G-A-A-Up was present on the pancreatic RNase fingerprint of subfragment tB, the latter containing all of fragment A together with approximately 80 nucleotides to the 5’ end. The sequence must be derived from the only compatible oligonucleotide within the entire 16-S rRNA, A-A-U-(Up,Cp,Cp)A-C-G (J. Stanley, unpublished results), similar to the analogous oligonucleotide in E. coli, A-A-U-U-C-C-A-G [I].
and pancreatic RNase are shown in Fig.3. The subfragments allow the deduction of the complete sequence of fragments A and B. In the case of fragment C the purine-rich region at the 3‘ end of subfragments pE1 and pG1; Gp(A-Gp,Gp4)Cp has not yet been determined. The extensions to both the 5’ and 3’ ends of the largest subfragment of fragment C, i.e. pE1, were derived from data on the partial T1 RNase digestion of the total 16-S rRNA and are included to increase the extent of the homology between B . stearothermophilus and E. coli RNA in this region. Fingerprints of subfragments tK2, t12 and pE1, representative of fragments A, B and C respectively, are shown in Fig. 4A, B and C and the analyses of the oligonucleotides shown in Fig. 3, in Table 1. Fig.4D shows the fingerprints for the largest subfragment tA, obtained within the ribonucleoprotein
complex derived by TI RNase digestion. This subfragment has been shown to be background contamination of the complex only, as it is also present in the corresponding position within the control. The characteristic oligonucleotides of this fragment were found to have originated not from the 16-S rRNA but the 23-S rRNA and the fragment has since been identified as being the region that is recognised by protein L1 (J. Stanley and P. Sloof, unpublished results). There are two possible mechanisms by which this may have been brought about. Firstly, it may be a simple case of limited breakdown of the 50-S subunit during the extraction procedure and subsequent contamination of the 30-S subunit fraction during the sucrose gradient fractionation step. Secondly, on separation of the subunits a specific fragment of 23-S rRNA, possibly still bound to protein L1, may
Fig. 4. Fingerprints ojsubfrugrnmts o f T 1 undpuncreutic-RNuse-~er~v~d oligonucleotides. (A) Fingerprints of subfragment tKz, from fragment A, derived from digestion using TI RNase and alkaline phosphatase (left) and pancreatic RNase (right). (B) Fingerprints of subfragment t12, from fragment B, derived from digestion using TI RNase and alkaline phosphatase (left) and pancreatic RNase (right). The oligonucleotide A-C-A-U-U-G is derived from U-C-A-U-U-G by a base substitution at the 5’ end. The tetranucleotide A-U-U-G only occurs when the hexanucleotide U-C-A-U-U-G is present (for the subfragments produced by TI RNase), and is thought to be a degradation product. (C) Fingerprints of subfragment pE2, from fragment C, from digestion using TI RNase and alkaline phosphatase (left) and pancreatic RNase (right). (D) Fingerprints of subfragment tA, derived from digestion using T I RNase and alkaline phosphatase (left) and pancreatic RNase (right). Hyphens have been omitted as in Fig. 3
W
z
362
Protein S8 Binding Site on B. stearothermophilus 16-S RNA
Fig.4C
become detached from the 50-S subunit, which again necessitates the presence of hidden breaks within the 23-S rRNA, but remains bound to the 30-S subunit. In theory the correct mechanism may be established by observation of the total 16-S rRNA to find if the contamination is specific or non-specific. In practice, however, since the subunits are isolated in a relatively intact state, the amount of the fragment is low and consequently the characteristic oligonucleotides are masked by the intense spots from the 16-S rRNA. The second theory is consistent with the idea that protein L1 is to be found at the interface of the subunits within the 70-S ribosome [lo] and is required for their association [ll]. The region of E. coli 16-S rRNA protected from digestion with pancreatic RNase has been established as consisting of two short oligonucleotide fragments originating from section C, which are capable of basepairing together to give rise to the lower half of a large looped-out structure within the molecule [l,21. A certain degree of homology exists between these two fragments and fragments A and B of Fig.3.
Fragment C (Fig.3) shows homology, although to a lesser extent than for fragments A and B, with a region of E. coli 16-S rRNA located further towards the 3’ end of the molecule, within regions C4 and Ci (C. Ehresmann and P. Stiegler, personal communication). The extent of the homology is shown in Fig. 5. Fragment A shows 7 base changes within a stretch of 46 nucleotides in addition to an extra C-Gp dinucleotide in the B. stearothermophilus 16-S rRNA, which may be a real deletion within the E. coli 1 6 3 rRNA or a reflection of the difficulties in estimation of the molar yields of the smaller oligonucleotides within large fragments. Fragment B shows less homology with its analogous region of E. coli 16-S rRNA, there being 19 differing nucleotides within a sequence 49 nucleotides in length. Heterogeneity is observed in this region for both E. coli and B . stearothermophilus; in E. coli 16-S rRNA a base deletion occurs with a frequency of approximately 30% within the pentanucleotide A-A-C-U-Gp to give the hexanucleotide A-A-C-C-U-Gp and a second deletion occurs within one of the two neighbouring hexanucleotides,
363
J. Stanley and J.-P. Ebel
Fig. 4 D
C" (G G
--
C
! p
C G,G A A U U A C C S)U A A A G(C G,A G,C G C A C G)! G G U U U U A A A A U U A U U G U A A A G C G G G C G C G C A G G C G G U C U C U U A A 6 Fragment A A A A U C C C C G G G C U C A A C C C U G G G A A C C U ~ C A U F ~ G A ! A C U U C A U U G G A A A C U G
C'I
5
f f(-,G,G,G,A
G,A G,f,G)Y A G A A U U C C A G.....::U G I] f G A G C A G G A G C C G A G A G A G C k G A A U U C I Fragment B
t
----
K'
-
t
G U C G A U G U G G U C U G A U G U G I
G G $ t ~ f C U U G I ] G G G G A C U U G G
Fragment B A G A G A U C U G(A G,G,G)A A U A C
."
---
F C $ C U G)G C U G - A C G A A A G C U $ A G G I] G (C G,A A G,G)C G G C U C U C U G G C C U G C A C C U G A C G C U G A G G C G A A A c Fragment C
C G E U G,G C G ) A A G G(C G,C,C
----
c3
-(C G,U G,A C3,G.G.G)- C A A A C A G G A U U A G G C G U G(A G,G,G,G,G)C A A A C A G G A U U A G G Fragment C
% . .
Fig.5. Comparison of the sequence of the region C"-C-Cr1-K'-C'2-C'3from E. coli 16-S rRNA with those offragments A , B and C f r o m B. stearothermophilus (bottom row of each line). The unknown sequences within parentheses have been arranged to give maximum homology and the dashes represent apparent deletions and insertions. The dots between the sequences indicate those points at which base substitutions have occurred. Hyphens have been omitted as in Fig. 3
364
Protein S8 Binding Site on B. stearothermophilus 1 6 3 RNA
fined to one or two nucleotides only, have already been observed between the 5-S rRNA molecules of these two bacterial species [5].
ORIQIN-
MIIQIN-
lQmM M Y
-
1 2 x
Investigation of Po tent ial Base-Pairing Regions
10mM M Y 10 m M TRlS
I 1-
2-
12% I
15%
12
-
K2 Ll
-
__ BLUE __
+ Fig. 6. Electrophore.\iJ oj the ribonucleoprotein complex us produced in Fig. 1, through a 10 ”/, palyacrylumide gel containing both mugnesium and sodium dodecyl sulphate throughout. The subfragments from band 1 are shown on the right after dissociation on a polyacrylamide gel containing 8 M urea, together with a densitometer tracing of the autoradiograph
C-A-U-C-U-Gp or A-U-A-C-U-Gp, giving rise to the pentanucleotide A-U-C-U-Gp with a frequency of 20-30% [6]; in B. stearothermophilus a base substitution occurs within the hexanucleotide U-C-AU-U-Gp to give A-C-A-U-U-Gp with a frequency of approximately 10 %. Also in fragment B the heptanucleotide G-G-G-G-G-A-Cp is often fractionated into two u n i F e spots on the fingerprint of varying relative amounts, both oligonucleotides giving Gp and A-Cp only on analysis with T1 RNase. The difference between the oligonucleotides is still unknown but may be due to either an insertion of a Gp residue or the modification of an existing residue. The degree of homology between fragment C and the analogous region within E. coli 16-S rRNA is more difficult to assess due to the apparent deletions and insertions within the sequences. In Fig. 5 the sequences are arranged in a manner indicating the shift of the tetranucleotide A-A-A-Gp in E. coli 16-S rRNA 8 nucleotides towards the 3‘ end of the molecule to arrive at the situation found in B. stearothermophilus. In addition, the sequence in B. stearothermophilus has increased in length by 6 nucleotides. Nucleotide insertions and deletions of this kind, although con-
Direct evidence for base-pairing interactions between all three fragments A, B, and C was obtained by subjecting the ribonucleoprotein complex produced by T1 RNase to polyacrylamide gel electrophoresis through a gel containing both 0.01 M magnesium acetate and 0.5 % sodium dodecyl sulphate (Fig. 6). The sodium dodecyl sulphate treatment removes the protein from the complex while retaining any existing base-pairing interactions. As seen in Fig. 6, two bands were obtained using this procedure, the slower moving of the two dissociating in a polyacrylamide gel containing 8 M urea to give three major subfragments, identified by fingerprinting as subfragments tI2, tK2 and tL1, these fragments being the major representatives of fragments B, A and C respectively. Band 2 (Fig.6) dissociated to give a large number of subfragments, indicating that it contained a non-specific mixture of oligonucleotides. These data, in conjunction with the postulated base-pairing interaction between the two fragments in E. coli 16-S rRNA analogous to fragments A and B, have led to the proposal of the base-pairing scheme shown in Fig. 7 a, b and c for the region of B. stearothermophilus 16-S rRNA directly protected from ribonuclease digestion by protein B-S8. The 3‘ end of fragment A is shown to interact with the 5’ end of fragment B (Fig. 7a, region 111) and the nucleotides located within the middle of fragment B, with the 5‘ end of fragment C (Fig. 7a, region IV). Fig.7a, in addition to showing a possible basepairing scheme between the fragments to give the two long helical stems (I11 and IV), and three smaller loops (I, I1 and V), indicates the nucleotides at which the major cuts occur with both T1 and pancreatic RNase. Every point of cleavage, except two at the top of stem 111, is consistent with the structure in that they occur in the non-base-paired regions. The extent of ribonuclease digestion at other points throughout the sequences, as seen in the data of Fig. 3, is relatively small compared with those points shown in Fig.7a and probably reflects the initial breakdown of the secondary structure of the RNA. Fig. 7 b illustrates a second possible base-pairing scheme between the small looped-out structures I1 and V, again consistent with the points of ribonuclease attack. Other structures may be drawn for the sequences located to either side of stems 111 and IV and at present it is not possible to distinguish between them as to which exists within the ribosomal subunit. Other minor nucleotide sequences found within the ribonucleoprotein complexes [for example subfragment tB, containing all of frag-
365
J. Stanley and J.-P. Ebel
d
CuA C A G-C G-C G-C
c u C-G C-G C- G U-A
AA A A Cc G.U U . G-U
U*A- u*;
U-A.G CdJ - A.G U G-A G-C
Fig. I. Proposed base-pairing schemes. (a) A possible base-pairing scheme for fragments A, B and C from B. stearothermophilus. The arrows indicate the major positions at which ribonuclease digestion occurs. (b) An alternativc base-pairing scheme in which the small looped regions I1 and V (a) have been brought together, (c) The regions of fragments A, €3 and C that are most strongly protected by protein B-S8. (d) The suggested base-pairing scheme for region C of E. coli 16-S rRNA that is protected from digestion with pancreatic RNase by E. coli protein S8 [2]. The alternative nucleotides shown are those from the analogous sequences in B. stearothermophilus which differ as set out in Fig. 5
ment A together with approximately 80 of the adjacent nucleotides to the 5' side, and its derivative subfragments tC, tD, tE and tH1 (Fig. l), of which only the partial sequence is known] may well interact directly with the nucleotides within the small loopsI, I1 and V, in addition to the protected regions to the 3' ends of fragments B and C, to which no secondary structure has been assigned. It cannot be ruled out that the small hairpin loops are a result of refolding of the RNA after ribonuclease digestion, thereby bringing other nucleotides into exposed positions to create apparently very susceptible regions within the sequences. Fig. 7d shows the proposed secondary structure model for the region of E. coli 16-S rRNA protected from pancreatic RNase digestion by E. coli protein S8 [2] together with those analogous nucleotides from B. stearothermophilus fragments A and B which differ between the two bacteria (from Fig. 5). It is apparent that in all but one case within the protected region, at those positions where a nucleotide substitution has occurred within a base-paired region, the appropriate nucleotide substitution is to be found on the opposite side of the helix, allowing the overall structure to be maintained. This observation is in itself indirect evidence of the existence of the proposed base-pairing. A comparative study in this manner is not so readily available for helical region IV from B. stearothermophilus and the analogous regions of E. coli
16-S rRNA owing to the greater diversity of the sequences, the deletions and insertions of nucleotides throughout the sequences and the remaining sequences within this region of E. coli 16-S rRNA as yet to be completed, in particular the long run of purine bases in the middle of section C' 1 ; (A-Gpz,Gp~)up. Fig. 7c illustrates the region of B. stearothermophilus 16-S rRNA that is directly protected from ribonuclease digestion by protein B-S8. The sequences enclosed are those that are consistently found in high yields and that are common to the ribonucleoprotein complexes produced by both T1 and pancreatic RNase. The protected region is much larger than that found for the homologous complex in E. coli (Fig. 7 d). This may be explained in terms of differing secondary structures of the RNA (6 nucleotides appear to have been deleted from the sequence in E. coli which is analogous to stem region IV, in addition to the shift of the tetranucleotide A-A-A-Gp; see Fig. 5), variations between the analogous proteins from the two bacteria or a combination of both factors. Concerning the protein, however, the first 15 amino acid residues so far characterised for protein B-S8 differ only by two of these residues when compared with E. coli protein S8 ([12] and L. P. Visentin, personal communication). To investigate this problem further, conditions must be found with which to isolate the heterologous ribonucleoprotein complex ;
366
J. Stanley and J.-P. Ebel: Protein S8 Binding Site on B. stearothermophilus 16-S RNA
B. stearothermophilus 16-S rRNA, E. coli protein S8 (or vice versa) in order to observe the extent of protection. The main inconsistency in the postulated basepairing models in both bacteria is that the upper part of the structure common to both (Fig.7a, region I11 and Fig. 7d) is susceptible to pancreatic RNase digestion actually within the base-paired region. The adjacent nucleotides immediately above this region are not base-paired but form an open structure in E. coli [ 11 and B. stearothermophilus, which perhaps contributes to the accessibility to ribonuclease digestion. The inconsistency of the data with the suggested secondary structure may also be interpreted in terms of an unfolding or loosening of the base-pairing interactions during the recognition and binding of the protein. It is suggested that the helical stem region, common to both bacteria, provides the primary recognition site for the binding of the protein. Such a common structure is essential to explain the ability of the RNA of one bacteria to produce a heterologous complex with a protein from the other [3], given the diversity of the RNA primary sequence. Whether or not the structure is recognised in its entirety or is present merely to maintain one or more of its constituent nucleotides in a specific orientation remains to be evaluated.
We are indebted to K. Isono who kindly provided the ribosomal protein from B. stearothermophilus. This work was financially supported by the Centre National de la Recherche Scientqique, the Dtltgation Gdntrale u la Recherche Scientifique et Technique and the Commissariat a I’Energie Atomique. Financial support was provided by EMBO (to J.S.).
REFERENCES 1. Ehresmann, C., Stiegler, P., Fellner, P. & Ebel, J.-P. (1975) Biochimie (Paris) 57, 711 -149. 2. Ungewickell, E., Garrett, R., Ehresmann, C., Stiegler, P. & Fellner, P. (1975) Eur. J . Biochem. 51, 165-180. 3. Garrett, R., Rak, K. H., Daya, L. & Stoffler, G . (1971) Mol. Gen. Genet. 114, 112- 124. 4. Nomura, M., Traub, P. & Bechmann, H. (1968) Nature (Lond.) 219, 793 - 799. 5. Stanley, J. R. (1974) PhD Thesis, University of East Anglia, Norwich, England. 6. Ehresmann, C., Stiegler, P., Fellner, P. & Ebel, J.-P. (1972) Biocltimie (Paris) 54, 901 -967. 7. Ungewickell, E., Ehresmann, C., Stiegler, P. & Garrett, R. (1975) Nucleic Acid Res. 2, 1867-1888. 8. Sanger, F., Brownlee, G. G . & Barrel], B. G. (1965) J . Mol. Biol. 13, 373 - 398. 9. Brownlee, G. G. & Sanger, F. (1967) J . Mol. Bid. 23,337-353. 10. Morrison, C. A , , Garrett, R. A., Zeichhardt, H. & Stoffler, G. (1973) Mol. Gen. Genet. 127, 359-368. 11. Kazemie, M. (1975) Eur. J . Biochem. 58, 501 -510. 12. Yaguchi, M., Matheson, A. T. & Visentin, L. P. (1974) FEBS Lett. 46,296- 300. 13. Min Jou, W. & Fiers, W. (1976) FEBS Lett. 66, 77-81.
J. Stanley and J.-P. Ebel, Institut de Biologie Moleculaire et Cellulaire du C.N.R.S., 15 Rue Rene-Descartes, Esplanade, F-67084 Strasbourg-Cedex, France
The Binding Site of Ribosomal Protein S8 on the 16-S Ribosomal RNA from Bacillus stearothermophilus John STANLEY and Jean-Pierre EBEL Institut de Biologie Moleculaire et Cellulaire du Centre National de la Recherche Scientifique, Universite Louis Pasteur, Strasbourg (Received February 19, 1977)
The region of Bacillus stearothermophilus strain NCA 1503 16-S ribosomal RNA protected from ribonuclease digestion by the 30-S ribosomal subunit protein S8 from Bacillus stearothermoplzilus has been established. The nucleotide sequence is compared to the analogous region in Escherichia coli and a possible base-pairing scheme proposed that is consistent with the data of ribonuclease susceptibility
The majority of the primary nucleotide sequence of 36-S rRNA from Escherichia coli has now been established [l] and those regions that are involved in the recognition of the tight-binding 3 0 3 subunit proteins S4, S8, S15 and S20 have been described [2]. Furthermore, from the data obtained concerning the regions of susceptibility of the 16-S rRNA molecule to ribonuclease digestion, both for the isolated RNA and when associated with specific proteins, a certain amount of secondary structure throughout the molecule has been proposed [1,2]. Protein binding experiments using the above tightbinding proteins from E. coli and 1 6 3 rRNA from the thermophilic bacterium Bacillus stearothermophilus have shown that heterologous ribonucleoprotein complexes can be obtained [3] suggesting a certain degree of similarity between the protein recognition sites of these bacteria, even though the nucleotide composition is known to vary considerably [4]. In this paper the region within B. stearothermophilus 16-S rRNA which is protected from ribonuclease digestion by the ribosomal protein S8 from B. stearothermophilus (denoted B-SS), analogous to the E. coli ribosomal protein S8, is established. It is discussed in relation to the nucleotide sequence and basepairing scheme proposed for the binding site of the homologous complex between the E. coli ribosomal protein S8 and E. coli 16-S rRNA with the aim of establishing common structural features.
MATERIALS AND METHODS Preparation of 32P-Lahelled16-S rRNA B. stearothermophilus NCA 1503 was grown and labelled as previously described [ 5 ] , routinely using 50 mCi carrier-free 32P. The cells were harvested by centrifugation, the pellet washed with buffer (0.01 M Tris-HC1 pH 7.5, 0.001 M MgClz, 0.1 M KC1, 0.006 M mercaptoethanol) and then ground with glass beads. The ribosomes were extracted with a small volume of the above buffer, layered directly on to a 10 - 30 % sucrose gradient containing the buffer and spun in an SW 25.1 rotor for 15 h at 25000 rev./min at 2 "C to fractionate the subunits. Peak fractions were pooled and the subunits pelleted by centrifugation. The material was redissolved in a second buffer (0.01 M Tris-HC1 pH 7.5, 0.0001 M MgC12, 0.006 M mercaptoethanol) and extracted with phenol by shaking at 4 "C for 1 h. The aqueous layer was removed and the extraction repeated on it twice more before precipitating the RNA with ethanol. The precipitate was redissolved and pelleted through a 10% sucrose cushion, (SW 50 rotor, 20 h, 2 "C) to remove any residual phenol that would otherwise interfere with the formation of the ribonucleoprotein complex. The RNA was dissolved in water to a concentration of 10 mg/ml and stored frozen.
Preparation of Ribonucleoprotein Complexes Enzymes. T1 RNase (EC 3 1.4.8); pancreatic RNase (EC 3.1. 4.22); alkaline phosphatase (EC 3.1.3.1); U2 RNase (EC 3.1.4.-); venom phosphodiesterase (EC 3.1.4.1).
Usually about 50 pg 1 6 3 rRNA was mixed with a fivefold molar excess of protein in Tris/Mg/K buffer
358
(0.03 M Tris-HC1 pH 7.4, 0.02 M MgC12, 0.35 M KCI, 0.006 M mercaptoethanol) and incubated at 42 "C for 1 h. The mixture was cooled to 0 " C , digested for 30min with either T1 RNase (enzyme : substrate 1 : 10) or pancreatic RNase (enzyme : substrate 1 : 5 ) and the resulting digest fractionated by polyacrylamide gel electrophoresis on an 8 % or 10 "/, polyacrylamide gel [ 2 ] . The ribonucleoprotein complexes obtained were dissociated into their component fragments and repurified by electrophoresis on more concentrated gels [6]. The extent of base-pairing between the subfragments within the ribonucleoprotein complex derived by T1 RNase digestion was investigated using polyacrylamide gels containing both Mg2+ ions and sodium dodecyl sulphate [7]. The nucleotide sequences were established using the conventional two-dimensional electrophoresis technique and standard enzymatic analyses [8,9].
Protein S8 Binding Site on B. .stearothermophilus 16-S RNA ORlOlN
8-58
ORIGIN
01%505
__
-A
-0
RNP FRAGMENl10% -C
-D -E
-F -Q --H
RESULTS AND DISCUSSION
Homologous Complex between B. stearothermophilus 16-S rRNA and B. stearothermophilus Ribosomal Protein B-S8 Fig.1 and 2 show the isolation of the complexes between B. stearothermophilus 16-S rRNA and protein B-S8 and the fractionation of the component subfragments as produced by digestion with T1 and pancreatic RNase respectively. The use of two different enzymes with which to isolate the complex had two effects. Firstly it gave a large number of
- H I ,H2
-0 -P
Heterologous Complex between B. stearothermophilus 16-S r R N A and E. coli Ribosomal Protein S8 The initial approach to the problem was an attempt to isolate a resistant fragment of B. stearothermophilus 16-S rRNA after binding it to the E. coli ribosomal protein S8. Under the conditions used to isolate the complex by polyacrylamide gel electrophoresis, however, the resistant ribonucleoprotein complex was not observed. Because the protein S8 preparation used was shown to produce a stable complex with E. coli 16-S rRNA under identical conditions of fractionation and furthermore that the B. stearothermophilus 16-S rRNA could produce a stable complex with its homologous protein B-S8 (as discussed in this paper), it must be concluded that the heterologous interaction between B. stearothermophilus 16-S rRNA and E. coli protein S8 is less strong than either homologous interaction, and that under the relatively harsh conditions of fractionation by polyacrylamide gel electrophoresis the complex dissociates and is consequently not observed.
~
CONTROL
__ BLUE
+
+
Fig. 1. Isolation ofthe rihonuc,l~,oproteiiicomplex berween protein B-SK and B. stearothermophilus 16-S r R N A on an 8 o'u-magnesium-containing polyacrylumide gel ufter digestion with TI RNase (enzyme : substrate; I : 10). The control is a duplicate incubation with thc sole omission of the protein. The pattern of the constituent subfragments of the ribonucleoprotein complex after dissociation on a composite 10:6/15 y,; polyacrylamide gel containing 8 M urea and 0.1 sodium dodecyl sulphate is shown on the right. The nucleotide sequences of these subfragments, given in Fig.3, have the prefix t. R N P , ribonucleoprotein complex
subfragments, which allowed the unambiguous derivation of the major sequences without the need for partial ribonuclease digestion of the subfragments. Secondly, and more importantly, the technique of binding a specific protein to RNA followed by ribonuclease digestion effectively gives those regions of the molecule that are protected from digestion in one of two ways; (a) directly by the protein and (b) indirectly. The latter effect is a result of either the presence of secondary and tertiary structure within the RNA or merely through the lack of the appropriate nucleotide residue (i.e. G : T1 RNase, or C and U : pancreatic RNase) in an exposed position. Consequently any fragments not derived by both ribonuclease digestions were assumed to be only indirectly associated with the protein. The three series of subfragments common to the ribonucleoprotein complexes produced by both T1
359
J. Stanley and J.-P. Ebel
ORIGIN
858
CONTROL
-
-
A ORIGIN
B
-
O.l%SDS
-A
-B -C
BLUE
+
BLUE
+ Fig. 2. Isolation of two resistent fruzment.v on a I 0 ~-mugne,sium-contuininfipolyncrylumide gel u f t w digestion with puncwatic RNusr (enzyme :substrate; 1 :5 ) . The dissociation pattern of the constituent subfragments of each band, as fractionated on a 15 polyacrylamide gel containing 8 M urea and 0.5 "/, sodium dodecyl sulphate is shown on the right. The nucleotide sequences of these subfragments, given in Fig. 3 , have the prefix p. RNP, ribonucleoprotein complex Fragment B
Fragment A
A UCAUUGGAAACUGGGGGACUUGGGAGCAGGAGGGGAGAGAGCGGAAUUC
AAUUAUUGUAAAGCGGGCGCGCAGGCGGUCUCUUAAGUCUGAUGUG tN tM ft K K3 2
f
L2 tJ2
t12 C H 2
tJ1
pL2
pK2
LG
CF
PJ2
PHI pH2
pi2FH3 PKI
pF3
PMI
pE2
PD
Fragment C
[CG.~ICGGCUCUCUGGCCUGCACCUGACGCUGAGGC
Fig. 3. Nucleotide sequences of the subfiugments fractionated us in Fig.I and 2. The complete digestion of each with T I and pancreatic RNase allows the unambiguous placing of all oligonucleotides within their respective sequences with the exception of the sequence (C-Gp,A-A-Gp,Gp) in fragment C. The sequence in fragment C , in addition to that of the largest subfragment obtained within the ribonucleoprotein complex, (subfragment pE,), was derived from a fragment obtained by the partial digestion of the total 16-S rRNA using T I RNase. The sequences of the underlined oligonucleotides (A-Gp,Gp,)Cp and (A-A-Gp,Gp)Cp in fragment C are unknown. The nucleotide composition of the pancreatic-RNase-derived oligonucleotide at the 5' end of fragment B (shown by a dotted line) is unknown as it remained at the origin of the second dimension of' the fingerprint together with the other long oligonucleotides from the subfragments in question. It must, however, contain at least 5 G p residues, which makes it significantly different from the analogous region seen in E. coli (Fig. 5). The subfragment pD occurs twice within fragment B, both oligonucleotides A-A-U and A-A-U-U-C appearing on the fingerprint, implying a mixture. At the 5' end of fragment B heterogeneity occurs, the T1 -RNase-derived dephosphorylated oligonucleotide Hyphens representing the phosphate linkages U-C-A-U-U-G being replaced by A-C-A-U-U-G with a frequency of approximately 10 between nucleosides have been omitted to save space
'x.
360
Protein SX Binding Site on B. stearothermophih~s16-S RNA
Table 1. Sequence determination of the oligonucleotidesfrom f r a , p e n t s A , B and Cproduced by digestion nith either combined TI RNase and alkaline phosphatase or pancreatic RNase Only the data for those oligonucleotides for which the sequence cannot be directly deduced by either simple analysis using TI or pancreatic RNase (as appropriate) or by the position on the fingerprint are given. The extensive run of purine nucleotides A-G-G-A-G-G-G-G-A-G-A-GA-G-Cp in fragment B was derived from the sequence analysis of subfragments tJz, tIz, tH2 and pL2. The sequences of the pancreatic KNase oligonucleotides A-G-G-Cp (fragment A), G-A-A-A-G-Cp and A-G-G-A-Up (fragment C) were deduced from a knowledge of the TI RNase plus alkaline phosphatase digestion products. Products in bold type indicate that they were found in 2 or more mol/oligonucleotide. Complete modification of the oligonucleotidewith kethoxal was followed by digestion using UZ RNase according to the conditions of Min Jou and Fiers [I31 Oligonucleotide origin
Proposed sequence
Fragment A A-A-U-U-A-U-U-G” U-C-U-C-U-U-A-A-G
Pancreatic RNase products
UZ RNase products
A-A-Up A-Up, 2Up A-A-G, 2Up, 4Cp
U-U-Ap, U-U-G, Ap
Partial venom phosphodiesterase digestion products
T1 RNase products
UZ RNase products after kethoxal modification
A-Gp, 3Gp, Cp
G-G-G-Ap, G-Cp
A-Gp, 2Gp, Cp
G-Ap, G-G-Cp
u-c-u-C-u-u U-C-U-c-u u-C-u-C
u-c-u u-c
U-C-A-U-U-G A-C-A-U-U-G A-A-A-C-U-G A-C-U-U-G A-A-U-U-C G-G-G-A-G-Cp Fragment C C-U-C-U-C-U-G
Fragment B
C-A-C-C-U-G C-A-A-A-C-A-G A-U-U-A-G G-A-G-G-Cp
A-UP, UP, CP A-Up, A-Cp, Up A-A-A-G, Up A-Cp, 2Up A-A-Up, Up
U-C-Ap, U-U-G C-Ap, U-U-G, Ap C-U-G, Ap C-U-U-G, Ap
c-u-c-u-C-U C- u -c-U -C c-u-C-u c-u-C C-U
3UP, 3CP
A-Cp, IJp, 2Cp A-A-A-Cp, A-G, Cp A-Up, A-G. Up
C-Ap, C-C-U-G C-AQ,AP U-U-Ap, Ap
a The sequence of this oligonucleotide was completed from the partial hydrolysis products A-A-U-Up and A-U-U-G frequently observed on the fingerprint. In addition, the tetranucleotide G-A-A-Up was present on the pancreatic RNase fingerprint of subfragment tB, the latter containing all of fragment A together with approximately 80 nucleotides to the 5’ end. The sequence must be derived from the only compatible oligonucleotide within the entire 16-S rRNA, A-A-U-(Up,Cp,Cp)A-C-G (J. Stanley, unpublished results), similar to the analogous oligonucleotide in E. coli, A-A-U-U-C-C-A-G [I].
and pancreatic RNase are shown in Fig.3. The subfragments allow the deduction of the complete sequence of fragments A and B. In the case of fragment C the purine-rich region at the 3‘ end of subfragments pE1 and pG1; Gp(A-Gp,Gp4)Cp has not yet been determined. The extensions to both the 5’ and 3’ ends of the largest subfragment of fragment C, i.e. pE1, were derived from data on the partial T1 RNase digestion of the total 16-S rRNA and are included to increase the extent of the homology between B . stearothermophilus and E. coli RNA in this region. Fingerprints of subfragments tK2, t12 and pE1, representative of fragments A, B and C respectively, are shown in Fig. 4A, B and C and the analyses of the oligonucleotides shown in Fig. 3, in Table 1. Fig.4D shows the fingerprints for the largest subfragment tA, obtained within the ribonucleoprotein
complex derived by TI RNase digestion. This subfragment has been shown to be background contamination of the complex only, as it is also present in the corresponding position within the control. The characteristic oligonucleotides of this fragment were found to have originated not from the 16-S rRNA but the 23-S rRNA and the fragment has since been identified as being the region that is recognised by protein L1 (J. Stanley and P. Sloof, unpublished results). There are two possible mechanisms by which this may have been brought about. Firstly, it may be a simple case of limited breakdown of the 50-S subunit during the extraction procedure and subsequent contamination of the 30-S subunit fraction during the sucrose gradient fractionation step. Secondly, on separation of the subunits a specific fragment of 23-S rRNA, possibly still bound to protein L1, may
Fig. 4. Fingerprints ojsubfrugrnmts o f T 1 undpuncreutic-RNuse-~er~v~d oligonucleotides. (A) Fingerprints of subfragment tKz, from fragment A, derived from digestion using TI RNase and alkaline phosphatase (left) and pancreatic RNase (right). (B) Fingerprints of subfragment t12, from fragment B, derived from digestion using TI RNase and alkaline phosphatase (left) and pancreatic RNase (right). The oligonucleotide A-C-A-U-U-G is derived from U-C-A-U-U-G by a base substitution at the 5’ end. The tetranucleotide A-U-U-G only occurs when the hexanucleotide U-C-A-U-U-G is present (for the subfragments produced by TI RNase), and is thought to be a degradation product. (C) Fingerprints of subfragment pE2, from fragment C, from digestion using TI RNase and alkaline phosphatase (left) and pancreatic RNase (right). (D) Fingerprints of subfragment tA, derived from digestion using T I RNase and alkaline phosphatase (left) and pancreatic RNase (right). Hyphens have been omitted as in Fig. 3
W
z
362
Protein S8 Binding Site on B. stearothermophilus 16-S RNA
Fig.4C
become detached from the 50-S subunit, which again necessitates the presence of hidden breaks within the 23-S rRNA, but remains bound to the 30-S subunit. In theory the correct mechanism may be established by observation of the total 16-S rRNA to find if the contamination is specific or non-specific. In practice, however, since the subunits are isolated in a relatively intact state, the amount of the fragment is low and consequently the characteristic oligonucleotides are masked by the intense spots from the 16-S rRNA. The second theory is consistent with the idea that protein L1 is to be found at the interface of the subunits within the 70-S ribosome [lo] and is required for their association [ll]. The region of E. coli 16-S rRNA protected from digestion with pancreatic RNase has been established as consisting of two short oligonucleotide fragments originating from section C, which are capable of basepairing together to give rise to the lower half of a large looped-out structure within the molecule [l,21. A certain degree of homology exists between these two fragments and fragments A and B of Fig.3.
Fragment C (Fig.3) shows homology, although to a lesser extent than for fragments A and B, with a region of E. coli 16-S rRNA located further towards the 3’ end of the molecule, within regions C4 and Ci (C. Ehresmann and P. Stiegler, personal communication). The extent of the homology is shown in Fig. 5. Fragment A shows 7 base changes within a stretch of 46 nucleotides in addition to an extra C-Gp dinucleotide in the B. stearothermophilus 16-S rRNA, which may be a real deletion within the E. coli 1 6 3 rRNA or a reflection of the difficulties in estimation of the molar yields of the smaller oligonucleotides within large fragments. Fragment B shows less homology with its analogous region of E. coli 16-S rRNA, there being 19 differing nucleotides within a sequence 49 nucleotides in length. Heterogeneity is observed in this region for both E. coli and B . stearothermophilus; in E. coli 16-S rRNA a base deletion occurs with a frequency of approximately 30% within the pentanucleotide A-A-C-U-Gp to give the hexanucleotide A-A-C-C-U-Gp and a second deletion occurs within one of the two neighbouring hexanucleotides,
363
J. Stanley and J.-P. Ebel
Fig. 4 D
C" (G G
--
C
! p
C G,G A A U U A C C S)U A A A G(C G,A G,C G C A C G)! G G U U U U A A A A U U A U U G U A A A G C G G G C G C G C A G G C G G U C U C U U A A 6 Fragment A A A A U C C C C G G G C U C A A C C C U G G G A A C C U ~ C A U F ~ G A ! A C U U C A U U G G A A A C U G
C'I
5
f f(-,G,G,G,A
G,A G,f,G)Y A G A A U U C C A G.....::U G I] f G A G C A G G A G C C G A G A G A G C k G A A U U C I Fragment B
t
----
K'
-
t
G U C G A U G U G G U C U G A U G U G I
G G $ t ~ f C U U G I ] G G G G A C U U G G
Fragment B A G A G A U C U G(A G,G,G)A A U A C
."
---
F C $ C U G)G C U G - A C G A A A G C U $ A G G I] G (C G,A A G,G)C G G C U C U C U G G C C U G C A C C U G A C G C U G A G G C G A A A c Fragment C
C G E U G,G C G ) A A G G(C G,C,C
----
c3
-(C G,U G,A C3,G.G.G)- C A A A C A G G A U U A G G C G U G(A G,G,G,G,G)C A A A C A G G A U U A G G Fragment C
% . .
Fig.5. Comparison of the sequence of the region C"-C-Cr1-K'-C'2-C'3from E. coli 16-S rRNA with those offragments A , B and C f r o m B. stearothermophilus (bottom row of each line). The unknown sequences within parentheses have been arranged to give maximum homology and the dashes represent apparent deletions and insertions. The dots between the sequences indicate those points at which base substitutions have occurred. Hyphens have been omitted as in Fig. 3
364
Protein S8 Binding Site on B. stearothermophilus 1 6 3 RNA
fined to one or two nucleotides only, have already been observed between the 5-S rRNA molecules of these two bacterial species [5].
ORIQIN-
MIIQIN-
lQmM M Y
-
1 2 x
Investigation of Po tent ial Base-Pairing Regions
10mM M Y 10 m M TRlS
I 1-
2-
12% I
15%
12
-
K2 Ll
-
__ BLUE __
+ Fig. 6. Electrophore.\iJ oj the ribonucleoprotein complex us produced in Fig. 1, through a 10 ”/, palyacrylumide gel containing both mugnesium and sodium dodecyl sulphate throughout. The subfragments from band 1 are shown on the right after dissociation on a polyacrylamide gel containing 8 M urea, together with a densitometer tracing of the autoradiograph
C-A-U-C-U-Gp or A-U-A-C-U-Gp, giving rise to the pentanucleotide A-U-C-U-Gp with a frequency of 20-30% [6]; in B. stearothermophilus a base substitution occurs within the hexanucleotide U-C-AU-U-Gp to give A-C-A-U-U-Gp with a frequency of approximately 10 %. Also in fragment B the heptanucleotide G-G-G-G-G-A-Cp is often fractionated into two u n i F e spots on the fingerprint of varying relative amounts, both oligonucleotides giving Gp and A-Cp only on analysis with T1 RNase. The difference between the oligonucleotides is still unknown but may be due to either an insertion of a Gp residue or the modification of an existing residue. The degree of homology between fragment C and the analogous region within E. coli 16-S rRNA is more difficult to assess due to the apparent deletions and insertions within the sequences. In Fig. 5 the sequences are arranged in a manner indicating the shift of the tetranucleotide A-A-A-Gp in E. coli 16-S rRNA 8 nucleotides towards the 3‘ end of the molecule to arrive at the situation found in B. stearothermophilus. In addition, the sequence in B. stearothermophilus has increased in length by 6 nucleotides. Nucleotide insertions and deletions of this kind, although con-
Direct evidence for base-pairing interactions between all three fragments A, B, and C was obtained by subjecting the ribonucleoprotein complex produced by T1 RNase to polyacrylamide gel electrophoresis through a gel containing both 0.01 M magnesium acetate and 0.5 % sodium dodecyl sulphate (Fig. 6). The sodium dodecyl sulphate treatment removes the protein from the complex while retaining any existing base-pairing interactions. As seen in Fig. 6, two bands were obtained using this procedure, the slower moving of the two dissociating in a polyacrylamide gel containing 8 M urea to give three major subfragments, identified by fingerprinting as subfragments tI2, tK2 and tL1, these fragments being the major representatives of fragments B, A and C respectively. Band 2 (Fig.6) dissociated to give a large number of subfragments, indicating that it contained a non-specific mixture of oligonucleotides. These data, in conjunction with the postulated base-pairing interaction between the two fragments in E. coli 16-S rRNA analogous to fragments A and B, have led to the proposal of the base-pairing scheme shown in Fig. 7 a, b and c for the region of B. stearothermophilus 16-S rRNA directly protected from ribonuclease digestion by protein B-S8. The 3‘ end of fragment A is shown to interact with the 5’ end of fragment B (Fig. 7a, region 111) and the nucleotides located within the middle of fragment B, with the 5‘ end of fragment C (Fig. 7a, region IV). Fig.7a, in addition to showing a possible basepairing scheme between the fragments to give the two long helical stems (I11 and IV), and three smaller loops (I, I1 and V), indicates the nucleotides at which the major cuts occur with both T1 and pancreatic RNase. Every point of cleavage, except two at the top of stem 111, is consistent with the structure in that they occur in the non-base-paired regions. The extent of ribonuclease digestion at other points throughout the sequences, as seen in the data of Fig. 3, is relatively small compared with those points shown in Fig.7a and probably reflects the initial breakdown of the secondary structure of the RNA. Fig. 7 b illustrates a second possible base-pairing scheme between the small looped-out structures I1 and V, again consistent with the points of ribonuclease attack. Other structures may be drawn for the sequences located to either side of stems 111 and IV and at present it is not possible to distinguish between them as to which exists within the ribosomal subunit. Other minor nucleotide sequences found within the ribonucleoprotein complexes [for example subfragment tB, containing all of frag-
365
J. Stanley and J.-P. Ebel
d
CuA C A G-C G-C G-C
c u C-G C-G C- G U-A
AA A A Cc G.U U . G-U
U*A- u*;
U-A.G CdJ - A.G U G-A G-C
Fig. I. Proposed base-pairing schemes. (a) A possible base-pairing scheme for fragments A, B and C from B. stearothermophilus. The arrows indicate the major positions at which ribonuclease digestion occurs. (b) An alternativc base-pairing scheme in which the small looped regions I1 and V (a) have been brought together, (c) The regions of fragments A, €3 and C that are most strongly protected by protein B-S8. (d) The suggested base-pairing scheme for region C of E. coli 16-S rRNA that is protected from digestion with pancreatic RNase by E. coli protein S8 [2]. The alternative nucleotides shown are those from the analogous sequences in B. stearothermophilus which differ as set out in Fig. 5
ment A together with approximately 80 of the adjacent nucleotides to the 5' side, and its derivative subfragments tC, tD, tE and tH1 (Fig. l), of which only the partial sequence is known] may well interact directly with the nucleotides within the small loopsI, I1 and V, in addition to the protected regions to the 3' ends of fragments B and C, to which no secondary structure has been assigned. It cannot be ruled out that the small hairpin loops are a result of refolding of the RNA after ribonuclease digestion, thereby bringing other nucleotides into exposed positions to create apparently very susceptible regions within the sequences. Fig. 7d shows the proposed secondary structure model for the region of E. coli 16-S rRNA protected from pancreatic RNase digestion by E. coli protein S8 [2] together with those analogous nucleotides from B. stearothermophilus fragments A and B which differ between the two bacteria (from Fig. 5). It is apparent that in all but one case within the protected region, at those positions where a nucleotide substitution has occurred within a base-paired region, the appropriate nucleotide substitution is to be found on the opposite side of the helix, allowing the overall structure to be maintained. This observation is in itself indirect evidence of the existence of the proposed base-pairing. A comparative study in this manner is not so readily available for helical region IV from B. stearothermophilus and the analogous regions of E. coli
16-S rRNA owing to the greater diversity of the sequences, the deletions and insertions of nucleotides throughout the sequences and the remaining sequences within this region of E. coli 16-S rRNA as yet to be completed, in particular the long run of purine bases in the middle of section C' 1 ; (A-Gpz,Gp~)up. Fig. 7c illustrates the region of B. stearothermophilus 16-S rRNA that is directly protected from ribonuclease digestion by protein B-S8. The sequences enclosed are those that are consistently found in high yields and that are common to the ribonucleoprotein complexes produced by both T1 and pancreatic RNase. The protected region is much larger than that found for the homologous complex in E. coli (Fig. 7 d). This may be explained in terms of differing secondary structures of the RNA (6 nucleotides appear to have been deleted from the sequence in E. coli which is analogous to stem region IV, in addition to the shift of the tetranucleotide A-A-A-Gp; see Fig. 5), variations between the analogous proteins from the two bacteria or a combination of both factors. Concerning the protein, however, the first 15 amino acid residues so far characterised for protein B-S8 differ only by two of these residues when compared with E. coli protein S8 ([12] and L. P. Visentin, personal communication). To investigate this problem further, conditions must be found with which to isolate the heterologous ribonucleoprotein complex ;
366
J. Stanley and J.-P. Ebel: Protein S8 Binding Site on B. stearothermophilus 16-S RNA
B. stearothermophilus 16-S rRNA, E. coli protein S8 (or vice versa) in order to observe the extent of protection. The main inconsistency in the postulated basepairing models in both bacteria is that the upper part of the structure common to both (Fig.7a, region I11 and Fig. 7d) is susceptible to pancreatic RNase digestion actually within the base-paired region. The adjacent nucleotides immediately above this region are not base-paired but form an open structure in E. coli [ 11 and B. stearothermophilus, which perhaps contributes to the accessibility to ribonuclease digestion. The inconsistency of the data with the suggested secondary structure may also be interpreted in terms of an unfolding or loosening of the base-pairing interactions during the recognition and binding of the protein. It is suggested that the helical stem region, common to both bacteria, provides the primary recognition site for the binding of the protein. Such a common structure is essential to explain the ability of the RNA of one bacteria to produce a heterologous complex with a protein from the other [3], given the diversity of the RNA primary sequence. Whether or not the structure is recognised in its entirety or is present merely to maintain one or more of its constituent nucleotides in a specific orientation remains to be evaluated.
We are indebted to K. Isono who kindly provided the ribosomal protein from B. stearothermophilus. This work was financially supported by the Centre National de la Recherche Scientqique, the Dtltgation Gdntrale u la Recherche Scientifique et Technique and the Commissariat a I’Energie Atomique. Financial support was provided by EMBO (to J.S.).
REFERENCES 1. Ehresmann, C., Stiegler, P., Fellner, P. & Ebel, J.-P. (1975) Biochimie (Paris) 57, 711 -149. 2. Ungewickell, E., Garrett, R., Ehresmann, C., Stiegler, P. & Fellner, P. (1975) Eur. J . Biochem. 51, 165-180. 3. Garrett, R., Rak, K. H., Daya, L. & Stoffler, G . (1971) Mol. Gen. Genet. 114, 112- 124. 4. Nomura, M., Traub, P. & Bechmann, H. (1968) Nature (Lond.) 219, 793 - 799. 5. Stanley, J. R. (1974) PhD Thesis, University of East Anglia, Norwich, England. 6. Ehresmann, C., Stiegler, P., Fellner, P. & Ebel, J.-P. (1972) Biocltimie (Paris) 54, 901 -967. 7. Ungewickell, E., Ehresmann, C., Stiegler, P. & Garrett, R. (1975) Nucleic Acid Res. 2, 1867-1888. 8. Sanger, F., Brownlee, G. G . & Barrel], B. G. (1965) J . Mol. Biol. 13, 373 - 398. 9. Brownlee, G. G. & Sanger, F. (1967) J . Mol. Bid. 23,337-353. 10. Morrison, C. A , , Garrett, R. A., Zeichhardt, H. & Stoffler, G. (1973) Mol. Gen. Genet. 127, 359-368. 11. Kazemie, M. (1975) Eur. J . Biochem. 58, 501 -510. 12. Yaguchi, M., Matheson, A. T. & Visentin, L. P. (1974) FEBS Lett. 46,296- 300. 13. Min Jou, W. & Fiers, W. (1976) FEBS Lett. 66, 77-81.
J. Stanley and J.-P. Ebel, Institut de Biologie Moleculaire et Cellulaire du C.N.R.S., 15 Rue Rene-Descartes, Esplanade, F-67084 Strasbourg-Cedex, France
