Molecular & Biochemical Parasitology 196 (2014) 75–81
Contents lists available at ScienceDirect
Molecular & Biochemical Parasitology
The chloramphenicol acetyltransferase vector as a tool for stable tagging of Neospora caninum Luiz Miguel Pereira a,b , Ana Patrícia Yatsuda a,b,∗ a b
Faculdade de Ciências Farmacêuticas de Ribeirão Preto, Universidade de São Paulo, Av do Café, sn/n, 14040-903 Ribeirão Preto, SP, Brazil Núcleo de Apoio à Pesquisa em Produtos Naturais e Sintéticos, Universidade de São Paulo, Ribeirão Preto, SP, Brazil
a r t i c l e
i n f o
Article history: Received 8 April 2014 Received in revised form 3 July 2014 Accepted 4 August 2014 Available online 12 August 2014 Keywords: Neospora caninum CAT Transfection Chloramphenicol acetyltransferase Lac-Z gene
a b s t r a c t Neospora caninum is an obligate intracellular Apicomplexa, a phylum where one of the current methods for functional studies relies on molecular genetic tools. For Toxoplasma gondii, the first method described, in 1993, was based on resistance against chloramphenicol. As in T. gondii, we developed a vector constituted of the chloramphenicol acetyltransferase gene (CAT) flanked by the N. caninum dihydrofolate reductase-thymidylate synthase (DHFR-TS) 5 coding sequence flanking region. Five weeks after transfection and under the selection of chloramphenicol the expression of CAT increased compared to the wild type and the resistance was retained for more than one year. Between the stop codon of CAT and the 3 UTR of DHFR, a Lac-Z gene controlled by the N. caninum tubulin 5 coding sequence flanking region was ligated, resulting in a vector with a reporter gene (Ncdhfr-CAT/NcTub-tetO/Lac-Z). The stability was maintained through an episomal pattern for 14 months when the tachyzoites succumbed, which was an unexpected phenomenon compared to T. gondii. Stable parasites expressing the Lac-Z gene allowed the detection of tachyzoites after invasion by enzymatic reaction (CPRG) and were visualised macro- and microscopically by X-Gal precipitation and fluorescence. This work developed the first vector for stable expression of proteins based on chloramphenicol resistance and controlled exclusively by N. caninum promoters. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Neospora caninum is an apicomplexan parasite that has been closely related to abortion and loss of fertility in cattle [1]. One of the key events to deeply investigate the invasion/replication system of the parasite is based on molecular exploitation. Although highly developed for Toxoplasma gondii, molecular tools are rare for N. caninum. The genetic manipulation in N. caninum with exclusive promoters was initiated by our group through the mutation of DHFR-TS and insertion of the Lac-Z gene [2]. Another possible alternative is the development of parasites that are resistant to chloramphenicol. Chloramphenicol is an antibiotic that inhibits translation through the binding to a peptidyltransferase enzyme on the 50S ribosome protein, both in Gram-negative and -positive bacteria
∗ Corresponding author at: Departamento de Análises Clínicas, Bromatológicas e Toxicológicas, Faculdade de Ciências Farmacêuticas de Ribeirão Preto, Universidade de São Paulo, 14040-903 Ribeirão Preto, Brazil. Tel.: +55 16 3602 4724; fax: +55 16 3602 4725. E-mail addresses: [email protected], [email protected] (A.P. Yatsuda). http://dx.doi.org/10.1016/j.molbiopara.2014.08.001 0166-6851/© 2014 Elsevier B.V. All rights reserved.
[3]. It probably acts in a manner similar to that in the apicomplexan apicoplast, a non-photosynthetic plastid-like organelle [4]. In bacteria, resistance against chloramphenicol is achieved by chloramphenicol acetyltransferase (CAT). CAT transfers an acetyl group of Acetyl-S-CoA to chloramphenicol to yield the initial product acetoxychloramphenicol, which is devoid of significant antibiotic activity [5]. T. gondii has sensitivity to chloramphenicol; however, the tachyzoites acquire resistance after transfection with the gene of resistance, CAT, flanked by a 5 coding sequence flanking region and a 3 downstream region of an active and non-lethal tachyzoite gene [6]. The development of a gene-controlling system in T. gondii, based on tetracycline transactivation [7,8], allowed the evaluation of genes related to the gliding and invasion processes. For N. caninum, there is a lack of options for the control of gene expression, particularly those responsive to a drug addiction. In this work, we performed the insertion of Lac-Z and tagged the tachyzoites through chloramphenicol resistance. The tachyzoites were able to receive and express the resistance gene, and the expression of the reporter gene was responsive to the concentration of the drug applied. Our findings will contribute to the development of more elaborate experiments for the genetic manipulation of N. caninum.
76
L.M. Pereira, A.P. Yatsuda / Molecular & Biochemical Parasitology 196 (2014) 75–81
Fig. 1. The Neospora caninum Ncdhfr-CAT and Ncdhfr-CAT/NcTub-tetO/Lac-Z construct. (A) The vector for CAT expression was constructed by successive ligations of NcDHFR 5 coding sequence flanking region, chloramphenicol coding sequence (CAT) and 3 downstream region of NcDHFR in the TgtubYFP-TetR/sag-CAT [8]. (B) The vector for transient expression of Lac-Z in Neospora caninum, NcTub-tetO/Lac-Z, was ligated to Ncdhfr-CAT after treatment with Pstl.
2. Materials and methods 2.1. N. caninum culture Vero cell cultures were maintained in RPMI-1640 medium (Sigma) supplemented with 5% foetal calf serum (Gibco/Invitrogen), 50 g/ml of kanamycin at 37 ◦ C and 5% CO2 in T25 cm2 or 75 cm2 tissue culture flasks. N. caninum tachyzoites of Nc1 isolate were maintained in Vero cell monolayers and purified [9]. 2.2. Construction of Ncdhrf-CAT and Ncdhfr-CAT/NcTub-tetO/Lac-Z The T. gondii construct, TgtubYFP-TetR/sag-CAT [8], was designed from the pCAT-GFP, which was originally derived from a pKS backbone plasmid [10]. TgtubYFP-TetR/sag-CAT was successively treated with restriction enzymes and ligated as described below. The vector Ncdhfr-CAT was constituted of the CAT coding sequence (663 bp), amplified from the TgtubYFP-TetR/sag-CAT [8] with forward (CCCAGATCTATGCATGAGAAAAAAATC) and reverse (CCCCATATGTTATGCCCCGCCCTGCCA) primers, controlled by the 5 coding sequence flanking region of the dihydrofolate reductasethymidylate synthase (DHFR-TS) gene of N. caninum (Fig. 1A); this was amplified (1428 bp) using the forward (TTTAAGCTTTGGGCATCACTGAGGGACTT) and reverse (TTTCCTAGGCATGTTTCGCTGCACAACTC) primers and the 3 UTR sequence of the same gene (886 bp) was amplified using the forward (CCCCTGCAGTGGAAAAATCTGAAATATATA) and reverse (TCCGCGGCCGCCTTTCTCGCAAGTCTCCTG) primers (Fig. 1A). The Lac-Z expression was obtained with ligation of the Lac-Z gene downstream of the N. caninum tubulin 5 coding sequence flanking region. Treatment of Ncdhrf-CAT with Pstl allowed ligation between the CAT coding sequence and the 3 UTR region of NcDHFRTS gene, generating the Ncdhfr-CAT/NcTub-tetO/Lac-Z construct (Fig. 1B). The tetO region is a site with affinity to the TetR protein extracted from a T. gondii construct [8], but only the -galactosidase expression was used in this manuscript. 2.3. Stably transfected tachyzoites and CAT-ELISA The plasmids (25 g) were inserted in freshly purified N. caninum tachyzoites (1 × 108 ) by the enzyme restriction mediated integration (REMI) with HindIII, in cytomix buffer (120 mM KCl, 0.15 mM CaCl2 , 10 mM K2 HPO4 /KH2 PO4 , 25 mM Hepes, 2 mM EDTA, 5 mM MgCl2 , pH 7.6) supplemented with 5 mM glutathione, as described by [11]. Cells were transferred to a 0.4 cm gap cuvette, electroporated with 1.8 kV at 25 mFd and 100 in a BioRad GenePulser Xcell and incubated for 18 h at 37 ◦ C, 5% CO2 , when 30 M of chloramphenicol was added. After the lytic cycle, tachyzoites were purified and cultured with 20 M of chloramphenicol
until the development of resistant tachyzoites in the third week. Two weeks later, stable transfected tachyzoites (1 × 107 ) were compared with the wild type strain for the expression of chloramphenicol acetyltransferase using the CAT-ELISA kit (Roche Applied Science, USA), following the manufacturer’s instructions. The reaction was read at an absorbance of 405 nm (Synergy H1, BioTek, software Gen5 2.01) and absorbance of the Vero cells was used as blank; values were analysed by one-way ANOVA with the software Prism 5.1, and post-analysed by Tukey test. 2.4. Selection of Lac-Z tachyzoites under chloramphenicol Two equal and independent aliquots of purified tachyzoites (3 × 107 ) were transfected, in separated cuvettes, with 5 g of plasmid Ncdhfr-CAT/NcTub-tetO/Lac-Z, previously treated with HindIII, and incubated in 5% CO2 at 37 ◦ C for 18 h, at which point four concentrations of chloramphenicol (5, 10, 20 and 40 M) were added. After each lytic cycle, the tachyzoites were purified in Sephadex G-25 (PD-10 columns, GE) and 1 × 104 tachyzoites were inoculated in a new Vero cell culture until the next lytic cycle. The purified tachyzoites were counted in a haemocytometer and 1 × 103 , 1 × 104 , 1 × 105 and 1 × 106 (only after the third cycle) were incubated with 5 mM of CPRG (chlorophenolred-d-galactopyranoside, Roche) for 18 h at 37 ◦ C. The samples were transferred to a 96-well plate in duplicate and the absorbance was measured at 570 nm (Synergy H1, BioTek). The absorbance equivalent to 1 × 105 tachyzoites with the standard error was calculated and plotted against each lytic cycle. 2.5. Rescue of plasmid from transfected tachyzoites Genomic DNA from stable tachyzoites (5 × 107 ), selected using 20 M of chloramphenicol for 2 months, was extracted (Wizard® Genomic DNA Purification kit, Promega), treated with Pstl (0.5 U) for 18 h, purified (Illustra GFX PCR DNA and Gel Band Purification Kit, GE) and eluted in 30 l of deionised water. A volume of 17 l was submitted to a ligation reaction with 0.4 U Weiss of T4 ligase (Fermentas) for 18 h at 16 ◦ C. The ligated N. caninum DNA was electroporated in E. coli Top10 (2.5 kV; 25 F; 200 ), and the ampicillin-resistant colonies were either PstI- or EcoRl-treated for visualisation of the whole plasmid or for verification of the NcdhfrCAT insertion, respectively. 2.6. Semi-quantification of rescued plasmids Genomic DNA from stable tachyzoites (1 × 107 ) selected with 5, 10, 20 and 40 M of chloramphenicol from the seventh lytic cycle were extracted (Wizard® Genomic DNA Purification kit, Promega) and 50 ng (GeneQuant Pro, The GE Healthcare Lifesciences, formerly Amersham Biosciences) was amplified using the PCR primers Forward Ncdhfr (TTTAAGCTTTGGGCATCACTGAGGGACTT)
L.M. Pereira, A.P. Yatsuda / Molecular & Biochemical Parasitology 196 (2014) 75–81
and reverse CAT (CCCCATATGTTATGCCCCGCCCTGCCA) with HotStarTaq DNA Polymerase (Qiagen). The touchdown PCR conditions were: one cycle 94 ◦ C, 1 min; 25 cycles 94 ◦ C, 30 s; five cycles 60 ◦ C, 30 s; five cycles 55 ◦ C, 30 s; 15 cycles 50 ◦ C, 30 s and 25 cycles 72 ◦ C, 2 min. The 5 coding sequence flanking region from the ribosomal gene NcRPS13 (NCBI: XM 003883829.1) was amplified under the same conditions as a control, using the forward and reverse NcRPS13 primers (CCCAAGCTTCCCAGGTTTGCGTTGT and CCGTTCCGAAGCTGTCGAATTCTCTC, respectively). 2.7. ˇ-Galactosidase detection by CPRG The cultures from invasion and proliferation assays (items 2.10 and 2.11) were lysed with -galactosidase lysis buffer (100 mM 4(2-hydroxyethyl)-1-piperazineethanesulfonic acid, pH 8.0; 1 mM CaCl2 ; 1% Triton X-100, 0.5% SDS; 5 mM DTT) for 1 h at 50 ◦ C and centrifuged for 10 min at 10,000 × g. Each lysate (20 l) was incubated with 5 mM CPRG in -galactosidase lysis buffer for 18 h at 37 ◦ C in an ELISA plate (Nunc) and the reading was taken at 570 nm in an ELISA reader (Synergy H1, BioTek). 2.8. ˇ-Galactosidase detection by X-Gal precipitation The N. caninum tachyzoites expressing Lac-Z were detected by the X-Gal precipitation with the kit -Gal Staining Set (Roche). The samples from the culture supernatant, and of invasion and proliferation assays (items 2.10 and 2.11) were submitted to a similar procedure. The samples were fixed with 2% formaldehyde, washed twice with PBS and incubated with the working solution (Iron buffer and X-Gal solution from the kit -Gal Staining Set) for 2 h at 37 ◦ C. The samples were washed twice with PBS, mounted in glycerol 60% and the images captured with the AxioCam MRc 5 camera in the microscope Zeiss Axioskop 40 and processed using the AxioVison 4.6 software. 2.9. ˇ-Galactosidase detection by fluorescence
77
and incubated with the working solution (X-Gal precipitation). The outcomes from CPRG were plotted for the calculation of the R2 linear regression by the program GraphPad Prism 5.1. The images from X-Gal precipitation were captured with the AxioCam MRc 5 camera in the microscope Zeiss Axioskop 40 and processed by the AxioVison 4.6 software. 2.11. Proliferation assay Purified tachyzoites (1 × 103 /well) were incubated in Vero cell monolayers in 24-well plates (TPP) for CPRG or 8-well chambers (TPP) for X-Gal precipitation for 18 h, at 37 ◦ C, 5% CO2 ; to the medium, different dilutions of pyrimethamine (Sigma) were added: 16, 8, 4, 2, 1, 0.5 and 0.25 M for CPRG and 4, 2, 1, 0.5 and 0.25 M for X-Gal. These samples were incubated for a further 54 h (total of 72 h) at 37 ◦ C, 5% CO2 . The samples for CPRG reaction or X-Gal precipitation were processed as previously described (2.7 and 2.8). The percentage of inhibition, for CPRG reaction, was calculated using the formula (100 – ((T/C) × 100)), where T is the absorbance of the treated well and C the absorbance of the wells without any drug. A similar calculation was performed for X-Gal precipitation, where T and C represent the mean of the 20 field counts of treated and control wells, respectively, in an optic microscope. 3. Results 3.1. Detection of CAT enzyme expression in N. caninum tachyzoites The chloramphenicol acetyltransferase activity in transfected tachyzoites exhibited a significant absorbance of 1.296 for NcdhfrCAT (data not show). The tachyzoites were evaluated 2 weeks after the rise of stable tachyzoites (which corresponds to a total of 5 weeks of chloramphenicol selection). The resistance of stable transfected tachyzoites was retained for 14 months under chloramphenicol selection.
The supernatant of a 5-day culture of tachyzoites (2 × 107 ) from N. caninum selected by chloramphenicol (5, 10, 20 and 40 M, of the seventh cycle) was fixed with 2% formaldehyde and ligated to a poly-l-lysine coated coverslip (Sigma) for 30 min. The coverslips were washed twice with PBS and permeabilised with 0.2% PBS-Triton 100 for 30 min and washed twice with PBS. The samples were blocked with PBS-BSA (3% BSA, glycine 50 mM) for 18 h at 4 ◦ C, washed twice with PBS, incubated with mouse anti-galactosidase (Sigma) for 1 h at 37 ◦ C and washed twice with PBS; this was followed by incubation with conjugated anti-mouse Alexa-488 (Invitrogen) and washing twice with PBS. The coverslips were mounted with DAPI (Santa Cruz) and the images were captured using a Confocal Microscope (Leica TCS SP5 Laser Scanning Confocal Microscope, Leica Microsystems, Heidelberg, Germany). The images were captured by a 60× objective in oil immersion. Three images of 0.6 m from each channel were captured, grouped and processed by the program Image J 1.41 (National Institutes of Health, USA).
3.2. Expression of Lac-Z after selection with chloramphenicol in N. caninum tachyzoites
2.10. Invasion assay
3.3. Episomal stability of parasites
The invasion of tachyzoites was measured by CPRG and X-Gal precipitation. Purified tachyzoites were diluted (1 × 106 ; 5 × 105 ; 1 × 105 , 5 × 104 and 1 × 104 for CPRG and 1 × 106 ; 5 × 105 ; 1 × 105 and 5 × 104 for X-Gal precipitation) and incubated on a Vero cell monolayer in a 24-well (TPP) plate or 8-well chamber slide (Nunc Lab-Tek® ) respectively for CPRG and X-Gal precipitation. The cultures were incubated for 2 h at 37 ◦ C, in 5% CO2 , washed three times with PBS and lysed with -galactosidase lysis buffer (CPRG) or fixed
Tachyzoites Ncdhfr-CAT or Ncdhfr-CAT/Lac-Z selected with 20 M of chloramphenicol were stable in culture for 14 months, at which point the growth started to decrease, until being completely extinguished after 18 months of culture (inclusive in the absence of chloramphenicol). After treatment of the genomic DNA with PstI (Fig. S1A) and recircularisation, only plasmids without genomic DNA of N. caninum were found, with a size of 5.9 kb (Fig. S1B). The treatment of the rescued plasmids with EcoRI (Fig. S1C)
The selection under chloramphenicol generated tachyzoites with different patterns of Lac-Z expression (Fig. 2). Parasites selected with higher concentrations (40 and 20 M) reached a plateau of Lac-Z expression after the fourth lytic cycle, when the number of tachyzoites increased, similarly to the wild culture after the fifth cycle. Chloramphenicol at 10 M has a slight effect on tachyzoite proliferation and the Lac-Z expression peak was reached after the seventh cycle. The proliferation of tachyzoites under 5 M was not affected and the expression of Lac-Z was similar along the process of selection. The control transfected and non-selected indicated a -galactosidase activity similar to the selected with 5 M of drug in the first lytic cycle. The Lac-Z expression decreased until the wild type levels after the third cycle. The expression of Lac-Z of the parasites under 40, 20, 10 and 5 M exhibited a relative absorbance per 105 tachyzoites of 33.7; 23.3; 0.32 and 0.0045, respectively.
78
L.M. Pereira, A.P. Yatsuda / Molecular & Biochemical Parasitology 196 (2014) 75–81
Fig. 2. Selection of Neospora caninum tachyzoites Ncdhfr-CAT/NcTub-tetO/Lac-Z with chloramphenicol. Four groups of purified tachyzoites (3 × 107 ), in two parallel assays, were transfected with 5 g of Ncdhfr-CAT/NcTub-tetO/Lac-Z and incubated for 18 h. Each culture was incubated with 5, 10, 20 and 40 M of chloramphenicol, purified after the lytic cycle and inoculated (1 × 104 ) in a new Vero culture. The purified tachyzoites from each lytic cycle were counted and the -galactosidase activity measured by CPRG reaction and the absorbance 570 nm per 105 tachyzoites calculated. (A) Logarithm of Absorbance/105 tachyzoites plotted against the respective lytic cycle. (B) Tachyzoites counted in a haemocytometer and plotted against the respective lytic cycle.
liberated the predicted fragment of 1170 bp (Fig. S1D), with the typical pattern of circular Ncdhfr-CAT. Therefore, the resistance for 14 months against the drug occurred due to episomal forms of the plasmid which were detected in all of the rescued clones. Supplementary Fig. S1 related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.molbiopara. 2014.08.001. The detection of plasmids by PCR was readily observed for tachyzoites selected with 20 and 40 M and a faint band was observed for 10 M, whereas for 5 M and wild type samples, the plasmids were undetectable (Fig. 3A, lanes 5, 4, 3, 2 and 1, respectively). In parallel, amplification of part of the 5 coding sequence flanking region from the ribosomal gene NcRPS13 (651 bp) indicated a similar amount of DNA extracted from each sample (Fig. 3A). The same batch of parasites was tested for Lac-Z expression. The tachyzoites selected with 40 M (ABS 20.87) improved the -galactosidase activity 1.5 (ABS 13.4), 52 (ABS 0.4) and 4496 (ABS 0.0046) times compared to 20 M, 10 M and 5 M, respectively (Fig. 3B). 3.4. Detection of Lac-Z tachyzoites after invasion Two hours after invasion, the N. caninum tachyzoites expressed Lac-Z detectable up to 1 × 104 /well. The absorbance of each dilution was 1.5 (1 × 106 ); 1.0 (5 × 105 ); 0.163 (1 × 105 ); 0.117 (5 × 104 ) and 0.025 (1 × 104 ), excluding the absorbance of wild tachyzoites. The number of tachyzoites and their absorbance were sufficiently proportional to generate a linear regression curve with R2 of 0.955 (Fig. S2). Supplementary Fig. S2 related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.molbiopara. 2014.08.001. 3.5. Detection of Lac-Z expression by X-Gal precipitation The precipitation of X-Gal was proportional to the concentration of chloramphenicol, being very intense in tachyzoites selected with
Fig. 3. Detection of Ncdhfr-CAT/NcTub-tetO/Lac-Z by PCR and Lac-Z expression by CPRG. Detection of the Ncdhfr-CAT and the region of the 5 coding sequence flanking region NcRPS13 from genomic DNA of Neospora caninum Lac-Z tachyzoites selected with 5, 10, 20 and 40 M. (A) Agarose electrophoresis (0.8%) of the Ncdhfr-CAT and NcRPS13 amplification; lane 1 = wild type N. caninum, lanes 2–5 = N. caninum Lac-Z, selected with, respectively, 5, 10, 20 and 40 M of chloramphenicol. (B) Relative absorbance per 105 tachyzoites selected with chloramphenicol from the seventh cycle, evaluated by CPRG reaction.
20 and 40 M (Fig. S3B and S3A), indicating the consistency of the tubulin promoter from N. caninum and the adaptation of the vector within the parasite expression machinery. The tachyzoites selected with lower concentrations of the drug (10 and 5 M) did not exhibit a visible precipitation, as observed in the wild type (Fig. S3C, D and E). Supplementary Fig. S3 related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.molbiopara. 2014.08.001. The Lac-Z tachyzoites were visualised macroscopically, forming a blue pellet after centrifugation (Fig. 4A), in contrast to the wild ones (Fig. 4B). The staining allowed the detection of isolated tachyzoites (Fig. 4C) including the visualisation of replicating (Fig. 4D) and early egressed forms (Fig. 4E). Tachyzoites were detected after invasion in Vero cells and different amounts of incubated parasites were distinguishable at concentrations of 1 × 106 , 5 × 105 , 1 × 105 and 5 × 104 (Fig. 4F, G, H and I, respectively). 3.6. Detection of ˇ-galactosidase by fluorescence The -galactosidase form expressed by N. caninum was detected with an antiserum against the enzyme form from E. coli. The fluorescence allowed the discrimination of isolated parasites and indicated a uniform distribution of the enzyme along the parasite (Fig. 5A–D). The concentration of chloramphenicol during the selection of parasites had an influence on the -galactosidase expression and, consequentially, on the fluorescence detection. Parasites selected with 40 and 20 M of drug demonstrated an intense fluorescence, whereas expression under 10 and 5 M (Fig. 5G and H, respectively) was not sufficient to allow detection by this method and the tachyzoites were undifferentiated when compared to the wild type (Fig. 5I). 3.7. Evaluation of N. caninum (Ncdhfr-CAT/NcTub-tetO/Lac-Z) susceptibility to pyrimethamine The expression of -galactosidase allowed the measurement of tachyzoite proliferation by two methods: CPRG (Fig. 6A) and counting after X-Gal precipitation (Fig. 6B–H). Concentrations higher than 1 M of pyrimethamine inhibited the replication by ∼80% in
L.M. Pereira, A.P. Yatsuda / Molecular & Biochemical Parasitology 196 (2014) 75–81
79
Fig. 5. Detection of N. caninum Lac-Z (Ncdhfr-CAT/NcTub-tetO/Lac-Z) by fluorescence. Tachyzoites selected with chloramphenicol were fixed, permeabilised, blocked and incubated with mouse anti--galactosidase and anti-mouse Alexa 488 labelled conjugate and the nucleus stained with DAPI. (A) The nuclei were visualised with DAPI. (B) Detection of -galactosidase. (C) Visualisation of tachyzoites by optic microscopy. (D) Images A, B and C merged. (E–I) Visualisation of nucleus and galactosidase from tachyzoites selected with 5, 10, 20 and 40 M of chloramphenicol and the wild type, respectively.
Fig. 4. Detection of N. caninum Lac-Z tachyzoites (Ncdhfr-CAT/NcTub-tetO/Lac-Z) by X-Gal precipitation. The tachyzoites were detected by three approaches with the kit -Gal Staining Set (Roche): in isolated forms, after cell invasion and the supernatant of a 5-day infected culture. (A and B) Macroscopic visualisation of X-Gal precipitation in Lac-Z and wild tachyzoites, respectively. (C) Isolated Lac-Z tachyzoites. (D) Lac-Z tachyzoites replicating on a Vero cell. (E) Early egressed Lac-Z tachyzoites. (F, G, H and I) Vero cells monolayers incubated with 1 × 106 ; 5 × 105 ; 1 × 105 and 5 × 104 tachyzoites, respectively, for 2 h.
the CPRG assay (Fig. 6A) and ∼75% by X-Gal precipitation and counting (Fig. 6B). The visualisation of the cultures incubated with the drug indicated a similar pattern, when the replication was inhibited at concentrations higher than 1 M (Fig. 6F, G and H) and demonstrated a partial proliferation with 0.5 and 0.25 M (Fig. 6D and E) compared to the control (Fig. 6C). 4. Discussion Despite being poorly developed for N. caninum, the insertion of genes in T. gondii started more than 20 years ago with cassettes based on CAT [6], followed by mutated DHFR [12], complete knockouts [13], the insertion of reporter genes such as Lac-Z [14] or GFP [10] and the site-specific insertion of genes [15]. We demonstrate that N. caninum, which is closely related to T. gondii, is a suitable model for the expression of chloramphenicol acetyltransferase (CAT). The design of vectors based on this enzyme allowed the insertion of Lac-Z gene and the tagging of tachyzoites.
The expression of CAT in N. caninum was robust, similar to the findings reported for T. gondii [6]. Our work also evaluated CAT expression by the CAT ELISA, which directly indicates the increase of enzyme expression. The tagging of N. caninum with CAT is a complementary method used to detect tachyzoites via in vitro assays, as performed in eukaryotic cells [16,17]. The episomal pattern allowed a preliminary form of gene expression control in N. caninum. The dosage of chloramphenicol determined the proportional expression of Lac-Z, according to the selection with 5 or 10 M and 20 or 40 M of the drug by CPRG assay. X-Gal precipitation and fluorescence confirmed the application of chloramphenicol as a drug for expression control, complementing the insertion of genes. In addition to the low galactosidase detection, the tachyzoites selected with 5 and 10 M of chloramphenicol exhibited the same fluorescence and X-Gal precipitation as the wild type, which were clearly detectable on parasites selected with 20 or 40 M. The possibility to improve the expression of inserted genes by the addition of chloramphenicol is the first molecular tool for the evaluation of genes in N. caninum. The overexpression of genes will contribute to the evaluation and design of tachyzoites applicable for protective tests in vivo or for evaluating the effects of genes related to invasion, gliding or metabolism. The overexpression of reporter genes such as GFP, YFP and luciferase might allow the design of more sensitive tests for the detection of N. caninum without modifying the genome. Additionally, the improvement of expression by chloramphenicol will probably be useful for the detection of poorly expressed proteins in N. caninum.
80
L.M. Pereira, A.P. Yatsuda / Molecular & Biochemical Parasitology 196 (2014) 75–81
Fig. 6. Incubation of N. caninum Lac-Z (Ncdhfr-CAT/NcTub-tetO/Lac-Z) with pyrimethamine. The proliferation of N. caninum was evaluated by CPRG reaction and X-Gal precipitation after incubation with pyrimethamine. Tachyzoites (1 × 103 /well) were incubated in 24-well plates (for CPRG) or 8-well chambers (for X-Gal precipitation) and serial dilutions of pyrimethamine were added after 18 h, followed by incubation for a further 54 h (total of 72 h). (A) Percentage of inhibition of N. caninum proliferation incubated with pyrimethamine and evaluated after CPRG reaction (A) or X-Gal precipitation and counting (B). (C–H) Images of N. caninum incubated with serial dilutions of pyrimethamine (0, 0.25, 0.5, 1, 2 and 4 M).
Lac-Z in T. gondii appeared as direct alternatives to evaluate the effects of drugs on parasites [18,19], lysis [20] and detection in tissues [14]. The Lac-Z N. caninum adhered/invaded the Vero cells with a correlation between the number of tachyzoites and galactosidase activity (R2 ) of 0.955. The standardisation of a fast and simple invasion assay amplified the range of inhibitors/enhancers to be tested on invasion, thus optimising the screening process of drug candidates. Furthermore, the episomal maintenance of resistance generates tagged tachyzoites with unaltered genomic structure and the presence of Lac-Z expression during 14 months of selection represents a long time window for the use of the tachyzoites. Despite the application of REMI transfection, which elevated the integration rate in T. gondii [11] no evidence of integration was found and the episomal form was predominant for N. caninum. The parasites could be detected not only macroscopically (the blue pellet was visible after centrifugation), but also microscopically (either isolated or after invasion in Vero cells). As this was an enzymatic reaction, the colour appeared as a complement for the detection and quantification by microscopic counting, which, for N. caninum, was mainly based on immunofluorescence [21,22], immunohistochemistry [23] and direct staining [9,24]. The detection of tachyzoites under different stages of replication in Vero cells opens up the possibility of refining the assay via the substitution of 5 coding sequence flanking regions, which can improve or decrease the X-Gal precipitation or have a time-specific expression for detection in different periods of the life cycle, as seen for the promoter of BAG1 activated in the bradyzoite stage [25].
Lac-Z tachyzoites allowed the design of proliferation assays and the evaluation of drugs in this process. The parasites were inhibited by pyrimethamine, an important drug for toxoplasmosis [26,27] and an auxiliary drug for malaria prophylaxis [28]. Despite the great potential for neosporosis combat, the application of pyrimethamine on N. caninum proliferation assays has been described once, based on microscopic counting after Giemsa staining of the cultures [29], where the concentration of total inhibition was 0.05 g/ml [29]. In contrast, in our conditions, 0.25 M (0.062 g/ml) inhibited the proliferation in ∼30% of cells. An effective dose to block N. caninum proliferation at levels of ∼80% was found to be 1 M (0.25 g/ml). These results will provide guidance to a more specific form to determine the ideal dosage for in vivo approaches, which will upgrade the application of folate inhibitors on neosporosis combat. Giemsa and other forms of subjective evaluation of proliferation demand specialised technique support in contrast to the CPRG assay. Also, X-Gal precipitation exhibits proliferation without staining the host cells, as observed for Giemsa. The application of the insertion of CAT vectors into genes amplifies the tools for N. caninum detection and the evaluation of molecular manipulation effects. The episomal maintenance and dose-response pattern of tachyzoites selected with chloramphenicol indicates a new form of expression control of inserted genes in N. caninum, which will lead to the development of more refined methods for gene evaluation. The tagging of tachyzoites without genomic modification is the functional contribution of this work, offering parasites that are more closely related to wild type ones.
L.M. Pereira, A.P. Yatsuda / Molecular & Biochemical Parasitology 196 (2014) 75–81
Acknowledgements We would like to thank CNPq (478767/2007-2) and FAPESP (2005/53785-9) for the research Grants; FAPESP for the PhD fellowship to L.M.P. (2009/07713-7) and Intervet International (current Merck Animal Health) for the plasmid with TetO and Lac-Z sequences (pRPS13LacZ, [8]). References [1] Dubey JP, Schares G. Neosporosis in animals – the last five years. Vet Parasitol 2011;180(1–2):90–108. [2] Pereira LM, Baroni L, Yatsuda AP. A transgenic Neospora caninum strain based on mutations of the dihydrofolate reductase-thymidylate synthase gene. Exp Parasitol 2014;138:40–7. [3] Neu HC, Gootz TD. Antimicrobial chemotherapy. In: Baron S, editor. Medical microbiology. Galveston, TX: University of Texas Medical Branch at Galveston; 1996. [4] Ramya TN, Mishra S, Karmodiya K, Surolia N, Surolia A. Inhibitors of nonhousekeeping functions of the apicoplast defy delayed death in Plasmodium falciparum. Antimicrob Agents Chemother 2007;51(1):307–16. [5] Shaw WV, Packman LC, Burleigh BD, Dell A, Morris HR, Hartley BS. Primary structure of a chloramphenicol acetyltransferase specified by R plasmids. Nature 1979;282(5741):870–2. [6] Kim K, Soldati D, Boothroyd JC. Gene replacement in Toxoplasma gondii with chloramphenicol acetyltransferase as selectable marker. Science 1993;262(5135):911–4. [7] Meissner M, Schluter D, Soldati D. Role of Toxoplasma gondii myosin A in powering parasite gliding and host cell invasion. Science 2002;298(5594): 837–40. [8] van Poppel NF, Welagen J, Duisters RF, Vermeulen AN, Schaap D. Tight control of transcription in Toxoplasma gondii using an alternative tet repressor. Int J Parasitol 2006;36(4):443–52. [9] Pereira LM, Candido-Silva JA, De Vries E, Yatsuda AP. A new thrombospondinrelated anonymous protein homologue in Neospora caninum (NcMIC2-like1). Parasitology 2011;138(3):287–97. [10] Striepen B, He CY, Matrajt M, Soldati D, Roos DS. Expression, selection, and organellar targeting of the green fluorescent protein in Toxoplasma gondii. Mol Biochem Parasitol 1998;92:325–38. [11] Black M, Seeber F, Soldati D, Kim K, Boothroyd JC. Restriction enzyme-mediated integration elevates transformation frequency and enables co-transfection of Toxoplasma gondii. Mol Biochem Parasitol 1995;74:55–63. [12] Donald RG, Roos DS. Stable molecular transformation of Toxoplasma gondii: a selectable dihydrofolate reductase-thymidylate synthase marker based on drug-resistance mutations in malaria. Proc Natl Acad Sci U S A 1993;90(24):11703–7.
81
[13] Donald RG, Carter D, Ullman B, Roos DS. Insertional tagging, cloning, and expression of the Toxoplasma gondii hypoxanthine-xanthine-guanine phosphoribosyltransferase gene. Use as a selectable marker for stable transformation. J Biol Chem 1996;271(24):14010–9. [14] Seeber F, Boothroyd JC. Escherichia coli beta-galactosidase as an in vitro and in vivo reporter enzyme and stable transfection marker in the intracellular protozoan parasite Toxoplasma gondii. Gene 1996;169(1):39–45. [15] Huynh MH, Carruthers VB. Tagging of endogenous genes in a Toxoplasma gondii strain lacking Ku80. Eukaryot Cell 2009;8(4):530–9. [16] Gorman CM, Moffat LF, Howard BH. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol 1982;2(9):1044–51. [17] New DC, Miller-Martini DM, Wong YH. Reporter gene assays and their applications to bioassays of natural products. Phytother Res 2003;17(5):439–48. [18] Jin C, Jung SY, Kim SY, Song HO, Park H. Simple and efficient model systems of screening anti-Toxoplasma drugs in vitro. Expert Opin Drug Discov 2012;7(3):195–205. [19] McFadden DC, Seeber F, Boothroyd JC. Use of Toxoplasma gondii expressing beta-galactosidase for colorimetric assessment of drug activity in vitro. Antimicrob Agents Chemother 1997;41(9):1849–53. [20] Seeber F. An enzyme-release assay for the assessment of the lytic activities of complement or antimicrobial peptides on extracellular Toxoplasma gondii. J Microbiol Methods 2000;39(3):189–96. [21] He P, Li J, Gong P, Liu C, Zhang G, Yang J, et al. Neospora caninum surface antigen (p40) is a potential diagnostic marker for cattle neosporosis. Parasitol Res 2013;112(5):2117–20. [22] Borsuk S, Andreotti R, Leite FP, Pinto L da S, Simionatto S, Hartleben CP, et al. Development of an indirect ELISA-NcSRS2 for detection of Neospora caninum antibodies in cattle. Vet Parasitol 2011;177(1–2):33–8. [23] Medina-Esparza L, Macias L, Ramos-Parra M, Morales-Salinas E, Quezada T, Cruz-Vazquez C. Frequency of infection by Neospora caninum in wild rodents associated with dairy farms in Aguascalientes, Mexico. Vet Parasitol 2013;191(1–2):11–4. [24] Machado RZ, Mineo TW, Landim Jr LP, Carvalho AF, Gennari SM, Miglino MA. Possible role of bovine trophoblast giant cells in transplacental transmission of Neospora caninum in cattle. Rev Bras Parasitol Vet 2007;16(1):21–5. [25] Kobayashi T, Narabu S, Yanai Y, Hatano Y, Ito A, Imai S, et al. Gene cloning and characterization of the protein encoded by the Neospora caninum bradyzoitespecific antigen gene BAG1. J Parasitol 2013;99(3):453–8. [26] Kaye A. Toxoplasmosis: diagnosis, treatment, and prevention in congenitally exposed infants. J Pediatr Health Care 2011;25(6):355–64. [27] Rorman E, Zamir CS, Rilkis I, Ben-David H. Congenital toxoplasmosis-prenatal aspects of Toxoplasma gondii infection. Reprod Toxicol 2006;21(4):458–72. [28] Nwakanma DC, Duffy CW, Amambua-Ngwa A, Oriero EC, Bojang KA, Pinder M, et al. Changes in malaria parasite drug resistance in an endemic population over a 25-year period with resulting genomic evidence of selection. J Infect Dis 2014;209:1126–35. [29] Lindsay DS, Dubey JP. Evaluation of anti-coccidial drugs’ inhibition of Neospora caninum development in cell cultures. J Parasitol 1989;75(6):990–2.
Contents lists available at ScienceDirect
Molecular & Biochemical Parasitology
The chloramphenicol acetyltransferase vector as a tool for stable tagging of Neospora caninum Luiz Miguel Pereira a,b , Ana Patrícia Yatsuda a,b,∗ a b
Faculdade de Ciências Farmacêuticas de Ribeirão Preto, Universidade de São Paulo, Av do Café, sn/n, 14040-903 Ribeirão Preto, SP, Brazil Núcleo de Apoio à Pesquisa em Produtos Naturais e Sintéticos, Universidade de São Paulo, Ribeirão Preto, SP, Brazil
a r t i c l e
i n f o
Article history: Received 8 April 2014 Received in revised form 3 July 2014 Accepted 4 August 2014 Available online 12 August 2014 Keywords: Neospora caninum CAT Transfection Chloramphenicol acetyltransferase Lac-Z gene
a b s t r a c t Neospora caninum is an obligate intracellular Apicomplexa, a phylum where one of the current methods for functional studies relies on molecular genetic tools. For Toxoplasma gondii, the first method described, in 1993, was based on resistance against chloramphenicol. As in T. gondii, we developed a vector constituted of the chloramphenicol acetyltransferase gene (CAT) flanked by the N. caninum dihydrofolate reductase-thymidylate synthase (DHFR-TS) 5 coding sequence flanking region. Five weeks after transfection and under the selection of chloramphenicol the expression of CAT increased compared to the wild type and the resistance was retained for more than one year. Between the stop codon of CAT and the 3 UTR of DHFR, a Lac-Z gene controlled by the N. caninum tubulin 5 coding sequence flanking region was ligated, resulting in a vector with a reporter gene (Ncdhfr-CAT/NcTub-tetO/Lac-Z). The stability was maintained through an episomal pattern for 14 months when the tachyzoites succumbed, which was an unexpected phenomenon compared to T. gondii. Stable parasites expressing the Lac-Z gene allowed the detection of tachyzoites after invasion by enzymatic reaction (CPRG) and were visualised macro- and microscopically by X-Gal precipitation and fluorescence. This work developed the first vector for stable expression of proteins based on chloramphenicol resistance and controlled exclusively by N. caninum promoters. © 2014 Elsevier B.V. All rights reserved.
1. Introduction Neospora caninum is an apicomplexan parasite that has been closely related to abortion and loss of fertility in cattle [1]. One of the key events to deeply investigate the invasion/replication system of the parasite is based on molecular exploitation. Although highly developed for Toxoplasma gondii, molecular tools are rare for N. caninum. The genetic manipulation in N. caninum with exclusive promoters was initiated by our group through the mutation of DHFR-TS and insertion of the Lac-Z gene [2]. Another possible alternative is the development of parasites that are resistant to chloramphenicol. Chloramphenicol is an antibiotic that inhibits translation through the binding to a peptidyltransferase enzyme on the 50S ribosome protein, both in Gram-negative and -positive bacteria
∗ Corresponding author at: Departamento de Análises Clínicas, Bromatológicas e Toxicológicas, Faculdade de Ciências Farmacêuticas de Ribeirão Preto, Universidade de São Paulo, 14040-903 Ribeirão Preto, Brazil. Tel.: +55 16 3602 4724; fax: +55 16 3602 4725. E-mail addresses: [email protected], [email protected] (A.P. Yatsuda). http://dx.doi.org/10.1016/j.molbiopara.2014.08.001 0166-6851/© 2014 Elsevier B.V. All rights reserved.
[3]. It probably acts in a manner similar to that in the apicomplexan apicoplast, a non-photosynthetic plastid-like organelle [4]. In bacteria, resistance against chloramphenicol is achieved by chloramphenicol acetyltransferase (CAT). CAT transfers an acetyl group of Acetyl-S-CoA to chloramphenicol to yield the initial product acetoxychloramphenicol, which is devoid of significant antibiotic activity [5]. T. gondii has sensitivity to chloramphenicol; however, the tachyzoites acquire resistance after transfection with the gene of resistance, CAT, flanked by a 5 coding sequence flanking region and a 3 downstream region of an active and non-lethal tachyzoite gene [6]. The development of a gene-controlling system in T. gondii, based on tetracycline transactivation [7,8], allowed the evaluation of genes related to the gliding and invasion processes. For N. caninum, there is a lack of options for the control of gene expression, particularly those responsive to a drug addiction. In this work, we performed the insertion of Lac-Z and tagged the tachyzoites through chloramphenicol resistance. The tachyzoites were able to receive and express the resistance gene, and the expression of the reporter gene was responsive to the concentration of the drug applied. Our findings will contribute to the development of more elaborate experiments for the genetic manipulation of N. caninum.
76
L.M. Pereira, A.P. Yatsuda / Molecular & Biochemical Parasitology 196 (2014) 75–81
Fig. 1. The Neospora caninum Ncdhfr-CAT and Ncdhfr-CAT/NcTub-tetO/Lac-Z construct. (A) The vector for CAT expression was constructed by successive ligations of NcDHFR 5 coding sequence flanking region, chloramphenicol coding sequence (CAT) and 3 downstream region of NcDHFR in the TgtubYFP-TetR/sag-CAT [8]. (B) The vector for transient expression of Lac-Z in Neospora caninum, NcTub-tetO/Lac-Z, was ligated to Ncdhfr-CAT after treatment with Pstl.
2. Materials and methods 2.1. N. caninum culture Vero cell cultures were maintained in RPMI-1640 medium (Sigma) supplemented with 5% foetal calf serum (Gibco/Invitrogen), 50 g/ml of kanamycin at 37 ◦ C and 5% CO2 in T25 cm2 or 75 cm2 tissue culture flasks. N. caninum tachyzoites of Nc1 isolate were maintained in Vero cell monolayers and purified [9]. 2.2. Construction of Ncdhrf-CAT and Ncdhfr-CAT/NcTub-tetO/Lac-Z The T. gondii construct, TgtubYFP-TetR/sag-CAT [8], was designed from the pCAT-GFP, which was originally derived from a pKS backbone plasmid [10]. TgtubYFP-TetR/sag-CAT was successively treated with restriction enzymes and ligated as described below. The vector Ncdhfr-CAT was constituted of the CAT coding sequence (663 bp), amplified from the TgtubYFP-TetR/sag-CAT [8] with forward (CCCAGATCTATGCATGAGAAAAAAATC) and reverse (CCCCATATGTTATGCCCCGCCCTGCCA) primers, controlled by the 5 coding sequence flanking region of the dihydrofolate reductasethymidylate synthase (DHFR-TS) gene of N. caninum (Fig. 1A); this was amplified (1428 bp) using the forward (TTTAAGCTTTGGGCATCACTGAGGGACTT) and reverse (TTTCCTAGGCATGTTTCGCTGCACAACTC) primers and the 3 UTR sequence of the same gene (886 bp) was amplified using the forward (CCCCTGCAGTGGAAAAATCTGAAATATATA) and reverse (TCCGCGGCCGCCTTTCTCGCAAGTCTCCTG) primers (Fig. 1A). The Lac-Z expression was obtained with ligation of the Lac-Z gene downstream of the N. caninum tubulin 5 coding sequence flanking region. Treatment of Ncdhrf-CAT with Pstl allowed ligation between the CAT coding sequence and the 3 UTR region of NcDHFRTS gene, generating the Ncdhfr-CAT/NcTub-tetO/Lac-Z construct (Fig. 1B). The tetO region is a site with affinity to the TetR protein extracted from a T. gondii construct [8], but only the -galactosidase expression was used in this manuscript. 2.3. Stably transfected tachyzoites and CAT-ELISA The plasmids (25 g) were inserted in freshly purified N. caninum tachyzoites (1 × 108 ) by the enzyme restriction mediated integration (REMI) with HindIII, in cytomix buffer (120 mM KCl, 0.15 mM CaCl2 , 10 mM K2 HPO4 /KH2 PO4 , 25 mM Hepes, 2 mM EDTA, 5 mM MgCl2 , pH 7.6) supplemented with 5 mM glutathione, as described by [11]. Cells were transferred to a 0.4 cm gap cuvette, electroporated with 1.8 kV at 25 mFd and 100 in a BioRad GenePulser Xcell and incubated for 18 h at 37 ◦ C, 5% CO2 , when 30 M of chloramphenicol was added. After the lytic cycle, tachyzoites were purified and cultured with 20 M of chloramphenicol
until the development of resistant tachyzoites in the third week. Two weeks later, stable transfected tachyzoites (1 × 107 ) were compared with the wild type strain for the expression of chloramphenicol acetyltransferase using the CAT-ELISA kit (Roche Applied Science, USA), following the manufacturer’s instructions. The reaction was read at an absorbance of 405 nm (Synergy H1, BioTek, software Gen5 2.01) and absorbance of the Vero cells was used as blank; values were analysed by one-way ANOVA with the software Prism 5.1, and post-analysed by Tukey test. 2.4. Selection of Lac-Z tachyzoites under chloramphenicol Two equal and independent aliquots of purified tachyzoites (3 × 107 ) were transfected, in separated cuvettes, with 5 g of plasmid Ncdhfr-CAT/NcTub-tetO/Lac-Z, previously treated with HindIII, and incubated in 5% CO2 at 37 ◦ C for 18 h, at which point four concentrations of chloramphenicol (5, 10, 20 and 40 M) were added. After each lytic cycle, the tachyzoites were purified in Sephadex G-25 (PD-10 columns, GE) and 1 × 104 tachyzoites were inoculated in a new Vero cell culture until the next lytic cycle. The purified tachyzoites were counted in a haemocytometer and 1 × 103 , 1 × 104 , 1 × 105 and 1 × 106 (only after the third cycle) were incubated with 5 mM of CPRG (chlorophenolred-d-galactopyranoside, Roche) for 18 h at 37 ◦ C. The samples were transferred to a 96-well plate in duplicate and the absorbance was measured at 570 nm (Synergy H1, BioTek). The absorbance equivalent to 1 × 105 tachyzoites with the standard error was calculated and plotted against each lytic cycle. 2.5. Rescue of plasmid from transfected tachyzoites Genomic DNA from stable tachyzoites (5 × 107 ), selected using 20 M of chloramphenicol for 2 months, was extracted (Wizard® Genomic DNA Purification kit, Promega), treated with Pstl (0.5 U) for 18 h, purified (Illustra GFX PCR DNA and Gel Band Purification Kit, GE) and eluted in 30 l of deionised water. A volume of 17 l was submitted to a ligation reaction with 0.4 U Weiss of T4 ligase (Fermentas) for 18 h at 16 ◦ C. The ligated N. caninum DNA was electroporated in E. coli Top10 (2.5 kV; 25 F; 200 ), and the ampicillin-resistant colonies were either PstI- or EcoRl-treated for visualisation of the whole plasmid or for verification of the NcdhfrCAT insertion, respectively. 2.6. Semi-quantification of rescued plasmids Genomic DNA from stable tachyzoites (1 × 107 ) selected with 5, 10, 20 and 40 M of chloramphenicol from the seventh lytic cycle were extracted (Wizard® Genomic DNA Purification kit, Promega) and 50 ng (GeneQuant Pro, The GE Healthcare Lifesciences, formerly Amersham Biosciences) was amplified using the PCR primers Forward Ncdhfr (TTTAAGCTTTGGGCATCACTGAGGGACTT)
L.M. Pereira, A.P. Yatsuda / Molecular & Biochemical Parasitology 196 (2014) 75–81
and reverse CAT (CCCCATATGTTATGCCCCGCCCTGCCA) with HotStarTaq DNA Polymerase (Qiagen). The touchdown PCR conditions were: one cycle 94 ◦ C, 1 min; 25 cycles 94 ◦ C, 30 s; five cycles 60 ◦ C, 30 s; five cycles 55 ◦ C, 30 s; 15 cycles 50 ◦ C, 30 s and 25 cycles 72 ◦ C, 2 min. The 5 coding sequence flanking region from the ribosomal gene NcRPS13 (NCBI: XM 003883829.1) was amplified under the same conditions as a control, using the forward and reverse NcRPS13 primers (CCCAAGCTTCCCAGGTTTGCGTTGT and CCGTTCCGAAGCTGTCGAATTCTCTC, respectively). 2.7. ˇ-Galactosidase detection by CPRG The cultures from invasion and proliferation assays (items 2.10 and 2.11) were lysed with -galactosidase lysis buffer (100 mM 4(2-hydroxyethyl)-1-piperazineethanesulfonic acid, pH 8.0; 1 mM CaCl2 ; 1% Triton X-100, 0.5% SDS; 5 mM DTT) for 1 h at 50 ◦ C and centrifuged for 10 min at 10,000 × g. Each lysate (20 l) was incubated with 5 mM CPRG in -galactosidase lysis buffer for 18 h at 37 ◦ C in an ELISA plate (Nunc) and the reading was taken at 570 nm in an ELISA reader (Synergy H1, BioTek). 2.8. ˇ-Galactosidase detection by X-Gal precipitation The N. caninum tachyzoites expressing Lac-Z were detected by the X-Gal precipitation with the kit -Gal Staining Set (Roche). The samples from the culture supernatant, and of invasion and proliferation assays (items 2.10 and 2.11) were submitted to a similar procedure. The samples were fixed with 2% formaldehyde, washed twice with PBS and incubated with the working solution (Iron buffer and X-Gal solution from the kit -Gal Staining Set) for 2 h at 37 ◦ C. The samples were washed twice with PBS, mounted in glycerol 60% and the images captured with the AxioCam MRc 5 camera in the microscope Zeiss Axioskop 40 and processed using the AxioVison 4.6 software. 2.9. ˇ-Galactosidase detection by fluorescence
77
and incubated with the working solution (X-Gal precipitation). The outcomes from CPRG were plotted for the calculation of the R2 linear regression by the program GraphPad Prism 5.1. The images from X-Gal precipitation were captured with the AxioCam MRc 5 camera in the microscope Zeiss Axioskop 40 and processed by the AxioVison 4.6 software. 2.11. Proliferation assay Purified tachyzoites (1 × 103 /well) were incubated in Vero cell monolayers in 24-well plates (TPP) for CPRG or 8-well chambers (TPP) for X-Gal precipitation for 18 h, at 37 ◦ C, 5% CO2 ; to the medium, different dilutions of pyrimethamine (Sigma) were added: 16, 8, 4, 2, 1, 0.5 and 0.25 M for CPRG and 4, 2, 1, 0.5 and 0.25 M for X-Gal. These samples were incubated for a further 54 h (total of 72 h) at 37 ◦ C, 5% CO2 . The samples for CPRG reaction or X-Gal precipitation were processed as previously described (2.7 and 2.8). The percentage of inhibition, for CPRG reaction, was calculated using the formula (100 – ((T/C) × 100)), where T is the absorbance of the treated well and C the absorbance of the wells without any drug. A similar calculation was performed for X-Gal precipitation, where T and C represent the mean of the 20 field counts of treated and control wells, respectively, in an optic microscope. 3. Results 3.1. Detection of CAT enzyme expression in N. caninum tachyzoites The chloramphenicol acetyltransferase activity in transfected tachyzoites exhibited a significant absorbance of 1.296 for NcdhfrCAT (data not show). The tachyzoites were evaluated 2 weeks after the rise of stable tachyzoites (which corresponds to a total of 5 weeks of chloramphenicol selection). The resistance of stable transfected tachyzoites was retained for 14 months under chloramphenicol selection.
The supernatant of a 5-day culture of tachyzoites (2 × 107 ) from N. caninum selected by chloramphenicol (5, 10, 20 and 40 M, of the seventh cycle) was fixed with 2% formaldehyde and ligated to a poly-l-lysine coated coverslip (Sigma) for 30 min. The coverslips were washed twice with PBS and permeabilised with 0.2% PBS-Triton 100 for 30 min and washed twice with PBS. The samples were blocked with PBS-BSA (3% BSA, glycine 50 mM) for 18 h at 4 ◦ C, washed twice with PBS, incubated with mouse anti-galactosidase (Sigma) for 1 h at 37 ◦ C and washed twice with PBS; this was followed by incubation with conjugated anti-mouse Alexa-488 (Invitrogen) and washing twice with PBS. The coverslips were mounted with DAPI (Santa Cruz) and the images were captured using a Confocal Microscope (Leica TCS SP5 Laser Scanning Confocal Microscope, Leica Microsystems, Heidelberg, Germany). The images were captured by a 60× objective in oil immersion. Three images of 0.6 m from each channel were captured, grouped and processed by the program Image J 1.41 (National Institutes of Health, USA).
3.2. Expression of Lac-Z after selection with chloramphenicol in N. caninum tachyzoites
2.10. Invasion assay
3.3. Episomal stability of parasites
The invasion of tachyzoites was measured by CPRG and X-Gal precipitation. Purified tachyzoites were diluted (1 × 106 ; 5 × 105 ; 1 × 105 , 5 × 104 and 1 × 104 for CPRG and 1 × 106 ; 5 × 105 ; 1 × 105 and 5 × 104 for X-Gal precipitation) and incubated on a Vero cell monolayer in a 24-well (TPP) plate or 8-well chamber slide (Nunc Lab-Tek® ) respectively for CPRG and X-Gal precipitation. The cultures were incubated for 2 h at 37 ◦ C, in 5% CO2 , washed three times with PBS and lysed with -galactosidase lysis buffer (CPRG) or fixed
Tachyzoites Ncdhfr-CAT or Ncdhfr-CAT/Lac-Z selected with 20 M of chloramphenicol were stable in culture for 14 months, at which point the growth started to decrease, until being completely extinguished after 18 months of culture (inclusive in the absence of chloramphenicol). After treatment of the genomic DNA with PstI (Fig. S1A) and recircularisation, only plasmids without genomic DNA of N. caninum were found, with a size of 5.9 kb (Fig. S1B). The treatment of the rescued plasmids with EcoRI (Fig. S1C)
The selection under chloramphenicol generated tachyzoites with different patterns of Lac-Z expression (Fig. 2). Parasites selected with higher concentrations (40 and 20 M) reached a plateau of Lac-Z expression after the fourth lytic cycle, when the number of tachyzoites increased, similarly to the wild culture after the fifth cycle. Chloramphenicol at 10 M has a slight effect on tachyzoite proliferation and the Lac-Z expression peak was reached after the seventh cycle. The proliferation of tachyzoites under 5 M was not affected and the expression of Lac-Z was similar along the process of selection. The control transfected and non-selected indicated a -galactosidase activity similar to the selected with 5 M of drug in the first lytic cycle. The Lac-Z expression decreased until the wild type levels after the third cycle. The expression of Lac-Z of the parasites under 40, 20, 10 and 5 M exhibited a relative absorbance per 105 tachyzoites of 33.7; 23.3; 0.32 and 0.0045, respectively.
78
L.M. Pereira, A.P. Yatsuda / Molecular & Biochemical Parasitology 196 (2014) 75–81
Fig. 2. Selection of Neospora caninum tachyzoites Ncdhfr-CAT/NcTub-tetO/Lac-Z with chloramphenicol. Four groups of purified tachyzoites (3 × 107 ), in two parallel assays, were transfected with 5 g of Ncdhfr-CAT/NcTub-tetO/Lac-Z and incubated for 18 h. Each culture was incubated with 5, 10, 20 and 40 M of chloramphenicol, purified after the lytic cycle and inoculated (1 × 104 ) in a new Vero culture. The purified tachyzoites from each lytic cycle were counted and the -galactosidase activity measured by CPRG reaction and the absorbance 570 nm per 105 tachyzoites calculated. (A) Logarithm of Absorbance/105 tachyzoites plotted against the respective lytic cycle. (B) Tachyzoites counted in a haemocytometer and plotted against the respective lytic cycle.
liberated the predicted fragment of 1170 bp (Fig. S1D), with the typical pattern of circular Ncdhfr-CAT. Therefore, the resistance for 14 months against the drug occurred due to episomal forms of the plasmid which were detected in all of the rescued clones. Supplementary Fig. S1 related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.molbiopara. 2014.08.001. The detection of plasmids by PCR was readily observed for tachyzoites selected with 20 and 40 M and a faint band was observed for 10 M, whereas for 5 M and wild type samples, the plasmids were undetectable (Fig. 3A, lanes 5, 4, 3, 2 and 1, respectively). In parallel, amplification of part of the 5 coding sequence flanking region from the ribosomal gene NcRPS13 (651 bp) indicated a similar amount of DNA extracted from each sample (Fig. 3A). The same batch of parasites was tested for Lac-Z expression. The tachyzoites selected with 40 M (ABS 20.87) improved the -galactosidase activity 1.5 (ABS 13.4), 52 (ABS 0.4) and 4496 (ABS 0.0046) times compared to 20 M, 10 M and 5 M, respectively (Fig. 3B). 3.4. Detection of Lac-Z tachyzoites after invasion Two hours after invasion, the N. caninum tachyzoites expressed Lac-Z detectable up to 1 × 104 /well. The absorbance of each dilution was 1.5 (1 × 106 ); 1.0 (5 × 105 ); 0.163 (1 × 105 ); 0.117 (5 × 104 ) and 0.025 (1 × 104 ), excluding the absorbance of wild tachyzoites. The number of tachyzoites and their absorbance were sufficiently proportional to generate a linear regression curve with R2 of 0.955 (Fig. S2). Supplementary Fig. S2 related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.molbiopara. 2014.08.001. 3.5. Detection of Lac-Z expression by X-Gal precipitation The precipitation of X-Gal was proportional to the concentration of chloramphenicol, being very intense in tachyzoites selected with
Fig. 3. Detection of Ncdhfr-CAT/NcTub-tetO/Lac-Z by PCR and Lac-Z expression by CPRG. Detection of the Ncdhfr-CAT and the region of the 5 coding sequence flanking region NcRPS13 from genomic DNA of Neospora caninum Lac-Z tachyzoites selected with 5, 10, 20 and 40 M. (A) Agarose electrophoresis (0.8%) of the Ncdhfr-CAT and NcRPS13 amplification; lane 1 = wild type N. caninum, lanes 2–5 = N. caninum Lac-Z, selected with, respectively, 5, 10, 20 and 40 M of chloramphenicol. (B) Relative absorbance per 105 tachyzoites selected with chloramphenicol from the seventh cycle, evaluated by CPRG reaction.
20 and 40 M (Fig. S3B and S3A), indicating the consistency of the tubulin promoter from N. caninum and the adaptation of the vector within the parasite expression machinery. The tachyzoites selected with lower concentrations of the drug (10 and 5 M) did not exhibit a visible precipitation, as observed in the wild type (Fig. S3C, D and E). Supplementary Fig. S3 related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.molbiopara. 2014.08.001. The Lac-Z tachyzoites were visualised macroscopically, forming a blue pellet after centrifugation (Fig. 4A), in contrast to the wild ones (Fig. 4B). The staining allowed the detection of isolated tachyzoites (Fig. 4C) including the visualisation of replicating (Fig. 4D) and early egressed forms (Fig. 4E). Tachyzoites were detected after invasion in Vero cells and different amounts of incubated parasites were distinguishable at concentrations of 1 × 106 , 5 × 105 , 1 × 105 and 5 × 104 (Fig. 4F, G, H and I, respectively). 3.6. Detection of ˇ-galactosidase by fluorescence The -galactosidase form expressed by N. caninum was detected with an antiserum against the enzyme form from E. coli. The fluorescence allowed the discrimination of isolated parasites and indicated a uniform distribution of the enzyme along the parasite (Fig. 5A–D). The concentration of chloramphenicol during the selection of parasites had an influence on the -galactosidase expression and, consequentially, on the fluorescence detection. Parasites selected with 40 and 20 M of drug demonstrated an intense fluorescence, whereas expression under 10 and 5 M (Fig. 5G and H, respectively) was not sufficient to allow detection by this method and the tachyzoites were undifferentiated when compared to the wild type (Fig. 5I). 3.7. Evaluation of N. caninum (Ncdhfr-CAT/NcTub-tetO/Lac-Z) susceptibility to pyrimethamine The expression of -galactosidase allowed the measurement of tachyzoite proliferation by two methods: CPRG (Fig. 6A) and counting after X-Gal precipitation (Fig. 6B–H). Concentrations higher than 1 M of pyrimethamine inhibited the replication by ∼80% in
L.M. Pereira, A.P. Yatsuda / Molecular & Biochemical Parasitology 196 (2014) 75–81
79
Fig. 5. Detection of N. caninum Lac-Z (Ncdhfr-CAT/NcTub-tetO/Lac-Z) by fluorescence. Tachyzoites selected with chloramphenicol were fixed, permeabilised, blocked and incubated with mouse anti--galactosidase and anti-mouse Alexa 488 labelled conjugate and the nucleus stained with DAPI. (A) The nuclei were visualised with DAPI. (B) Detection of -galactosidase. (C) Visualisation of tachyzoites by optic microscopy. (D) Images A, B and C merged. (E–I) Visualisation of nucleus and galactosidase from tachyzoites selected with 5, 10, 20 and 40 M of chloramphenicol and the wild type, respectively.
Fig. 4. Detection of N. caninum Lac-Z tachyzoites (Ncdhfr-CAT/NcTub-tetO/Lac-Z) by X-Gal precipitation. The tachyzoites were detected by three approaches with the kit -Gal Staining Set (Roche): in isolated forms, after cell invasion and the supernatant of a 5-day infected culture. (A and B) Macroscopic visualisation of X-Gal precipitation in Lac-Z and wild tachyzoites, respectively. (C) Isolated Lac-Z tachyzoites. (D) Lac-Z tachyzoites replicating on a Vero cell. (E) Early egressed Lac-Z tachyzoites. (F, G, H and I) Vero cells monolayers incubated with 1 × 106 ; 5 × 105 ; 1 × 105 and 5 × 104 tachyzoites, respectively, for 2 h.
the CPRG assay (Fig. 6A) and ∼75% by X-Gal precipitation and counting (Fig. 6B). The visualisation of the cultures incubated with the drug indicated a similar pattern, when the replication was inhibited at concentrations higher than 1 M (Fig. 6F, G and H) and demonstrated a partial proliferation with 0.5 and 0.25 M (Fig. 6D and E) compared to the control (Fig. 6C). 4. Discussion Despite being poorly developed for N. caninum, the insertion of genes in T. gondii started more than 20 years ago with cassettes based on CAT [6], followed by mutated DHFR [12], complete knockouts [13], the insertion of reporter genes such as Lac-Z [14] or GFP [10] and the site-specific insertion of genes [15]. We demonstrate that N. caninum, which is closely related to T. gondii, is a suitable model for the expression of chloramphenicol acetyltransferase (CAT). The design of vectors based on this enzyme allowed the insertion of Lac-Z gene and the tagging of tachyzoites.
The expression of CAT in N. caninum was robust, similar to the findings reported for T. gondii [6]. Our work also evaluated CAT expression by the CAT ELISA, which directly indicates the increase of enzyme expression. The tagging of N. caninum with CAT is a complementary method used to detect tachyzoites via in vitro assays, as performed in eukaryotic cells [16,17]. The episomal pattern allowed a preliminary form of gene expression control in N. caninum. The dosage of chloramphenicol determined the proportional expression of Lac-Z, according to the selection with 5 or 10 M and 20 or 40 M of the drug by CPRG assay. X-Gal precipitation and fluorescence confirmed the application of chloramphenicol as a drug for expression control, complementing the insertion of genes. In addition to the low galactosidase detection, the tachyzoites selected with 5 and 10 M of chloramphenicol exhibited the same fluorescence and X-Gal precipitation as the wild type, which were clearly detectable on parasites selected with 20 or 40 M. The possibility to improve the expression of inserted genes by the addition of chloramphenicol is the first molecular tool for the evaluation of genes in N. caninum. The overexpression of genes will contribute to the evaluation and design of tachyzoites applicable for protective tests in vivo or for evaluating the effects of genes related to invasion, gliding or metabolism. The overexpression of reporter genes such as GFP, YFP and luciferase might allow the design of more sensitive tests for the detection of N. caninum without modifying the genome. Additionally, the improvement of expression by chloramphenicol will probably be useful for the detection of poorly expressed proteins in N. caninum.
80
L.M. Pereira, A.P. Yatsuda / Molecular & Biochemical Parasitology 196 (2014) 75–81
Fig. 6. Incubation of N. caninum Lac-Z (Ncdhfr-CAT/NcTub-tetO/Lac-Z) with pyrimethamine. The proliferation of N. caninum was evaluated by CPRG reaction and X-Gal precipitation after incubation with pyrimethamine. Tachyzoites (1 × 103 /well) were incubated in 24-well plates (for CPRG) or 8-well chambers (for X-Gal precipitation) and serial dilutions of pyrimethamine were added after 18 h, followed by incubation for a further 54 h (total of 72 h). (A) Percentage of inhibition of N. caninum proliferation incubated with pyrimethamine and evaluated after CPRG reaction (A) or X-Gal precipitation and counting (B). (C–H) Images of N. caninum incubated with serial dilutions of pyrimethamine (0, 0.25, 0.5, 1, 2 and 4 M).
Lac-Z in T. gondii appeared as direct alternatives to evaluate the effects of drugs on parasites [18,19], lysis [20] and detection in tissues [14]. The Lac-Z N. caninum adhered/invaded the Vero cells with a correlation between the number of tachyzoites and galactosidase activity (R2 ) of 0.955. The standardisation of a fast and simple invasion assay amplified the range of inhibitors/enhancers to be tested on invasion, thus optimising the screening process of drug candidates. Furthermore, the episomal maintenance of resistance generates tagged tachyzoites with unaltered genomic structure and the presence of Lac-Z expression during 14 months of selection represents a long time window for the use of the tachyzoites. Despite the application of REMI transfection, which elevated the integration rate in T. gondii [11] no evidence of integration was found and the episomal form was predominant for N. caninum. The parasites could be detected not only macroscopically (the blue pellet was visible after centrifugation), but also microscopically (either isolated or after invasion in Vero cells). As this was an enzymatic reaction, the colour appeared as a complement for the detection and quantification by microscopic counting, which, for N. caninum, was mainly based on immunofluorescence [21,22], immunohistochemistry [23] and direct staining [9,24]. The detection of tachyzoites under different stages of replication in Vero cells opens up the possibility of refining the assay via the substitution of 5 coding sequence flanking regions, which can improve or decrease the X-Gal precipitation or have a time-specific expression for detection in different periods of the life cycle, as seen for the promoter of BAG1 activated in the bradyzoite stage [25].
Lac-Z tachyzoites allowed the design of proliferation assays and the evaluation of drugs in this process. The parasites were inhibited by pyrimethamine, an important drug for toxoplasmosis [26,27] and an auxiliary drug for malaria prophylaxis [28]. Despite the great potential for neosporosis combat, the application of pyrimethamine on N. caninum proliferation assays has been described once, based on microscopic counting after Giemsa staining of the cultures [29], where the concentration of total inhibition was 0.05 g/ml [29]. In contrast, in our conditions, 0.25 M (0.062 g/ml) inhibited the proliferation in ∼30% of cells. An effective dose to block N. caninum proliferation at levels of ∼80% was found to be 1 M (0.25 g/ml). These results will provide guidance to a more specific form to determine the ideal dosage for in vivo approaches, which will upgrade the application of folate inhibitors on neosporosis combat. Giemsa and other forms of subjective evaluation of proliferation demand specialised technique support in contrast to the CPRG assay. Also, X-Gal precipitation exhibits proliferation without staining the host cells, as observed for Giemsa. The application of the insertion of CAT vectors into genes amplifies the tools for N. caninum detection and the evaluation of molecular manipulation effects. The episomal maintenance and dose-response pattern of tachyzoites selected with chloramphenicol indicates a new form of expression control of inserted genes in N. caninum, which will lead to the development of more refined methods for gene evaluation. The tagging of tachyzoites without genomic modification is the functional contribution of this work, offering parasites that are more closely related to wild type ones.
L.M. Pereira, A.P. Yatsuda / Molecular & Biochemical Parasitology 196 (2014) 75–81
Acknowledgements We would like to thank CNPq (478767/2007-2) and FAPESP (2005/53785-9) for the research Grants; FAPESP for the PhD fellowship to L.M.P. (2009/07713-7) and Intervet International (current Merck Animal Health) for the plasmid with TetO and Lac-Z sequences (pRPS13LacZ, [8]). References [1] Dubey JP, Schares G. Neosporosis in animals – the last five years. Vet Parasitol 2011;180(1–2):90–108. [2] Pereira LM, Baroni L, Yatsuda AP. A transgenic Neospora caninum strain based on mutations of the dihydrofolate reductase-thymidylate synthase gene. Exp Parasitol 2014;138:40–7. [3] Neu HC, Gootz TD. Antimicrobial chemotherapy. In: Baron S, editor. Medical microbiology. Galveston, TX: University of Texas Medical Branch at Galveston; 1996. [4] Ramya TN, Mishra S, Karmodiya K, Surolia N, Surolia A. Inhibitors of nonhousekeeping functions of the apicoplast defy delayed death in Plasmodium falciparum. Antimicrob Agents Chemother 2007;51(1):307–16. [5] Shaw WV, Packman LC, Burleigh BD, Dell A, Morris HR, Hartley BS. Primary structure of a chloramphenicol acetyltransferase specified by R plasmids. Nature 1979;282(5741):870–2. [6] Kim K, Soldati D, Boothroyd JC. Gene replacement in Toxoplasma gondii with chloramphenicol acetyltransferase as selectable marker. Science 1993;262(5135):911–4. [7] Meissner M, Schluter D, Soldati D. Role of Toxoplasma gondii myosin A in powering parasite gliding and host cell invasion. Science 2002;298(5594): 837–40. [8] van Poppel NF, Welagen J, Duisters RF, Vermeulen AN, Schaap D. Tight control of transcription in Toxoplasma gondii using an alternative tet repressor. Int J Parasitol 2006;36(4):443–52. [9] Pereira LM, Candido-Silva JA, De Vries E, Yatsuda AP. A new thrombospondinrelated anonymous protein homologue in Neospora caninum (NcMIC2-like1). Parasitology 2011;138(3):287–97. [10] Striepen B, He CY, Matrajt M, Soldati D, Roos DS. Expression, selection, and organellar targeting of the green fluorescent protein in Toxoplasma gondii. Mol Biochem Parasitol 1998;92:325–38. [11] Black M, Seeber F, Soldati D, Kim K, Boothroyd JC. Restriction enzyme-mediated integration elevates transformation frequency and enables co-transfection of Toxoplasma gondii. Mol Biochem Parasitol 1995;74:55–63. [12] Donald RG, Roos DS. Stable molecular transformation of Toxoplasma gondii: a selectable dihydrofolate reductase-thymidylate synthase marker based on drug-resistance mutations in malaria. Proc Natl Acad Sci U S A 1993;90(24):11703–7.
81
[13] Donald RG, Carter D, Ullman B, Roos DS. Insertional tagging, cloning, and expression of the Toxoplasma gondii hypoxanthine-xanthine-guanine phosphoribosyltransferase gene. Use as a selectable marker for stable transformation. J Biol Chem 1996;271(24):14010–9. [14] Seeber F, Boothroyd JC. Escherichia coli beta-galactosidase as an in vitro and in vivo reporter enzyme and stable transfection marker in the intracellular protozoan parasite Toxoplasma gondii. Gene 1996;169(1):39–45. [15] Huynh MH, Carruthers VB. Tagging of endogenous genes in a Toxoplasma gondii strain lacking Ku80. Eukaryot Cell 2009;8(4):530–9. [16] Gorman CM, Moffat LF, Howard BH. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol Cell Biol 1982;2(9):1044–51. [17] New DC, Miller-Martini DM, Wong YH. Reporter gene assays and their applications to bioassays of natural products. Phytother Res 2003;17(5):439–48. [18] Jin C, Jung SY, Kim SY, Song HO, Park H. Simple and efficient model systems of screening anti-Toxoplasma drugs in vitro. Expert Opin Drug Discov 2012;7(3):195–205. [19] McFadden DC, Seeber F, Boothroyd JC. Use of Toxoplasma gondii expressing beta-galactosidase for colorimetric assessment of drug activity in vitro. Antimicrob Agents Chemother 1997;41(9):1849–53. [20] Seeber F. An enzyme-release assay for the assessment of the lytic activities of complement or antimicrobial peptides on extracellular Toxoplasma gondii. J Microbiol Methods 2000;39(3):189–96. [21] He P, Li J, Gong P, Liu C, Zhang G, Yang J, et al. Neospora caninum surface antigen (p40) is a potential diagnostic marker for cattle neosporosis. Parasitol Res 2013;112(5):2117–20. [22] Borsuk S, Andreotti R, Leite FP, Pinto L da S, Simionatto S, Hartleben CP, et al. Development of an indirect ELISA-NcSRS2 for detection of Neospora caninum antibodies in cattle. Vet Parasitol 2011;177(1–2):33–8. [23] Medina-Esparza L, Macias L, Ramos-Parra M, Morales-Salinas E, Quezada T, Cruz-Vazquez C. Frequency of infection by Neospora caninum in wild rodents associated with dairy farms in Aguascalientes, Mexico. Vet Parasitol 2013;191(1–2):11–4. [24] Machado RZ, Mineo TW, Landim Jr LP, Carvalho AF, Gennari SM, Miglino MA. Possible role of bovine trophoblast giant cells in transplacental transmission of Neospora caninum in cattle. Rev Bras Parasitol Vet 2007;16(1):21–5. [25] Kobayashi T, Narabu S, Yanai Y, Hatano Y, Ito A, Imai S, et al. Gene cloning and characterization of the protein encoded by the Neospora caninum bradyzoitespecific antigen gene BAG1. J Parasitol 2013;99(3):453–8. [26] Kaye A. Toxoplasmosis: diagnosis, treatment, and prevention in congenitally exposed infants. J Pediatr Health Care 2011;25(6):355–64. [27] Rorman E, Zamir CS, Rilkis I, Ben-David H. Congenital toxoplasmosis-prenatal aspects of Toxoplasma gondii infection. Reprod Toxicol 2006;21(4):458–72. [28] Nwakanma DC, Duffy CW, Amambua-Ngwa A, Oriero EC, Bojang KA, Pinder M, et al. Changes in malaria parasite drug resistance in an endemic population over a 25-year period with resulting genomic evidence of selection. J Infect Dis 2014;209:1126–35. [29] Lindsay DS, Dubey JP. Evaluation of anti-coccidial drugs’ inhibition of Neospora caninum development in cell cultures. J Parasitol 1989;75(6):990–2.
