The critical role of myeloid-derived suppressor cells and FXR activation in immune-mediated liver injury.

Journal of Autoimmunity xxx (2014) 1e12

Contents lists available at ScienceDirect

Journal of Autoimmunity journal homepage: www.elsevier.com/locate/jautimm

The critical role of myeloid-derived suppressor cells and FXR activation in immune-mediated liver injury Haiyan Zhang a, b,1, Yuan Liu a, b,1, Zhaolian Bian a, b, Shanshan Huang a, b, Xiaofeng Han a, b, Zhengrui You a, b, Qixia Wang a, b, Dekai Qiu a, b, Qi Miao a, b, Yanshen Peng a, b, Xiaoying Li c, Pietro Invernizzi d, Xiong Ma a, b, * a Division of Gastroenterology and Hepatology, Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai Institute of Digestive Disease, China b Key Laboratory of Gastroenterology & Hepatology, Ministry of Health (Shanghai Jiao-Tong University), Shanghai, China c Shanghai Institute of Endocrinology and Metabolism, Department of Endocrine and Metabolic Diseases, Shanghai Clinical Center for Endocrine and Metabolic Diseases, Ruijin Hospital, School of Medicine, Shanghai Jiao Tong University, China d Liver Unit and Center for Autoimmune Liver Diseases, Humanitas Clinical and Research Center, Rozzano, Milan, Italy

a r t i c l e i n f o

a b s t r a c t

Article history: Received 12 February 2014 Accepted 23 February 2014

The immunobiology of FXR has attracted significant attention in immune regulation and innate immunity. We have studied the mechanism of action of FXR activation on two models of acute hepatitis, inflammation mediated by Con A and a-GalCer and focused on the interactions of FXR activation and expression of PIR-B, both in vivo and in vitro using luciferase reporter and CHIP assays. In addition, based upon our data, we studied the role of FXR activation on the immunobiology of myeloid-derived suppressor cells (MDSCs). Importantly, we report herein that FXR activation reduces the inflammatory insult induced by either a-GalCer or Con A; such treatment expands CD11bþLy6Cþ MDSCs. The protective effect of FXR activation is dependent on expansion of MDSCs, particularly liver CD11bþLy6Chigh cells. Indeed, FXR activation enhances the suppressor function of MDSCs through upregulation of PIR-B by binding the PIR-B promoter. FXR activation drives the accumulation of MDSCs to liver through upregulation of S100A8. FXR activation facilitates homing and function of MDSCs, which function as a critical negative feedback loop in immune-mediated liver injury. The novel mechanisms defined herein emphasize not only the importance of liver lymphoid subpopulations, but also the potential roles of modulating FXR in autoimmune liver disease. Ó 2014 Elsevier Ltd. All rights reserved.

Keywords: Autoimmunity FXR activation Lymphoid subpopulations Myeloid-derived suppressor cells

1. Introduction FXR is a highly expressed hepatic nuclear bile acid receptor; it serves as a ligand-mediated transcription factor that regulates expression of genes involved in liver homeostasis [1]. Interestingly, however, FXR also has an important role in immune regulation, including modulation of multiple lymphoid lineages [2,3]. Within the lymphoid liver, there is a unique and newly identified lymphoid population, coined myeloid-derived suppressor cells (MDSCs), which both accumulate and preferentially home to liver and appear to play multiple roles, including immunosuppression [4]. MDSCs

* Corresponding author. Ren Ji Hospital, School of Medicine, Shanghai Jiao Tong University, Shanghai Institute of Digestive Disease, 145 Shandong Middle Road, Shanghai 200001, China. Tel.: þ86 21 63200874; fax: þ86 21 63266027. E-mail address: [email protected] (X. Ma). 1 These authors contributed equally to this paper.

also function as an important negative feedback mechanism and reduction in either number or activity of this cell population facilitates inflammatory liver injury [5]. Myeloid-derived suppressor cells (MDSCs) are a heterogeneous population of myeloid cells consisting of progenitor and immature myeloid cells [6]. In mice, MDSCs are characterized by co-expression of the myeloid-cell lineage differentiation antigen Gr1 and CD11b [7]. Gr1 has two different epitopes, Ly6G and Ly6C [7,8]; the use of Ly6G and Ly6C-specific antibodies has led to the identification of two MDSCs subsets: granulocytic MDSCs with a CD11bþ Ly6GþLy6Clow phenotype and monocytic MDSCs with a CD11bþLy6GLy6Chigh phenotype [8]. MDSCs have a remarkable ability to suppress T cell responses and regulate innate immunity by modulating cytokine production [8,9]. The liver is an important site for MDSCs accumulation that can result in tolerance and/or immunosuppression [4], by interacting with both Kupffer cells [4] and natural killer cells [10]. In TGFb1

http://dx.doi.org/10.1016/j.jaut.2014.02.010 0896-8411/Ó 2014 Elsevier Ltd. All rights reserved.

Please cite this article in press as: Zhang H, et al., The critical role of myeloid-derived suppressor cells and FXR activation in immune-mediated liver injury, Journal of Autoimmunity (2014), http://dx.doi.org/10.1016/j.jaut.2014.02.010

2

H. Zhang et al. / Journal of Autoimmunity xxx (2014) 1e12

Abbreviations FXR farnesoid X receptor MDSCs myeloid-derived suppressor cells Con A concanavalin A a-GalCer a-galactosylceramide PIR-B paired immunoglobin-like receptor-B CHIP chromatin immunoprecipitation TGF transforming growth factor GFP green fluorescent protein IP Intraperitoneally IV intravenously ALT alanine aminotransferase AST aspartate transaminase MNCs mononuclear cell HMNCs hepatic mononuclear cells FACS flow cytometry BM MDSCs bone marrow-derived myeloid-derived suppressor cells Ct threshold cycle PBS phosphate-buffered saline

FBS GM-CSF WT SEAP Gluc RLU RXR SD RT-PCR IHC MHC FXRE IL COX-2 CCL-2 mRNA H&E MFI VEGF cDNA

fetal bovine serum granulocyte-macrophage colony stimulating factor wild-type secreted alkaline phosphatase Gaussia luciferase relative light unit retinoid X receptor standard deviation real time-polymerase chain reaction immunohistochemistry major histocompatibility complex farnesoid X receptor response element interleukin cyclooxygenase 2 chemokine (CeC motif) ligand 2 messenger RNA hematoxylin and eosin mean fluorescence intensity vascular endothelial growth factor complementary DNA

deficient mice, liver Th1 cell accumulation is accompanied by MDSCs [5]; suppressor function is specifically associated with the “monocytic” CD11bþLy6GLy6Chigh subset of liver TGFb1/ CD11bþ cells. To address the role of MDSCs in immune-mediated liver injury and the potential role of FXR, we induced liver injury with a-GalCer and Con A and focused on the cellular basis of inflammation and its influence by FXR.

In both of these experiments, sera were analyzed for levels of ALT and AST using a multichannel autoanalyzer [13,14]. Sections of liver tissues were fixed in 10% formalin, embedded in paraffin for subsequent usage. Parts of the liver were snap frozen for future RNA studies. Finally, the majority of the liver and spleen were used for mononuclear cell preparations for subsequent phenotypic analysis using flow cytometry.

2. Materials and methods

2.3. The effect of MDSCs depletion on development of immunemediated hepatitis

2.1. Mice C57BL/6J mice were obtained from the Shanghai SLAC Laboratory Animal Co. Ltd. FXR null mice were kindly provided by Professor Xiaoying Li (Shanghai Institute of Endocrinology and Metabolism, Ruijin Hospital). C57BL/6 GFP transgenic mice (C57BL/ 6-Tg (CAG-EGFP)131Osb/LeySopJ) were kindly provided by Jufang Yao (Renji Hospital). All mice were housed under pathogen-free conditions in the animal facility of Renji Hospital, School of Medicine, Shanghai Jiao Tong University.

To identify the role of MDSCs in the immune-mediated hepatitis and the relative contribution of FXR activation, groups of C57BL/6 male mice were injected with either 100 mg of anti-murine Gr1 antibody or an irrelevant IgG control 24 and 12 h before a-GalCer treatment. This dose of anti-Gr1 antibody was chosen as optimal based on pilot experiments that reflected depletion of MDSCs. Eight hours after a-GalCer injection, mice were sacrificed to obtain sera and liver. Each limb of this experiment included a minimum of 5e6 mice and all experiments replicated at least twice.

2.2. Induction of immune-mediated hepatitis and treatment with GW4064

2.4. Adoptive cell transfer

To induce liver injury, there were two protocols used. In the first protocol, mice were treated with a-GalCer. In this series of experiments, 8 week old C57BL/6J male mice, in groups of 10, were injected IP with a-GalCer at 40 mg/kg; age and sex matched controls were injected with vehicle. Within these groups, half were injected daily intraperitoneally (IP) for 7 days with either GW4064 (30 mg/kg) or the vehicle control. The dose of GW4064 was chosen as optimal based on pilot experiments and previous study [11,12]. At 8 h following the a-GalCer/vehicle challenge, all mice were sacrificed to collect serum, liver and spleen. In a second series of experiments, 8 weeks old C57BL/6 male mice, in groups of 10, were injected intravenously with concanavalin A at a dose of 20 mg/kg or vehicle. As before, mice were pretreated with GW4064/vehicle control for 7 days, using daily injections of GW4064 30 mg/kg IP. Eight hours following the Con A challenge, mice were sacrificed to collect serum, liver and spleen. Each protocol was replicated twice.

To identify the ability of purified liver or spleen MDSCs to modulate immune-mediated hepatitis following adoptive transfer, purified MDSCs from a-GalCer (40 mg/kg)injected mice were Table 1 The primer sequences of MDSCs related genes and b-actin. Gene

Forward primer

Reverse primer

S100A8 S100A9 CCL-2 COX-2 IL-1b IL-6 VEGF-A VEGF-C b-actin

CTGAGTGTCCTCAGTTTGTG CACAGTTGGCAACCTTTATGAA CAGCCAGATGCAGTTAACGC ACAACATCCCCTTCCTGCG GCAACTGTTCCTGAACTCA CCAGGTAGCTATGGTACTCCAGAA CTGTGCAGGCTGCTGTAACG TGTGGGGAAGGAGTTTGGAGC CTAAGGCCAACCGTGAAAAG

TTGCATTGTCACTATTGATGTCC GGTCCTCCATGATGTCATTTATG GCCTACTCATTGGGATCATCTTG GCTCCTTATTTCCCTTCACACCC CTCGGAGCCTGTAGTGCAG GCTACCAAACTGGATATAATCAGGA GTTCCCGAAACCCTGAGGAG CGGCAGGAAGTGTGATTGGC GGTACGACCAGAGGCATACA

For each sample, mRNA expression level was normalized to the level of b-actin housekeeping genes using the DDCt algorithm.



transferred through tail-vein injection (5 106 purified MDSCs/ mouse) 12 h before injecting a-GalCer. There were 4 different cell populations, defined according to tissue source and phenotype, including 1) liver CD11bþLy6Chigh cells; 2) liver CD11bþLy6Clow cells; 3) splenic CD11bþLy6Chigh cells; and 4) splenic

3

CD11bþLy6Clow cells. The purity of cell populations was >99% and viability confirmed to be >95%. Each of these 4 cell populations were transferred into 8-weeks-old C57/Bl6 mice (3e5 recipient mice/group). Twelve hours following adoptive transfer, recipient mice were injected IP with 40 mg/kg a-GalCer to monitor specific

Fig. 1. FXR activation attenuates a-GalCer or Con A induced liver injury. Mice were injected with either a-GalCer or Con A/vehicle with or without FXR activation. (A) Representative H&E staining of livers in a-GalCer experiments (200). (B) The number of inflammatory foci per 200 field, mean SD. (C) Serum ALT and AST levels, mean SD. (D) Representative H&E stained livers in Con A experiments (200). (E) Quantification of necrotic lesions as a percentage of liver parenchyma, mean SD. (F) Serum ALT or AST levels SD. **P < 0.01.


4




MDSCs population. Mice injected with a-GalCer in parallel served as a positive control; identical untreated mice were negative controls. 2.5. In vitro MDSC suppression assay Liver mononuclear cells were isolated 8 h after a-GalCer and purified liver MDSCs from wild type or FXR null mice were sorted using our purification protocol. T cells were purified from the spleen of 6-weeks-old C57/Bl6 mice by magnetic cell separation [15]. The purity of CD3þ T cell populations was >99%. T cell proliferation was assessed using CFSE (Molecular Probes/ Invitrogen, Carlsbad, CA). Purified liver CD11bþLy6Chigh or CD11bþLy6Clow subsets were cultured at different ratios with purified CFSE-labeled T cells in 96-well plates that were coated with anti-CD3 (10 mg/mL, BD Biosciences, Palo Alto, CA) and anti-CD28 (2 mg/mL, BD Biosciences), in RPMI 1640 medium supplemented with 10% Heat Inactivated FBS, 10 mM HEPES, 1 mM penicilline streptomycin, and 50 mM 2-mercaptoethanol. T cell proliferation was analyzed after 72 h of culture via flow cytometry. The proliferation fraction was calculated using ModFit LT software. 2.6. The role of bone marrow-derived MDSCs (BM MDSCs) Briefly, femurs and tibiae of 6 weeks old C57BL/6 male mice were removed and isolated from surrounding muscle tissue. Next, intact bones were left in 70% ethanol for 1 min and washed with PBS. Thence both ends were cut with sterile scissors and the marrow flushed with RPMI 1640 using a syringe. These cells were then cultured as described to induce BM MDSCs with minor modifications [16]. At day 0 BM leukocytes were seeded at 2 106 per 100 mm dish in 10 ml culture medium containing 200 U/ml rmGM-CSF (R&D Systems, Minneapolis, MN, USA). At day 3, another 10 ml media containing 200 U/ml rmGM-CSF was added to the plates. GW4064 (2 mM) was added at day 0 and day 3 in the GW4064-treated group. The cells were collected at day 4. The viability of cultured cells was confirmed to be >95%. Finally, BM MDSCs were stained using appropriate monoclonal antibodies for phenotyping and evaluated by flow cytometry. The purity of BM MDSCs was approximately 95%. Thence we took advantage of our C57BL6/GFP mice to focus on the ability of BM MDSCs to modulate immune-mediated liver injury. To derive GFPþ BM MDSCs, we employed the same culture method and subsequently transferred to 8-weeks-old C57/BL6 male wild-type mice (n ¼ 5) through tailvein injection (5 106 GFPþ BM MDSCs/mouse). Twelve hours following adoptive transfer, recipient mice were injected IP with 40 mg/kg a-GalCer. Unmanipulated WT mice were injected with aGalCer in parallel serving as a positive control; identical groups of mice that went untreated were negative controls (3e5 mice/ group). 8 h following the a-GalCer injection, mice were sacrificed for ALT and AST levels and histologic evaluation. Fresh-frozen tissue sections were cut onto Superfrost/Plus slides at a thickness of 6 mm [17] and sections observed by fluorescent microscopy. 2.7. The role of FXR in regulating the expression of PIR-B We thence focused on whether FXR can regulate the expression of PIR-B through binding of the promoter. We cloned the PIR-B promoter and prepared a plasmid construct for a luciferase

5

reporter gene assay. Essentially, a 1214 bp fragment of mouse PIR-B promoter (from 1179 bp to þ34 bp) was cloned into the pEZX-PG04 Gaussia luciferase-SEAP dual-reporter vector (MPRM11909-PG04, Genecopoeia, Maryland, USA). For practical reasons (i.e. ease of transfection, rapid replication and achievement of high number of cells to perform molecular experiments) we performed transfection experiments in RAW264.7 cells, a mouse monocyte/macrophage cell line, instead of primary cultures of MDSCs. RAW264.7 cells were transiently transfected with the indicated reporter plasmid (600 ng), using LipofectamineÒ LTX & Plus Reagent (Invitrogen). After 24 h of transfection, the media was changed, and cells exposed to GW4064 (2 mM) or vehicle. After 48 or 72 h, the cell culture media was collected for analysis using the Secrete-Pair Dual Luminescence Assay Kit (Genecopoeia). Luciferase activities and SEAP signals were measured using a luminometer (Promega, Madison, Wisconsin, USA). When comparing GLuc activities of multiple transfected cell samples, we used SEAP as an internal standard control. We calculated the ratio of luminescence intensities of the GLuc over SEAP and compared the normalized GLuc activity of all samples. For each experimental trial, wells were transfected in triplicate, and each well was assayed in duplicate. To identify the promoter elements responsible for the observed effects of FXR, we then searched for putative FXR responsive elements in the promoter of PIR-B. The NUBIScan analysis (http:// www.nubiscan.unibas.ch) of the 50 flanking regions of mouse PIRB revealed the presence of putative FXR responsive sequences including IR-6 and IR-7 in the PIR-B promoter. For example, a IR-6 element was located between nucleotides 1030 and 1047 and a IR-7 element was located between nucleotides 1126 and 1145. We thence designed 4 pairs of primers containing the above mentioned FXRE in different parts of the PIR-B promoter. To further determine whether the PIR-B gene is a direct target of FXR and FXR/RXR heterodimer or whether FXR monomer can bind to the relevant FXRE in the PIR-B promoter, ChIP experiments were performed. RAW264.7 cells (10 106) were cultured for 48 h with GW4064 (2 mM) or vehicle alone. ChIP assays were then performed (Upstate, Millipore, Bedford, MA). In short, RAW264.7 cells were fixed with 1% formaldehyde. DNA was sheared to fragments of 200e1000 bp by sonication using optimal concentrations. Chromatins were incubated and precipitated with antibodies against FXR, RXR, or control IgG. Nonprecipitated chromatin (input) was used as a positive control. DNA extractions were PCR amplified using the following flanking primers, and PCR products analyzed by agarose gel electrophoresis: Primers-1 for 108 to 197 bp region of PIR-B promoter (forward, 50 -atgggagggaagactgcttt-30 ; reverse, 50 - cttcctggtgttcccttcac-30 ); Primers- 2 for 362 to 530 bp region (forward, 50 - taaacctgcacctgtgtgga-30 ; reverse, 50 - tccagtgtggatcctgtcaa-30 ); Primers-3 for 516 to 726 bp region o (forward, 50 -aggatccacactggacaagg-30 ; reverse, 50 -tgcattaccactgggcatta-30 ); Primers-4 for 958 to 1139 bp region (forward, 50 -gatgaggaaacgccatctgt-30 ; reverse, 50 -tgtgtacagggtgtggcact-30 ). 2.8. Flow cytometry Hepatic mononuclear cells (HMNCs) were isolated as previously described [18]. Single-cell suspensions of HMNCs were labeled with fluorescent conjugated antibodies against mouse CD45-FITC, Ly6CAPC and CD11b-PerCP-CyÔ5.5 (BD Pharmingen), as well as PIR-BPE (R&D Systems). Finally, HMNCs were evaluated by flow

Fig. 2. Pretreatment with GW4064 induces an increase of hepatic CD11bþLy6Cþ MDSCs following a-GalCer or Con A. (A) Representative flow profiles and quantification of percentages of CD45þCD11bþLy6Cþcells in a-GalCer experiment, mean SD. (B) Representative flow profiles and quantification of percentages of CD45þCD11bþLy6Cþcells in Con A experiment, mean SD. To delete MDSCs in vivo, mice were injected with anti-Gr-1 or isotype IgG before a-GalCer treatment. (C) Representative flow profiles showing frequency of CD45þCD11bþLy6Cþcells following MDSC depletion. (D) The frequencies of CD45þCD11bþLy6Cþcells, mean SD. (E) Serum AST levels, mean SD. (F) Representative H&E staining of liver sections following MDSCs depletion (200).*p < 0.05, **p < 0.01.


6


Fig. 3. Liver CD11bþLy6ChighMDSCs reflect the highest immunosuppressive activity following a-GalCer treatment. (A) Representative WrighteGiemsa staining of purified MDSCs (400). (B) Representative H&E staining of liver sections following adoptive transfer (200). (C) The number of inflammatory foci per 200 field, mean SD. (D) Serum ALT or AST levels, mean SD. (E) Representative H&E staining of livers following adoptive transfer of GFPþ bone marrow-derived MDSCs or vehicle(200). (F) Representative frozen liver sections of GFPþ BM MDSCs (in green) transferred-mice under fluorescent microscopy (400). *p < 0.05, **p < 0.01.



7

Fig. 4. FXR activation increases PIR-B expression and induces the immunosuppressive activity in MDSCs. (A) Representative histograms from the T cell proliferation assay at the indicated ratio. (B) Respective histograms for PIR-B expression on indicated gated cells are shown for each group with respective mean fluorescence intensity (MFI). Liver CD11bþLy6Cþ MDSCs versus splenic MDSCs. (C) Liver CD11bþLy6Chigh cells and CD11bþLy6Clow population in a-GalCer-challenged mice. (D) The effect of FXR activation on PIR-B expression in liver CD11bþLy6Cþ MDSCs. (E) The effect of FXR activation on PIR-B levels in murine BM MDSCs in vitro. (F) The PIR-B expression on liver CD11bþLy6Cþ MDSCs and BM MDSCs from FXR/ and control mice. *p < 0.05, **p < 0.01.


8


cytometry, and the data analyzed using Cell Quest software (Becton Dickinson). 2.9. Histology and immunohistochemistry To define the lineage of liver CD11bþLy6ChighMDSCs and CD11bþLy6ClowMDSCs, FACS sorted cells were collected using cytospin [19], stained with a WrighteGiemsa stain [5] and analyzed by a “blinded” observer using light microscopy. Immunohistochemistry was performed on the liver sections using antibodies against S100A8 (1:200 dilution, Epitomics, Burlingame, CA). The procedures were performed as previously described [20].

a-GalCer and Con A induced hepatitis. Importantly, the FXR agonist GW4064 significantly attenuated hepatic portal inflammatory changes and decreased hepatocyte ballooning (p < 0.01) (Fig. 1A and B). In addition, the a-Galcer treated mice, reflective of their histological inflammatory changes, also manifest significant elevations of serum ALT (p < 0.01) and AST levels (p < 0.01). Once again, GW4064 plus a-GalCer treatment significantly reduced serum ALT and AST levels (p < 0.01, respectively) (Fig. 1C). In efforts to demonstrate that the effects of GW4064 were not unique to a-GalCer induced liver injury, a parallel experiment was done by inducing hepatitis with Con A. In these series of experiments, GW4064 pretreatment once again significantly reduced hepatic necrosis (p < 0.01) (Fig.1D and E) and reduced the levels of ALT (p < 0.01) and AST (p < 0.01) compared to Con A alone treated mice (Fig. 1F).

2.10. RNA isolation and real-time PCR Total RNA was isolated from tissues using standard TRIzol method (Invitrogen) and complementary DNA synthesized. Realtime PCR was performed using SYBR Premix Ex Taq TM (Takara, Shiga, Japan) in an ABI PRISMÒ 7900HT sequence detector. The results were normalized against b-actin gene expression. The primer sequences are described in Table 1. 2.11. Statistical analysis All continuous variables are expressed as mean standard deviation (SD). Correlations were determined using the Spearman’s correlation coefficient. Statistical differences were determined by a Student t test or one-way analysis of variance test. All analyses were two-tailed and performed using GraphPad Prism; p values < 0.05 were considered statistically significant. 3. Results 3.1. Induction of immune-mediated hepatitis and the role of GW4064 In efforts to determine the regulatory effort of FXR on immunemediated hepatitis, we utilized two murine liver injury models,

3.2. The role of MDSCs depletion and its relationship to FXR activation We first began to study the role of specific MDSCs subpopulations to modulate liver injury with or without FXR activation. a-GalCer treatment significantly increased the percentage of liver CD11bþLy6Cþ MDSCs compared to untreated controls (p < 0.01). Further study of MDSCs subpopulations revealed that aGalCer generated an increase in both CD11bþLy6Chigh and CD11bþLy6Clow cell populations compared to untreated controls (p < 0.01 and p < 0.05, respectively). FXR activation induced by GW4064, followed by a-GalCer, further augmented CD11bþLy6Cþ cells compared to controls (p < 0.01). In-depth analysis of MDSCs subpopulations revealed that FXR activation followed by a-GalCer produced a robust induction of the CD11bþLy6Chigh cell population compared to the a-GalCer treatment group alone (p < 0.01) as well as unmanipulated control mice (p < 0.01). In contrast, FXR activation followed by a-GalCer had no significant influence on the CD11bþLy6Clow cell population compared to either the a-GalCer treatment group (p > 0.05) or unmanipulated control mice (p > 0.05). To study the effects of FXR activation alone, we further compared the FXR activation alone compared to untreated controls. Administration of GW4064 alone induced hepatic CD11bþLy6Cþ MDSCs compared to the untreated controls (p < 0.01). We note that

Fig. 5. Functional assessment of FXR binding in the PIR-B gene. (A) Scheme of the full-length PIR-B-1179/þ34 promoter-driven luciferase reporter system. (B) The PIR-B promoter luciferase activity 48 h and 72 h after transfection in RAW264.7 cells. (C) FXR and RXR binds to the 1139/-958 region of the PIR-B promoter in RAW264.7 cells treated with GW4064(2 mM) or vehicle. (D) FXR only binds to 1139/-958 region (Primers 4) instead of the proximal region of the PIR-B promoter. *p < 0.05, **p < 0.01.




9

10


FXR activation primarily increased the CD11bþLy6Chigh cell population (p < 0.05) without any significant effect on the CD11bþLy6Clow cell population (p > 0.05), compared to untreated controls (Fig. 2A). A similar result was obtained in the Con A model. In particular, FXR activation followed by Con A induced a robust induction of the CD11bþLy6Chigh cell population compared to either Con A treatment alone or untreated control mice (p < 0.01, respectively). In contrast, FXR activation followed by Con A did not significantly effect the CD11bþLy6Clow cell population (p > 0.05, respectively) compared to either control group. Similar to our data on a-GalCer, pretreatment with GW4064 also induced an increase of hepatic CD11bþLy6Cþ MDSCs compared to untreated controls (p < 0.05). Finally, we should note that FXR activation alone primarily increased the CD11bþLy6Chigh cell population (p < 0.05) compared to untreated controls (Fig. 2B). To focus further on the mechanism, we first demonstrated that our use of anti-Gr1 antibody was successful in depletion of MDSCs. For example, there were no significant differences in the percentages of hepatic CD11bþLy6Cþ MDSCs when comparing FXR activation followed by treatment with anti-Gr1 and a-GalCer compared to the untreated control mice (p > 0.05) (Fig. 2C and D). Indeed, when MDSCs were depleted, the protective effects of GW4064 partially disappeared and the data were further revealed by increased hepatic injury, including increased AST levels compared to FXR activation and a-GalCer treatment but without anti-Gr1 antibody (p < 0.01, respectively) (Fig. 2E and F). 3.3. Adoptive MDSCs transfer Phenotypic analysis of the sorted hepatic CD11bþLy6Chigh cells were exclusively mononuclear in nature, as noted by WrighteGiemsa staining, whereas CD11bþLy6Clow cells consisted primarily of immature neutrophils with ring-shaped nuclei (Fig. 3A). In our adoptive cell transfer, we noted that it was only the use of transferred CD11bþLy6Chigh cells isolated from the inflammatory livers that significantly decreased hepatic inflammation (p < 0.01) (Fig. 3B and C), serum ALT (p < 0.05) and AST levels (p < 0.01) (Fig. 3D) compared to the a-GalCer treated control group. These data indicate that liver monocytic MDSCs (CD11bþLy6Chigh cells) are the major subpopulation involved in modulating this hepatic inflammatory injury. We also note that adoptive transfer of GFPþ bone marrow-derived MDSCs also attenuated a-GalCer-induced liver inflammation compared to the a-GalCer treated control group (Fig. 3E). More importantly, taking the advantage of the fluorescent assay, we confirmed that GFPþ bone marrow-derived MDSCs were located in murine liver after adoptive transfer (Fig. 3F). 3.4. The role of FXR in regulating MDSCs suppression ability in vitro To confirm that FXR play an essential role in hepatic MDSCs immunosuppressive activity, we took advantage of FXR/ mice and co-cultured the purified hepatic MDSCs with Pan-T cells at different effector/target ratios in the presence of activating antiCD3/28 antibodies. a-GalCer-induced hepatic CD11bþLy6Chigh cells from WT mice significantly suppressed T cell proliferation at 1:10 and 1:100 ratios (MDSC:T cell) (p < 0.01). More importantly, the counterpart- hepatic CD11bþLy6Chigh cells from FXR/ mice lost their immunosuppressive activity to suppress T cell

proliferation. As can be seen, hepatic CD11bþLy6Clow cells from WT mice or FXR/ mice could not suppressed T cell proliferation in vitro (Fig. 4A). 3.5. The paired immunoglobin receptor-b (PIR-B) and MDSCs PIR-B has been shown to have an important effect on activated murine MDSCs immunosuppressive function [21]. Liver CD11bþLy6Cþ MDSCs had a significantly higher expression of PIR-B than splenic MDSCs, both in the a-GalCer challenged and untreated control group (p < 0.01) (Fig. 4B). Within the liver MDSCs subpopulations, we noted a significantly higher PIR-B expression in CD11bþLy6Chigh cells compared to the CD11bþLy6Clow population in a-GalCer-challenged mice (p < 0.01) (Fig. 4C). FXR activation significantly increased PIR-B expression in liver CD11bþLy6Cþ MDSCs either in otherwise unmanipulated mice, in a-GalCer treated mice, or Con A challenged mice (p < 0.01) (Fig. 4D). Similarly, FXR activation also increased PIR-B levels in murine BM MDSCs in vitro (p < 0.01) (Fig. 4E). In contrast, liver CD11bþLy6Cþ MDSCs or BM MDSCs from FXR/ mice produced a significantly reduced PIR-B expression compared to wild type mice (p < 0.01, respectively) (Fig. 4F). 3.6. Functional assessment of FXR binding in the PIR-B gene To further identify relevant promoter element(s), we conducted a luciferase reporter gene assay of the PIR-B promoter (Fig. 5A). GW4064 treatment increased the luciferase activity 3-fold compared to vehicle alone 48 h after transfection in RAW264.7 cells (p < 0.01). Furthermore, this induction was increased 10-fold 72 h after transfection (p < 0.05) (Fig. 5B). ChIP experiments were conducted using the above 4 pairs of primers separately. FXR, and RXR, the heterodimeric partner of FXR, were observed to bind to (1139 to 958 bp region) the PIR-B promoter with or without GW4064 stimulation. As a negative control, an equivalent amount of chromatin precipitated with a non-relevant anti-IgG antibody did not result in any signal (Fig. 5C). The same DNA samples were PCR amplified using other three pair primers covering the proximal region of the PIR-B promoter, but no signal was observed (Fig. 5D). These results suggest that the 1139to 958-bp region of the mouse PIR-B promoter mediates FXR induction of PIR-B transcription. 3.7. The effects of S100A8 on MDSCs hepatic homing We examined 8 relevant genes associated with MDSCs accumulation in our treatment groups using RT-PCR. a-GalCer increased hepatic S100A8 and S100A9 mRNA expression compared to untreated controls (p < 0.01, respectively). Furthermore, GW4064 plus a-GalCer treatment had the highest expression of S100A8 and S100A9 in liver compared to untreated control mice (p < 0.01, respectively) and a-GalCer (p < 0.01, respectively). GW4064 treatment alone also induced a robust increased of the gene expression of S100A8 and S100A9 when compared to untreated controls (p < 0.01, respectively) (Fig. 6A). The expression trend is related to the number of MDSCs infiltrating liver. IHC staining demonstrated that the numbers of S100A8 positive cells were increased in a-GalCer treated groups compared to untreated controls (p < 0.01). Further, GW4064 plus a-GalCer treatment

Fig. 6. Hepatic S100A8 expression following immune-mediated liver injury and recruitment of MDSCs. Mice were injected with either a-GalCer/vehicle with or without FXR activation. (A) mRNA expression levels, mean SD. (B) Representative immunohistochemical staining (200) and quantification of hepatic S100A8 following a-GalCer, mean SD. (C) Correlation between the numbers of S100A8þ cells and MDSCs in liver following a-GalCer experiment. (D) Representative immunohistochemical staining(200X) and quantification of hepatic S100A8 following Con A, mean SD. (E) Correlation between the numbers of S100A8þ cells and MDSCs in the liver following Con A. *p < 0.05, **p < 0.01.



generated the highest numbers of S100A8 positive cell infiltrates either in portal tract or in the lobular area of liver compared to untreated control (p < 0.01) and a-GalCer treatment mice (p < 0.01) (Fig. 6B). The numbers of S100A8 positive cells positively correlated with the numbers of MDSCs in the liver (R ¼ 0.96, p < 0.05) (Fig. 6C). A similar phenomenon was observed in the Con A-induced liver injury model. GW4064 plus Con A treatment generated the highest numbers of S100A8 positive cell infiltrates either in portal tract or in the lobular area of the liver compared to untreated controls (p < 0.01) and Con A treatment (p < 0.01) (Fig. 6D). The numbers of S100A8 positive cells positively correlated with the numbers of MDSCs in liver (R ¼ 0.95, p < 0.05) (Fig. 6E). 4. Discussion Our data demonstrate an increased frequency of CD11bþLy6Cþ MDSCs in both immune-mediated liver injury models. FXR activation reduces the inflammatory injuries induced by Con A and aGalCer and simultaneously expanded the population of CD11bþLy6Cþ MDSCs. Of note, FXR activation primarily increased the liver CD11bþLy6Chigh cell population (monocytic MDSCs) while it had no significant effects on the hepatic CD11bþLy6Clow cell population (granulocytic MDSCs). More importantly, the protective effect of FXR activation on immune-mediated liver injury was dependent on this MDSC expansion. To focus on this latter point as well as define the mechanism of action, we therefore proceeded to evaluate specific MDSC subpopulations. Liver CD11bþLy6Chigh cells isolated from the inflammatory liver were the most powerful component of MDSCs. Our data is concordant with the observation that regulation of T cell function by MDSCs during a localized inflammatory response is restricted in vivo to the site of an ongoing immune response [22]. It is known that PIR-B, expressed on murine myeloid lineage cells, B cells, and prethymic stage T cells, is an immunoregulatory cell-surface receptor, whose physiological ligand in the immune system has been identified as MHC class I [23]. PIR-B also functions in regulating dendritic cells [24,25], macrophages [26], and B cells [27]. Indeed, a recent study demonstrates that the PIR signaling pathway has an essential role in immune suppression and activation through the regulation of MDSCs-mediated immune responses [21]. Based on these latter observations, we focused on the relationships of FXR, PIR-B expression and MDSCs. We report herein that immunosuppressive activity of MDSCs in the immunemediated hepatitis mice was dependent on FXR. Moreover, the expression of PIR-B directly correlates with the immunosuppressive function of MDSCs. Liver monocytic MDSCs (CD11bþLy6Chigh cells) manifest higher PIR-B expression, which is consistent with the data from our adoptive transfer experiments. FXR activation not only increases the numbers of MDSCs, but also up-regulates expression of PIR-B in MDSCs to enhance the immunosuppressive activity of MDSCs in vivo. More importantly, in-depth analysis including the luciferase reporter gene assay, FXRE mapping and CHIP assay further illustrates that FXR regulates PIR-B expression through direct binding to the PIR-B promoter. Our work also reflects that adoptive transfer of MDSCs leads to hepatic homing and accumulation in the inflammatory liver milieu. Previous work from other laboratories has demonstrated that MDSCs accumulation and activation are driven by multiple factors, many of which are associated with chronic inflammation, such as cyclooxygenase 2, CCL-2, IL-1b, IL-6, VEGF and s100A8/A9 [28e31]. In our hands, by analysis of cytokines and chemokines associated with MDSCs, we demonstrate that FXR activation up-regulates expression of S100A8/A9 in liver. We therefore submit that FXR activation drives the accumulation of MDSCs to liver through

11

upregulation of S100A8 in the context of inflammation. This is an area for future study. Hitherto most studies on liver MDSCs are derived from basic and clinical observations of hepatocellular carcinoma [10,32]. We emphasize, however, that there is accumulating evidence that MDSCs are involved in the regulation of immune responses in acute and chronic hepatic inflammation [33,34]. In fact, recent data demonstrates that MDSCs function in attenuating Con A-induced acute inflammation in liver, and a parallel observation indicates that cannabidiol may trigger MDSCs through activation of TRP1 vanilloid receptors [35]. It has also been demonstrated that activated hepatic stellate cells increase IL-10 expression in CD11bþGr1þ bone marrow cells (MDSCs), which in turn ameliorates liver fibrosis [36]. Our data emphasize that MDSCs function as a critical negative feedback loop in inflammatory mediated hepatocyte injury. Furthermore, FXR activation facilitates the accumulation of MDSCs through upregulation of S100A8 and also enhances the suppressor function of MDSCs through upregulation of PIR-B by directly binding the PIR-B promoter. These novel mechanisms of action raise several corollary questions which have therapeutic implications in autoimmune liver disease and emphasize the critical role essential in defining liver lymphoid subpopulations. Financial support This work was supported by grants from the National Natural Science Foundation of China (Nos. 81170380 and 81325002 to X.M., 81100271 to Q. W.), the Program of Shanghai Innovative Research Team in Immunity of Non-viral Liver Diseases (to X.M.) and the program of excellent academic leader from the Science and Technology Commission of Shanghai Municipality (12XD140 3300). References [1] Wang YD, Chen WD, Wang M, Yu D, Forman BM, Huang W. Farnesoid X receptor antagonizes nuclear factor kappaB in hepatic inflammatory response. Hepatology 2008;48:1632e43. [2] Schote AB, Turner JD, Schiltz J, Muller CP. Nuclear receptors in human immune cells: expression and correlations. Mol Immunol 2007;44:1436e45. [3] Inagaki T, Moschetta A, Lee YK, Peng L, Zhao G, Downes M, et al. Regulation of antibacterial defense in the small intestine by the nuclear bile acid receptor. Proc Natl Acad Sci U S A 2006;103:3920e5. [4] Ilkovitch D, Lopez DM. The liver is a site for tumor-induced myeloid-derived suppressor cell accumulation and immunosuppression. Cancer Res 2009;69: 5514e21. [5] Cripps JG, Wang J, Maria A, Blumenthal I, Gorham JD. Type 1 T helper cells induce the accumulation of myeloid-derived suppressor cells in the inflamed Tgfb1 knockout mouse liver. Hepatology 2010;52:1350e9. [6] Gabrilovich DI, Nagaraj S. Myeloid-derived suppressor cells as regulators of the immune system. Nat Rev Immunol 2009;9:162e74. [7] Ostrand-Rosenberg S, Sinha P. Myeloid-derived suppressor cells: linking inflammation and cancer. J Immunol 2009;182:4499e506. [8] Movahedi K, Guilliams M, Van den Bossche J, Van den Bergh R, Gysemans C, Beschin A, et al. Identification of discrete tumor-induced myeloid-derived suppressor cell subpopulations with distinct T cell-suppressive activity. Blood 2008;111:4233e44. [9] Dietlin TA, Hofman FM, Lund BT, Gilmore W, Stohlman SA, van der Veen RC. Mycobacteria-induced Gr-1þ subsets from distinct myeloid lineages have opposite effects on T cell expansion. J Leukoc Biol 2007;81: 1205e12. [10] Hoechst B, Voigtlaender T, Ormandy L, Gamrekelashvili J, Zhao F, Wedemeyer H, et al. Myeloid derived suppressor cells inhibit natural killer cells in patients with hepatocellular carcinoma via the NKp30 receptor. Hepatology 2009;50:799e807. [11] Lee H, Hubbert ML, Osborne TF, Woodford K, Zerangue N, Edwards PA. Regulation of the sodium/sulfate co-transporter by farnesoid X receptor alpha. J Biol Chem 2007;282:21653e61. [12] Liu Y, Binz J, Numerick MJ, Dennis S, Luo G, Desai B, et al. Hepatoprotection by the farnesoid X receptor agonist GW4064 in rat models of intra- and extrahepatic cholestasis. J Clin Invest 2003;112:1678e87. [13] Bian Z, Peng Y, You Z, Wang Q, Miao Q, Liu Y, et al. CCN1 expression in hepatocytes contributes to macrophage infiltration in nonalcoholic fatty liver disease in mice. J Lipid Res 2013;54:44e54.


12


[14] Tang Y, Bian Z, Zhao L, Liu Y, Liang S, Wang Q, et al. Interleukin-17 exacerbates hepatic steatosis and inflammation in non-alcoholic fatty liver disease. Clin Exp Immunol 2011;166:281e90. [15] Sarra M, Cupi ML, Bernardini R, Ronchetti G, Monteleone I, Ranalli M, et al. IL25 prevents and cures fulminant hepatitis in mice through a myeloid-derived suppressor cell-dependent mechanism. Hepatology 2013;58:1436e50. [16] Rossner S, Voigtlander C, Wiethe C, Hanig J, Seifarth C, Lutz MB. Myeloid dendritic cell precursors generated from bone marrow suppress T cell responses via cell contact and nitric oxide production in vitro. Eur J Immunol 2005;35:3533e44. [17] Kawamoto T, Shimizu M. A method for preparing 2- to 50-micron-thick freshfrozen sections of large samples and undecalcified hard tissues. Histochem Cell Biol 2000;113:331e9. [18] Onori P, Alvaro D, Floreani AR, Mancino MG, Franchitto A, Guido M, et al. Activation of the IGF1 system characterizes cholangiocyte survival during progression of primary biliary cirrhosis. J Histochem Cytochem 2007;55: 327e34. [19] Youn JI, Nagaraj S, Collazo M, Gabrilovich DI. Subsets of myeloid-derived suppressor cells in tumor-bearing mice. J Immunol 2008;181:5791e802. [20] You Z, Wang Q, Bian Z, Liu Y, Han X, Peng Y, et al. The immunopathology of liver granulomas in primary biliary cirrhosis. J Autoimmun 2012;39:216e21. [21] Ma G, Pan PY, Eisenstein S, Divino CM, Lowell CA, Takai T, et al. Paired immunoglobin-like receptor-B regulates the suppressive function and fate of myeloid-derived suppressor cells. Immunity 2011;34:385e95. [22] Haverkamp JM, Crist SA, Elzey BD, Cimen C, Ratliff TL. In vivo suppressive function of myeloid-derived suppressor cells is limited to the inflammatory site. Eur J Immunol 2011;41:749e59. [23] Matsushita H, Endo S, Kobayashi E, Sakamoto Y, Kobayashi K, Kitaguchi K, et al. Differential but competitive binding of Nogo protein and class i major histocompatibility complex (MHCI) to the PIR-B ectodomain provides an inhibition of cells. J Biol Chem 2011;286:25739e47. [24] Endo S, Sakamoto Y, Kobayashi E, Nakamura A, Takai T. Regulation of cytotoxic T lymphocyte triggering by PIR-B on dendritic cells. Proc Natl Acad Sci U S A 2008;105:14515e20. [25] Mitsuhashi Y, Nakamura A, Endo S, Takeda K, Yabe-Wada T, Nukiwa T, et al. Regulation of plasmacytoid dendritic cell responses by PIR-B. Blood 2012;120: 3256e9.

[26] Munitz A, Cole ET, Beichler A, Groschwitz K, Ahrens R, Steinbrecher K, et al. Paired immunoglobulin-like receptor B (PIR-B) negatively regulates macrophage activation in experimental colitis. Gastroenterology 2010;139:530e41. [27] Arita K, Endo S, Kaifu T, Kitaguchi K, Nakamura A, Ohmori H, et al. Transcriptional activation of the Pirb gene in B cells by PU.1 and Runx3. J Immunol 2011;186:7050e9. [28] Bunt SK, Sinha P, Clements VK, Leips J, Ostrand-Rosenberg S. Inflammation induces myeloid-derived suppressor cells that facilitate tumor progression. J Immunol 2006;176:284e90. [29] Sinha P, Clements VK, Fulton AM, Ostrand-Rosenberg S. Prostaglandin E2 promotes tumor progression by inducing myeloid-derived suppressor cells. Cancer Res 2007;67:4507e13. [30] Sinha P, Okoro C, Foell D, Freeze HH, Ostrand-Rosenberg S, Srikrishna G. Proinflammatory S100 proteins regulate the accumulation of myeloid-derived suppressor cells. J Immunol 2008;181:4666e75. [31] Bunt SK, Yang L, Sinha P, Clements VK, Leips J, Ostrand-Rosenberg S. Reduced inflammation in the tumor microenvironment delays the accumulation of myeloid-derived suppressor cells and limits tumor progression. Cancer Res 2007;67:10019e26. [32] Hoechst B, Ormandy LA, Ballmaier M, Lehner F, Kruger C, Manns MP, et al. A new population of myeloid-derived suppressor cells in hepatocellular carcinoma patients induces CD4(þ)CD25(þ)Foxp3(þ) T cells. Gastroenterology 2008;135:234e43. [33] Sander LE, Sackett SD, Dierssen U, Beraza N, Linke RP, Muller M, et al. Hepatic acute-phase proteins control innate immune responses during infection by promoting myeloid-derived suppressor cell function. J Exp Med 2010;207: 1453e64. [34] Chou HS, Hsieh CC, Yang HR, Wang L, Arakawa Y, Brown K, et al. Hepatic stellate cells regulate immune response by way of induction of myeloid suppressor cells in mice. Hepatology 2011;53:1007e19. [35] Hegde VL, Nagarkatti PS, Nagarkatti M. Role of myeloid-derived suppressor cells in amelioration of experimental autoimmune hepatitis following activation of TRPV1 receptors by cannabidiol. PloS One 2011;6:e18281. [36] Suh YG, Kim JK, Byun JS, Yi HS, Lee YS, Eun HS, et al. CD11b(þ) Gr1(þ) bone marrow cells ameliorate liver fibrosis by producing interleukin-10 in mice. Hepatology 2012;56:1902e12.


The role of the liver in recovery from critical injury.

FXR and liver carcinogenesis.

Protective effects of calycosin against CCl4-induced liver injury with activation of FXR and STAT3 in mice.

The nuclear bile acid receptor FXR controls the liver derived tumor suppressor histidine-rich glycoprotein.

Critical Role of Myeloid-Derived Suppressor Cells in Tumor-Induced Liver Immune Suppression through Inhibition of NKT Cell Function.

The role of the thymus in the establishment of suppressor cells in liver chimeras.

Liver Capsule: FXR agonists against liver disease.

The role of T suppressor cells in the maintenance of spontaneously accepted orthotopic rat liver allografts.

The protective role of myeloid-derived suppressor cells in concanavalin A-induced hepatic injury.

- mice.

HOXA7 plays a critical role in metastasis of liver cancer associated with activation of Snail.

A critical role for pannexin-1 in activation of innate immune cells of the choroid plexus.

FXR antagonism of NSAIDs contributes to drug-induced liver injury identified by systems pharmacology approach.

Role of stem cells during diabetic liver injury.

Evidence for prostaglandin-producing suppressor cells in drug-induced liver injury and implications in the diagnosis of drug sensitization.

Genome-wide profiling to analyze the effects of FXR activation on mouse renal proximal tubular cells.

PTPRO-associated hepatic stellate cell activation plays a critical role in liver fibrosis.

Role of stem cells in repair of liver injury: experimental and clinical benefit of transferred stem cells on liver failure.

The role of myeloid-derived suppressor cells in immune ontogeny.

The role of specific suppressor T cells in immune tolerance.

Role of FXR in β-cells of lean and obese mice.

Mechanisms of lymphocyte activation: the role of suppressor cells in the proliferative responses of chronic lymphatic leukemia lymphocytes.

Myeloid-Derived Suppressor Cells: Critical Cells Driving Immune Suppression in the Tumor Microenvironment.

Role of liver progenitors in acute liver injury.