Cell, vol. 62, 151-163, July 13, 1990, Copyright 0 1990 by Cell Press

The Drosophila Gene tailless Is Expressed at the Embryonic Termini and Is a Member of the Steroid Receptor Superfamily Francesca Pignoni,” Richard M. Baldarelli,t Eirlkur Steingrimsson: Robert J. Diaz, Ardem Patapoutian,’ John R. Merriam, and Judith A. Lengyel’t l Department of Biology t Molecular Biology Institute University of California Los Angeles, California 90024-1606

Summary The zygotically active tailless (t/l) gene plays a key role in the establishment of nonmetameric domains at the anterior and posterior poles of the Drosophila embryo. We have cloned the f/l gene and show that it encodes a protein with striking similarity to steroid hormone receptors in both the DNA binding “finger” and ligand binding domains. f/l RNA is initially expressed in embryos in two mirror-image symmetrical domains; this pattern then quickly resolves into a pattern consistent with the mutant phenotype: a posterior cap and an anterior dorsal stripe. That the 111gene may also play a role in the nervous system is suggested by its strong expression in the forming brain and transient expression in the peripheral nervous system. introduction The terminal domains of the early Drosophila embryo are fundamentally distinct from the central segmental domain. Not only do the body parts to which they give rise lack an overtly segmented metameric organization, but the pathway by which they are established is genetically separate and molecularly dissimilar. This distinction between terminal and central domains may have an origin as ancient as the ancestor to annelids and arthropods: a creature with an unsegmented acron and telson, and a central growth zone giving rise to segments by budding (for review see Strecker and Lengyel, 1988). Each of these independent pattern domains, the nonmetameric termini and the segmented center, is established by a system of maternal effect genes acting during oogenesis. The anterior and posterior maternal effect genes initiate the establishment of the central segmental domain (Ntisslein-Volhard et al., 1987). The primary morphogen in the segmented domain is the product of the maternal effect gene bicoid. This transcription factor is distributed as a gradient along the anterior posterior axis of the early embryo and activates specific zygotic gap genes in subdomains of the central domain. Subsequent activation of pair rule and segment polarity genes by a complex hierarchy of interactions leads to specification of cell fate in a fine-grained, metameric pattern (for reviews see Akam, 1987; Ingham, 1988). The maternal terminal genes define two terminal domains at either end of the blastoderm fate map that give

rise largely to unsegmented structures including labrum, brain (acron), and part of the cephalopharyngeal skeleton at the anterior, and the eighth abdominal segment, telson, hindgut, Maipighian tubules, and posterior midgut at the posterior. Rather than establishing a gradient of a transcription factor morphogen (as do the maternal segmental genes), the maternal terminal genes appear to establish a signal transduction pathway activated at the embryonic poles by localized production of ligand. Sequence similarities suggest that the torso protein is a membrane-bound tyrosine kinase (Sprenger et al., 1989) and that the D-raf (I(llpo/eho/e) product acting downstream of it encodes a serine/threonine kinase (Mark et al., 1987; Nishida et al., 1988; Ambrosio et al., 1989). One primary target for the terminal class genes is the zygotic lethal gene tailless (t/l). Embryos lacking the f/I gene are missing the structures derived from both anterior and posterior portions of the blastoderm fate map: the posterior t/l domain overlaps almost entirely, and the anterior f/I domain partially, the domains of the maternal terminal genes (Strecker et al., 1988). That t/l is activated by maternal terminal genes is indicated by its interactions with dominant gain-of-function alleles of the torso gene. Extreme alleles of this class give rise to embryos lacking all segmentation; in double mutant combination with t/l alleles, however, most of the segmentation pattern is restored (Klingler et al., 1988; Strecker et al., 1989). These results are consistent with the hypothesis that the maternal terminal pathway activates the N/gene in the termini; t/l activity then represses segmentation and activates terminal-specific genes in these domains. We describe here our molecular cloning and analysis of the t/f gene. The early embryonic expression pattern of t// is largely consistent with the phenotypic defects of mutants. A second phase of U/expression is in the embryonic central and peripheral nervous systems. The predicted amino acid sequence of the t/l protein shows a significant similarity to both DNA binding and ligand binding domains of steroid hormone receptors. These data suggest that the t/i protein functions as a transcription factor and allow the speculation that there may be a ligand for t/l protein. Results The t/l Phenotype Cuticles of mutant embryos lack abdominal segment 8 (A8) and the telson (including posterior spiracles and anal pads) in the posterior, and the dorsal bridge and dorsal arms of the cephalopharyngeal skeleton in the anterior; the dorsal pouch is shortened and contains scleritized material (Strecker et al., 1988; Figures 1A and 1B). The availability of antibody probes that detect internal structures provides new information about embryonic domains requiring t// activity. Staining with 44Cll antibody, which specifically stains nerve cells, reveals that r/I deficiency (Of(3R)tlpgx/Of(3R)N) embryos lack most of the supra-

Cell 152

Figure

1. The tll Mutant

Phenotype

The structures requiring zygotic f// activity were identified by examination rcf cuticle (A and B), staining of the nervous system with the monoclonal antibody 44Cll (C, D, and E), and staining of the posterior midgut with anti. caudal antibody (F, G, and H) (see Experimental Procedures for details). Wild-type embryos (A, C, and F); f/l deficiency (or(3R)t//s/oY3R)n/PaX) embr ‘yes (D and G); r//r49 embryos (B, E, and H). Anterior is to the left, dorsal up. BR = brain, MT = Mafpighian tubules, PM = pos terior midgut. (t//%7f(3R)t//~x)

esophageal ganglion (brain) (Figures 1C and 1D). The absence of the optic lobe, which gives rise to the posterior portion of the brain (Campos-Ortega and Hartenstein, 1985) from t// deficiency embryos (Strecker et al., 1988) suggests that the brain remnant in t//deficiency embryos is the anterior portion of the brain. Staining with anticaudal antibody, which specifically stains posterior mid-

gut and Malpighian tubules, reveals that t//deficiency embryos lack hindgut and Malpighian tubules, as well as much of the posterior midgut (Figures 1F and 1G). From a screen of 20,000 chromosomes, we obtained a strong t/I point mutation, t/p49 (see Experimental Procedures). The cuticular and brain defects of tW (f//r4g/LY~3Rjti/~x) embryos are comparable with those of N/deficiency embryos

Drosophila 153

A

/

Terminal

t// Is

Gene

a Steroid

Receptor

telomere

centromere

\

-60

-70

-60

-50

-40

30

-20

-10

0

10

20

30

I

I

I

I

I

I

I

I

I

I

I

I

B

G3

BL1.6

82 Dl

A2

4221 Al

Cl

C

2.0 kb

6.6 kb 5.6. 4.1. 2.9.

-

-

D1.R

D

Hindlll

Sst1

Pstl

Pstl

I

I

I

I

Hindlll I

Bglll I

Bglll I

Hind1 ,

1-1 5

Figure

2. Molecular

Map of the

3'

I

1 kb

I

t/f Region

sites that (A) EcoRl restriction map of approximately 120 kb of cloned genomic DNA around t/I.The origin of the walk is at 0 kb. Brackets surround were not ordered relative to each other. (B) Phage and cosmid clones containing the DNA of the walk are aligned with the EcoRl restriction sites in (A). Cosmids, G3 and Dl; phage, 82, BL1.6 (from M. Nell), 4221, Cl, A2, and Al. (C) Transcripts detected at 2-4 hr of embryogenesis. RNAs detected by hybridizing gel blots with DNA of cosmid Dl and phage Cl and 82 are indicated as solid bars below the phage or cosmid used as probe. The 2.0 kb (t/f)transcript is shown in its precise map position; the 8.6, 5.6, 4.1, and 2.9 kb transcripts map between the left end of cosmid Dl and the left end of phage Cl. (D) Transformation clone and mapping of t/Itranscription unit. Cosmid Dl.R, a subclone of Dl, was used for transformation rescue. Below D1.R is an enlargement of the genomic restriction map in the region around the t/l gene. Mapping of the t/f breakpoint to the genomic DNA is indicated with an open rectangle, that of the cDNA clone N4 with a solid bar.

(Figures 1B and lF), but the posterior midgut defect in f//r4g is less extreme (Figure 1H). We conclude that f//r49 is the strongest tll allele described to date, but not a null. The positions in the blastoderm embryo from which the structures described above arise are indicated in Figure 56. These regions are expected to display localized t/l activity at the blastoderm stage, when embryonic pattern is determined. This prediction is confirmed below at the RNA level, by in situ hybridization with the cloned f// transcript. Cloning of DNA around the t/1* Breakpoint and Identification of Embryonic Transcripts Previous cytogenetic analysis placed the f/l gene in the polytene chromosome interval lOOA5,6 to lOOB1,2, de-

fined by the synthetic deficiency Df(3R)All3;Dp(3;1)15OP (Strecker et al., 1966). Starting from subclones of two overlapping phage mapping to the synthetic deficiency (M. Nell, personal communication), we walked in both directions in bacteriophage lambda and cosmid libraries to obtain 120 kb of DNA (Figures 2A and 28). Of the available f// mutations (Strecker et al., 1988; this is associated with a cytologically work), only /n(3R)f12 visible rearrangement and could thus be used to identify a region in the walk essential fort// function. In situ hybridization to polytene chromosomes with the phage and cosmids of the walk indicated that the genomic DNA of phage Cl spanned the f/I2 inversion breakpoint. To identify candidate f// transcription units, DNA of phage Cl and 82, and cosmid Dl, which collectively cover

Cdl 154

A

0

2

4

6

8

II

14 17

1 2

1 4

1 6

I 8

1 II

1 14

1 1 1722

hrs

3.1 2.4 2.0I .6-

B. rp49-

Figure

3. Changing

Levels

of r/I RNA during

Embryogenesis

(A) A gel blot of polyadenylated RNA (5 vg per lane) from O-2 hr, 2-4 hr, etc., embryos was probed with the f// cDNA clone N4. (B) As a control for consistency in sample loading, the same blot as in (A) was subsequently probed with DNA encoding the ribosomal protein rp49.

43 kb around the t/P breakpoint, were used to probe RNA gel blots. Five transcripts were detected at the blastoderm stage, when t// expression is expected. Determination of the approximate map position of these RNAs shows that the 2.0 kb transcription unit maps closest to the t//* breakpoint (Figure 2C). A nearly full-length cDNA clone, N4, encoding the 2.0 kb transcript, was isolated and mapped onto the genomic DNA (Figure 2D); the resolution of the mapping was sufficient to conclude that there are no introns larger than 200 nucleotides. The orientation of transcription was determined by using single-stranded RNA probes from the cDNA subcloned into pBluescript. Southern blotting using fragments of phage Cl DNA as probe localized the t/1* breakpoint to the 1.0 kb Sstl-Pstl fragment at the 5’ end of the 2.0 kb transcription unit (Figure 2D). This map position (i.e., outside the coding region) is consistent with the weakly hypomorphic phenotype of the t//* allele (Strecker et al., 1988). Ransformation Rescue of t/l Mutants On the basis of its proximity to the t//* breakpoint, the 2.0 kb transcription unit was considered the most likely candidate for the t//RNA. To test this proposition, we generated a subclone of cosmid Dl, D1.R which carries the 2.0 kb putative t//transcription unit as well as 6.2 kb of upstream and 2.0 kb of downstream DNA, in a P element transformation vector (Figure 2D). The D1.R cosmid was used to generate several transformant lines, in particular P75-2, which carries the insert on the second chromosome. The F75-2 insert-bearing second chromosome was crossed background; the resulting flies were then into a w11r8;t//14g crossed inter se or to wlll*;t//a flies and scored for progeny carrying two mutant t/I alleles and the transformant DNA. Embryos carrying both combinations of t/i alleles (t//14a/t//14g and t//W/P) were rescued to fertile adulthood; nearly 100% of the progeny class expected for complete rescue was observed. The rescue to adulthood demonstrates that all elements required to rescue the strong t//14gallele and the hypomorphic t/P allele reside within the 10.2 kb genomic DNA

insert of cosmid D1.R. We conclude that the 2.0 kb transcript is transcribed from the t// gene. Temporal Expression of the 111Gene during Embryogenesis A gel blot of RNA from different times during embryogenesis was probed with the N4 cDNA (Figure 3). A low level of t/i RNA is detected in O-2 hr embryos (Figure 3); at least half of this is due to zygotic transcription, as the level at O-2 hr is more than twice that at O-l hr (data not shown). The maximal level of t//transcript is present at 2-4 hr, consistent with the requirement for t/I activity by the cellular blastoderm stage (Mahoney and Lengyel, 1987). Levels of t/I transcript decrease dramatically (approximately 20-fold) by 4-6 hr, then rise slightly (about e-fold), remaining at a plateau from 6 to 11 hr. The t/l RNA concentration then declines a second time; by 14-17 hr, little t/l RNA is detected. Spatial Expression of 111 Terminal Domains The spatial distribution of t// RNA was detected by in situ hybridization to whole embryos. The earliest detectable expression of t/I is at nuclear cycle (NC) 11 (data not shown). During NC11 and NC12 (syncytial blastoderm), staining is seen in the nuclei of the termini in a mirrorimage symmetrical pattern, extending from 0%-200/o egg length in the posterior and 800/o-100% egg length in the anterior (Figure 4A). By NC13, t// RNA is concentrated in the cytoplasm (Figure 48). The symmetrical expression of t/I is transient; shortly after its appearance, t// RNA begins to disappear from the anterior tip and the ventral midline of the anterior domain. The resolution of this pattern occurs in some embryos as early as NC12; in other embryos the symmetrical staining pattern persists into NC13 (Figure 48). By early NC14 (cellular blastoderm), t/l expression has resolved into smaller domains at both anterior and posterior. Having receded from both the anterior tip and the ventral midline, the anterior domain has now become a stripe traversing the dorsal midline between 76% and 89% egg length; this stripe comes to a point about two-thirds of the way toward the ventral midline (Figure 4C). The dorsal stripe is continuous across the dorsal midline (Figure 4D). In the posterior, the t// expression domain has receded from its most anterior boundary to cover only 0% to 15% of egg length (Figure 4C). The expression of t//during NCs 12-14 is presumably that required to establish the terminal domains and is defined as the early expression phase. The structures missing from mature t/l mutant embryos are summarized in Figure 5A. In Figure 56, the anlagen giving rise to these structures, i.e., the t//-requiring domains, are shaded on the blastoderm fate map. The regions of the blastoderm embryo expressing t/i RNA are indicated, for NC12 and NC14 embryos, in Figures 5C and 5D. At NC12, t/I expression in the posterior is congruent with the domains requiring t//activity, while in the anterior, t/i expression extends significantly beyond domains requiring t// activity. By NC14, the anterior domain corresponds reasonably well with the position in the blasto-

Drosophila 155

Figure

Terminal

4. Spatial

Gene

Distribution

t// Is a Steroid

Receptor

of 111RNA during

Early

Embryogenesis

In situ hybridization of t// cDNA to whole, wild-type embryos, and staging of embryos, was as described in Experimental Procedures. Because t// transcript levels change dramatically during embryogenesis (Figure 3), embryos of different stages were stained for different periods of time (leading to different levels of background staining) to allow specific aspects of the pattern to be detected. All views are lateral, with anterior on the left, unless otherwise indicated. (A) NC12 (stage 4, syncytial blastoderm). (B) NC13 (stage 4). (C) NC14 (stage 5, cellular blastoderm). (D) NC14, dorsal view. (E) Stage 6 (early gastrulation), dorso-lateral view. (F) Stage 7 (gastrulation).

derm fate map of the anlagen of the brain and the dorsal portion of the cephalopharyngeal skeleton (Hartenstein et al., 1985; Jtirgens et al., 1986). The dorsal pouch arises from a relatively large area (Jiirgens et al., 1986); the minor effects of f/l mutants on the derivatives of this domain suggest that t/l is required only in part of the domain. The posterior domain at NC14 (0% to 15% egg length ) overlaps most of the anlagen for posterior U/defects, i.e., those for posterior midgut, Malpighian tubules, hindgut, and anal pads. The anterior part of the posterior t// domain does not, however, extend to the A8 ectodermal domain t/l is exdeleted in amorphic t// mutants. Furthermore, pressed all the way to the extreme posterior of the embryo, even though not all of the posterior midgut is deleted in t/l amorphic embryos. Nervous System After the cellular blastoderm stage, t//expression is limited to the anterior of the embryo, particularly to the forming brain. Starting at gastrulation, posterior NI RNA decays rapidly, with a half-life of approximately 10 min (see

Figures 4E and 4F); that which remains at the end of gastrulation is found in the anterior of the amnioproctodeal plate (Figures 4F and 6A). After stage 9, expression of U/ in the posterior is no longer detected. At the end of the cellular blastoderm stage, the dorsal stripe becomes divided along the midline into two distinct dorsolateral domains anterior to the cephalic furrow; expression levels vary among the cells in the domain (see Figure 4E). During gastrulation, the dorsolateral t//domains become stretched anteroposteriorly and each appears as two adjacent, obliquely inclined bands (see Figure 4F). During germband extension (stage 8), t/l expression in the anterior overlaps with the region destined to give rise to the brain (Campos-Ortega and Hartenstein, 1985) (Figures 6A and 6B). During stages 11 and 12, t/l RNA levels increase (consistent with the increase in V/ RNA levels seen in gel blots at 6-8 hr) in a group of cells whose position corresponds closely to that of the procephalic neuroblasts (the forming brain) (Figures 6C and 6D). During stage 13 and subsequently, N/RNA is lost from the central

Cell 156

what is most likely the peripheral nervous system (PNS). Small groups of cells in the clypeolabrum and the gnathal segments, and in a row in each trunk segment, become labeled in stage 12 (Figure 6D). The position of the labeled cells just beneath the ectoderm as a row in each segment is consistent with their being neuroblast progenitors of the PNS (Campos-Ortega and Hartenstein, 1965). The presumed PNS expression persists into stage 13 (germband shortening completed) but not beyond (Figures 6F and 6G).

D

Figure 5. Comparison of Domains Requiring and Domains Expressing t// (A) Oytline of stage 17 embryo showing internal organs, redrawn from Campos-Ortega and Hartenstein (1965). Structures and organs missing from f/I embryos are shaded. (B, C, and 0) Fate map of blastoderm embryo, redrawn from Jiirgens et al. (1996). Jgrgens (1967), and Hartenstein et al. (1965). (8) The anlagen giving rise to the structures deleted in f// embryos (from [A]) are shaded. (C) Domains expressing HI RNA at NC12 are shaded (average of measurements on 5 embryos); data taken from experiments described in Figure 4. (The NC14 fate map is shown for orientation, but is not meant to imply that nuclei are determined at this stage.) (D) Domains expressing U/at NC14 (average of measurements on 10 embryos) are shaded. AMG = anterior midgut, AP = anal pads, DA = dorsal arms, DB = dorsal bridge of cephalopharyngeal skeleton, DP = dorsal pouch, HG = hindgut, LR = labrum, MT = Malpighian tubules, PM = posterior midgut, PS = posterior spiracles, BTOM = stomodeum, T = telson.

Sequence of t/l cDNA The 1662-nucleotide sequence of the t/i cDNA clone N4 is shown in Figure 7. No poly(A) tract is found in this sequence; a putative poly(A) addition signal (Proudfoot and Brownlee, 1976), AATAA, is found 7 nucleotides from the 3’ end. The t// RNA is detected in the poly(A)+ fraction; the length of the N4 cDNA plus a short poly(A) tract are essentially equal to the size of the t/I RNA detected on gel blots. Mapping of the N4 cDNA onto the DNA of phage Cl (see Figure 28) reveals that the transcription unit contains no large introns (see Figure 20). Conceptual translation of the NlcDNA sequence reveals a large open reading frame, capable of encoding a 452amino-acid polypeptide, with a molecular weight of 50,549 daltons. The codon usage within the open reading frame is consistent with that seen for other Drosophila genes. Three ATG codons, all within this same reading frame, are found at the beginning of the open reading frame. The first of these codons is surrounded by a sequence that provides a reasonable match to the Drosophila translation start consensus (Cavener, 1987) and was chosen as the translation start for the amino acid sequence. Similarity between the f/l Protein and Steroid Hormone Receptors Searches of several protein data bases revealed a highly significant similarity between the predicted NI protein and the members of the steroid receptor superfamily (Figure 6). Within this family are the vertebrate receptor for the putative morphogen retinoic acid, as well as the Drosophila neural determination gene seven-up and the ecdysteroid-inducible gene E75 (for reviews see Evans, 1988; Mlodzik et al., 1990; Segraves and Hogness, 1990). Members of this family share two domains of similarity: a 66to 66-amino-acid DNA binding region and a 250-aminoacid hormone binding portion at the C-terminus (Evans, 1966). Additional members of the family have been identified in Drosophila binding domain,

to the DNA binding do-

main. These include the segmentation gap gene knirps and related genes knirps-related and embryonic gonad (Nauber et al., 1966; Oro et al., 1988a; Rothe et al., 1969). The predicted t// protein contains domains similar to both

portion but persists in the most peripheral (particularly posterior) cortical regions of the brain (Figures 6F and 6G). By stage IS, the residual f//expression is most prominent in the optic lobe (Figure 6H). In addition to the strong expression in the brain, transient expression of t// occurs during stages 12 and 13 in

that have a strong similarity but lack the canonical ligand

the

DNA

binding

domain

and

the ligand

binding

do-

main characteristic of the steroid receptor superfamily. In the DNA binding domain, NI is 54% identical to the estrogen receptor (hER) and the seven-up protein (Figure 8A). High similarity is also seen to the Drosophila E75 protein (49%). The similarity to the knirps group of genes is lower (40%-43%), not much higher than the similarity to the

Drosophila 157

Terminal

Gene

t// Is a Steroid

Receptor

H

Figure

6. Expression

of r// RNA in the Brain and PNS

In situ hybridization to whole embryos as described in Figure 4. (A) Stage 8 (germband elongation). (B) Stage 6, dorsal view. (C) Stage 11 (maximal germband extension). (D) Stage 12 (germband shortening). (E) Stage 12 (end of germband shortening), dorsolateral view. (F) Stage 13 (germband shortening completed), dorsal view. (G) Stage 14 (head involution and dorsal closure), dorsal view. (H) Stage 16 (condensation of central nervous system), dorsal view. BR = brain, PNB = procephalic neuroblasts, PNSp = cells presumed to be precursors of the peripheral nervous system.

receptor that appears least related to t// (vitamin D, 38% similarity). Among the members of the steroid receptor superfamily, the ligand binding domain shows much more divergence than the DNA binding domain. There are three conserved subdomains within the ligand binding domain (Segraves and Hogness, 1990); the first two of these show significant similarity between t//and seven-up (40%) and t/l and hER (37%) (Figure 8B). This high level of identity

argues that a canonical ligand binding domain has been conserved in the evolution of the t/l gene. Discussion We have cloned and characterized the zygotic terminal gene f//, which is required to establish anterior and posterior domains in the blastoderm embryo. Approximately 10 kb of genomic DNA is sufficient to rescue embryos

Cell 15%

1 91

CGGGATCACATCGGAGTMCCMCGATATATCGMTATATCACTCC MMCCACTCMACATACACCAGTCCCMGTGMATTCMTTTCTGTG~GCGTTTCTAC~TCGC~TTACGCCC~~TCGGT 1MPSSEGSPDMMDGKYNSVRLSPAASSRlLY

90 180 :;D El

121N A N Y KD AM N G A G E II P 9 I 541 ATGGCCATGTAtMGCATGCCATCATeCCtCCCGGCCACATCCGGC 151F P G V P M PM P G L P P R A G H 631 TTTCCTGcAGTACCGATGCCWTGCCTGCCTGGCCACAGTCG 181A AA V L D L S V P R V P H Ii P V 721 GCTGCCGCTGTCTTGGACTTATCCCTGCCACCACTCCCCCCCGCCGCC 211 I M N AL AT R A L P PTP P L I4

PA

E

I

L

II

HP

A

II

N

AA

NT F

A

AL

9

P

P

T

G

P

S

H

9

G

H

H

G

F

F

S

P

T

AA

A

A

E

H

I

K

E

T

A

A

E

YL

271 (s F F I LANA P Y L II P II N F A P L L F V Y ES E N A N 991 CAGTTCTTUTCCTGGCUTGGCCCAGTACCTMTGCCATGMTGCCMCCGG 301 E I II G II V T R E V H A F P E V L N P L C H ~~~~~~~~~~~~~~~~~~~~~~ 1081 331 ~CATUTGCGUTCGTCACCCGa;ACCTCCACCCCTTCCAG~GGTGCT~CCMCTGTGCCATCTGM~Al~GACAG~CC~AGrAC c”” ..(~,.‘,~, ...:*,.,,..+);.,p’, ..:*?Liw. .(..,.....$ ..::,.......,.::....:.::... ..:.>,.:.. ... .,.,.: .. :..,. ....:.:.: .\..... :.:.:.. ...?:... ‘..:‘:“:.. .::. . .::.:.:.:: .......~..~~.~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~.~~~.~~~~.~~:~~~:~~~~~~~~:~ N S S , L T 1171 ~~~~~~~~~~A~~~~~~~f~~~~~~~~~c~cc~~c~~~ttc~A~~~A~~~.tf~~cc~cAGc~c~~~~~~~~AG~ 361 s G s p N s s A s A E s R G L L E ~~~,~~~~~~~~~~~~~.~~~~~~~~~~ 1261 ACtGGCAGCCCGMCTCCTCCCCCTCTGCTWAICUGGGGTC~G~GTCTTCTG~GT~~~~t~~~G~~~A~~C~~~~~~~~~~d~GT 391A L H N YIP R T HP S P P M R F G T L L G V VP L M H K 1351 GCGCTGWUACTACATCCAWGGACCCATCCCC~CGCAGCC~~GC~~~C~~CGC~CTTGGGCGTGGTGCAGCTCATGCACMGGTC 421s S F T IE E L F F R K T I G D I T I V R L I SD M Y So 1441 ICMGCITCAC~TCCAGCTGTTCTTCCWMGACCATCTGTACAGTCAGCGC 451 K I l 1531 MGAlCTCMMGTATGTACACCCTAGACTMTCGCACTCtGCCTTCCMGTGCTGGGMCTGTGATMTCTCGGMCMGCG 1621 CTTTGCACMTACTCGATCAGTGMAICMCGATTTCTCATATC~~GTC~~CTT~TACGTA~CMCACT~CCTTMTACC 1711 TTACCTMACACAACTCGAMiTMTCTTAGCTAMCTeTCTCAGTTTCMCTTT 1801 GCCTGTTMATACGTCMTCGTAGTTTTMACACT7TACTTTAGTTTTMGCGCATATTATTAGCTTTAGGATTTG~~TTATTCCCG Figure

7. Nucleotide

and Predicted

Amino

Acid

Sequence

R

G s V R

EO 120 540 150 630 180 720 210 810 240 900 270 3z0 1080 330 1170 360 1260 390 1350 420 1440 450 1530 1620 1710 1800 1889

of the f// cDNA

The nucleotide sequence of the 1882-nucleotide t/l cDNA N4 is shown with its predicted amino acid sequence. The ATG used to begin conceptual translation of the t// protein was chosen owing to its conformity to the consensus Drosophila translation start site and to its primary position. The domains of similarity between the NI protein and the steroid receptor family are shaded. The first and last three bases of sequence are from the linker used for cloning the cDNA. The putative poly(A) addition site, AATAA. at the 3’ end is underlined.

homozygous for a strong t// allele to adulthood. The expression pattern of t/I at the blastoderm stage is generally consistent with the mutant phenotype. In addition, t/I is expressed strongly in the developing brain and transiently in what is most likely the PNS. Sequence similarities show that the t/I protein is a newly described member of the steroid receptor superfamily. Regulation and Requirement for First Phase of f/l Expression Regulafion The localized early expression of t/I constitutes the first visible manifestation of maternal terminal gene activity and reveals its symmetrical nature. The complete mirrorimage symmetry of the two terminal domains is remarkable, given the formation of most of the anterior midgut and stomodeum (the anlagen of which overlap with the earliest t/I expression, see Figure 5C) in maternal terminal mutant embryos (Schiipbach and Wieschaus, 1988; Klingler, 1989). The maternal terminal system thus appears to be activated in regions in which it is not ultimately required. Our data on t// make it possible to integrate previous results (Sprenger et al., 1989; Mark et al., 1987; Nishida et al., 1988; Ambrosio et al., 1989; Klingler, 1989) into the following model for establishing the termini (Figure 9A). The membrane-bound tyrosine kinase torso protein, the serine/threonine kinase D-raf protein, and unknown tran-

scriptional activators are provided maternally and distributed uniformly in the embryo. Ligand released symmetrically at the poles of the embryo (controlled by the torso-like gene) probably forms a gradient; above a certain threshold concentration of ligand, the torso protein is activated. Symmetrically activated torso protein phosphorylates the D-&protein, which in turn activates one or more transcriptional activators for t// (Figure 9B). The symmetrical transcriptional activation of the t/I gene at the poles of the NC11 embryo is the earliest known spatially localized transcription resulting from the activity of the maternal terminal system. The genetically characterized activation of the D-raf gene product by the torso gene product in Drosophila embryos is strikingly analogous to the platelet-derived growth factor (PDGF) activation of Raf-1 via the PDGF Preceptor in mammalian cells (Morrison et al., 1989). Furthermore, the induction of N/transcription by a (presumed) ligand-activated phosphorylation cascade is analogous to the induction of the steroid receptor homolog NGFB-I by nerve growth factor (Milbrandt, 1988) and more broadly to the induction of a variety of transcription factor genes by growth factors (for review see Herschman, 1989). The symmetrical activation of the t// gene at the two ends of the embryo lends further support to the argument that there is an underlying similarity between the asegmental anterior and posterior domains; these terminal domains are believed to be conserved in annelids and ar-

YFphila

Terminal

A ttt S”P E75A kni km-1 IF hGR

Gene

111 Is a

Steroid

Receptor

DNA-BINDING

2; 245

RRSRQ RRNLT aatcta NNIST NNLSS NNIST PGHND EGPHN

5 14 5 185 421

t11 ba 234 SEA279 kni 39 knr 1 48 egon 39 hER 219 hGR 455

B

CV-~$~$S~KGGL v,‘& - d’d G S R N - ~:~J~~TKNPP-I$EC-:$NEGK-I$DC-KNNGE-I & E t$rt N E G K - tN-EPATNQ-~L-~AGRND--

LIGAND-BINDING

tll svp E75A hER hGR

244 352 422 358 575

tll svp E75A hER hGR

323 434 502 438 656

tll SVP E75A hER hGR

378 489 557 504 718

Figure 8. Sequence Similarity between the Predicted t// Sequence and Domains of the Steroid Receptor Superfamily

DOMAIN

V N U I If S v; R A f T #ifi

TH&NP HHRNP

I #;& N R K Ifjig T 1 Kf@qTA K y;.tj 1 1 NR(IKS IRltKN

DOMAIN P M P 63.f

L L: $ E E S U K t

(A) The DNA binding domain; t/lresidues compared with domains of the Drosophila seven-up (svp), E75, knirps (kni), knirps-reelated (knrl), and embryonic gonad (egon) proteins, as well as the human estrogen and glucocorticoid receptors (hER and hGR) (Mlodzik et al., 1990; Segraves and Hogness, 1990; Nauber et al., 1999; Oro et al., 19aaa; Rothe et al., 1999; Walter et al., 1985; Hollenberg et al., 1985). Residues that are identical or similar (E/D; FMIIY; I/W; L/M; R/K; T/S) are shaded if they occur in 4 (or more) of 9 sequences. The corresponding amino acid residue numbers for each protein are shown at the left of the sequences. (6) The ligand binding domain. tll residues compared with domains of seven-up, E75, hER, and hGR; the knirps, knirps-related, and embryonic gonad proteins do not share this similarity. Residues that are similar or identical in 3 (or more) of 5 sequences are shaded.

UEU:~KNI.FFFPhtPVT~:P:tlAtLRLVUSE ‘! D pi 4 ,C M j.:p~;@~$ P L. t: T Q D tr,,,K,,/F T &;k K A G L, F D 4 N Y.&.:$ R Y;p-,‘Be V 9:;~ T $ Ii l@;t, H t;:-& E C A N L t tlKV:.I::iKAIiQ’:~.8%RNXiHtiD$iiPMT~.f;oYSUMF . ..

thropods (for review see Strecker and Lengyel, 1988). With the key components of the Drosophila hierarchy now in hand, it may be possible to investigate, at the molecular level, the conservation of a mechanism for distinguishing terminal asegmental from central segmental domains. Although the initial activation of t/l is symmetrical, subsequent regulation quickly becomes pole specific as the anterior cap resolves into a dorsal stripe and the posterior cap recedes. At the anterior, the simplest hypothesis is that the bicoid and dorsal genes repress t/l transcription anteriorly and ventrally, respectively. At the posterior, retraction of the domain from 20% to 15% egg length is more difficult to explain. Resolution of the domain by mutually repressive interactions leading to adjoining borders, as seems to be the case for the gap genes hunchback, Kriippel, and knirps (JBckle et al., 1986; Pankratz et al., 1989), is an unlikely mechanism. First, at NC14, the posterior domain of t//expression is separated by intervals of 9% and 15% egg length, respectively, from the more centrally located domains expressing the gap genes giant and knirps (Figure 5D; Pankratz et al., 1989; Mohler et al., 1989). Second, and more significantly, although t// represses knirps (Pankratz et al., 1989), the failure of the terminal domains to expand in knirps embryos (Lehmann, 1988) makes a reciprocal effect of knirps on t/i unlikely. Requirement for t/l The anlagen that require t/l activity are those for the brain

and dorsal portion of the cephalopharyngeal skeleton in the anterior, and the posterior midgut, Malpighian tubules, hindgut, anal pads, telson, and A8 in the posterior (Figures 58 and 5C). For the most part, the domains in which t/l is expressed at the blastoderm stage correspond to the positions of these anlagen. A departure from this correlation is that the resolved posterior domain (at NC14) does not overlap with the A8 anlage, even though A8 is missing from U/ mutant embryos. Similar observations on hunchback, Kriippel, and knirps-namely, that the pattern deletion extends significantly beyond the borders of RNA expression-have been explained by diffusion of protein from its localized source of synthesis in the syncytial embryo and combinatorial effects of proteins at the borders (Pankratz et al., 1989; StanojeviC et al., 1989). In the case of t/l, the protein required in the A8 anlage could arise either from translation of RNA present at NC12 (when the t/l expression domain does extend to the A8 anlage) or by diffusion from the retracted NC14 domain. In contrast to the situation described above, t//is also expressed in a region of the embryo, the most extreme posterior, where it is not required. Even in the complete absence of t/l activity, this region gives rise to a portion of the posterior midgut (Figure 1G). In mutants of the gap gene huckebein, the entire posterior midgut is missing (Weigel et al., 1990). Thus, overlapping activity of both t//

Cell

160

A

uniform tar+, D-rof+,tram

act

t locally octlvoted toe, o-rof+, Irons. act

locollzed /I/ tronscriptlon

a B

0

ligand

C/s/)

serme

kinose

threonme

(D-r&)

transcr&tuon activ+3r(s) t f//gene L Figure

9. Model

for Establishing

the Termini

(A) Distribution within the Drosophila embryo of gene products leading to transcription of the t// gene. tar+, D-rap = protein products of the torso and D-ref genes; trans. act. = unknown transcriptional activator(s) of the t//gene. Open circles and solid circles = unactivated and activated, respectively, torso+, D-mf+, and transcriptional activator(s). (6) Phosphorylation cascade leading to transcriptional activation of t/l.

and huckebein is required to establish part of the posterior midgut, while (even though t/I is expressed there) only huckebein activity is required to establish the most posterior of the embryo. As the early expression of f/l is required for normal pattern formation and viability (Strecker et al., 1986; Mahoney and Lengyel, 1987), the regulatory elements required for the early expression of t// must reside in the 10 kb of rescuing DNA in cosmid D1.R. Molecular identification of these regulatory elements and the gene products that interact with them should help to define the pathways controlling the early f// expression pattern. Second Phase: Expression in the Nervous System The major expression of f/I during the second phase is in the anterior, in the region that will give rise to the brain. Expression in the nervous system is a feature that f/I shares with the gap genes hunchback and Kriippel (Knipple et al., 1985; Tautz et al., 1987). Also, most of the segmentation genes, e.g., fushi tarazu, even-skipped, and en-

grailed, are expressed in repeating segmental patterns in the developing ventral nerve cord (for review see Doe et al., 1988b). The nervous system expression of t//is exceptional in that it occurs at a high level throughout the developing brain and, later, transiently in the presumptive forming PNS. This staining pattern can best be correlated with the location of neuroblasts. Thus, t// RNA is present at a high level in the forming brain during stages 8 through 12 (Figure 6), begins to disappear from the central portion of the brain during stage 13 (consistent with the cortical location of neuroblasts at later stages), and is seen only in the posterolateral cortical region by stage 16 (consistent with the position of neuroblasts in the optic lobe anlagen) (Campos-Ortega and Hartenstein, 1985; Truman and Bate, 1988). Finally, the stage and location at which t// RNA is detected peripherally in each segment is very likely to correspond to the terminal division of the sensillum precursors of the PNS during germband shortening (Campos-Ortega and Hartenstein, 1985; Bodmer et al., 1989). The early expression of t//is clearly required to establish the anlage of the posterior portion of the brain. Whether the later expression of N/ plays an additional role in development of the nervous system is unknown at present. Of the segmentation genes expressed in the nervous system, the pair-rule genes fushi tarazu and even-skipped and the segment polarity genes gooseberry, patched, Cell, and wingless have been shown to play specific roles in controlling neuronal cell fate (Doe et al., 1988a, 1988b; Pate1 et al., 1989). While neuroblasts that express t/l during the second phase, namely, the anterior portion of the brain and the PNS precursors, do not appear grossly abnormal in t/l mutants, (J. A. L., unpublished data), the expression of r// in these cells could be required to establish more subtle properties. Transformation rescue with constructs that express only the early t/I pattern may reveal whether there is a requirement during neurogenesis. t/l As a Potential Transcription Factor Sequence analysis of the t// gene places it in the steroid receptor superfamily. Like all members of the family, the t// irotein shows a high degree of similarity to a 66- to 68amino-acid domain with invariantly spaced cysteine residues believed to coordinate Zn2+ and thus hold the polypeptide chain into DNA binding “fingers.” The similarity between the putative DNA binding domain of t/l and that of other proteins ranges from identities of 54% with sevenup and hER, to 38% with the vitamin D receptor. In vitro mutagenesis analysis of the DNA binding domains of several steroid receptors has identified specific amino acid positions as critical for target specificity or for transcriptional activation. In these positions, the t/f protein differs from the described steroid receptors. Three amino acid residues important for sequence specificity of binding are located between and immediately following the 3rd and 4th conserved cysteines: the residues Glu-Gly and Gly (CECKQ are found in the thyroid and retinoic acid, while Gly-Ser and Val (CGSCKU are found in the glucocorticoid class of receptors (Umesono and Evans, 1989; Danielsen et al., 1989; Mader et al., 1989). The t/f protein,

YFphila

Terminal

Gene

t// Is a Steroid

Receptor

with residues Asp-Gly and Gly (CECAG), is in this respect most like the thyroid and retinoic acid class of receptors, but differs in the Glu/Gly position, which is thought to contact DNA directly (Danielsen et al., 1989). Another region implicated in target specificity (but not thought to bind to DNA directly) lies between the fifth and sixth conserved cysteines of the DNA binding domain (Umesono and Evans, 1989). While this region contains 5 amino acids in all other receptors, there are 7 in the t/I protein. Finally, in all steroid receptors, the position immediately following the 4th cysteine is a Lys (K); replacement of this Lys by Gly in the glucocorticoid receptor did not affect binding to DNA or repression of transcription, but did eliminate activation of transcription (Oro et al., 1988b). In the t// protein this position is occupied by an Ala. The significance of the difference, at these important amino acid positions, between the f/I protein and other steroid receptors awaits the characterization of DNA targets of the f/I gene. The Drosophila receptor homologs described to date fall into two categories with respect to their C-terminal domain. In one group, the C-terminal domain is similar to the ligand binding domain of the mammalian receptors. This group contains t//, E75, and seven-up (Segraves and Hogness, 1990; Mlodzik et al., 1990). The similarity between members of this group in the ligand binding domain raises the possibility that there exist small lipophilic ligand molecules for these proteins that have yet to be identified. In the second group of Drosophila receptor homologs, which includes knirps and the related genes knirps-related and embryonic gonad, the C-terminal domain shows little if any similarity to the ligand binding domain. It is unlikely that members of this group bind to steroid-like molecules, although they may respond to a different class of ligand, or function in a ligand-independent manner. At the genetic level, t//functions both as a repressor and as an activator. When expressed ectopically in the central segmental domain (under control of torso dominant alleles), t// represses both the Kfflppel and fushi tarazu genes and thus inhibits the formation of segments (Klingler et al., 1988; Strecker et al., 1989). In the termini, t/f activity is required for appearance of the 7th stripe of fushi tarazu and hairy expression (Mahoney and Lengyel, 1987) as well as for specific domains of expression of caudal, hunchback, and forkhead (Mlodzik and Gehring, 1987; Schrederet al., 1988; Weigel et al., 1990). It may be significant that several steroid hormone receptors are capable of acting both as activators and repressors of transcription (for reviews see Seato, 1989; Levine and Manley, 1989). Whether t//also acts directly as both a repressor and activator via its putative DNA binding domain can be addressed by DNA binding and in vitro transcription assays. The t//protein provides the crucial molecular link in the terminal gene hierarchy, between the torso membrane receptor and downstream region-specific homeotic genes such as spa/t and forkhead (for review see Weigel and Jackie, 1989). As N/is itself a putative transcription factor, its expression is the first manifestation of terminal gene activity that can lead to altered zygotic transcription. The transduction of the polar signal via the torso and D-raf pro-

teins, leading to the transcriptional activation of a gene that itself encodes a transcription factor, is strikingly analogous to the growth factor induction of transcription of the proto-oncogene transcription factor APl/jun (for review see Herschman, 1989). Further analysis of the terminal gene hierarchy, including the U/gene, is thus expected to provide insight not only into the mechanism of terminal specification, but also into the general problem of growth factor modulation of cellular transcriptional activity. Experimental

Procedures

Drosophila Stocks, Mutagenesis, and Crosses The deficiencies Dff3R)tlle and Df(3R)t/lg, the inversion /n(3R)t//*, and the point mutation tlla have been described previously (Strecker et al., 1988). A strong allele, t//‘4g, was isolated in a screen of approximately 20,000 X-ray irradiated cu chromosomes over the t/l* deficiency. The deficiency Df(3R)t//mx, which deletes chromosomal bands lOOA1,2 through 10061,2, was isolated in a screen of 5000 X-ray treated fi e chromosomes over the t//g deficiency. Wild-type Ore R flies were maintained in population cages at 25’C. Clonlng of 111and Trensformetlon Rescue Standard chromosome walking techniques were used. The genomic libraries screened were provided by Dr. J. Tamkun and consist of SaudA partially digested DNA subcloned into EMBLB phage or CosPer cosmid modified to include Notl sites in the polylinker (J. Tamkun, personal communication). DNA probes were labeled by random priming (Feinberg and Vogelstein, 1983). The 11 kb Sal1 restriction fragment of phage Cl (Figure 28) was used to screen a O-4 hr embryonic cDNA library in lambda gtl0 (Frigerio et al., 1988). Approximately 500,000 plaques were screened using standard procedures and one cDNA clone, N4, was isolated (Figure 2D); this was mapped onto the 11 kb Sal1 genomic DNA fragment of phage Cl by Southern blotting. For transformation rescue (Spradling and Rubin, 1982; Rubin and Spradling, 1982), subclone D1.R was prepared from cosmid Dl, which contains an internal Notl site, by partial digestion and religation (see text). From injection of D1.R DNA into wlHB embryos, two transformant lines, P12 and P75, were obtained. The latter line resulted from two insertion events; these were separated to generate lines P75-2 and P75-3, carrying independent inserts on the second and third chromosomes, respectively. Phenotype Analysis Cuticles were prepared by standard techniques (Wieschaus and Niisslein-Volhard, 1988). Antibody staining was as described by Hartenstein and Campos-Ortega (1988), using monoclonal antibody 44Cl1, which specifically stains the nuclei of the embryonic nervous system (Bier et al., 1988), and anti-caudal antibody, which stains nuclei of the posterior midgut and Malpighian tubules, but not hindgut (MacDonald and Struhl, 1988). Secondary antibody was goat anti-mouse and goat anti-rabbit F(ab’) coupled to horseradish peroxidase (Jackson Immunoresearch Laboratories). Analysis of t/l RNA Expression For RNA gel blots, embryos were collected and aged at 25OC, frozen in liquid nitrogen, and stored at -70°C until needed. F’oly(A)+ RNA was isolated using the Fasttrack kit (In Vitrogen). RNA was treated with glyoxal/dimethyl sulfoxide and electrophoresed on a 1.1% agarose gel (Thomas, 1980), transferred to Nylran (Schleicher & Schuell), UV cross-linked, and baked for 1 hr. Hybridization with DNA probes was at 55OC in 0.99 M Na+and 50% formamide; final washes were at 0.2x SSC, 0.1% SDS at 8OOC. Filters were exposed to Kodak X-omat film with intensifying screen. The probe for rp49 expression was the EcoRI-Hindlll fragment from the Sall insert of plasmid ~~20.1 (Kongsuwan et al., 1985) subcloned into pBluescript. For in situ hybridization to whole embryos (Mahoney and Lengyel, 1987), embryos were collected and aged at room temperature, devitellinized, fixed, and stored in 100% ethanol at -20°C until needed. DNA probes were labeled by random priming with digoxigenin-dATP (Genius kit, Boehringer Mannheim), and incorporation was monitored by

Cdl 162

addition of [32P]dCTP Hybridization and detection was carried out by the procedure of Tautz and Pfeifle (1989) as modified by C. Oh and B. Edgar (personal communication). Embryonic stages are those of Campos-Ortega and Hartenstein (1985). Nuclear cycles were determined from the distance between nuclei relative to embryo length, following the description of Foe and Alberts (1983). Sequencing and Computer Analysis The t/l cDNA N4 was subcloned in both orientations into pBluescript. Using exonuclease Ill (Erase-a-base system, Promega), progressive deletions of the insert DNA were generated. Sequencing of both strands was by the dideoxy chain termination method (Sanger et al., 1977) from the universal Ml3 primer or synthetic oligonucleotides using Sequenase (Version 2.0, U. S. Biochemical Corp.) and [%]dATP Some sequence was obtained by the Sequencing Facility at the University of California, Los Angeles, using the Applied Biosystems Sequenator. Ambiguous GC-rich regions were resequenced using dlTP Sequence was compiled using the DB system (Staden, 1980) and codon usage probabilities were determined using the Drosophila codon tables of Michael Ashburner (Version 8.0, personal communication). The deduced t//protein sequence was compared with the NBRF and GenBank protein data bases using the program FASTA; comparisons between t// and other members of the steroid receptor superfamily were made with the ALIGN program (Pearson and Lipman, 1988). Acknowledgments We are very grateful to M. Noll for providing unpublished clones that allowed us to initiate our walk, as well as a cDNA library; to J. Tamkun for providing the genomic libraries and continued advice for the chromosomal walk; to J. Campos-Ortega for the facilities where some of this work was initiated; F. Laski for assistance with Drosophila transformation; V. Hartenstein for assistance with interpreting t//expression in the nervous system; f? MacDonald and Y.-N. Jan for providing anticaudaland 44Cll antibody, respectively; D. Weigel for communicating data prior to publication; F. Grawe for carrying out some of the initial in situ hybridizations to whole embryos; E. Gruzynski for assistance with the genetic screens; A. Maliglig for embryo collections and antibody staining; and K. V. Anderson and S. Crews for comments on the manuscript. The research was supported by National Science Foundation grant DCB1045 to J. A. L. and J. Ft. M., National Institutes of Health grants HD09948 to J. A. L. and GM38432 to J. R. M., an Ursula Mandel Fellowship to F. F’., and a UCLA Research Mentorship Fellowship to R. J. D. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Received

April 26, 1990; revised

May 16, 1990

Doe, C. Q., Smouse. D., and Goodman, C. S. (1988a). Control of the neuronal fate by the Drosophila segmentation gene even-skipped. Nature 333, 376-378. Doe, C. Q., Hiromi, Y., Gehring, W. J., and Goodman, C. S. (1988b). Expression and function of the segmentation gene fushi faram during Drosophila neurogenesis. Science 239, 170-175. Evans, R. (1988). The steroid ily. Science 240, 889-895.

Akam, M. (1987). The molecular sophila embryo. Development

basis for metameric 707, 1-22.

pattern

in the Dro-

Ambrosio, L., Mahowald, A. P, and Perrimon, N. (1989). /(l&o/eho/e is required maternally for pattern formation in the terminal regions of the embryo. Development 706, 145-158. Gene

regulation

by steroid

hormones.

Cell 56,

Bier, E., Ackerman, L.. Barbel, S., Jan, L., and Jan, Y. N. (1988). Identification and characterization of a neuron-specific nuclear antigen in Drosophila. Science 240, 913-916. Bodmer, R., Carretto, R., and Jan, Y. N. (1989). Neurogenesis of the peripheral nervous system in Drosophila embryos: DNA replication patterns and cell lineages. Neuron 3, 21-32. Campos-Crtega, J. A., and Hartenstein, velopment of Drosophila melanogastar

V. (1985). The Embryonic (Berlin: Springer-Verlag).

De-

Cavener, D. R. (1987). Comparison of the consensus sequence flanking translation start sites in Drosophila and vertebrates. Nucl. Acids Res. 15, 1353-1361.

and thyroid

hormone

receptor

superfam-

Feinberg, A. P., and Vogelstein, 8. (1983). A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132, 6-13. Foe, V. E., and Alberts. B. M. (1983). Studies of nuclear and cytoplasmic behaviour during the five mitotic cycles that precede gastrulation in Drosophila embryogenesis. J. Cell Sci. 67, 31-70. Frigerio, G., Burri, M., Bopp, D., Baumgartner, S., and Nell, M. (1986). Structure of the segmentation gene paired and the Drosophila PRD gene set as part of a gene network. Cell 47, 735-746. Hartenstein, V., and Campos-Ortega, J. A. (1986). The peripheral nervous system of mutants of early embryogenesis in Drosophila melanogaster Roux’s Arch. Dev. Biol. 196, 210-221. Hartenstein, V, Technau, G. M., and Campos-Ortega, J. A. (1985). Fate-mapping in wild-type Drosophila melanogastar: Ill. A fate map of the blastoderm. Roux’s Arch. Dev. Biol. 794, 213-216. Herschman, and cellular

H. (1989). Extracellular signals, transcriptional specificity. Trends Biochem. 74, 455-458.

responses

Hollenberg, S. M., Weinberger, C., Ong, E. S., Cerelli, G., Ore, A., Lebo, R., Thompson, E. B., Rosenfeld. M. G., and Evans, R. M. (1985). Primary structure and expression of a functional human glucocorticoid receptor cDNA. Nature 378, 635-641. Ingham, f? W. (1988). The molecular genetics mation in Drosophila. Nature 335, 25-33.

of embryonic

pattern

for-

Jackie, H., Seifert, E., Preiss. A., and Rosenberg, U. 8. (1986). Probing gene activity in Drosophila embryos. J. Embryol. Exp. Morphol. (Suppl.) 97, 157-168. Jiirgens, G. (1987). Segmental organisation of the tail region in the embryo of Drosophila melanogastar, a blastoderm fate map of the cuticle structures of the larval tail region. Roux’s Arch. Dev. Biol. 796, 141-157. Jtirgens, G., Lehmann, R., Schardin, M., and Niisslein-Volhard, C. (1986). Segmental organisation of the head in the embryo of Drosophila melanogaster. A blastoderm fate map of the cuticle structures of the larval head. Roux’s Arch. Dev. Biol. 795, 359-377. Klingler, M. (1989). Die Funktion des Gens torso bei der Determination terminaler Anlagen im Drosophila Embryo. Ph.D. thesis, University of Tubingen, Federal Republic of Germany. Klingler, Function embryo.

References

Beato, M. (1989). 335-344.

Danielsen, M., Hinck, L., and Ringold, G. M. (1989). Two amino acids within the knuckle of the first zinc finger specify DNA response element activation by the glucocorticoid receptor. Cell 57, 1131-1138.

M., Erdelyi, M., Szabad, J., and Niisslein-Volhard, C. (1988). of torso in determining the terminal anlagen of the Drosophila Nature 335, 275-277.

Knipple, D. C.. Seifert, E., Rosenberg, U. B., Preiss, A., and Jiickle, (1985). Spatial and temporal patterns of Kri@pe/ gene expression early Drosophila embryos. Nature 377; 40-43.

H. in

Kongsuwan, K.. Yu, CL, Vincent, A., Frisardi, M. C., Rosbash, Lengyel. J. A., and Merriam, J. R. (1985). AD-osophi/a mhufagene codes a ribosomal protein. Nature 377, 555-558.

M., en-

Lehmann, R. (1988). Phenotypic comparison between maternal zygotic genes controlling the segmental pattern of the Drosophila bryo. Development (Suppl.) 704, 17-27.

and em-

Levine, karyotic

M.. and Manley, J. L. (1989). Transcriptional promoters. Cell 59, 405-408.

repression

of eu-

MacDonald, P M., and Struhl, G. (1986). A molecular gradient in early Drosophila embryos and its role in specifying the body pattern. Nature 234, 537-545. Mader, S., Kumar, V., de Verneuil, H., and Chambon, P (1989). Three amino acids of the oestrogen receptor are essential to its ability to distinguish an oestrogen from a glucocorticoid-responsive element. Nature 338, 271-274.

Drosophila 163

Terminal

Gene

t// Is a Steroid

Receptor

Mahoney, P. A., and Lengyel, J. A. (1987). The zygotic segmentation mutant tailless alters the blastoderm fate map of the Drosophila embryo. Dev. Biol. 122, 464-470. Mark, G. E., Maclntyre, R. J., Digan, M. E., Ambrosio, mon, N. (1987). Drosophila melanogester homologs cogene. Mol. Cell. Biol. 7, 2134-2140. Milbrandt, J. (1988). to the glucocorticoid

L., and Perriof the raf on-

Spradling, elements 347.

of the steroid

receptor

superfamily.

Genes

A. C., and Rubin, G. M. (1982). Transposition of cloned P into Drosophila germline chromosomes. Science 218, 341-

Sprenger, F., Stevens, L. M., and NOsslein-Volhard, C. (1989). The Drosophila gene torso encodes a putative receptor tyrosine kinase. Nature 338, 478-483.

Nerve growth factor induces a gene homologous receptor gene. Neuron 7, 183-188.

Mlodzik, M., and Gehring, W. J. (1987). Hierarchy of the genetic interactions that specify the anteroposterior segmentation pattern of the Drosophila embryo as monitored by caudal protein expression. Development 101, 421-435. Mlodzik, M., Hiromi, Y., Weber, U.. Goodman, C. S., and Rubin, G. M. (1990). The Drosophila seven-up gene, a member of the steroid receptor gene superfamily, controls photoreceptor cell fates. Cell 60, 211224. Mohler, J., Eldon, E. D., and Pirrotta, V. (1989). scription pattern associated with the segmentation sophila. EMBO J. 8, 1539-1548.

codes two new members Dev. 4, 204-219.

Staden, R. (1980). A new computer method for the storage and manipulation of DNA gel reading data. Nucl. Acids Res. 8. 3673. StanojeviC, D., Hoey, DNA-binding activities Kriippel in Drosophila.

T., and Levine, M. (1989). of the gap proteins encoded Nature 347, 331-335.

Sequence-specific by hunchback and

Strecker, T. R., and Lengyel, J. A. (1988). Anterior-posterior mation: an evolutionary perspective on genes specifying mains. Bioessays 9, 3-8.

pattern terminal

fordo-

A novel spatial trangene, giant, of Dro-

Strecker, T. R., Kongsuwan, K., Lengyel, J. A., and Merriam, J. R. (1986). tailless, a zygotic mutant affecting the anterior and posterior regions of the Drosophila embryo. Dev. Biol. 773, 64-7’6.

Morrison, D. K., Kaplan, D. R., Escobedo, J. A., Rapp, U. R., Roberts, T M., and Williams, L. T. (1989). Direct activation of the serine/threonine kinase activity of Raf-1 through tyrosine phosphorylation by the PDGF preceptor. Cell 58, 649-657.

Strecker, T. R., Merriam, J. R., and Lengyel, J. A. (1988). Graded requirement for the zygotic terminal gene, tailless, in the brain and tail region of the Drosophila embryo. Development 102, 721-734.

Nauber, U., Pankratz, M. J., Kienlin, A., Seifert, E., Klemm, U., and JBckle, H. (1988). Abdominal segmentation of the Drosophila embryo requires a hormone receptor-like protein encoded by the gap gene knirps. Nature 336, 489-492. Nishida, Y., Hata, M., Ayaki, T., Ryo, H., Yamagata, M., Shimizu, K., and Nishizuka, Y. (1988). Proliferation of both somatic and germ cells is affected in the Drosophila mutants of raf protoancogene. EMBO J. 7, 775-781. NOsslein-Volhard, C., FrohnMfer, H. G., and Lehmann, termination of anteroposterior polarity in Drosophila. 1675-1681.

R. (1987). DeScience 238,

Oro, A. E., Ong, E. S., Margolis, J. S., Posakony, J. W., McKeown, M., and Evans, R. M. (1988a). The Drosophila gene knirps-related is a member of the steroid-receptor gene superfamily. Nature 336, 493496. Oro, A. E., Hollenberg. S. M., and tional inhibition by a glucocorticoid protein. Cell 55, 11091114.

Evans, R. M. (1988b). receptor+-galactosidase

Transcripfusion

Pankratz, M. J., Hoch, M., Seifert, E., and JBckle, H. (1989). Kriippel requirement for knirps enhancement reflects overlapping gap gene activities in the Drosophila embryo. Nature 341, w-340. Patel, N. H., Schafer, B., Goodman, The role of segment polarity genes Genes Dev. 34, 890-904. Pearson, sequence

C. S., and Holmgren, R. (1989). during Drosophila neurogenesis.

W. R., and Lipman, D. J. (1988). Improved tools for biological comparison. Proc. Natl. Acad. Sci. USA 8, 2444-2448.

Proudfoot, N., and Brownlee, G. (1976). 3’ non-coding region quences in eukaryotic messenger RNA. Nature 263, 211-214.

se-

Rothe, M., Nauber, U., and Jgckle, H. (1989). Three hormone receptorlike Drosophila genes encode an identical DNA-binding finger. EMBO J. 8, 3087-3094. Rubin, G. M., and Spradling, Drosophila using transposable 353. Sanger, F., Nicklen, with chain-terminating 5467.

A. C. (1982). Genetic transformation of element vectors. Science 218, 348-

S., and Coulson, A. R. (1977). DNA sequencing inhibitors. Proc. Natl. Acad. Sci. USA 74, 5483-

Schriider, C., Tautz, D., Seifert, E., and JBckle, H. (1988). Differential regulation of the two transcripts from the Drosophila gap segmentation gene hunchback. EMBO J. 7, 2881-2887. Schiipbach, T., and Wieschaus, E. (1988). Maternal-effect mutations altering the anterior-posterior pattern of the Drosophila embryo. Roux’s Arch. Dev. Biol. 795, 302-317. Segraves, inducible

W. A., and Hogness, D. S. (1990). The E75 ecdysonegene responsible for the 758 early puff in Drosophila en-

Strecker, T. R., Halsell, S. R., Fisher, W. W., and Lipshitz, H. D. (1989). Reciprocal effects of hyper- and hypoactivity mutations in the Drosophila pattern gene torso. Science 243, 1062-1066. Tautz, D., and Pfeifle, C. (1989). A non-radioactive in situ hybridization method for the localization of specific RNAs in Drosophila embryos reveals translation control of the segmentation gene hunchback. Chromosoma 98, 81-85. Tautz, D., Lehmann, R.. Schniirch, H., Seifert, E., Kienlin, A., Jones, K., and JBckle, H. (1987). Finger protein of novel structure encoded by hunchback, a second member of the gap class of Drosophila segmentation genes. Nature 327, 383-389. Thomas, F! S. (1980). fragments transferred 5201-5205.

Hybridization of denatured RNA and small DNA to nitrocellulose. Proc. Natl. Acad. Sci. USA 77,

Truman, J. W., and Bate, M. (1988). Spatial and temporal patterns of neurogenesis in the central nervous system of Drusophile melanogaster. Dev. Biol. 125, 145-157. Umesono, specificity

K., and Evans, for steroid/thyroid

R. M. (1989). Determinants of target gene hormone receptors. Cell 57, 1139-1146.

Walter, P., Green, S., Greene, G., Krust, A., Bornert, J. M., Jeltsch, J. M., Staub, A., Jensen, E., Scrace. G., Waterfield, M., and Chambon, i? (1985). Cloning of the human estrogen receptor cDNA. Proc. Natl. Acad. Sci. USA 82, 7889-7893. Weigel, D., and Jlckle, H. (1989). Novel homeotic melanogaster Biochem. Cell Biol. 67, 393-396.

genes

in Drosophile

Weigel, D., Jijrgens, G., Klinger, M., and JBckle, H. (1990). Two gap genes mediate maternal terminal pattern information in Drosophila. Science 248.495-498. Wieschaus, E., and Niisslein-Volhard, In Drosophila: A Practical Approach, D. C.: IRL Press), pp. 199-227. GenBank

Accesslon

The accession M34639.

number

C. (1986). Looking at embryos. D. B. Roberts, ed. (Washington,

Number for the sequence

reported

in this paper

is