Research Article Received: 1 July 2014,
Revised: 14 November 2014,
Accepted: 12 December 2014
Published online in Wiley Online Library
(wileyonlinelibrary.com) DOI 10.1002/jat.3117
The effect of a methyl-deficient diet on the global DNA methylation and the DNA methylation regulatory pathways Shota Takumia,b, Kazuyuki Okamuraa, Hiroyuki Yanagisawab, Tomoharu Sanoc, Yayoi Kobayashia and Keiko Noharaa* ABSTRACT: Methyl-deficient diets are known to induce various liver disorders, in which DNA methylation changes are implicated. Recent studies have clarified the existence of the active DNA demethylation pathways that start with oxidization of 5-methylcytosine (5meC) to 5-hydroxymethylcytosine by ten-eleven translocation (Tet) enzymes, followed by the action of base–excision–repair pathways. Here, we investigated the effects of a methionine–choline-deficient (MCD) diet on the hepatic DNA methylation of mice by precisely quantifying 5meC using a liquid chromatography–electrospray ionization– mass spectrometry and by investigating the regulatory pathways, including DNA demethylation. Although feeding the MCD diet for 1 week induced hepatic steatosis and lower level of the methyl donor S-adenosylmethionine, it did not cause a significant reduction in the 5meC content. On the other hand, the MCD diet significantly upregulated the gene expression of the Tet enzymes, Tet2 and Tet3, and the base–excision–repair enzymes, thymine DNA glycosylase and apurinic/ apyrimidinic-endonuclease 1. At the same time, the gene expression of DNA methyltransferase 1 and a, was also significantly increased by the MCD diet. These results suggest that the DNA methylation level is precisely regulated even when dietary methyl donors are restricted. Methyl-deficient diets are well known to induce oxidative stress and the oxidative-stressinduced DNA damage, 8-hydroxy-2′-deoxyguanosine (8OHdG), is reported to inhibit DNA methylation. In this study, we also clarified that the increase in 8OHdG number per DNA by the MCD diet is approximately 10 000 times smaller than the reduction in 5meC number, suggesting the contribution of 8OHdG formation to DNA methylation would not be significant. Copyright © 2015 John Wiley & Sons, Ltd. Keywords: methyl-deficient diet; hepatic DNA methylation; active DNA demethylation; Tet family proteins; 5-methylcytosine (5meC); Thymine DNA glycosylase (Tdg)
Introduction Methyl-deficient diets, including methionine–choline-deficient (MCD) diets and methionine–choline–folic acid-deficient diets, are used to establish rodent models of hepatocellular carcinoma and nonalcoholic steatohepatitis (Luyendyk et al., 2010; Pogribny et al., 2004, 2009a,b, 2012; Zhang et al., 2010). Recent studies have suggested the involvement of DNA methylation changes, including global DNA hypomethylation, a state in which genomic DNA contains a lower amount of 5-methylcytosine (5meC), in carcinogenesis by methyl-deficient diets (James et al., 2003; Pogribny et al., 2004, 2012). Hence, for understanding carcinogenesis caused by methyl deficiency, it is important to elucidate the mechanism of DNA methylation changes caused by methyldeficient diets. Methylation of DNA is catalyzed by the three DNA methyltransferases (Dnmts): Dnmt1, which recognizes hemimethylated DNA and acts as a maintenance Dnmt, and Dnmt3a and Dnmt3b, which catalyze de novo DNA methylation (Gopalakrishnan et al., 2008). These Dnmts transfer a methyl group provided by the universal methyl donor S-adenosylmethionine (SAM) to a cytosine in CpG dinucleotides thereby producing 5meC (Dahl et al., 2011; Gopalakrishnan et al., 2008). In addition to DNA methylation, DNA demethylation should be involved in the regulation of DNA methylation levels. DNA demethylation occurs in a passive manner when Dnmt1 fails to
J. Appl. Toxicol. 2015
methylate target cytosines in newly synthesized DNA during replication (Zhu, 2009). Recent studies have clarified the active DNA demethylation pathways that start with the action of ten-eleven translocation (Tet) family proteins, Tet1, Tet2 and Tet3 (Gong & Zhu, 2011). 5meC is oxidized to 5-hydroxymethylcytosine (5hmC) and further to the short-lived cytosines, 5-formylcytosine and 5-carboxylcytosine, by Tet proteins (He et al., 2011; Ito et al., 2011). These modified cytosines can be rapidly removed by the base–excision–repair (BER) pathways involving thymine DNA glycosylase (Tdg) (He et al., 2011; Maiti & Drohat, 2011). The generated abasic sites are cleaved by apurinic/apyrimidinicendonuclease 1 (Ape1), and then an unmethylated cytosine is inserted by subsequent BER pathways, which results in DNA *Correspondence to: Keiko Nohara, Center for Environmental Health Sciences, National Institute for Environmental Studies, Tsukuba 305-8506, Japan. E-mail: [email protected] a Center for Environmental Health Sciences, National Institute for Environmental Studies, Tsukuba 305-8506, Japan b Department of Public Health and Environmental Medicine, The Jikei University School of Medicine, Tokyo 105-8461, Japan c Center for Environmental Measurement and Analysis, National Institute for Environmental Studies, Tsukuba 305-8506, Japan
Copyright © 2015 John Wiley & Sons, Ltd.
S. Takumi et al. demethylation (He et al., 2011; Ito et al., 2011; Maiti & Drohat, 2011). It has also been reported deamination of 5hmC to 5hydroxymethyluracil by deaminating enzymes participates in the active DNA demethylation (Bhutani et al., 2011; Gong & Zhu, 2011). 5-hydroxymethyluracil:G mismatches produced by deamination of 5hmC in double-stranded DNA are removed by DNA glycosylases, such as Tdg and single-stranded-selective monofunctional uracil-DNA glycosylase 1 (Smug1) (Maiti & Drohat, 2011), and an unmethylated cytosine is then inserted through the BER pathways. However, the role of the active DNA demethylation pathways in DNA methylation changes by methyl-deficient diets has not been fully elucidated. Methyl-deficient diets are also well known to induce oxidative stress (Gao et al., 2004; James et al., 2003; Powell et al., 2005). Increased oxidative stress causes a variety of carcinogenic alterations, including DNA damage and altered biological functions (Ravanat et al., 2002; Rolo et al., 2012). Oxidative-stress-induced DNA damage is reported to inhibit Dnmt (Maltseva et al., 2009; Turk et al., 1995). Replacement of the guanine in CpG by 8-hydroxy-2′-deoxyguanosine (8OHdG), a representative example of oxidative DNA damage, in synthetic oligodeoxynucleotides has been shown to suppress the ability of Dnmt to methylate the adjacent cytosine (Maltseva et al., 2009; Turk et al., 1995). Thus, oxidative DNA damage induced by methyl-deficient diets might also result in an increase in DNA demethylation. On the other hand, DNA damage induction by methyl-deficient diets may enhance the active DNA demethylation pathways, as DNA damage could activate BER pathways. Regarding the DNA methylation changes, previous studies primarily measured the levels of DNA methylation by indirect methods, such as by performing a methyl acceptance assay with a methyltransferase and isotope-labeled methyl donor or a digestion assay with methyl-sensitive restriction enzymes (reviewed by James et al., 2003 and Pogribny et al., 2012). In our previous study (Nohara et al., 2011), we precisely measured the amount of 5meC in the liver of mice fed a methionine– choline–folic acid-deficient diet by liquid chromatography– electrospray ionization–mass spectrometry (LC/ESI-MS) and found that the changes in hepatic 5meC content by the methyldeficient diet are smaller than thought in previous studies. In the present study, we attempted to clarify the DNA methylation status of the liver of mice fed the MCD diet by precisely measuring the amount of 5meC by LC/ESI-MS and investigated the involvement of the active DNA demethylation and DNAdamage-induced demethylation in the global DNA methylation changes.
Materials and Methods Mice and Experimental Design Five-week-old male C57BL/6J mice were purchased from Clea Japan (Tokyo, Japan) and were acclimatized to the environment for 1 week before use. Throughout the experiment, the animals were maintained in a controlled environment at a temperature of 24 ± 1 °C and humidity of 50 ± 10% and under a 12/12 h light/dark cycle. Before starting the experiments, the mice were fed with the standard diet (CLEA Rodent Diet CE-2) for 1 week. Then, the mice were fed either the control diet (no. 518754) or the MCD diet (no. 518810) ad libitum for 1 week (Luyendyk et al., 2010; Zhang et al., 2010). The diets were purchased from Dyets Inc. (Bethlehem, PA, USA). Both diets contained similar
wileyonlinelibrary.com/journal/jat
nutrients (14.2% protein, 15% fat, 3.09% ash, 5% fiber), except that methionine and choline were not included to the MCD diet, whereas 1.70 g kg–1 methionine and 14.48 g kg–1 choline bitartrate were provided in the control diet. After feeding the diets for 1 week, the mice were killed. The liver samples for 8OHdG and 5meC detection were snap frozen in liquid nitrogen and stored at –80 °C until use. Formalin-fixed liver sections were stained with hematoxylin and eosin staining to evaluate the severity of histological changes. The mice were handled in a humane manner, in accordance with the National Institute for Environmental Studies (NIES) guidelines for animal experiments. Quantification of S-Adenosylmethionine and S-Adenosylhomocysteine The liver of each mouse (three per group) was homogenized in 0.4 M HClO4 and after centrifugation (15 000 g, 30 min) the supernatant was collected. The supernatant was filtrated through a 0.45 μm syringe-driven filter before analyzing its SAM and S-adenosylhomocysteine (SAH) contents. The analysis of SAM and SAH was carried out as described by Nohara et al. (2011). cDNA Preparation and Measurement of mRNA Expression Total RNA of individual livers was prepared with an RNeasy Mini Kit. After checking the quality of the RNA by electrophoresis, the reverse transcription reaction was performed with an AMV Reverse Transcriptase XL (Takara Bio Inc. Shiga, Japan) using 100 ng of total RNA. The expression of target genes in the liver of each mouse (six per group) was quantified by real-time polymerase chain reaction (PCR) on LightCycler instrument (Roche Diagnostics, Basel, Switzerland) as described previously (Nohara et al., 2006). Amplification in experimental samples during the log linear phase was compared to the relative standard curve from the dilution series of a control cDNA using LightCycler quantification software (version 3.5). The control cDNA was prepared from the livers of C57BL/6J mice. The expression of each gene was normalized relative to the Cpb mRNA expression level. The primer sequences and annealing temperatures used for realtime PCR are shown in Table 1. Western Blot Analysis About 20 mg of each liver was washed with phosphate-buffered saline and homogenized in sodium dodecyl sulfate (SDS) lysis buffer (50 mM Tris–HCl pH 7.5, 1% SDS, 10% glycerol). The lysates were then cyclically sonicated for 10 min (30 s each, with 30 s intervals) with a Bioruptor UCD-200TM (Cosmo Bio, Tokyo, Japan) and the supernatant was collected after centrifugation. The protein concentrations in the supernatant were determined with a BCA protein assay kit (Pierce, Rockford, IL). After being boiled in SDS sample buffer (50 mM Tris–HCl pH 6.8, 2% SDS, 10% glycerol, 100 mM DTT, 0.001% bromophenol blue), the samples were subjected to SDS-polyacrylamide gel electrophoresis and then transferred on to PVDF membranes (Hybond-P; Amersham Biosciences, Little Chalfont, England). After blocking, the membranes were incubated with anti-Tdg (1: 500; Santa Cruz, CA, USA), anti-Ape1 (1: 1000; Abcam, Cambridge, United Kingdom), anti-Dnmt1 (1: 1000; Cell Signaling, Danvers, MA), anti-Dnmt3a (1: 1000; Cell Signaling) and anti-β-actin (1: 5000; Sigma, St Louis, MO) overnight at 4 °C. After washing, the membranes were incubated with horseradish
Copyright © 2015 John Wiley & Sons, Ltd.
J. Appl. Toxicol. 2015
Effects of methyl deficient diet on the balance of DNA methylation Table 1. List of primers Description
HO-1 Ogg1 Mutyh Mth1 Dnmt1 Dnmt3a Dnmt3b Tet2 Tet3 Apobec1 Tdg Smug1 Ape1 Cpb
Primer sequence (5′-3′)
Annealing temperature (°C)
CTGCTAGCCTGGTGCAAGA CCAACAGGAAGCTGAGAGTGA TGTGTACCGAGGAGACGACA CAGCAGTCTCACACCTTGGA CCTGGTGCAAAGGCCTGA ATTCCTCCCAGGTCAGCCAT GGGGCTAAGAGAGAGCTGCTGGAA TTCTGTGGGCGTCCCGTGCA CCAAGCTCCGGACCCTGGATGTGT CGAGGCCGGTAGTAGTCACAGTAG GCACCTATGGGCTGCTGCGAAGACG CTGCCTCCAATCACCAGGTCGAATG GTCTGCACACCAGAGACCAGAG TCAGAGCCATTCCCATCATCTAC TGTTGTTGTCAGGGTGAGAATC TCTTGCTTCTGGCAAACTTACA CCGGATTGAGAAGGTCATCTAC AAGATAACAATCACGGCGTTCT CACCACACGGATCAGCGAAA TCATGATCTGGATAGTCACACCG CCTCCGTGGACTCGAAGCT TCTGCGTGTGACTGCAACCC TCAAGTCTTCTTCCGGCACT AGCTCAGCTGGGGTAAGGTT ATGAAGAAATTGACCTCCGTAACC GTGTAAGCGTAAGCAGTGTTG AGACTGTTCCAAAAACAGTGGA GATGCTCTTTCCTCCTGTGC
64 64 64
150 mm, 5 μm; Waters, Milford, MA, USA) in an isocratic mode with a mobile phase of methanol–10 mM ammonium acetate (2: 98, v/v) at a flow rate of 0.2 ml min–1. The internal standards (13C9,15N3-20deoxycytidine, 13C10,15N2-5-methyl-20-deoxycytidine, 100 ng each) were added to 15 μl of the hydrolyzed sample, and the mixture was diluted to 500 μl with H2O. A 10 μl volume of the mixture was injected into high-performance liquid chromatography (HPLC)–MS, and dC and 5medC were analyzed on a SIM mode. The SIM m/z of dC and 5medC was 228.1 and 242.1, respectively. The amount of 5meC was presented as the contents (%) of 5medC in total dC and 5medC (dC + 5medC).
64 64 64 64 64 64 64 64
Analysis of 8-Hydroxy-2′-Deoxyguanosine Levels Nuclease P1 (Yamasa Shoyu Co., Chiba, Japan) and alkaline phosphatase (Promega, Madison, WI) were used to hydrolyze the hepatic DNA. The level of both 8OHdG and deoxyguanosine in the DNA hydrolysates were quantified using a system of HPLC (LC-10A; Shimadzu) with an electrochemical detector (ED 623B; GL Science, Tokyo, Japan) and photodiode array detector (SPD M10A; Shimadzu). The HPLC conditions were as follows: column (Mightysil RP-18, 4.6 × 150 mm, 5 μm; Kanto Chemicals Co., Tokyo, Japan); solvent (8% methanol containing 10 mg l–1 EDTA and 40 mM phosphate buffer at pH 4.5; flow rate (1 ml min–1); diamond electrochemical detector (650 mV); and detection wave length (290 nm). The 8OHdG content in the hepatic DNA is expressed as the number of 8OHdG residues per 106 deoxyguanosines.
64 64
Statistical Analysis
64
Differences between the control group and the MCD group were analyzed using the Mann–Whitney U-test. P < 0.05 was considered significant.
peroxidase-conjugated antigoat IgG (1: 8000; Sigma), antirabbit IgG (1: 8000; Sigma) or antimouse IgG (1: 8000; Sigma) for 1 h at room temperature. After washing, the membranes were developed using the ECL Prime Western Blotting Detection System (Amersham Biosciences). Molecular weights of Tdg, Ape1, Dnmt1, Dnmt3a and β-actin proteins were approximately 46, 34, 200, 130 and 42 kDa, respectively. Isolation of Hepatic DNA
Results The Methionine–Choline-Deficient Diet-Induced Hepatic Steatosis, Reduced S-Adenosylmethionine Content and Oxidative-Stress Response After feeding the MCD diet for 1 week, the body weight and liver weight of the mice decreased by about 20–25% in comparison with the control group (Table 2), as reported previously (Zhang et al., 2010). Hematoxylin and eosin staining revealed swollen hepatocytes with moderate microvesicular steatosis in the
To avoid the DNA oxidation that occurs during DNA isolation, hepatic DNA was isolated by using a DNA extractor TIS Kit (Wako, Osaka, Japan), which uses sodium iodide (NaI) and an oxidation inhibitor, according to the manufacturer’s protocol. The isolated hepatic DNA was stored at –80 °C until use.
Table 2. Body weight and liver weight of mice fed the control and MCD diet
Measurement of 5-Methylcytosine Amounts by Liquid Chromatography–Electrospray Ionization–Mass Spectrometry
Body weight (g) 1 week Liver weight (g) 1 week
Isolated hepatic DNA was hydrolyzed and analyzed for 5meC by LC/ESI-MS as described previously (Nohara et al., 2010). LC-MS analyses were performed by using a LC/MS-2010A mass spectrometer and ESI ionization probe (Shimadzu, Kyoto, Japan). Deoxycytidine (dC) and 5-methyl-deoxycitidine (5medC) were separated using a reversed-phase column (Atlantis dC18, 2.1 ×
MCD, methionine–choline-deficient. The number in the parentheses indicates the percentage of the value in the age-matched control group. Results are reported as means ± SE (n = 6). An asterisk indicates a statistically significant difference from the control group (P < 0.01).
J. Appl. Toxicol. 2015
Copyright © 2015 John Wiley & Sons, Ltd.
Control
MCD
22.6 ± 0.4 (100) 1.12 ± 0.03 (100)
17.9 ± 0.3** (79.2) 0.84 ± 0.03** (75.0)
wileyonlinelibrary.com/journal/jat
S. Takumi et al. enzymes 8-oxoguanine DNA-glycosylase 1 and mutY homolog (Escherichia coli) (Mutyh) (Tsuzuki et al., 2007). In addition, MutT homolog 1 (Mth1) removes 8OHdGTP from the nucleotide pool to prevent incorporation of 8OHdGTP into DNA (Tsuzuki et al., 2007). Thus, we also measured the expression of these genes in the livers and found that Mutyh mRNA was upregulated on the MCD diet (Fig. 1c). These results indicated that the MCD diet augments oxidative stress in the liver. 5-Methylcytosine and 8-Hydroxy-2′-Deoxyguanosine Contents in the Liver of Mice Fed on the Methionine–CholineDeficient Diet The detailed contents of 5meC in hepatic DNA were measured by using the LC/ESI-MS method. The measurements in the group fed the control diet revealed that 5meC accounted for 5.67 ± 0.12% of the total cytosine in the hepatic DNA (Table 3). The mice fed the MCD diet showed a lower 5meC content, which accounted for 5.44 ± 0.17% of the total cytosine (Table 3). However, there were no statistical differences between the control and MCD groups. The amount of 8OHdG in hepatic DNA was measured by HPLC–electrochemical detector. Extraction of DNA was carried out by using NaI and the oxidation inhibitor in the DNA extractor TIS Kit to prevent artificial DNA oxidation (Helbock et al., 1998). The results showed that the 8OHdG content was 0.98 ± 0.04 per 106 deoxyguanosines on the control diet and moderately increased on the MCD diet (1.17 ± 0.09 per 106 deoxyguanosines, P = 0.082) (Table 3).The frequencies of 8OHdG formation in both groups were much lower than the frequencies of 5meC in the genome as discussed in the Discussion.
Figure 1. The hepatocellular damage and the expression of oxidativestress-inducible genes by the MCD diet. (a) Liver samples were processed for hematoxylin and eosin staining. Arrows indicate the typical macrovesicular hepatic steatosis. (b) Contents of SAM and SAH in the liver. SAM and SAH were prepared from the liver and measured by high-performance liquid chromatography as described in Materials and methods. The value was expressed as the concentration in the supernatant of 20% liver homogenate. Results are reported as means ± SE (n = 3). (c) The expression of mRNA was measured by real-time polymerase chain reaction and normalized to the expression of Cpb mRNA. The results are expressed as fold changes in each genes expression in the MCD group compared to the control group. Results are reported as means ± SE (n = 6). Asterisks indicate statistically significant differences from the control group (*P < 0.05 and **P < 0.01). MCD, methionine–cholinedeficient; SAH, S-adenosylhomocysteine; SAM, S-adenosylmethionine.
MCD group (Fig. 1a), which was also reported in previous studies (Luyendyk et al., 2010; Zhang et al., 2010). Another well-known feature of MCD diet-induced change in the liver is a decrease in the methyl donor SAM. After providing a methyl group to DNA, SAM is converted to SAH. The SAM content of the liver was significantly reduced by the MCD diet, while the SAH content did not significantly differ from the control group (Fig. 1b) Oxidative stress induction by the MCD diet has also been reported in previous studies (Gao et al., 2004; Powell et al., 2005). After 1 week on the MCD diet, we found a significant increase in expression of HO-1 mRNA, one of the oxidative stressinducible genes (Fig. 1c). Oxidative stress induction can lead to DNA damage and induction of DNA repair enzymes. Ubiquitous oxidative DNA damage 8OHdG is repaired by the DNA repair
wileyonlinelibrary.com/journal/jat
Effects of the Methionine–Choline-Deficient Diet on the Expression of the Genes Involved in Active DNA Demethylation Pathways As methyl-deficient diets have been reported to affect DNA methylation level, we investigated the effects of the MCD diet on the active DNA demethylation pathways by assessing the induction of the involved enzymes. The results demonstrated that mRNA of Tet2 and Tet3 were expressed in the liver, but Tet1 was not, as reported previously (Ito et al., 2010), and that mRNA expression of Tet2 and Tet3 was significantly upregulated on the MCD diet (Fig. 2a). mRNA expression of Tdg and Ape1, which are major components of Table 3. The contents of 5meC and 8OHdG in the livers of mice fed the control and MCD diet
5meC (%) 8OHdGb
a
Control
MCD
5.67 ± 0.12 (100) 0.98 ± 0.04 (100)
5.44 ± 0.17 (95.9) 1.17 ± 0.09 (119.4)
8OHdG, 8-hydroxy-2′-deoxyguanosine; 5meC, 5methylcytosine; MCD, methionine–choline-deficient. a The content (%) of 5meC was expressed as the percentage of 5meC in total cytosine (cytosine + 5-methylcytosine). b The content of 8OHdG was expressed as the number of 8OHdG residues per 106 deoxyguanosines. The number in the parentheses indicates the value of each sample compared to the value in the age-matched control groups, in which it is set as 100. Results are reported as means ± SE (n = 6).
Copyright © 2015 John Wiley & Sons, Ltd.
J. Appl. Toxicol. 2015
Effects of methyl deficient diet on the balance of DNA methylation
Figure 2. Expression of the active DNA demethylation-related genes. (a) The expression of genes involved in active DNA demethylation pathways were measured in the liver of mice fed the control diet or MCD diet for 1 week by real-time polymerase chain reaction and normalized to the expression of Cpb mRNA. The results are expressed as fold changes in each genes expression in the MCD group compared to the values of the control group. Results are reported as means ± SE (n = 6). Asterisks indicate statistically significant differences from the control group (*P < 0.05 and **P < 0.01). (b,c) Immunoblot analysis of Tdg and Ape1 from the liver of control or MCD groups. β-actin is used as a loading control. MCD, methionine–choline-deficient.
Tdg-mediated BER pathway, were also significantly upregulated on the MCD diet (Fig. 2a). The upregulation of Tdg and Ape1 on the MCD diet was also confirmed for protein levels (Fig. 2b,c). These results showed that feeding the MCD diet for 1 week activates the active DNA demethylation pathway. Among other enzymes involved in the active DNA demethylation pathway, mRNA expression of a deaminating enzyme, apolipoprotein B mRNA-editing catalytic polypeptide 1 (Apobec1) and a DNA-glycosylase, single-stranded-selective monofunctional uracil-DNA glycosylase 1 (Smug1) were unaffected by the MCD diet (Fig. 2a) and expression of a deaminating enzyme, activation-induced deaminase (Aid) was not detectable in the liver. These results indicated that deamination of 5hmC was minimally impacted by the MCD diet. Effect of the Methionine–Choline-Deficient Diet on Expression of DNA Methyltransferases We also measured Dnmt mRNA expression in the liver. The MCD diet significantly increased the expression of Dnmt1, the DNA methyltransferase, which is required for the accurate maintenance of the DNA methylation patterns in somatic cells (Fig. 3a). The expression of de novo DNA methyltransferase Dnmt3a was significantly increased on the MCD diet (Fig. 3a). The upregulation of Dnmt1 and Dnmt3a on the MCD diet was also confirmed for protein levels (Fig. 3b,c).
Discussion In the present study, hepatic steatosis, a typical methyl-deficient diet-induced lesion, and prominent body weight loss were observed after feeding the MCD diet for 1 week (Fig. 1a, Table 2). It has been reported that methionine and choline are required for hepatic secretion of triglycerides in the form of very
J. Appl. Toxicol. 2015
Figure 3. Expression of Dnmts in the liver. The expression of Dnmts mRNA was measured by real-time polymerase chain reaction and normalized to the expression of Cpb mRNA. The results are expressed as fold changes in each genes expression in the MCD group compared to values of the control group. Results are reported as means ± SE (n = 6). Asterisks indicate statistically significant differences from the control group (*P < 0.05 and **P < 0.01). (b,c) Immunoblot analysis of Dnmt1 and Dnmt3a from the liver of control or MCD groups. β-actin is used as a loading control. Dnmts, DNA methyltransferases; MCD, methionine– choline-deficient.
low-density lipoprotein (Matsumoto et al., 2013). Hence, the impairment of lipid export from the liver to peripheral tissues is thought to be a reason for weight loss in this model. Methyldeficient diets have also been reported to induce depletion of SAM and an increase in oxidative stress in the liver (Pogribny et al., 2009a; Powell et al., 2005; Rolo et al., 2012). Consistently, the present study showed a decreased SAM content and the induction of oxidative stress related genes such as HO-1 and Mutyh in the liver of MCD group (Fig. 1b,c). The induction of oxidative stress causes various oxidative DNA damage, and activates the DNA repair pathway. Therefore, the methyl-deficient diet-induced activation of DNA repair pathway is suggested to promote active DNA demethylation (Pogribny et al., 2012). However, the involvement of active DNA demethylation-related genes, such as Tet enzymes’ genes, has not been determined in methyl-deficient diet models. In the present study, we demonstrated that the expression of Tet2, Tet3, Tdg and Ape1 were significantly upregulated after feeding the MCD diet for 1 week (Fig. 2). These results indicated that the MCD diet activates the active DNA demethylation pathway starting with oxidization of 5meC by Tet enzymes followed by the Tdg-mediated BER pathway (Fig. 4). On the other hand, the DNA methylation level in the liver was not significantly changed by feeding the MCD diet for 1 week (Table 3). As DNA methylation is a mechanism that is essential to maintaining genomic stability and regulating gene expression, the methylation level may be strictly controlled by various systems. In support of this expectation, the expression of Dnmt1 and Dnmt3a were increased in the liver of the MCD group (Fig. 3a–c). Previous studies reported that feeding the MCD diet for 9 weeks or longer caused DNA hypomethylation associated with suppressed expression of Dnmt1 (James et al., 2003; Pogribny et al., 2009a,2009b). Hence, the duration of methyl deficiency may lead to a failure of the maintenance system of DNA methylation, including Dnmts. Not only the maintaining Dnmt, Dnmt1, but also Dnmt3a and Dnmt3b are reported to take
Copyright © 2015 John Wiley & Sons, Ltd.
wileyonlinelibrary.com/journal/jat
S. Takumi et al.
Figure 4. Outline of the DNA methylation regulatory pathways in the MCD group. This figure shows the possible involvement of the DNA methylation and active DNA demethylation pathways in the MCD group. The results obtained in the present study demonstrated that the MCD diet induces expression of Tet2, Tet3, Tdg and Ape1, which are involved in active DNA demethylation pathways. The bold arrows indicate the pathway that is activated by the MCD diet. Ape1, apurinic/apyrimidinic-endonuclease 1; 5caC, 5-carboxylcytosine; 5fC, 5-formylcytosine; 5hmC, 5-hydroxymethylcytosine; 5hmU, 5hydroxymethyluracil; 5meC, 5-methylcytosine; Dnmts, DNA methyltransferases; MCD, methionine–choline-deficient; Tdg, thymine DNA glycosylase.
a part in radiation-induced DNA methylation changes in the spleen and liver (Raiche et al., 2004). Recent studies also propose the supportive role of Dnmt3a in the maintenance of DNA methylation by Dnmt1 (Jones & Liang, 2009). Further studies are needed to clarify that the induction of Dnmt1 and Dnmt3a may cooperatively maintain DNA methylation under methyldeficient conditions. Depletion of SAM by MCD diets is reported to be associated with global DNA hypomethylation (reviewed by Pogribny et al., 2012). In the present study, although the MCD diet for 1 week greatly reduced SAM content in the liver, the DNA methylation levels were not affected. Therefore, the amount of SAM may be enough for maintaining DNA methylation for 1 week. Among factors that may lead to DNA demethylation, previous studies reported that replacement of guanine with 8OHdG diminishes the ability of human Dnmts and murine Dnmt3a to methylate the adjacent cytosine in synthetic oligodeoxynucleotides (Maltseva et al., 2009; Turk et al., 1995). In the present study, the content of 8OHdG in the control diet group was estimated to be approximately 1 per 106 deoxyguanosines, and it was in agreement with the content of 8OHdG reported by the European Standards Committee on oxidative DNA damage (ESCODD) (Table 3) (ESCODD, 2002). The change in the 8OHdG number by the MCD diet compared to the control diet (1.17 vs 0.98 per 106 deoxyguanosines) was approximately 2 per 107 deoxyguanosines (Table 3). On the other hand, 5meC accounted for 5.67% of total cytosine in the liver of the control group and 5.44% in the MCD group (Table 3). Thus, the MCD diet-induced change in 5meC was roughly 0.2% relative to total cytosine, or 2 per 103 total cytosine. Therefore, the change in the 8OHdG number by the MCD diet (2 per 107 total guanine) was about 10 000 times smaller compared to the change in the 5meC number by the MCD diet (2 per 103 total cytosine). From these calculations, the suppression of Dnmt activity by 8OHdG seems not to have had a considerable effect on global DNA methylation.
wileyonlinelibrary.com/journal/jat
In conclusion, this study suggests that the DNA methylation status is strictly controlled by the balance between the activities of Dnmt, and the active DNA demethylation pathways by a methyl-deficient diet (Fig. 4). To our knowledge, this is the first report to provide evidence suggesting upregulation of the Tet family by a methyl-deficient diet. Regarding the regulatory mechanism of Tet expression, a recent study reported that the expression of Tet2 is regulated by the transcription factor Oct4 in embryonic stem cells (Wu et al., 2012). However, it is totally unknown how the MCD diet activates Tet enzymes and their functions in the liver. Further study on the linkage between Tet induction and methyl deficiency is necessary to provide a better understanding on the etiology of the methyl-deficient diet. Acknowledgments This work was supported by the National Institute for Environmental Studies (0710AG333, K.N., 1115AA082), Ministry of Education, Science, Sports and Culture, Grant-in-Aid for Scientific Research (23390166, K.N.; 24790600, S.T.). We wish to thank Ms. J. Bao for her kind cooperation in preparing liver sections, Ms. M. Matsumoto and Ms. H. Murai for their excellent technical assistance, and Ms. S. Itaki for her helpful secretarial assistance.
Conflict of Interest The authors declare that there are no conflicts of interest.
References Bhutani N, Burns DM, Blau HM. 2011. DNA demethylation dynamics. Cell 146: 866–872. Dahl C, Gronbaek K, Guldberg P. 2011. Advances in DNA methylation: 5-hydroxymethylcytosine revisited. Clin. Chim. Acta 412: 831–836. ESCODD (European Standards Committee on Oxidative DNA Damage). 2002. Comparative analysis of baseline 8-oxo-7,8-dihydroguanine in
Copyright © 2015 John Wiley & Sons, Ltd.
J. Appl. Toxicol. 2015
Effects of methyl deficient diet on the balance of DNA methylation mammalian cell DNA, by different methods in different laboratories: an approach to consensus. Carcinogenesis 23: 2129–2133. Gao D, Wei C, Chen L, Huang J, Yang S, Diehl AM. 2004. Oxidative DNA damage and DNA repair enzyme expression are inversely related in murine models of fatty liver disease. Am. J. Physiol. Gastrointest. Liver Physiol. 287: G1070–G1077. Gong Z, Zhu JK. 2011. Active DNA demethylation by oxidation and repair. Cell Res. 21: 1649–1651. Gopalakrishnan S, Van Emburgh BO, Robertson KD. 2008. DNA methylation in development and human disease. Mutat. Res. 647: 30–38. He YF, Li BZ, Li Z, Liu P, Wang Y, Tang Q, Ding J, Jia Y, Chen Z, Li L, et al. 2011. Tet-mediated formation of 5-carboxylcytosine and its excision by TDG in mammalian DNA. Science 333: 1303–1307. Helbock HJ, Beckman KB, Shigenaga MK, Walter PB, Woodall AA, Yeo HC, Ames BN. 1998. DNA oxidation matters: the HPLC-electrochemical detection assay of 8-oxo-deoxyguanosine and 8-oxo-guanine. Proc. Natl. Acad. Sci. U. S. A. 95: 288–293. Ito S, D’Alessio AC, Taranova OV, Hong K, Sowers LC, Zhang Y. 2010. Role of Tet proteins in 5mC to 5hmC conversion, ES-cell self-renewal and inner cell mass specification. Nature 466: 1129–1133. Ito S, Shen L, Dai Q, Wu SC, Collins LB, Swenberg JA, He C, Zhang Y. 2011. Tet proteins can convert 5-methylcytosine to 5-formylcytosine and 5-carboxylcytosine. Science 333: 1300–1303. James SJ, Pogribny IP, Pogribna M, Miller BJ, Jernigan S, Melnyk S. 2003. Mechanisms of DNA damage, DNA hypomethylation, and tumor progression in the folate/methyl-deficient rat model of hepatocarcinogenesis. J. Nutr. 133: 3740S–3747S. Jones PA, Liang G. 2009. Rethinking how DNA methylation patterns are maintained. Nat. Rev. Genet. 10: 805–811. Luyendyk JP, Sullivan BP, Guo GL, Wang R. 2010. Tissue factor-deficiency and protease activated receptor-1-deficiency reduce inflammation elicited by diet-induced steatohepatitis in mice. Am. J. Pathol. 176: 177–186. Maiti A, Drohat AC. 2011. Thymine DNA glycosylase can rapidly excise 5-formylcytosine and 5-carboxylcytosine: potential implications for active demethylation of CpG sites. J. Biol. Chem. 286: 35334–35338. Maltseva DV, Baykov AA, Jeltsch A, Gromova ES. 2009. Impact of 7,8-dihydro-8-oxoguanine on methylation of the CpG site by Dnmt3a. Biochemistry 48: 1361–1368. Matsumoto M, Hada N, Sakamaki Y, Uno A, Shiga T, Tanaka C, Ito T, Katsume A, Sudoh M. 2013. An improved mouse model that rapidly develops fibrosis in non-alcoholic steatohepatitis. Int. J. Exp. Pathol. 94: 93–103. Nohara K, Ao K, Miyamoto Y, Ito T, Suzuki T, Toyoshiba H, Tohyama C. 2006. Comparison of the 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-induced CYP1A1 gene expression profile in lymphocytes from mice, rats, and humans: most potent induction in humans. Toxicology 225: 204–213. Nohara K, Baba T, Murai H, Kobayashi Y, Suzuki T, Tateishi Y, Matsumoto M, Nishimura N, Sano T. 2010. Global DNA methylation in the mouse
J. Appl. Toxicol. 2015
liver is affected by methyl deficiency and arsenic in a sex-dependent manner. Arch. Toxicol. 85: 653–661. Nohara K, Baba T, Murai H, Kobayashi Y, Suzuki T, Tateishi Y, Matsumoto M, Nishimura N, Sano T. 2011. Global DNA methylation in the mouse liver is affected by methyl deficiency and arsenic in a sex-dependent manner. Arch. Toxicol. 85: 653–661. Pogribny IP, James SJ, Jernigan S, Pogribna M. 2004. Genomic hypomethylation is specific for preneoplastic liver in folate/methyl deficient rats and does not occur in non-target tissues. Mutat. Res. 548: 53–59. Pogribny IP, Shpyleva SI, Muskhelishvili L, Bagnyukova TV, James SJ, Beland FA. 2009a. Role of DNA damage and alterations in cytosine DNA methylation in rat liver carcinogenesis induced by a methyldeficient diet. Mutat. Res. 669: 56–62. Pogribny IP, Tryndyak VP, Bagnyukova TV, Melnyk S, Montgomery B, Ross SA, Latendresse JR, Rusyn I, Beland FA. 2009b. Hepatic epigenetic phenotype predetermines individual susceptibility to hepatic steatosis in mice fed a lipogenic methyl-deficient diet. J. Hepatol. 51: 176–186. Pogribny IP, James SJ, Beland FA. 2012. Molecular alterations in hepatocarcinogenesis induced by dietary methyl deficiency. Mol. Nutr. Food Res. 56: 116–125. Powell CL, Kosyk O, Bradford BU, Parker JS, Lobenhofer EK, Denda A, Uematsu F, Nakae D, Rusyn I. 2005. Temporal correlation of pathology and DNA damage with gene expression in a choline-deficient model of rat liver injury. Hepatology 42: 1137–1147. Raiche J, Rodriguez-Juarez R, Pogribny I, Kovalchuk O. 2004. Sex- and tissue-specific expression of maintenance and de novo DNA methyltransferases upon low dose X-irradiation in mice. Biochem. Biophys. Res. Commun. 325: 39–47. Ravanat JL, Douki T, Duez P, Gremaud E, Herbert K, Hofer T, Lasserre L, Saint-Pierre C, Favier A, Cadet J. 2002. Cellular background level of 8-oxo-7,8-dihydro-2′-deoxyguanosine: an isotope based method to evaluate artefactual oxidation of DNA during its extraction and subsequent work-up. Carcinogenesis 23: 1911–1918. Rolo AP, Teodoro JS, Palmeira CM. 2012. Role of oxidative stress in the pathogenesis of nonalcoholic steatohepatitis. Free Radic. Biol. Med. 52: 59–69. Tsuzuki T, Nakatsu Y, Nakabeppu Y. 2007. Significance of error-avoiding mechanisms for oxidative DNA damage in carcinogenesis. Cancer Sci. 98: 465–470. Turk PW, Laayoun A, Smith SS, Weitzman SA. 1995. DNA adduct 8-hydroxyl-2′-deoxyguanosine (8-hydroxyguanine) affects function of human DNA methyltransferase. Carcinogenesis 16: 1253–1255. Wu Y, Guo Z, Liu Y, Tang B, Wang Y, Yang L, Du J, Zhang Y. 2012. Oct4 and the small molecule inhibitor, SC1, regulates Tet2 expression in mouse embryonic stem cells. Mol. Biol. Rep. 40: 2897–2906. Zhang YK, Yeager RL, Tanaka Y, Klaassen CD. 2010. Enhanced expression of Nrf2 in mice attenuates the fatty liver produced by a methionineand choline-deficient diet. Toxicol. Appl. Pharmacol. 245: 326–334. Zhu JK. 2009. Active DNA demethylation mediated by DNA glycosylases. Annu. Rev. Genet. 43: 143–166.
Copyright © 2015 John Wiley & Sons, Ltd.
wileyonlinelibrary.com/journal/jat
Revised: 14 November 2014,
Accepted: 12 December 2014
Published online in Wiley Online Library
(wileyonlinelibrary.com) DOI 10.1002/jat.3117
The effect of a methyl-deficient diet on the global DNA methylation and the DNA methylation regulatory pathways Shota Takumia,b, Kazuyuki Okamuraa, Hiroyuki Yanagisawab, Tomoharu Sanoc, Yayoi Kobayashia and Keiko Noharaa* ABSTRACT: Methyl-deficient diets are known to induce various liver disorders, in which DNA methylation changes are implicated. Recent studies have clarified the existence of the active DNA demethylation pathways that start with oxidization of 5-methylcytosine (5meC) to 5-hydroxymethylcytosine by ten-eleven translocation (Tet) enzymes, followed by the action of base–excision–repair pathways. Here, we investigated the effects of a methionine–choline-deficient (MCD) diet on the hepatic DNA methylation of mice by precisely quantifying 5meC using a liquid chromatography–electrospray ionization– mass spectrometry and by investigating the regulatory pathways, including DNA demethylation. Although feeding the MCD diet for 1 week induced hepatic steatosis and lower level of the methyl donor S-adenosylmethionine, it did not cause a significant reduction in the 5meC content. On the other hand, the MCD diet significantly upregulated the gene expression of the Tet enzymes, Tet2 and Tet3, and the base–excision–repair enzymes, thymine DNA glycosylase and apurinic/ apyrimidinic-endonuclease 1. At the same time, the gene expression of DNA methyltransferase 1 and a, was also significantly increased by the MCD diet. These results suggest that the DNA methylation level is precisely regulated even when dietary methyl donors are restricted. Methyl-deficient diets are well known to induce oxidative stress and the oxidative-stressinduced DNA damage, 8-hydroxy-2′-deoxyguanosine (8OHdG), is reported to inhibit DNA methylation. In this study, we also clarified that the increase in 8OHdG number per DNA by the MCD diet is approximately 10 000 times smaller than the reduction in 5meC number, suggesting the contribution of 8OHdG formation to DNA methylation would not be significant. Copyright © 2015 John Wiley & Sons, Ltd. Keywords: methyl-deficient diet; hepatic DNA methylation; active DNA demethylation; Tet family proteins; 5-methylcytosine (5meC); Thymine DNA glycosylase (Tdg)
Introduction Methyl-deficient diets, including methionine–choline-deficient (MCD) diets and methionine–choline–folic acid-deficient diets, are used to establish rodent models of hepatocellular carcinoma and nonalcoholic steatohepatitis (Luyendyk et al., 2010; Pogribny et al., 2004, 2009a,b, 2012; Zhang et al., 2010). Recent studies have suggested the involvement of DNA methylation changes, including global DNA hypomethylation, a state in which genomic DNA contains a lower amount of 5-methylcytosine (5meC), in carcinogenesis by methyl-deficient diets (James et al., 2003; Pogribny et al., 2004, 2012). Hence, for understanding carcinogenesis caused by methyl deficiency, it is important to elucidate the mechanism of DNA methylation changes caused by methyldeficient diets. Methylation of DNA is catalyzed by the three DNA methyltransferases (Dnmts): Dnmt1, which recognizes hemimethylated DNA and acts as a maintenance Dnmt, and Dnmt3a and Dnmt3b, which catalyze de novo DNA methylation (Gopalakrishnan et al., 2008). These Dnmts transfer a methyl group provided by the universal methyl donor S-adenosylmethionine (SAM) to a cytosine in CpG dinucleotides thereby producing 5meC (Dahl et al., 2011; Gopalakrishnan et al., 2008). In addition to DNA methylation, DNA demethylation should be involved in the regulation of DNA methylation levels. DNA demethylation occurs in a passive manner when Dnmt1 fails to
J. Appl. Toxicol. 2015
methylate target cytosines in newly synthesized DNA during replication (Zhu, 2009). Recent studies have clarified the active DNA demethylation pathways that start with the action of ten-eleven translocation (Tet) family proteins, Tet1, Tet2 and Tet3 (Gong & Zhu, 2011). 5meC is oxidized to 5-hydroxymethylcytosine (5hmC) and further to the short-lived cytosines, 5-formylcytosine and 5-carboxylcytosine, by Tet proteins (He et al., 2011; Ito et al., 2011). These modified cytosines can be rapidly removed by the base–excision–repair (BER) pathways involving thymine DNA glycosylase (Tdg) (He et al., 2011; Maiti & Drohat, 2011). The generated abasic sites are cleaved by apurinic/apyrimidinicendonuclease 1 (Ape1), and then an unmethylated cytosine is inserted by subsequent BER pathways, which results in DNA *Correspondence to: Keiko Nohara, Center for Environmental Health Sciences, National Institute for Environmental Studies, Tsukuba 305-8506, Japan. E-mail: [email protected] a Center for Environmental Health Sciences, National Institute for Environmental Studies, Tsukuba 305-8506, Japan b Department of Public Health and Environmental Medicine, The Jikei University School of Medicine, Tokyo 105-8461, Japan c Center for Environmental Measurement and Analysis, National Institute for Environmental Studies, Tsukuba 305-8506, Japan
Copyright © 2015 John Wiley & Sons, Ltd.
S. Takumi et al. demethylation (He et al., 2011; Ito et al., 2011; Maiti & Drohat, 2011). It has also been reported deamination of 5hmC to 5hydroxymethyluracil by deaminating enzymes participates in the active DNA demethylation (Bhutani et al., 2011; Gong & Zhu, 2011). 5-hydroxymethyluracil:G mismatches produced by deamination of 5hmC in double-stranded DNA are removed by DNA glycosylases, such as Tdg and single-stranded-selective monofunctional uracil-DNA glycosylase 1 (Smug1) (Maiti & Drohat, 2011), and an unmethylated cytosine is then inserted through the BER pathways. However, the role of the active DNA demethylation pathways in DNA methylation changes by methyl-deficient diets has not been fully elucidated. Methyl-deficient diets are also well known to induce oxidative stress (Gao et al., 2004; James et al., 2003; Powell et al., 2005). Increased oxidative stress causes a variety of carcinogenic alterations, including DNA damage and altered biological functions (Ravanat et al., 2002; Rolo et al., 2012). Oxidative-stress-induced DNA damage is reported to inhibit Dnmt (Maltseva et al., 2009; Turk et al., 1995). Replacement of the guanine in CpG by 8-hydroxy-2′-deoxyguanosine (8OHdG), a representative example of oxidative DNA damage, in synthetic oligodeoxynucleotides has been shown to suppress the ability of Dnmt to methylate the adjacent cytosine (Maltseva et al., 2009; Turk et al., 1995). Thus, oxidative DNA damage induced by methyl-deficient diets might also result in an increase in DNA demethylation. On the other hand, DNA damage induction by methyl-deficient diets may enhance the active DNA demethylation pathways, as DNA damage could activate BER pathways. Regarding the DNA methylation changes, previous studies primarily measured the levels of DNA methylation by indirect methods, such as by performing a methyl acceptance assay with a methyltransferase and isotope-labeled methyl donor or a digestion assay with methyl-sensitive restriction enzymes (reviewed by James et al., 2003 and Pogribny et al., 2012). In our previous study (Nohara et al., 2011), we precisely measured the amount of 5meC in the liver of mice fed a methionine– choline–folic acid-deficient diet by liquid chromatography– electrospray ionization–mass spectrometry (LC/ESI-MS) and found that the changes in hepatic 5meC content by the methyldeficient diet are smaller than thought in previous studies. In the present study, we attempted to clarify the DNA methylation status of the liver of mice fed the MCD diet by precisely measuring the amount of 5meC by LC/ESI-MS and investigated the involvement of the active DNA demethylation and DNAdamage-induced demethylation in the global DNA methylation changes.
Materials and Methods Mice and Experimental Design Five-week-old male C57BL/6J mice were purchased from Clea Japan (Tokyo, Japan) and were acclimatized to the environment for 1 week before use. Throughout the experiment, the animals were maintained in a controlled environment at a temperature of 24 ± 1 °C and humidity of 50 ± 10% and under a 12/12 h light/dark cycle. Before starting the experiments, the mice were fed with the standard diet (CLEA Rodent Diet CE-2) for 1 week. Then, the mice were fed either the control diet (no. 518754) or the MCD diet (no. 518810) ad libitum for 1 week (Luyendyk et al., 2010; Zhang et al., 2010). The diets were purchased from Dyets Inc. (Bethlehem, PA, USA). Both diets contained similar
wileyonlinelibrary.com/journal/jat
nutrients (14.2% protein, 15% fat, 3.09% ash, 5% fiber), except that methionine and choline were not included to the MCD diet, whereas 1.70 g kg–1 methionine and 14.48 g kg–1 choline bitartrate were provided in the control diet. After feeding the diets for 1 week, the mice were killed. The liver samples for 8OHdG and 5meC detection were snap frozen in liquid nitrogen and stored at –80 °C until use. Formalin-fixed liver sections were stained with hematoxylin and eosin staining to evaluate the severity of histological changes. The mice were handled in a humane manner, in accordance with the National Institute for Environmental Studies (NIES) guidelines for animal experiments. Quantification of S-Adenosylmethionine and S-Adenosylhomocysteine The liver of each mouse (three per group) was homogenized in 0.4 M HClO4 and after centrifugation (15 000 g, 30 min) the supernatant was collected. The supernatant was filtrated through a 0.45 μm syringe-driven filter before analyzing its SAM and S-adenosylhomocysteine (SAH) contents. The analysis of SAM and SAH was carried out as described by Nohara et al. (2011). cDNA Preparation and Measurement of mRNA Expression Total RNA of individual livers was prepared with an RNeasy Mini Kit. After checking the quality of the RNA by electrophoresis, the reverse transcription reaction was performed with an AMV Reverse Transcriptase XL (Takara Bio Inc. Shiga, Japan) using 100 ng of total RNA. The expression of target genes in the liver of each mouse (six per group) was quantified by real-time polymerase chain reaction (PCR) on LightCycler instrument (Roche Diagnostics, Basel, Switzerland) as described previously (Nohara et al., 2006). Amplification in experimental samples during the log linear phase was compared to the relative standard curve from the dilution series of a control cDNA using LightCycler quantification software (version 3.5). The control cDNA was prepared from the livers of C57BL/6J mice. The expression of each gene was normalized relative to the Cpb mRNA expression level. The primer sequences and annealing temperatures used for realtime PCR are shown in Table 1. Western Blot Analysis About 20 mg of each liver was washed with phosphate-buffered saline and homogenized in sodium dodecyl sulfate (SDS) lysis buffer (50 mM Tris–HCl pH 7.5, 1% SDS, 10% glycerol). The lysates were then cyclically sonicated for 10 min (30 s each, with 30 s intervals) with a Bioruptor UCD-200TM (Cosmo Bio, Tokyo, Japan) and the supernatant was collected after centrifugation. The protein concentrations in the supernatant were determined with a BCA protein assay kit (Pierce, Rockford, IL). After being boiled in SDS sample buffer (50 mM Tris–HCl pH 6.8, 2% SDS, 10% glycerol, 100 mM DTT, 0.001% bromophenol blue), the samples were subjected to SDS-polyacrylamide gel electrophoresis and then transferred on to PVDF membranes (Hybond-P; Amersham Biosciences, Little Chalfont, England). After blocking, the membranes were incubated with anti-Tdg (1: 500; Santa Cruz, CA, USA), anti-Ape1 (1: 1000; Abcam, Cambridge, United Kingdom), anti-Dnmt1 (1: 1000; Cell Signaling, Danvers, MA), anti-Dnmt3a (1: 1000; Cell Signaling) and anti-β-actin (1: 5000; Sigma, St Louis, MO) overnight at 4 °C. After washing, the membranes were incubated with horseradish
Copyright © 2015 John Wiley & Sons, Ltd.
J. Appl. Toxicol. 2015
Effects of methyl deficient diet on the balance of DNA methylation Table 1. List of primers Description
HO-1 Ogg1 Mutyh Mth1 Dnmt1 Dnmt3a Dnmt3b Tet2 Tet3 Apobec1 Tdg Smug1 Ape1 Cpb
Primer sequence (5′-3′)
Annealing temperature (°C)
CTGCTAGCCTGGTGCAAGA CCAACAGGAAGCTGAGAGTGA TGTGTACCGAGGAGACGACA CAGCAGTCTCACACCTTGGA CCTGGTGCAAAGGCCTGA ATTCCTCCCAGGTCAGCCAT GGGGCTAAGAGAGAGCTGCTGGAA TTCTGTGGGCGTCCCGTGCA CCAAGCTCCGGACCCTGGATGTGT CGAGGCCGGTAGTAGTCACAGTAG GCACCTATGGGCTGCTGCGAAGACG CTGCCTCCAATCACCAGGTCGAATG GTCTGCACACCAGAGACCAGAG TCAGAGCCATTCCCATCATCTAC TGTTGTTGTCAGGGTGAGAATC TCTTGCTTCTGGCAAACTTACA CCGGATTGAGAAGGTCATCTAC AAGATAACAATCACGGCGTTCT CACCACACGGATCAGCGAAA TCATGATCTGGATAGTCACACCG CCTCCGTGGACTCGAAGCT TCTGCGTGTGACTGCAACCC TCAAGTCTTCTTCCGGCACT AGCTCAGCTGGGGTAAGGTT ATGAAGAAATTGACCTCCGTAACC GTGTAAGCGTAAGCAGTGTTG AGACTGTTCCAAAAACAGTGGA GATGCTCTTTCCTCCTGTGC
64 64 64
150 mm, 5 μm; Waters, Milford, MA, USA) in an isocratic mode with a mobile phase of methanol–10 mM ammonium acetate (2: 98, v/v) at a flow rate of 0.2 ml min–1. The internal standards (13C9,15N3-20deoxycytidine, 13C10,15N2-5-methyl-20-deoxycytidine, 100 ng each) were added to 15 μl of the hydrolyzed sample, and the mixture was diluted to 500 μl with H2O. A 10 μl volume of the mixture was injected into high-performance liquid chromatography (HPLC)–MS, and dC and 5medC were analyzed on a SIM mode. The SIM m/z of dC and 5medC was 228.1 and 242.1, respectively. The amount of 5meC was presented as the contents (%) of 5medC in total dC and 5medC (dC + 5medC).
64 64 64 64 64 64 64 64
Analysis of 8-Hydroxy-2′-Deoxyguanosine Levels Nuclease P1 (Yamasa Shoyu Co., Chiba, Japan) and alkaline phosphatase (Promega, Madison, WI) were used to hydrolyze the hepatic DNA. The level of both 8OHdG and deoxyguanosine in the DNA hydrolysates were quantified using a system of HPLC (LC-10A; Shimadzu) with an electrochemical detector (ED 623B; GL Science, Tokyo, Japan) and photodiode array detector (SPD M10A; Shimadzu). The HPLC conditions were as follows: column (Mightysil RP-18, 4.6 × 150 mm, 5 μm; Kanto Chemicals Co., Tokyo, Japan); solvent (8% methanol containing 10 mg l–1 EDTA and 40 mM phosphate buffer at pH 4.5; flow rate (1 ml min–1); diamond electrochemical detector (650 mV); and detection wave length (290 nm). The 8OHdG content in the hepatic DNA is expressed as the number of 8OHdG residues per 106 deoxyguanosines.
64 64
Statistical Analysis
64
Differences between the control group and the MCD group were analyzed using the Mann–Whitney U-test. P < 0.05 was considered significant.
peroxidase-conjugated antigoat IgG (1: 8000; Sigma), antirabbit IgG (1: 8000; Sigma) or antimouse IgG (1: 8000; Sigma) for 1 h at room temperature. After washing, the membranes were developed using the ECL Prime Western Blotting Detection System (Amersham Biosciences). Molecular weights of Tdg, Ape1, Dnmt1, Dnmt3a and β-actin proteins were approximately 46, 34, 200, 130 and 42 kDa, respectively. Isolation of Hepatic DNA
Results The Methionine–Choline-Deficient Diet-Induced Hepatic Steatosis, Reduced S-Adenosylmethionine Content and Oxidative-Stress Response After feeding the MCD diet for 1 week, the body weight and liver weight of the mice decreased by about 20–25% in comparison with the control group (Table 2), as reported previously (Zhang et al., 2010). Hematoxylin and eosin staining revealed swollen hepatocytes with moderate microvesicular steatosis in the
To avoid the DNA oxidation that occurs during DNA isolation, hepatic DNA was isolated by using a DNA extractor TIS Kit (Wako, Osaka, Japan), which uses sodium iodide (NaI) and an oxidation inhibitor, according to the manufacturer’s protocol. The isolated hepatic DNA was stored at –80 °C until use.
Table 2. Body weight and liver weight of mice fed the control and MCD diet
Measurement of 5-Methylcytosine Amounts by Liquid Chromatography–Electrospray Ionization–Mass Spectrometry
Body weight (g) 1 week Liver weight (g) 1 week
Isolated hepatic DNA was hydrolyzed and analyzed for 5meC by LC/ESI-MS as described previously (Nohara et al., 2010). LC-MS analyses were performed by using a LC/MS-2010A mass spectrometer and ESI ionization probe (Shimadzu, Kyoto, Japan). Deoxycytidine (dC) and 5-methyl-deoxycitidine (5medC) were separated using a reversed-phase column (Atlantis dC18, 2.1 ×
MCD, methionine–choline-deficient. The number in the parentheses indicates the percentage of the value in the age-matched control group. Results are reported as means ± SE (n = 6). An asterisk indicates a statistically significant difference from the control group (P < 0.01).
J. Appl. Toxicol. 2015
Copyright © 2015 John Wiley & Sons, Ltd.
Control
MCD
22.6 ± 0.4 (100) 1.12 ± 0.03 (100)
17.9 ± 0.3** (79.2) 0.84 ± 0.03** (75.0)
wileyonlinelibrary.com/journal/jat
S. Takumi et al. enzymes 8-oxoguanine DNA-glycosylase 1 and mutY homolog (Escherichia coli) (Mutyh) (Tsuzuki et al., 2007). In addition, MutT homolog 1 (Mth1) removes 8OHdGTP from the nucleotide pool to prevent incorporation of 8OHdGTP into DNA (Tsuzuki et al., 2007). Thus, we also measured the expression of these genes in the livers and found that Mutyh mRNA was upregulated on the MCD diet (Fig. 1c). These results indicated that the MCD diet augments oxidative stress in the liver. 5-Methylcytosine and 8-Hydroxy-2′-Deoxyguanosine Contents in the Liver of Mice Fed on the Methionine–CholineDeficient Diet The detailed contents of 5meC in hepatic DNA were measured by using the LC/ESI-MS method. The measurements in the group fed the control diet revealed that 5meC accounted for 5.67 ± 0.12% of the total cytosine in the hepatic DNA (Table 3). The mice fed the MCD diet showed a lower 5meC content, which accounted for 5.44 ± 0.17% of the total cytosine (Table 3). However, there were no statistical differences between the control and MCD groups. The amount of 8OHdG in hepatic DNA was measured by HPLC–electrochemical detector. Extraction of DNA was carried out by using NaI and the oxidation inhibitor in the DNA extractor TIS Kit to prevent artificial DNA oxidation (Helbock et al., 1998). The results showed that the 8OHdG content was 0.98 ± 0.04 per 106 deoxyguanosines on the control diet and moderately increased on the MCD diet (1.17 ± 0.09 per 106 deoxyguanosines, P = 0.082) (Table 3).The frequencies of 8OHdG formation in both groups were much lower than the frequencies of 5meC in the genome as discussed in the Discussion.
Figure 1. The hepatocellular damage and the expression of oxidativestress-inducible genes by the MCD diet. (a) Liver samples were processed for hematoxylin and eosin staining. Arrows indicate the typical macrovesicular hepatic steatosis. (b) Contents of SAM and SAH in the liver. SAM and SAH were prepared from the liver and measured by high-performance liquid chromatography as described in Materials and methods. The value was expressed as the concentration in the supernatant of 20% liver homogenate. Results are reported as means ± SE (n = 3). (c) The expression of mRNA was measured by real-time polymerase chain reaction and normalized to the expression of Cpb mRNA. The results are expressed as fold changes in each genes expression in the MCD group compared to the control group. Results are reported as means ± SE (n = 6). Asterisks indicate statistically significant differences from the control group (*P < 0.05 and **P < 0.01). MCD, methionine–cholinedeficient; SAH, S-adenosylhomocysteine; SAM, S-adenosylmethionine.
MCD group (Fig. 1a), which was also reported in previous studies (Luyendyk et al., 2010; Zhang et al., 2010). Another well-known feature of MCD diet-induced change in the liver is a decrease in the methyl donor SAM. After providing a methyl group to DNA, SAM is converted to SAH. The SAM content of the liver was significantly reduced by the MCD diet, while the SAH content did not significantly differ from the control group (Fig. 1b) Oxidative stress induction by the MCD diet has also been reported in previous studies (Gao et al., 2004; Powell et al., 2005). After 1 week on the MCD diet, we found a significant increase in expression of HO-1 mRNA, one of the oxidative stressinducible genes (Fig. 1c). Oxidative stress induction can lead to DNA damage and induction of DNA repair enzymes. Ubiquitous oxidative DNA damage 8OHdG is repaired by the DNA repair
wileyonlinelibrary.com/journal/jat
Effects of the Methionine–Choline-Deficient Diet on the Expression of the Genes Involved in Active DNA Demethylation Pathways As methyl-deficient diets have been reported to affect DNA methylation level, we investigated the effects of the MCD diet on the active DNA demethylation pathways by assessing the induction of the involved enzymes. The results demonstrated that mRNA of Tet2 and Tet3 were expressed in the liver, but Tet1 was not, as reported previously (Ito et al., 2010), and that mRNA expression of Tet2 and Tet3 was significantly upregulated on the MCD diet (Fig. 2a). mRNA expression of Tdg and Ape1, which are major components of Table 3. The contents of 5meC and 8OHdG in the livers of mice fed the control and MCD diet
5meC (%) 8OHdGb
a
Control
MCD
5.67 ± 0.12 (100) 0.98 ± 0.04 (100)
5.44 ± 0.17 (95.9) 1.17 ± 0.09 (119.4)
8OHdG, 8-hydroxy-2′-deoxyguanosine; 5meC, 5methylcytosine; MCD, methionine–choline-deficient. a The content (%) of 5meC was expressed as the percentage of 5meC in total cytosine (cytosine + 5-methylcytosine). b The content of 8OHdG was expressed as the number of 8OHdG residues per 106 deoxyguanosines. The number in the parentheses indicates the value of each sample compared to the value in the age-matched control groups, in which it is set as 100. Results are reported as means ± SE (n = 6).
Copyright © 2015 John Wiley & Sons, Ltd.
J. Appl. Toxicol. 2015
Effects of methyl deficient diet on the balance of DNA methylation
Figure 2. Expression of the active DNA demethylation-related genes. (a) The expression of genes involved in active DNA demethylation pathways were measured in the liver of mice fed the control diet or MCD diet for 1 week by real-time polymerase chain reaction and normalized to the expression of Cpb mRNA. The results are expressed as fold changes in each genes expression in the MCD group compared to the values of the control group. Results are reported as means ± SE (n = 6). Asterisks indicate statistically significant differences from the control group (*P < 0.05 and **P < 0.01). (b,c) Immunoblot analysis of Tdg and Ape1 from the liver of control or MCD groups. β-actin is used as a loading control. MCD, methionine–choline-deficient.
Tdg-mediated BER pathway, were also significantly upregulated on the MCD diet (Fig. 2a). The upregulation of Tdg and Ape1 on the MCD diet was also confirmed for protein levels (Fig. 2b,c). These results showed that feeding the MCD diet for 1 week activates the active DNA demethylation pathway. Among other enzymes involved in the active DNA demethylation pathway, mRNA expression of a deaminating enzyme, apolipoprotein B mRNA-editing catalytic polypeptide 1 (Apobec1) and a DNA-glycosylase, single-stranded-selective monofunctional uracil-DNA glycosylase 1 (Smug1) were unaffected by the MCD diet (Fig. 2a) and expression of a deaminating enzyme, activation-induced deaminase (Aid) was not detectable in the liver. These results indicated that deamination of 5hmC was minimally impacted by the MCD diet. Effect of the Methionine–Choline-Deficient Diet on Expression of DNA Methyltransferases We also measured Dnmt mRNA expression in the liver. The MCD diet significantly increased the expression of Dnmt1, the DNA methyltransferase, which is required for the accurate maintenance of the DNA methylation patterns in somatic cells (Fig. 3a). The expression of de novo DNA methyltransferase Dnmt3a was significantly increased on the MCD diet (Fig. 3a). The upregulation of Dnmt1 and Dnmt3a on the MCD diet was also confirmed for protein levels (Fig. 3b,c).
Discussion In the present study, hepatic steatosis, a typical methyl-deficient diet-induced lesion, and prominent body weight loss were observed after feeding the MCD diet for 1 week (Fig. 1a, Table 2). It has been reported that methionine and choline are required for hepatic secretion of triglycerides in the form of very
J. Appl. Toxicol. 2015
Figure 3. Expression of Dnmts in the liver. The expression of Dnmts mRNA was measured by real-time polymerase chain reaction and normalized to the expression of Cpb mRNA. The results are expressed as fold changes in each genes expression in the MCD group compared to values of the control group. Results are reported as means ± SE (n = 6). Asterisks indicate statistically significant differences from the control group (*P < 0.05 and **P < 0.01). (b,c) Immunoblot analysis of Dnmt1 and Dnmt3a from the liver of control or MCD groups. β-actin is used as a loading control. Dnmts, DNA methyltransferases; MCD, methionine– choline-deficient.
low-density lipoprotein (Matsumoto et al., 2013). Hence, the impairment of lipid export from the liver to peripheral tissues is thought to be a reason for weight loss in this model. Methyldeficient diets have also been reported to induce depletion of SAM and an increase in oxidative stress in the liver (Pogribny et al., 2009a; Powell et al., 2005; Rolo et al., 2012). Consistently, the present study showed a decreased SAM content and the induction of oxidative stress related genes such as HO-1 and Mutyh in the liver of MCD group (Fig. 1b,c). The induction of oxidative stress causes various oxidative DNA damage, and activates the DNA repair pathway. Therefore, the methyl-deficient diet-induced activation of DNA repair pathway is suggested to promote active DNA demethylation (Pogribny et al., 2012). However, the involvement of active DNA demethylation-related genes, such as Tet enzymes’ genes, has not been determined in methyl-deficient diet models. In the present study, we demonstrated that the expression of Tet2, Tet3, Tdg and Ape1 were significantly upregulated after feeding the MCD diet for 1 week (Fig. 2). These results indicated that the MCD diet activates the active DNA demethylation pathway starting with oxidization of 5meC by Tet enzymes followed by the Tdg-mediated BER pathway (Fig. 4). On the other hand, the DNA methylation level in the liver was not significantly changed by feeding the MCD diet for 1 week (Table 3). As DNA methylation is a mechanism that is essential to maintaining genomic stability and regulating gene expression, the methylation level may be strictly controlled by various systems. In support of this expectation, the expression of Dnmt1 and Dnmt3a were increased in the liver of the MCD group (Fig. 3a–c). Previous studies reported that feeding the MCD diet for 9 weeks or longer caused DNA hypomethylation associated with suppressed expression of Dnmt1 (James et al., 2003; Pogribny et al., 2009a,2009b). Hence, the duration of methyl deficiency may lead to a failure of the maintenance system of DNA methylation, including Dnmts. Not only the maintaining Dnmt, Dnmt1, but also Dnmt3a and Dnmt3b are reported to take
Copyright © 2015 John Wiley & Sons, Ltd.
wileyonlinelibrary.com/journal/jat
S. Takumi et al.
Figure 4. Outline of the DNA methylation regulatory pathways in the MCD group. This figure shows the possible involvement of the DNA methylation and active DNA demethylation pathways in the MCD group. The results obtained in the present study demonstrated that the MCD diet induces expression of Tet2, Tet3, Tdg and Ape1, which are involved in active DNA demethylation pathways. The bold arrows indicate the pathway that is activated by the MCD diet. Ape1, apurinic/apyrimidinic-endonuclease 1; 5caC, 5-carboxylcytosine; 5fC, 5-formylcytosine; 5hmC, 5-hydroxymethylcytosine; 5hmU, 5hydroxymethyluracil; 5meC, 5-methylcytosine; Dnmts, DNA methyltransferases; MCD, methionine–choline-deficient; Tdg, thymine DNA glycosylase.
a part in radiation-induced DNA methylation changes in the spleen and liver (Raiche et al., 2004). Recent studies also propose the supportive role of Dnmt3a in the maintenance of DNA methylation by Dnmt1 (Jones & Liang, 2009). Further studies are needed to clarify that the induction of Dnmt1 and Dnmt3a may cooperatively maintain DNA methylation under methyldeficient conditions. Depletion of SAM by MCD diets is reported to be associated with global DNA hypomethylation (reviewed by Pogribny et al., 2012). In the present study, although the MCD diet for 1 week greatly reduced SAM content in the liver, the DNA methylation levels were not affected. Therefore, the amount of SAM may be enough for maintaining DNA methylation for 1 week. Among factors that may lead to DNA demethylation, previous studies reported that replacement of guanine with 8OHdG diminishes the ability of human Dnmts and murine Dnmt3a to methylate the adjacent cytosine in synthetic oligodeoxynucleotides (Maltseva et al., 2009; Turk et al., 1995). In the present study, the content of 8OHdG in the control diet group was estimated to be approximately 1 per 106 deoxyguanosines, and it was in agreement with the content of 8OHdG reported by the European Standards Committee on oxidative DNA damage (ESCODD) (Table 3) (ESCODD, 2002). The change in the 8OHdG number by the MCD diet compared to the control diet (1.17 vs 0.98 per 106 deoxyguanosines) was approximately 2 per 107 deoxyguanosines (Table 3). On the other hand, 5meC accounted for 5.67% of total cytosine in the liver of the control group and 5.44% in the MCD group (Table 3). Thus, the MCD diet-induced change in 5meC was roughly 0.2% relative to total cytosine, or 2 per 103 total cytosine. Therefore, the change in the 8OHdG number by the MCD diet (2 per 107 total guanine) was about 10 000 times smaller compared to the change in the 5meC number by the MCD diet (2 per 103 total cytosine). From these calculations, the suppression of Dnmt activity by 8OHdG seems not to have had a considerable effect on global DNA methylation.
wileyonlinelibrary.com/journal/jat
In conclusion, this study suggests that the DNA methylation status is strictly controlled by the balance between the activities of Dnmt, and the active DNA demethylation pathways by a methyl-deficient diet (Fig. 4). To our knowledge, this is the first report to provide evidence suggesting upregulation of the Tet family by a methyl-deficient diet. Regarding the regulatory mechanism of Tet expression, a recent study reported that the expression of Tet2 is regulated by the transcription factor Oct4 in embryonic stem cells (Wu et al., 2012). However, it is totally unknown how the MCD diet activates Tet enzymes and their functions in the liver. Further study on the linkage between Tet induction and methyl deficiency is necessary to provide a better understanding on the etiology of the methyl-deficient diet. Acknowledgments This work was supported by the National Institute for Environmental Studies (0710AG333, K.N., 1115AA082), Ministry of Education, Science, Sports and Culture, Grant-in-Aid for Scientific Research (23390166, K.N.; 24790600, S.T.). We wish to thank Ms. J. Bao for her kind cooperation in preparing liver sections, Ms. M. Matsumoto and Ms. H. Murai for their excellent technical assistance, and Ms. S. Itaki for her helpful secretarial assistance.
Conflict of Interest The authors declare that there are no conflicts of interest.
References Bhutani N, Burns DM, Blau HM. 2011. DNA demethylation dynamics. Cell 146: 866–872. Dahl C, Gronbaek K, Guldberg P. 2011. Advances in DNA methylation: 5-hydroxymethylcytosine revisited. Clin. Chim. Acta 412: 831–836. ESCODD (European Standards Committee on Oxidative DNA Damage). 2002. Comparative analysis of baseline 8-oxo-7,8-dihydroguanine in
Copyright © 2015 John Wiley & Sons, Ltd.
J. Appl. Toxicol. 2015
Effects of methyl deficient diet on the balance of DNA methylation mammalian cell DNA, by different methods in different laboratories: an approach to consensus. Carcinogenesis 23: 2129–2133. Gao D, Wei C, Chen L, Huang J, Yang S, Diehl AM. 2004. Oxidative DNA damage and DNA repair enzyme expression are inversely related in murine models of fatty liver disease. Am. J. Physiol. Gastrointest. Liver Physiol. 287: G1070–G1077. Gong Z, Zhu JK. 2011. Active DNA demethylation by oxidation and repair. Cell Res. 21: 1649–1651. Gopalakrishnan S, Van Emburgh BO, Robertson KD. 2008. DNA methylation in development and human disease. Mutat. Res. 647: 30–38. He YF, Li BZ, Li Z, Liu P, Wang Y, Tang Q, Ding J, Jia Y, Chen Z, Li L, et al. 2011. Tet-mediated formation of 5-carboxylcytosine and its excision by TDG in mammalian DNA. Science 333: 1303–1307. Helbock HJ, Beckman KB, Shigenaga MK, Walter PB, Woodall AA, Yeo HC, Ames BN. 1998. DNA oxidation matters: the HPLC-electrochemical detection assay of 8-oxo-deoxyguanosine and 8-oxo-guanine. Proc. Natl. Acad. Sci. U. S. A. 95: 288–293. Ito S, D’Alessio AC, Taranova OV, Hong K, Sowers LC, Zhang Y. 2010. Role of Tet proteins in 5mC to 5hmC conversion, ES-cell self-renewal and inner cell mass specification. Nature 466: 1129–1133. Ito S, Shen L, Dai Q, Wu SC, Collins LB, Swenberg JA, He C, Zhang Y. 2011. Tet proteins can convert 5-methylcytosine to 5-formylcytosine and 5-carboxylcytosine. Science 333: 1300–1303. James SJ, Pogribny IP, Pogribna M, Miller BJ, Jernigan S, Melnyk S. 2003. Mechanisms of DNA damage, DNA hypomethylation, and tumor progression in the folate/methyl-deficient rat model of hepatocarcinogenesis. J. Nutr. 133: 3740S–3747S. Jones PA, Liang G. 2009. Rethinking how DNA methylation patterns are maintained. Nat. Rev. Genet. 10: 805–811. Luyendyk JP, Sullivan BP, Guo GL, Wang R. 2010. Tissue factor-deficiency and protease activated receptor-1-deficiency reduce inflammation elicited by diet-induced steatohepatitis in mice. Am. J. Pathol. 176: 177–186. Maiti A, Drohat AC. 2011. Thymine DNA glycosylase can rapidly excise 5-formylcytosine and 5-carboxylcytosine: potential implications for active demethylation of CpG sites. J. Biol. Chem. 286: 35334–35338. Maltseva DV, Baykov AA, Jeltsch A, Gromova ES. 2009. Impact of 7,8-dihydro-8-oxoguanine on methylation of the CpG site by Dnmt3a. Biochemistry 48: 1361–1368. Matsumoto M, Hada N, Sakamaki Y, Uno A, Shiga T, Tanaka C, Ito T, Katsume A, Sudoh M. 2013. An improved mouse model that rapidly develops fibrosis in non-alcoholic steatohepatitis. Int. J. Exp. Pathol. 94: 93–103. Nohara K, Ao K, Miyamoto Y, Ito T, Suzuki T, Toyoshiba H, Tohyama C. 2006. Comparison of the 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD)-induced CYP1A1 gene expression profile in lymphocytes from mice, rats, and humans: most potent induction in humans. Toxicology 225: 204–213. Nohara K, Baba T, Murai H, Kobayashi Y, Suzuki T, Tateishi Y, Matsumoto M, Nishimura N, Sano T. 2010. Global DNA methylation in the mouse
J. Appl. Toxicol. 2015
liver is affected by methyl deficiency and arsenic in a sex-dependent manner. Arch. Toxicol. 85: 653–661. Nohara K, Baba T, Murai H, Kobayashi Y, Suzuki T, Tateishi Y, Matsumoto M, Nishimura N, Sano T. 2011. Global DNA methylation in the mouse liver is affected by methyl deficiency and arsenic in a sex-dependent manner. Arch. Toxicol. 85: 653–661. Pogribny IP, James SJ, Jernigan S, Pogribna M. 2004. Genomic hypomethylation is specific for preneoplastic liver in folate/methyl deficient rats and does not occur in non-target tissues. Mutat. Res. 548: 53–59. Pogribny IP, Shpyleva SI, Muskhelishvili L, Bagnyukova TV, James SJ, Beland FA. 2009a. Role of DNA damage and alterations in cytosine DNA methylation in rat liver carcinogenesis induced by a methyldeficient diet. Mutat. Res. 669: 56–62. Pogribny IP, Tryndyak VP, Bagnyukova TV, Melnyk S, Montgomery B, Ross SA, Latendresse JR, Rusyn I, Beland FA. 2009b. Hepatic epigenetic phenotype predetermines individual susceptibility to hepatic steatosis in mice fed a lipogenic methyl-deficient diet. J. Hepatol. 51: 176–186. Pogribny IP, James SJ, Beland FA. 2012. Molecular alterations in hepatocarcinogenesis induced by dietary methyl deficiency. Mol. Nutr. Food Res. 56: 116–125. Powell CL, Kosyk O, Bradford BU, Parker JS, Lobenhofer EK, Denda A, Uematsu F, Nakae D, Rusyn I. 2005. Temporal correlation of pathology and DNA damage with gene expression in a choline-deficient model of rat liver injury. Hepatology 42: 1137–1147. Raiche J, Rodriguez-Juarez R, Pogribny I, Kovalchuk O. 2004. Sex- and tissue-specific expression of maintenance and de novo DNA methyltransferases upon low dose X-irradiation in mice. Biochem. Biophys. Res. Commun. 325: 39–47. Ravanat JL, Douki T, Duez P, Gremaud E, Herbert K, Hofer T, Lasserre L, Saint-Pierre C, Favier A, Cadet J. 2002. Cellular background level of 8-oxo-7,8-dihydro-2′-deoxyguanosine: an isotope based method to evaluate artefactual oxidation of DNA during its extraction and subsequent work-up. Carcinogenesis 23: 1911–1918. Rolo AP, Teodoro JS, Palmeira CM. 2012. Role of oxidative stress in the pathogenesis of nonalcoholic steatohepatitis. Free Radic. Biol. Med. 52: 59–69. Tsuzuki T, Nakatsu Y, Nakabeppu Y. 2007. Significance of error-avoiding mechanisms for oxidative DNA damage in carcinogenesis. Cancer Sci. 98: 465–470. Turk PW, Laayoun A, Smith SS, Weitzman SA. 1995. DNA adduct 8-hydroxyl-2′-deoxyguanosine (8-hydroxyguanine) affects function of human DNA methyltransferase. Carcinogenesis 16: 1253–1255. Wu Y, Guo Z, Liu Y, Tang B, Wang Y, Yang L, Du J, Zhang Y. 2012. Oct4 and the small molecule inhibitor, SC1, regulates Tet2 expression in mouse embryonic stem cells. Mol. Biol. Rep. 40: 2897–2906. Zhang YK, Yeager RL, Tanaka Y, Klaassen CD. 2010. Enhanced expression of Nrf2 in mice attenuates the fatty liver produced by a methionineand choline-deficient diet. Toxicol. Appl. Pharmacol. 245: 326–334. Zhu JK. 2009. Active DNA demethylation mediated by DNA glycosylases. Annu. Rev. Genet. 43: 143–166.
Copyright © 2015 John Wiley & Sons, Ltd.
wileyonlinelibrary.com/journal/jat
