Ecotoxicology (2014) 23:1430–1438 DOI 10.1007/s10646-014-1285-8
The effect of glufosinate on nitrogen assimilation at the physiological, biochemical and molecular levels in Phaeodactylum tricornutum Jun Xie • Xiaocui Bai • Yali Li • Chongchong Sun Haifeng Qian • Zhengwei Fu
•
Accepted: 27 June 2014 / Published online: 14 July 2014 Ó Springer Science+Business Media New York 2014
Abstract This study investigated the effects of glufosinate, a widely used herbicide, on the marine diatom Phaeodactylum tricornutum through short-term toxicity tests at the physiological and gene transcriptional levels. Glufosinate (4 mg L-1) decreased the amount of pigments but increased reactive oxygen species (ROS) and malondialdehyde levels. As a glutamine synthetase (GS) inhibitor, glufosinate affected the transcripts and activities of key enzymes related to nitrogen assimilation. Transcript levels of GS and nitrate reductase (NR) in P. tricornutum decreased to only 57 and 26 % of the control. However, transcript levels of nitrate transporter (NRT) and the small subunit of glutamate synthase (GltD) were 1.79 and 1.76 times higher than that of the control. The activities of NRT, GS and GOGAT were consistent with gene expression except for NR, which was regulated mainly by posttranslational modification. Furthermore, the results of electron microscopy showed that chloroplast structure was disrupted in response to glufosinate exposure. These results demonstrated that glufosinate first disturbed nitrogen metabolism and caused a ROS burst, which disrupted chloroplast ultrastructure. Ultimately, the growth of P. tricornutum was greatly inhibited by glufosinate.
J. Xie Y. Li H. Qian Z. Fu College of Biological and Environmental Engineering, Zhejiang University of Technology, Hangzhou 310032, People’s Republic of China X. Bai C. Sun H. Qian (&) Department of Food Science and Technology, Zhejiang University of Technology, Hangzhou 310032, People’s Republic of China e-mail: [email protected]
123
Keywords Phaeodactylum tricornutum Glufosinate Nitrogen assimilation Electron microscopy Real-time PCR
Introduction Nitrogen is a macronutrient that is necessary for life and is involved in building fundamental molecules: nucleotides, proteins, numerous other metabolites and cellular components. Nitrogen metabolism is not only one of the basic processes of plant physiology but also part of the global chemical cycles. Nitrogen assimilation in phytoplankton plays a direct role in amino acid synthesis and conversion through the reduction of nitrate. This process involves nitrate sensing and signaling, nitrate/nitrite transport, nitrate/nitrite reduction and ammonium incorporation into carbon skeletons (Fischer and Klein 1988; Allen et al. 2006; Fernandez and Galvan 2008). The simplified process of nitrate assimilation in diatoms is briefly shown in Fig. 1. Several key components involve in the process, including nitrate transporter (NRT), nitrate reductase (NR), glutamine synthetase (GS) and glutamate synthase (GOGAT). Glufosinate is an active ingredient of non-selective herbicides (Schwerdtle et al. 1981; Bu¨bl and Langelu¨ddeke 1984). As a phosphonic acid analog of glutamate, it potently inhibits GS, a key enzyme in nitrate assimilation, by competing with glutamate for binding sites in an irreversible way (Manderscheid and Wild 1986; Logusch et al. 1991). This process leads to the accumulation of toxic ammonium and decreases L-glutamine (Gln) synthesis in the cell. Previous studies demonstrated that glufosinate applied at 410 g ha-1 enhanced the amount of ammonium in amaranth after 30 min of exposure (Coetzer and Al-Khatib
The effect of glufosinate on nitrogen assimilation
1431
Fig. 1 Brief overview of nitrate assimilation pathways in diatoms (modified from Fernandez and Galvan 2008)
2001). Furthermore, the block of Gln synthesis decreased the levels of other amino acids, which are precursors in the chemical synthesis of nucleotides and proteins (RojanoDelgado et al. 2013). Moreover, glufosinate also detrimentally affected photosynthesis and photorespiration by disturbing chloroplast structure, decreasing the transcript abundance of photosynthetic genes and inhibiting the transamination of glyoxylate to glycine in photorespiration (Blackwell et al. 1987; Wendler et al. 1990; Qian et al. 2008). Nevertheless, there is an extensive body of literature dealing with the phytotoxicity of glufosinate in land plants, only a few publications have analyzed its impact on aquatic organisms. Studies investigating the potential effects of glufosinate on phytoplankton are particularly valuable due to its worldwide usage, the marketization of genetically modified crops that are resistant to glufosinate (Shaner 2000), its long half-life in the environment (Niu et al. 2010) (in three buffer solutions with pH values of 5.0, 6.9 and 9.3, the half-lives were 433, 693 and 533 days, respectively) and its high solubility in water (Royer et al. 2000) (approximately 1,370 g L-1). Phytoplankton are the primary producers in the food chain, and they are more sensitive to contaminants than fish and invertebrates (Whitton and Kelly 1995). Diatoms, an important type of marine phytoplankton which is the basis for the world’s shortest and most energy-efficient food webs (Allen et al. 2006), play a pivotal role in the global carbon cycle, and it is estimated that they perform 20 % of global CO2 assimilation (Haimovich-Dayan et al. 2013). Phaeodactylum tricornutum is an excellent model diatom species with which to study fundamental biological processes such as
photosynthesis, carbon and nitrogen metabolism and nutrient deficiency, among others, due to its ease in handling in microbiological experiments and the detailed molecular biological information available for the species. The aim of the present study was to assess the effects of glufosinate on the regulation of nitrate assimilation in P. tricornutum.
Materials and methods Culture conditions P. tricornutum were obtained from the Institute of Hydrobiology of the Chinese Academy of Sciences. Batch cultures were grown in Erdschreiber’s medium (http://web. biosci.utexas.edu/utex/media.aspx) at 22 ± 0.5 °C under a 12 h light: 12 h dark cycle with light provided by coolwhite fluorescent bulbs (&54 lE m-2 s-1). The cell density of cultures was estimated spectrophotometrically at an optical density of 680 nm (OD680). A calibration curve of cell density was constructed using a control diatom culture and a hemocytometer and was expressed as a function of OD680. The regression equation between cell density (y in 9 105 cells mL-1) and OD680 (x) was y = 100x ? 1.12 (R2 = 99.08). Glufosinate (Basta, 10 % solution) was purchased from Sangon (Shanghai, China), and the stock solutions were diluted in Milli-Q water. Cells in the exponential growth phase were used for each experiment, and the initial cell density for the experiment was OD680 = 0.09 (approximately 9.12 9 105 cells mL-1). The experiments were repeated at least three times, and
123
1432
J. Xie et al.
three replicates were performed for each bioassay. The samples were collected after 48 and 96 h for use in different tests. Pigment, reactive oxygen species and malondialdehyde assays A 10-mL aliquot of each culture was collected to extract pigments from P. tricornutum after 96 h of glufosinate exposure. The pellet was soaked in 5 mL acetone (90 %, v/v) and stored (-4 °C) for 24 h in dark. The supernatants were measured by spectrophotometry in microplate reader according to the method of Yang and Duan (2010). The quantities (lg/L) of chlorophyll a, chlorophyll c and carotenoid were calculated using the equations, respectively: Chla ¼ ½11:85ðOD664 OD750 Þ 1:54ðOD647 OD750 Þ 0:08ðOD630 OD750 Þ v=ðV LÞ Chlc ¼ ½24:52ðOD630 OD750 Þ 1:67ðOD664 OD750 Þ 7:6ðOD647 OD750 Þ v=ðV LÞ Carotenoid ¼ ð4:7 OD440 1:38 OD662 5:48 OD644 Þ v=ðV LÞ The v (mL) and V(L) stand for the volume of extract and microalgae, respectively, and L (cm) is the optical distance of cuvette. The reactive oxygen species (ROS) were measured using a fluorescent probe, 20 ,70 -dichlorofluorescin diacetate (DCFH-DA), following the instructions provided with the ROS Assay Kit (Beyotime Institute of Biotechnology, Haimen, China). Briefly, DCFH-DA reacts with ROS to form the fluorescent product DCF, which can be measured with a fluorescence microplate reader with an excitation wavelength at 485 nm and an emission wavelength at 525 nm (TECAN GENIOS, USA). The lipid peroxidation level was determined in terms of malondialdehyde (MDA) quantitation using the method provided with the MDA kit (Beyotime Institute of Biotechnology, China).
The activities of NRT, NR, GS and GOGAT The nitrate transporter activity in the diatoms was reflected by the absorptive capacity of nitrate. Dionex ICS-2000 Reagent-FreeTM Ion Chromatography (RFIC) was used to measure the nitrate level in the medium supernatant with or without diatoms after culturing for 96 h, as described previously (Qian et al. 2013a, b). The activities of NR, GS and GOGAT were measured according to the procedures provided with the NR, GS and GOGAT kits (NR & GS kit, Nanjing Jiancheng Bioengineering Institute, China;
123
GOGAT kit, Suzhou Comin Biotechnology Company, China), respectively. The basic principles of the kits were shown as follows: NR was estimated by optical density at 540 nm absorbance due to red azo-compound formation. Glutamine was converted into glutamyl-c-hydroxamate under GS catalysis, which was estimated by optical density at 550 nm absorbance. GOGAT was measured spectrophotometrically, monitoring absorbance due to NADH at 340 nm. The activity of each enzyme was expressed on a protein basis. The protein concentration was determined using bicinchoninic acid (BCA protein kit, Sangon Company, China).
Electron microscopy analysis Samples from the control and glufosinate-treated diatoms were fixed with 1.0 % OsO4 and embedded in epoxy resin. The samples were then cut into ultra-thin sections (70–90 nm) using a Reichert Ultracuts ultramicrotome and stained with uranyl acetate followed by lead citrate. Transmission electron microscopy (TEM) using a JEM1230 microscope (JEOL Ltd., Tokyo, Japan) was used to observe the substructure of the diatoms.
Gene transcription analysis The transcript levels of key genes involved in nitrate assimilation were detected by real-time PCR. In the present study, we selected NRT, NR, GS and the small subunit of glutamate synthase (GltD), which encodes NRT, NR, GS and GOGAT, respectively. Total RNA was extracted from diatom cells using RNAiso (Takara Company, Dalian, China) according to the manufacturer’s instructions. The RNA concentration and purity were measured with a spectrophotometer at 260 and 280 nm. The RNA integrity was evaluated by electrophoresis in a 1 % agarose formaldehyde gel. RNA was reverse-transcribed into cDNA using a reverse transcriptase kit (Toyobo, Tokyo, Japan). Real-time quantitative PCR was performed with an Eppendorf Master CyclerÒ ep RealPlex4 (WesselingBerzdorf, Germany), and a reaction mixture for each PCR run was prepared with the SYBR Green PCR reagents (Toyobo, Tokyo, Japan). The following PCR protocol was used with two steps : one denaturation step at 95 °C for 1 min and 40 cycles of 95 °C for 15 s, followed by 60 °C for 1 min. Actin was used as a housekeeping gene to standardize the results by eliminating variations in the quantity and quality of the mRNA and cDNA. The relative quantification of gene transcription among the treatment groups was achieved using the 2-DDCt method (Livak and
The effect of glufosinate on nitrogen assimilation Table 1 Sequences of the primer pairs in Phaeodactylum tricornutum for real-time PCR
1433
Gene orientation
Sequence
(50 –30 )
Actin
Forward
GACTCCACCTTCCAGACCATTA
NRT NR GS GltD
Reverse
GACCCTCCAATCCAAACAGAG
Forward
CCGACCAAGATGATAAGGCTAC
Reverse
TGGCAAACCAAATGAAGAAG
Forward
AACCCACAAGACCCTACACAAA
Reverse
AGGAAAGTTAGCAGCCCATTC
Forward
ACGACTTTGCCTTTCCCATTAT
Reverse
CCTTTCCGAGGTAGGTGGATAC
Forward
GTATGGCGGCTTCGTGTAAC
Reverse
GGGGAAAGACTGCTGAGATTAT
GI
195027 219112462 55845942 219125250 219118704
Schmittgen 2001). The primer pairs designed to amplify the tested genes are listed in Table 1.
Data analysis The data are presented as the mean ± standard error of the mean (SEM) and were compared using a one-way analysis of variance (ANOVA). Values were considered significantly different when the probability (p) was \0.05. All statistical analysis was performed using the StatView 5.0 program (Statistical Analysis Systems Institute, Cary, NC).
Results and discussion Effects of glufosinate on diatom growth and quantity of pigment As shown in Fig. 2, glufosinate did not affect diatom growth when it was present at low levels (0.5 and 1 mg/L); however, it inhibited P. tricornutum growth when the tested concentration was higher than 2 mg/L. The percentage of growth inhibition in diatoms increased to more than 30 % and increased continually with an increase in exposure time. After 96 h of exposure, the inhibition ratios reached approximately 47.7, 70.9, 78.1 and 78.7 % in the groups treated with 4, 6, 8 and 16 mg/L, respectively. Based on this experiment, to achieve acute toxicity, 4 mg/L glufosinate was chosen as the tested concentration. The amounts of chlorophyll and carotenoid after 96 h of glufosinate exposure are shown in Fig. 3. After 96 h, the amounts of chlorophyll a, chlorophyll c and carotenoids decreased significantly to 82.8, 69.6 and 55.1 % of the control, respectively. It is known that lipid-soluble pigments are intimately involved in all aspects of primary photosynthesis, including light harvesting, energy transfer and light/energy conversion (Owens 1986). Thus, the
Fig. 2 Effects of different concentrations of glufosinate on Phaeodactylum tricornutum growth
decrease in the amount of pigment indicated that the photosynthesis pathway was blocked and the synthesis of energy for metabolism was decreased. Similar experiments performed on soybeans and rice also demonstrated that pigment production was severely inhibited by glufosinate treatment (Reddy et al. 2001; Duan et al. 2003). Effects of glufosinate on the activities of GS, NRT, GOGAT and NR As the target enzyme of glufosinate, GS activity decreased rapidly after 96 h of herbicide application and was downregulated to 60 % of the control (Fig. 4a), which is similar to the findings of Barrios-Llerena et al. (2011) that GS activity was found to be significantly down regulated in the unicellular algae Ostreococcus tauri in the presence of glufosinate. The primary effect of GS inhibition by glufosinate is metabolically reflected by ammonium accumulation in vivo and the drastic decrease in Gln. In
123
1434
J. Xie et al.
Fig. 3 Effects of glufosinate on the amount of chlorophyll a, chlorophyll c and carotenoid in Phaeodactylum tricornutum after 96 h. Asterisk and double asterisk represent statistically significant differences when compared with the control (without glufosinate exposure) at p \ 0.05 and at p \ 0.01, respectively
Fig. 4 Effects of glufosinate on the quantity of ROS and MDA in Phaeodactylum tricornutum after 96 h. Asterisk and double asterisk represent statistically significant differences when compared with the control (without glufosinate exposure) at p \ 0.05 and at p \ 0.01, respectively
addition to GS inhibition, the increase of both NRT and GOGAT activities were observed after glufosinate treatment (Fig. 4b, c); however, NR activity was not significantly affected (Fig. 4d). Based on these results, it is speculated that GS inhibition could drastically decrease Gln, which resulted in an amino acid deficiency (RojanoDelgado et al. 2013). Furthermore, in addition to its fundamental role in nitrogen assimilation and detoxification,
123
GS may potentially integrate a broad N-signaling network in plants by mediating amino acid synthesis; therefore, the internal amino acid pool functions as a signal to regulate N uptake and assimilation (Miller et al. 2008). To deal with the shortage of amino acids caused by glufosinate exposure, NRT activity was induced to transport more nitrate from the medium and enhance nitrogen assimilation. This allows the synthesis of an adequate amount of amino acids
The effect of glufosinate on nitrogen assimilation
1435
Fig. 5 Effects of glufosinate on the activities of GS (a), NRT (b), GOGAT (c) and NR (d) in Phaeodactylum tricornutum after 96 h. Asterisk and double asterisk represent statistically significant differences when compared with the control (without glufosinate exposure) at p \ 0.05 and at p \ 0.01, respectively
related to organism metabolism or defense mechanisms, such as those needed for the synthesis of some antioxidant enzymes. However, the ability to convert nitrate into nitrite was not noticeably affected.
Effects of glufosinate on ROS and MDA production The production of MDA, a byproduct of lipid peroxidation, increased to approximately 10-fold of the control after 96 h of glufosinate exposure (Fig. 5a). The fluorescence intensity of DCF reached 7-fold of the control (Fig. 5b), indicating a ROS burst after glufosinate exposure. In microalgae, ROS include the superoxide radical (O2-), hydrogen peroxide (H2O2) and the hydroxyl radical (OH) and are produced through various metabolic pathways localized in mitochondria, chloroplasts and peroxisomes (Lesser 2006). It was reported that higher levels of ammonium in the cell induce perturbations of the electron transport systems of chloroplasts and mitochondria generating free radicals and inducing an oxidative stress response (Ahn 2008). Our previous study demonstrated that glufosinate decreased the abundance of photosynthesis-related genes to allow the accumulation of superfluous electrons, which combined with molecular oxygen to produce ROS in the chloroplast (Qian et al. 2008). The overproduction of ROS destroyed the integrity of the cellular lipid membrane, which could be evaluated based on the increase in the quantity of MDA. This increase is considered to be a symptom of environmental stress in several organisms (Yamauchi et al. 2008; Qian et al. 2010).
Effects of glufosinate on the subcellular structure of diatom cells In diatom, many cellular processes occur in plastids, e.g., occurrence of photosynthesis in the thylakoid membrane. There are many common features of chloroplast in diatoms and the other plants. But the membrane topology and pigment composition make the chloroplast in diatoms unique (Lepetit et al. 2007). Diatoms possess a chloroplast envelope with four membranes and the diatom thylakoid membranes do not differentiate into stroma and grana thylakoids but are arranged in groups of three (Archibald and Keeling 2002; Pyszniak and Gibbs 1992). The pigment composition of diatoms differs to that of vascular plants that they use Chl c as accessory pigment rather than Chl b (Lepetit et al. 2007). Because both a burst of oxidative damage (increase in ROS and MDA) and a decrease in the amount of pigment after glufosinate treatment were observed, we hypothesized that changes in the chloroplast ultrastructure may have occurred and this can be supported by the transmission electron microscopy analysis, which demonstrated that the chloroplast substructure was abnormal in the glufosinatetreated group. Compared with the highly organized lamellae in the control (Fig. 6a, c), the lamellae in glufosinate-treated cells were arranged loosely and randomly, which indicated that glufosinate damaged the thylakoids (Fig. 6b, d). This finding is in agreement with our previous report (Qian et al. 2008), and it indicates that the thylakoid membrane may be more sensitive to environmental stress
123
1436
J. Xie et al.
Fig. 6 Effects of glufosinate on the ultrastructure of Phaeodactylum tricornutum after 96 h. a cell structure in the control, b cell structure in a sample treated with glufosinate, c a magnified image of the area
within the rectangle in (a), d a magnified image of the area within the rectangle in (b). chl chloroplast, thy thylakoid, osm osmiophilic body
because many external factors, such as metals and salts, are able to destroy it (Barhoumi et al. 2007; Qian et al. 2013a). Furthermore, we also observed more osmiophilic bodies after glufosinate treatment (Fig. 6b, d), which indicated that lipids were released from the destroyed thylakoid membrane, as observed under salt and Cd stress (Djebali et al. 2005; Barhoumi et al. 2007). There is no doubt that the structural damage to the chloroplasts induced by glufosinate was accompanied by a reduction in photosynthetic and nitrogen assimilation activities.
(Fig. 7c). NR is a crucial rate-limiting enzyme in nitrogen assimilation (Solomonson and Barber 1990, Allen et al. 2006), and the transcription of the NR gene was downregulated (Fig. 7d). A possible explanation for this result was that down-regulation of NR could alleviate ammonium accumulation. However, the activity of the NR enzyme was not significantly affected by glufosinate (Fig. 5d), indicating that post-translational modifications were more important for the regulation of NR activity. It has been reported that in the process of post-translational modification, NR appears to be regulated by redox mechanisms (Franco et al. 1987) rather than by phosphorylation and 14-3-3 binding (Pozuelo et al. 2001). Our previous analysis has demonstrated that glufosinate reduced transcription of photosynthesis-related genes in C. vulgaris to impair carbon (C) assimilation (Qian et al. 2008). In this study, we demonstrated that nitrogen (N) assimilation was also disturbed by glufosinate, based upon the analysis in the transcripts of key genes in nitrate assimilation (GS and NR). As microalgae process an
Effects of glufosinate on the transcription of key genes involved in nitrate assimilation Figure 7 shows the effects of glufosinate on the relative abundance of NRT, NR, GS and GltD transcripts in P. tricornutum after 96 h. Consistent with the enzymatic activities (Fig. 5), the abundance of NRT and GltD increased to 160 and 170 % of the control, respectively (Fig. 7a, b), and the GS transcript decreased to 60 % of the control
123
The effect of glufosinate on nitrogen assimilation
1437
Fig. 7 Effects of glufosinate on the transcription of NRT, GltD, GS and NR in Phaeodactylum tricornutum after 96 h. Asterisk and double asterisk represent statistically significant differences when compared with the control (without glufosinate exposure) at p \ 0.05 and at p \ 0.01, respectively
intricate regulatory machinery to coordinate C and N assimilation by balancing C and N assimilation, we, therefore, speculated that glufosinate disturbed nitrogen metabolism and eventually abolished the C/N balance directly or indirectly.
Conclusions Here, we examined the effects of short-term glufosinate exposure on nitrogen assimilation in P. tricornutum, and these experiments reveal a toxicity mechanism that occurs in marine diatoms in response to glufosinate. It was demonstrated that glufosinate inhibits GS transcription and activity to cause ammonium accumulation and a decrease in Gln, although the diatoms up-regulated nitrogen assimilation by increasing the expression and activities of key enzymes (NRT, GOGAT) to resist glufosinate systemically. Glufosinate disturbed nitrogen metabolism and might abolish the C/N balance directly or indirectly to affect photosynthesis and carbon assimilation in microalgae. Therefore, glufosinate caused a ROS burst and disrupted the chloroplast ultrastructure to affect photosynthesis. Acknowledgments This work was financially supported by the National Basic Research Program of China (No. 2010CB126100) and Supported by Program for Changjiang Scholars and Innovative Research Team in University (IRT13096).
Conflict of interest of interest.
The authors declare that they have no conflict
References Ahn IP (2008) Glufosinate ammonium-induced pathogen inhibition and defense responses culminate in disease protection in bartransgenic rice. Plant Physiol 146:213–217 Allen AE, Vardi A, Bowler C (2006) An ecological and evolutionary context for integrated nitrogen metabolism and related signaling pathways in marine diatoms. Curr Opin Plant Biol 9:264–273 Archibald JM, Keeling PJ (2002) Recycled plastids: a ‘green movement’ in eukaryotic evolution. Trends Genet 18:577–584 Barhoumi Z, Djebali W, Chaı¨bi W, Abdelly C, Smaoui A (2007) Salt impact on photosynthesis and leaf ultrastructure of Aeluropus littoralis. J Plant Res 120:529–537 Barrios-Llerena ME, Pritchard JC, Kerr LE et al (2011) The use of a novel quantitation strategy based on Reductive Isotopic DiEthylation (RIDE) to evaluate the effect of glufosinate on the unicellular algae Ostreococcus tauri. J Proteomics 74:2798–2809 Blackwell R, Murray A, Lea P (1987) Inhibition of photosynthesis in barley with decreased levels of chloroplastic glutamine synthetase activity. J Exp Bot 38:1799–1809 Bu¨bl W, Langelu¨ddeke P (1984) Basta-ein modernes Herbizid fu¨r den Weinbau. Der Dt Weinbau 18:850–851 Coetzer E, Al-Khatib K (2001) Photosynthetic inhibition and ammonium accumulation in Palmer amaranth after glufosinate application. Weed Sci 49:454–459 Djebali W, Zarrouk M, Brouquisse R, El Kahoui S, Limam F, Ghorbel M, Chaı¨bi W (2005) Ultrastructure and lipid alterations induced by cadmium in tomato (Lycopersicon esculentum) chloroplast membranes. Plant Biol 7:358–368
123
1438 Duan F, Zhang M, Fan S, Duan J, Li Y, Liang C (2003) Effects of glufosinate on GS activity and photosynthetic function of bartransgenic rice. Mol Plant 29:530–534 (in Chinese) Fernandez E, Galvan A (2008) Nitrate assimilation in Chlamydomonas. Eukaryot Cell 7:555–559 Fischer P, Klein U (1988) Localization of nitrogen-assimilating enzymes in the chloroplast of Chlamydomonas reinhardtii. Plant Physiol 88:947–952 Franco AR, Ca´rdenas J, Ferna´ndez E (1987) Involvement of reversible inactivation in the regulation of nitrate reductase enzyme levels in Chlamydomonas reinhardtii. Plant Physiol 84:665–669 Haimovich-Dayan M, Garfinkel N, Ewe D, Marcus Y, Gruber A, Wagner H, Kroth PG, Kaplan A (2013) The role of C4 metabolism in the marine diatom Phaeodactylum tricornutum. New Phytol 197:177–185 Lepetit B, Volke D, Szabo M et al (2007) Spectroscopic and molecular characterization of the oligomeric antenna of the diatom Phaeodactylum tricornutum. Biochemistry 46:9813–9822 Lesser MP (2006) Oxidative stress in marine environments: biochemistry and physiological ecology. Annu Rev Physiol 68:253–278 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCT method. Methods 25:402–408 Logusch EW, Walker DM, McDonald JF, Franz JE (1991) Inhibition of plant glutamine synthetases by substituted phosphinothricins. Plant Physiol 95:1057–1062 Manderscheid R, Wild A (1986) Studies on the mechanism of inhibition by phosphinothricin of glutamine synthetase isolated from Triticum aestivum. J Plant Physiol 123:135–142 Miller AJ, Fan X, Shen Q, Smith SJ (2008) Amino acids and nitrate as signals for the regulation of nitrogen acquisition. J Exp Bot 59:111–119 Niu L, Gui W, Zhu G (2010) The degradation of glufosinate in water and toxicity to aquatic organism. Acta Agric Zhejiangensis 22:485–490 (in Chinese) Owens TG (1986) Light-harvesting function in the diatom Phaeodactylum tricornutum II. Distribution of excitation energy between the photosystems. Plant Physiol 80:739–746 Pozuelo M, MacKintosh C, Galva´n A, Ferna´ndez E (2001) Cytosolic glutamine synthetase and not nitrate reductase from the green alga Chlamydomonas reinhardtii is phosphorylated and binds 14-3-3 proteins. Planta 212:264–269 Pyszniak AM, Gibbs SP (1992) Immunocytochemical localization of photosystem I and the fucoxanthin-chlorophylla/c light-harvesting complex in the diatom Phaeodactylum tricornutum. Protoplasma 166:208–217 Qian H, Chen W, Sheng GD, Xu X, Liu W, Fu Z (2008) Effects of glufosinate on antioxidant enzymes, subcellular structure, and
123
J. Xie et al. gene expression in the unicellular green alga Chlorella vulgaris. Aquat Toxicol 88:301–307 Qian H, Yu S, Sun Z, Xie X, Liu W, Fu Z (2010) Effects of copper sulfate, hydrogen peroxide and N-phenyl-2-naphthylamine on oxidative stress and the expression of genes involved photosynthesis and microcystin disposition in Microcystis aeruginosa. Aquat Toxicol 99:405–412 Qian H, Peng X, Han X, Ren J, Sun L, Fu Z (2013a) Comparison of the toxicity of silver nanoparticles and silver ion on the growth of terrestrial plant model Arabidopsis thaliana. J Environ SciChina. 25:1947–1955 Qian H, Sun Z, Sun L, Jiang Y, Wei Y, Xie J, Fu Z (2013b) Phosphorus availability changes chromium toxicity in the freshwater alga Chlorella vulgaris. Chemosphere 93:885–891 Reddy KN, Hoagland RE, Zablotowicz RM (2001) Effect of glyphosate on growth, chlorophyll, and nodulation in glyphosate-resistant and susceptible soybean (Glycine max) varieties. J New Seeds 2:37–52 Rojano-Delgado AM, Priego-Capote F, Barro F, Luque de Castro MD, De Prado R (2013) Liquid chromatography-diode array detection to study the metabolism of glufosinate in Triticum aestivum T-590 and influence of the genetic modification on its resistance. Phytochemistry 96:117–122 Royer A, Beguin S, Sochor H, Communal PY (2000) Determination of glufosinate ammonium and its metabolite (AE F064619 and AE F061517) residues in water by gas chromatography with tandem mass spectrometry after ion exchange cleanup and derivatization. J Agric Food Chem 48:5184–5189 Schwerdtle F, Bieringer H, Finke M (1981) HOE 39866-ein neues nicht selektives Blattherbizid. Z Pflanzenkrankheiten Pflanzenschutz 9:431–440 Shaner DL (2000) The impact of glyphosate-tolerant crops on the use of other herbicides and on resistance management. Pest Manag Sci 56:320–326 Solomonson LP, Barber MJ (1990) Assimilatory nitrate reductase: functional properties and regulation. Annu Rev Plant Biol 41:225–253 Wendler C, Barniske M, Wild A (1990) Effect of phosphinothricin (glufosinate) on photosynthesis and photorespiration of C3 and C4 plants. Photosynth Res 24:55–61 Whitton BA, Kelly MG (1995) Use of algae and other plants for monitoring rivers. Aust J Ecol 20:45–56 Yamauchi Y, Furutera A, Seki K, Toyoda Y, Tanaka K, Sugimoto Y (2008) Malondialdehyde generated from peroxidized linolenic acid causes protein modification in heat-stressed plants. Plant Physiol Biochem 46:786–793 Yang H, Duan S (2010) The ecological toxic effects of dibutyl phthalate on Phaeodactylum tricornutum. Ecol Environ Sci 19:2155–2159 (in Chinese)
The effect of glufosinate on nitrogen assimilation at the physiological, biochemical and molecular levels in Phaeodactylum tricornutum Jun Xie • Xiaocui Bai • Yali Li • Chongchong Sun Haifeng Qian • Zhengwei Fu
•
Accepted: 27 June 2014 / Published online: 14 July 2014 Ó Springer Science+Business Media New York 2014
Abstract This study investigated the effects of glufosinate, a widely used herbicide, on the marine diatom Phaeodactylum tricornutum through short-term toxicity tests at the physiological and gene transcriptional levels. Glufosinate (4 mg L-1) decreased the amount of pigments but increased reactive oxygen species (ROS) and malondialdehyde levels. As a glutamine synthetase (GS) inhibitor, glufosinate affected the transcripts and activities of key enzymes related to nitrogen assimilation. Transcript levels of GS and nitrate reductase (NR) in P. tricornutum decreased to only 57 and 26 % of the control. However, transcript levels of nitrate transporter (NRT) and the small subunit of glutamate synthase (GltD) were 1.79 and 1.76 times higher than that of the control. The activities of NRT, GS and GOGAT were consistent with gene expression except for NR, which was regulated mainly by posttranslational modification. Furthermore, the results of electron microscopy showed that chloroplast structure was disrupted in response to glufosinate exposure. These results demonstrated that glufosinate first disturbed nitrogen metabolism and caused a ROS burst, which disrupted chloroplast ultrastructure. Ultimately, the growth of P. tricornutum was greatly inhibited by glufosinate.
J. Xie Y. Li H. Qian Z. Fu College of Biological and Environmental Engineering, Zhejiang University of Technology, Hangzhou 310032, People’s Republic of China X. Bai C. Sun H. Qian (&) Department of Food Science and Technology, Zhejiang University of Technology, Hangzhou 310032, People’s Republic of China e-mail: [email protected]
123
Keywords Phaeodactylum tricornutum Glufosinate Nitrogen assimilation Electron microscopy Real-time PCR
Introduction Nitrogen is a macronutrient that is necessary for life and is involved in building fundamental molecules: nucleotides, proteins, numerous other metabolites and cellular components. Nitrogen metabolism is not only one of the basic processes of plant physiology but also part of the global chemical cycles. Nitrogen assimilation in phytoplankton plays a direct role in amino acid synthesis and conversion through the reduction of nitrate. This process involves nitrate sensing and signaling, nitrate/nitrite transport, nitrate/nitrite reduction and ammonium incorporation into carbon skeletons (Fischer and Klein 1988; Allen et al. 2006; Fernandez and Galvan 2008). The simplified process of nitrate assimilation in diatoms is briefly shown in Fig. 1. Several key components involve in the process, including nitrate transporter (NRT), nitrate reductase (NR), glutamine synthetase (GS) and glutamate synthase (GOGAT). Glufosinate is an active ingredient of non-selective herbicides (Schwerdtle et al. 1981; Bu¨bl and Langelu¨ddeke 1984). As a phosphonic acid analog of glutamate, it potently inhibits GS, a key enzyme in nitrate assimilation, by competing with glutamate for binding sites in an irreversible way (Manderscheid and Wild 1986; Logusch et al. 1991). This process leads to the accumulation of toxic ammonium and decreases L-glutamine (Gln) synthesis in the cell. Previous studies demonstrated that glufosinate applied at 410 g ha-1 enhanced the amount of ammonium in amaranth after 30 min of exposure (Coetzer and Al-Khatib
The effect of glufosinate on nitrogen assimilation
1431
Fig. 1 Brief overview of nitrate assimilation pathways in diatoms (modified from Fernandez and Galvan 2008)
2001). Furthermore, the block of Gln synthesis decreased the levels of other amino acids, which are precursors in the chemical synthesis of nucleotides and proteins (RojanoDelgado et al. 2013). Moreover, glufosinate also detrimentally affected photosynthesis and photorespiration by disturbing chloroplast structure, decreasing the transcript abundance of photosynthetic genes and inhibiting the transamination of glyoxylate to glycine in photorespiration (Blackwell et al. 1987; Wendler et al. 1990; Qian et al. 2008). Nevertheless, there is an extensive body of literature dealing with the phytotoxicity of glufosinate in land plants, only a few publications have analyzed its impact on aquatic organisms. Studies investigating the potential effects of glufosinate on phytoplankton are particularly valuable due to its worldwide usage, the marketization of genetically modified crops that are resistant to glufosinate (Shaner 2000), its long half-life in the environment (Niu et al. 2010) (in three buffer solutions with pH values of 5.0, 6.9 and 9.3, the half-lives were 433, 693 and 533 days, respectively) and its high solubility in water (Royer et al. 2000) (approximately 1,370 g L-1). Phytoplankton are the primary producers in the food chain, and they are more sensitive to contaminants than fish and invertebrates (Whitton and Kelly 1995). Diatoms, an important type of marine phytoplankton which is the basis for the world’s shortest and most energy-efficient food webs (Allen et al. 2006), play a pivotal role in the global carbon cycle, and it is estimated that they perform 20 % of global CO2 assimilation (Haimovich-Dayan et al. 2013). Phaeodactylum tricornutum is an excellent model diatom species with which to study fundamental biological processes such as
photosynthesis, carbon and nitrogen metabolism and nutrient deficiency, among others, due to its ease in handling in microbiological experiments and the detailed molecular biological information available for the species. The aim of the present study was to assess the effects of glufosinate on the regulation of nitrate assimilation in P. tricornutum.
Materials and methods Culture conditions P. tricornutum were obtained from the Institute of Hydrobiology of the Chinese Academy of Sciences. Batch cultures were grown in Erdschreiber’s medium (http://web. biosci.utexas.edu/utex/media.aspx) at 22 ± 0.5 °C under a 12 h light: 12 h dark cycle with light provided by coolwhite fluorescent bulbs (&54 lE m-2 s-1). The cell density of cultures was estimated spectrophotometrically at an optical density of 680 nm (OD680). A calibration curve of cell density was constructed using a control diatom culture and a hemocytometer and was expressed as a function of OD680. The regression equation between cell density (y in 9 105 cells mL-1) and OD680 (x) was y = 100x ? 1.12 (R2 = 99.08). Glufosinate (Basta, 10 % solution) was purchased from Sangon (Shanghai, China), and the stock solutions were diluted in Milli-Q water. Cells in the exponential growth phase were used for each experiment, and the initial cell density for the experiment was OD680 = 0.09 (approximately 9.12 9 105 cells mL-1). The experiments were repeated at least three times, and
123
1432
J. Xie et al.
three replicates were performed for each bioassay. The samples were collected after 48 and 96 h for use in different tests. Pigment, reactive oxygen species and malondialdehyde assays A 10-mL aliquot of each culture was collected to extract pigments from P. tricornutum after 96 h of glufosinate exposure. The pellet was soaked in 5 mL acetone (90 %, v/v) and stored (-4 °C) for 24 h in dark. The supernatants were measured by spectrophotometry in microplate reader according to the method of Yang and Duan (2010). The quantities (lg/L) of chlorophyll a, chlorophyll c and carotenoid were calculated using the equations, respectively: Chla ¼ ½11:85ðOD664 OD750 Þ 1:54ðOD647 OD750 Þ 0:08ðOD630 OD750 Þ v=ðV LÞ Chlc ¼ ½24:52ðOD630 OD750 Þ 1:67ðOD664 OD750 Þ 7:6ðOD647 OD750 Þ v=ðV LÞ Carotenoid ¼ ð4:7 OD440 1:38 OD662 5:48 OD644 Þ v=ðV LÞ The v (mL) and V(L) stand for the volume of extract and microalgae, respectively, and L (cm) is the optical distance of cuvette. The reactive oxygen species (ROS) were measured using a fluorescent probe, 20 ,70 -dichlorofluorescin diacetate (DCFH-DA), following the instructions provided with the ROS Assay Kit (Beyotime Institute of Biotechnology, Haimen, China). Briefly, DCFH-DA reacts with ROS to form the fluorescent product DCF, which can be measured with a fluorescence microplate reader with an excitation wavelength at 485 nm and an emission wavelength at 525 nm (TECAN GENIOS, USA). The lipid peroxidation level was determined in terms of malondialdehyde (MDA) quantitation using the method provided with the MDA kit (Beyotime Institute of Biotechnology, China).
The activities of NRT, NR, GS and GOGAT The nitrate transporter activity in the diatoms was reflected by the absorptive capacity of nitrate. Dionex ICS-2000 Reagent-FreeTM Ion Chromatography (RFIC) was used to measure the nitrate level in the medium supernatant with or without diatoms after culturing for 96 h, as described previously (Qian et al. 2013a, b). The activities of NR, GS and GOGAT were measured according to the procedures provided with the NR, GS and GOGAT kits (NR & GS kit, Nanjing Jiancheng Bioengineering Institute, China;
123
GOGAT kit, Suzhou Comin Biotechnology Company, China), respectively. The basic principles of the kits were shown as follows: NR was estimated by optical density at 540 nm absorbance due to red azo-compound formation. Glutamine was converted into glutamyl-c-hydroxamate under GS catalysis, which was estimated by optical density at 550 nm absorbance. GOGAT was measured spectrophotometrically, monitoring absorbance due to NADH at 340 nm. The activity of each enzyme was expressed on a protein basis. The protein concentration was determined using bicinchoninic acid (BCA protein kit, Sangon Company, China).
Electron microscopy analysis Samples from the control and glufosinate-treated diatoms were fixed with 1.0 % OsO4 and embedded in epoxy resin. The samples were then cut into ultra-thin sections (70–90 nm) using a Reichert Ultracuts ultramicrotome and stained with uranyl acetate followed by lead citrate. Transmission electron microscopy (TEM) using a JEM1230 microscope (JEOL Ltd., Tokyo, Japan) was used to observe the substructure of the diatoms.
Gene transcription analysis The transcript levels of key genes involved in nitrate assimilation were detected by real-time PCR. In the present study, we selected NRT, NR, GS and the small subunit of glutamate synthase (GltD), which encodes NRT, NR, GS and GOGAT, respectively. Total RNA was extracted from diatom cells using RNAiso (Takara Company, Dalian, China) according to the manufacturer’s instructions. The RNA concentration and purity were measured with a spectrophotometer at 260 and 280 nm. The RNA integrity was evaluated by electrophoresis in a 1 % agarose formaldehyde gel. RNA was reverse-transcribed into cDNA using a reverse transcriptase kit (Toyobo, Tokyo, Japan). Real-time quantitative PCR was performed with an Eppendorf Master CyclerÒ ep RealPlex4 (WesselingBerzdorf, Germany), and a reaction mixture for each PCR run was prepared with the SYBR Green PCR reagents (Toyobo, Tokyo, Japan). The following PCR protocol was used with two steps : one denaturation step at 95 °C for 1 min and 40 cycles of 95 °C for 15 s, followed by 60 °C for 1 min. Actin was used as a housekeeping gene to standardize the results by eliminating variations in the quantity and quality of the mRNA and cDNA. The relative quantification of gene transcription among the treatment groups was achieved using the 2-DDCt method (Livak and
The effect of glufosinate on nitrogen assimilation Table 1 Sequences of the primer pairs in Phaeodactylum tricornutum for real-time PCR
1433
Gene orientation
Sequence
(50 –30 )
Actin
Forward
GACTCCACCTTCCAGACCATTA
NRT NR GS GltD
Reverse
GACCCTCCAATCCAAACAGAG
Forward
CCGACCAAGATGATAAGGCTAC
Reverse
TGGCAAACCAAATGAAGAAG
Forward
AACCCACAAGACCCTACACAAA
Reverse
AGGAAAGTTAGCAGCCCATTC
Forward
ACGACTTTGCCTTTCCCATTAT
Reverse
CCTTTCCGAGGTAGGTGGATAC
Forward
GTATGGCGGCTTCGTGTAAC
Reverse
GGGGAAAGACTGCTGAGATTAT
GI
195027 219112462 55845942 219125250 219118704
Schmittgen 2001). The primer pairs designed to amplify the tested genes are listed in Table 1.
Data analysis The data are presented as the mean ± standard error of the mean (SEM) and were compared using a one-way analysis of variance (ANOVA). Values were considered significantly different when the probability (p) was \0.05. All statistical analysis was performed using the StatView 5.0 program (Statistical Analysis Systems Institute, Cary, NC).
Results and discussion Effects of glufosinate on diatom growth and quantity of pigment As shown in Fig. 2, glufosinate did not affect diatom growth when it was present at low levels (0.5 and 1 mg/L); however, it inhibited P. tricornutum growth when the tested concentration was higher than 2 mg/L. The percentage of growth inhibition in diatoms increased to more than 30 % and increased continually with an increase in exposure time. After 96 h of exposure, the inhibition ratios reached approximately 47.7, 70.9, 78.1 and 78.7 % in the groups treated with 4, 6, 8 and 16 mg/L, respectively. Based on this experiment, to achieve acute toxicity, 4 mg/L glufosinate was chosen as the tested concentration. The amounts of chlorophyll and carotenoid after 96 h of glufosinate exposure are shown in Fig. 3. After 96 h, the amounts of chlorophyll a, chlorophyll c and carotenoids decreased significantly to 82.8, 69.6 and 55.1 % of the control, respectively. It is known that lipid-soluble pigments are intimately involved in all aspects of primary photosynthesis, including light harvesting, energy transfer and light/energy conversion (Owens 1986). Thus, the
Fig. 2 Effects of different concentrations of glufosinate on Phaeodactylum tricornutum growth
decrease in the amount of pigment indicated that the photosynthesis pathway was blocked and the synthesis of energy for metabolism was decreased. Similar experiments performed on soybeans and rice also demonstrated that pigment production was severely inhibited by glufosinate treatment (Reddy et al. 2001; Duan et al. 2003). Effects of glufosinate on the activities of GS, NRT, GOGAT and NR As the target enzyme of glufosinate, GS activity decreased rapidly after 96 h of herbicide application and was downregulated to 60 % of the control (Fig. 4a), which is similar to the findings of Barrios-Llerena et al. (2011) that GS activity was found to be significantly down regulated in the unicellular algae Ostreococcus tauri in the presence of glufosinate. The primary effect of GS inhibition by glufosinate is metabolically reflected by ammonium accumulation in vivo and the drastic decrease in Gln. In
123
1434
J. Xie et al.
Fig. 3 Effects of glufosinate on the amount of chlorophyll a, chlorophyll c and carotenoid in Phaeodactylum tricornutum after 96 h. Asterisk and double asterisk represent statistically significant differences when compared with the control (without glufosinate exposure) at p \ 0.05 and at p \ 0.01, respectively
Fig. 4 Effects of glufosinate on the quantity of ROS and MDA in Phaeodactylum tricornutum after 96 h. Asterisk and double asterisk represent statistically significant differences when compared with the control (without glufosinate exposure) at p \ 0.05 and at p \ 0.01, respectively
addition to GS inhibition, the increase of both NRT and GOGAT activities were observed after glufosinate treatment (Fig. 4b, c); however, NR activity was not significantly affected (Fig. 4d). Based on these results, it is speculated that GS inhibition could drastically decrease Gln, which resulted in an amino acid deficiency (RojanoDelgado et al. 2013). Furthermore, in addition to its fundamental role in nitrogen assimilation and detoxification,
123
GS may potentially integrate a broad N-signaling network in plants by mediating amino acid synthesis; therefore, the internal amino acid pool functions as a signal to regulate N uptake and assimilation (Miller et al. 2008). To deal with the shortage of amino acids caused by glufosinate exposure, NRT activity was induced to transport more nitrate from the medium and enhance nitrogen assimilation. This allows the synthesis of an adequate amount of amino acids
The effect of glufosinate on nitrogen assimilation
1435
Fig. 5 Effects of glufosinate on the activities of GS (a), NRT (b), GOGAT (c) and NR (d) in Phaeodactylum tricornutum after 96 h. Asterisk and double asterisk represent statistically significant differences when compared with the control (without glufosinate exposure) at p \ 0.05 and at p \ 0.01, respectively
related to organism metabolism or defense mechanisms, such as those needed for the synthesis of some antioxidant enzymes. However, the ability to convert nitrate into nitrite was not noticeably affected.
Effects of glufosinate on ROS and MDA production The production of MDA, a byproduct of lipid peroxidation, increased to approximately 10-fold of the control after 96 h of glufosinate exposure (Fig. 5a). The fluorescence intensity of DCF reached 7-fold of the control (Fig. 5b), indicating a ROS burst after glufosinate exposure. In microalgae, ROS include the superoxide radical (O2-), hydrogen peroxide (H2O2) and the hydroxyl radical (OH) and are produced through various metabolic pathways localized in mitochondria, chloroplasts and peroxisomes (Lesser 2006). It was reported that higher levels of ammonium in the cell induce perturbations of the electron transport systems of chloroplasts and mitochondria generating free radicals and inducing an oxidative stress response (Ahn 2008). Our previous study demonstrated that glufosinate decreased the abundance of photosynthesis-related genes to allow the accumulation of superfluous electrons, which combined with molecular oxygen to produce ROS in the chloroplast (Qian et al. 2008). The overproduction of ROS destroyed the integrity of the cellular lipid membrane, which could be evaluated based on the increase in the quantity of MDA. This increase is considered to be a symptom of environmental stress in several organisms (Yamauchi et al. 2008; Qian et al. 2010).
Effects of glufosinate on the subcellular structure of diatom cells In diatom, many cellular processes occur in plastids, e.g., occurrence of photosynthesis in the thylakoid membrane. There are many common features of chloroplast in diatoms and the other plants. But the membrane topology and pigment composition make the chloroplast in diatoms unique (Lepetit et al. 2007). Diatoms possess a chloroplast envelope with four membranes and the diatom thylakoid membranes do not differentiate into stroma and grana thylakoids but are arranged in groups of three (Archibald and Keeling 2002; Pyszniak and Gibbs 1992). The pigment composition of diatoms differs to that of vascular plants that they use Chl c as accessory pigment rather than Chl b (Lepetit et al. 2007). Because both a burst of oxidative damage (increase in ROS and MDA) and a decrease in the amount of pigment after glufosinate treatment were observed, we hypothesized that changes in the chloroplast ultrastructure may have occurred and this can be supported by the transmission electron microscopy analysis, which demonstrated that the chloroplast substructure was abnormal in the glufosinatetreated group. Compared with the highly organized lamellae in the control (Fig. 6a, c), the lamellae in glufosinate-treated cells were arranged loosely and randomly, which indicated that glufosinate damaged the thylakoids (Fig. 6b, d). This finding is in agreement with our previous report (Qian et al. 2008), and it indicates that the thylakoid membrane may be more sensitive to environmental stress
123
1436
J. Xie et al.
Fig. 6 Effects of glufosinate on the ultrastructure of Phaeodactylum tricornutum after 96 h. a cell structure in the control, b cell structure in a sample treated with glufosinate, c a magnified image of the area
within the rectangle in (a), d a magnified image of the area within the rectangle in (b). chl chloroplast, thy thylakoid, osm osmiophilic body
because many external factors, such as metals and salts, are able to destroy it (Barhoumi et al. 2007; Qian et al. 2013a). Furthermore, we also observed more osmiophilic bodies after glufosinate treatment (Fig. 6b, d), which indicated that lipids were released from the destroyed thylakoid membrane, as observed under salt and Cd stress (Djebali et al. 2005; Barhoumi et al. 2007). There is no doubt that the structural damage to the chloroplasts induced by glufosinate was accompanied by a reduction in photosynthetic and nitrogen assimilation activities.
(Fig. 7c). NR is a crucial rate-limiting enzyme in nitrogen assimilation (Solomonson and Barber 1990, Allen et al. 2006), and the transcription of the NR gene was downregulated (Fig. 7d). A possible explanation for this result was that down-regulation of NR could alleviate ammonium accumulation. However, the activity of the NR enzyme was not significantly affected by glufosinate (Fig. 5d), indicating that post-translational modifications were more important for the regulation of NR activity. It has been reported that in the process of post-translational modification, NR appears to be regulated by redox mechanisms (Franco et al. 1987) rather than by phosphorylation and 14-3-3 binding (Pozuelo et al. 2001). Our previous analysis has demonstrated that glufosinate reduced transcription of photosynthesis-related genes in C. vulgaris to impair carbon (C) assimilation (Qian et al. 2008). In this study, we demonstrated that nitrogen (N) assimilation was also disturbed by glufosinate, based upon the analysis in the transcripts of key genes in nitrate assimilation (GS and NR). As microalgae process an
Effects of glufosinate on the transcription of key genes involved in nitrate assimilation Figure 7 shows the effects of glufosinate on the relative abundance of NRT, NR, GS and GltD transcripts in P. tricornutum after 96 h. Consistent with the enzymatic activities (Fig. 5), the abundance of NRT and GltD increased to 160 and 170 % of the control, respectively (Fig. 7a, b), and the GS transcript decreased to 60 % of the control
123
The effect of glufosinate on nitrogen assimilation
1437
Fig. 7 Effects of glufosinate on the transcription of NRT, GltD, GS and NR in Phaeodactylum tricornutum after 96 h. Asterisk and double asterisk represent statistically significant differences when compared with the control (without glufosinate exposure) at p \ 0.05 and at p \ 0.01, respectively
intricate regulatory machinery to coordinate C and N assimilation by balancing C and N assimilation, we, therefore, speculated that glufosinate disturbed nitrogen metabolism and eventually abolished the C/N balance directly or indirectly.
Conclusions Here, we examined the effects of short-term glufosinate exposure on nitrogen assimilation in P. tricornutum, and these experiments reveal a toxicity mechanism that occurs in marine diatoms in response to glufosinate. It was demonstrated that glufosinate inhibits GS transcription and activity to cause ammonium accumulation and a decrease in Gln, although the diatoms up-regulated nitrogen assimilation by increasing the expression and activities of key enzymes (NRT, GOGAT) to resist glufosinate systemically. Glufosinate disturbed nitrogen metabolism and might abolish the C/N balance directly or indirectly to affect photosynthesis and carbon assimilation in microalgae. Therefore, glufosinate caused a ROS burst and disrupted the chloroplast ultrastructure to affect photosynthesis. Acknowledgments This work was financially supported by the National Basic Research Program of China (No. 2010CB126100) and Supported by Program for Changjiang Scholars and Innovative Research Team in University (IRT13096).
Conflict of interest of interest.
The authors declare that they have no conflict
References Ahn IP (2008) Glufosinate ammonium-induced pathogen inhibition and defense responses culminate in disease protection in bartransgenic rice. Plant Physiol 146:213–217 Allen AE, Vardi A, Bowler C (2006) An ecological and evolutionary context for integrated nitrogen metabolism and related signaling pathways in marine diatoms. Curr Opin Plant Biol 9:264–273 Archibald JM, Keeling PJ (2002) Recycled plastids: a ‘green movement’ in eukaryotic evolution. Trends Genet 18:577–584 Barhoumi Z, Djebali W, Chaı¨bi W, Abdelly C, Smaoui A (2007) Salt impact on photosynthesis and leaf ultrastructure of Aeluropus littoralis. J Plant Res 120:529–537 Barrios-Llerena ME, Pritchard JC, Kerr LE et al (2011) The use of a novel quantitation strategy based on Reductive Isotopic DiEthylation (RIDE) to evaluate the effect of glufosinate on the unicellular algae Ostreococcus tauri. J Proteomics 74:2798–2809 Blackwell R, Murray A, Lea P (1987) Inhibition of photosynthesis in barley with decreased levels of chloroplastic glutamine synthetase activity. J Exp Bot 38:1799–1809 Bu¨bl W, Langelu¨ddeke P (1984) Basta-ein modernes Herbizid fu¨r den Weinbau. Der Dt Weinbau 18:850–851 Coetzer E, Al-Khatib K (2001) Photosynthetic inhibition and ammonium accumulation in Palmer amaranth after glufosinate application. Weed Sci 49:454–459 Djebali W, Zarrouk M, Brouquisse R, El Kahoui S, Limam F, Ghorbel M, Chaı¨bi W (2005) Ultrastructure and lipid alterations induced by cadmium in tomato (Lycopersicon esculentum) chloroplast membranes. Plant Biol 7:358–368
123
1438 Duan F, Zhang M, Fan S, Duan J, Li Y, Liang C (2003) Effects of glufosinate on GS activity and photosynthetic function of bartransgenic rice. Mol Plant 29:530–534 (in Chinese) Fernandez E, Galvan A (2008) Nitrate assimilation in Chlamydomonas. Eukaryot Cell 7:555–559 Fischer P, Klein U (1988) Localization of nitrogen-assimilating enzymes in the chloroplast of Chlamydomonas reinhardtii. Plant Physiol 88:947–952 Franco AR, Ca´rdenas J, Ferna´ndez E (1987) Involvement of reversible inactivation in the regulation of nitrate reductase enzyme levels in Chlamydomonas reinhardtii. Plant Physiol 84:665–669 Haimovich-Dayan M, Garfinkel N, Ewe D, Marcus Y, Gruber A, Wagner H, Kroth PG, Kaplan A (2013) The role of C4 metabolism in the marine diatom Phaeodactylum tricornutum. New Phytol 197:177–185 Lepetit B, Volke D, Szabo M et al (2007) Spectroscopic and molecular characterization of the oligomeric antenna of the diatom Phaeodactylum tricornutum. Biochemistry 46:9813–9822 Lesser MP (2006) Oxidative stress in marine environments: biochemistry and physiological ecology. Annu Rev Physiol 68:253–278 Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2-DDCT method. Methods 25:402–408 Logusch EW, Walker DM, McDonald JF, Franz JE (1991) Inhibition of plant glutamine synthetases by substituted phosphinothricins. Plant Physiol 95:1057–1062 Manderscheid R, Wild A (1986) Studies on the mechanism of inhibition by phosphinothricin of glutamine synthetase isolated from Triticum aestivum. J Plant Physiol 123:135–142 Miller AJ, Fan X, Shen Q, Smith SJ (2008) Amino acids and nitrate as signals for the regulation of nitrogen acquisition. J Exp Bot 59:111–119 Niu L, Gui W, Zhu G (2010) The degradation of glufosinate in water and toxicity to aquatic organism. Acta Agric Zhejiangensis 22:485–490 (in Chinese) Owens TG (1986) Light-harvesting function in the diatom Phaeodactylum tricornutum II. Distribution of excitation energy between the photosystems. Plant Physiol 80:739–746 Pozuelo M, MacKintosh C, Galva´n A, Ferna´ndez E (2001) Cytosolic glutamine synthetase and not nitrate reductase from the green alga Chlamydomonas reinhardtii is phosphorylated and binds 14-3-3 proteins. Planta 212:264–269 Pyszniak AM, Gibbs SP (1992) Immunocytochemical localization of photosystem I and the fucoxanthin-chlorophylla/c light-harvesting complex in the diatom Phaeodactylum tricornutum. Protoplasma 166:208–217 Qian H, Chen W, Sheng GD, Xu X, Liu W, Fu Z (2008) Effects of glufosinate on antioxidant enzymes, subcellular structure, and
123
J. Xie et al. gene expression in the unicellular green alga Chlorella vulgaris. Aquat Toxicol 88:301–307 Qian H, Yu S, Sun Z, Xie X, Liu W, Fu Z (2010) Effects of copper sulfate, hydrogen peroxide and N-phenyl-2-naphthylamine on oxidative stress and the expression of genes involved photosynthesis and microcystin disposition in Microcystis aeruginosa. Aquat Toxicol 99:405–412 Qian H, Peng X, Han X, Ren J, Sun L, Fu Z (2013a) Comparison of the toxicity of silver nanoparticles and silver ion on the growth of terrestrial plant model Arabidopsis thaliana. J Environ SciChina. 25:1947–1955 Qian H, Sun Z, Sun L, Jiang Y, Wei Y, Xie J, Fu Z (2013b) Phosphorus availability changes chromium toxicity in the freshwater alga Chlorella vulgaris. Chemosphere 93:885–891 Reddy KN, Hoagland RE, Zablotowicz RM (2001) Effect of glyphosate on growth, chlorophyll, and nodulation in glyphosate-resistant and susceptible soybean (Glycine max) varieties. J New Seeds 2:37–52 Rojano-Delgado AM, Priego-Capote F, Barro F, Luque de Castro MD, De Prado R (2013) Liquid chromatography-diode array detection to study the metabolism of glufosinate in Triticum aestivum T-590 and influence of the genetic modification on its resistance. Phytochemistry 96:117–122 Royer A, Beguin S, Sochor H, Communal PY (2000) Determination of glufosinate ammonium and its metabolite (AE F064619 and AE F061517) residues in water by gas chromatography with tandem mass spectrometry after ion exchange cleanup and derivatization. J Agric Food Chem 48:5184–5189 Schwerdtle F, Bieringer H, Finke M (1981) HOE 39866-ein neues nicht selektives Blattherbizid. Z Pflanzenkrankheiten Pflanzenschutz 9:431–440 Shaner DL (2000) The impact of glyphosate-tolerant crops on the use of other herbicides and on resistance management. Pest Manag Sci 56:320–326 Solomonson LP, Barber MJ (1990) Assimilatory nitrate reductase: functional properties and regulation. Annu Rev Plant Biol 41:225–253 Wendler C, Barniske M, Wild A (1990) Effect of phosphinothricin (glufosinate) on photosynthesis and photorespiration of C3 and C4 plants. Photosynth Res 24:55–61 Whitton BA, Kelly MG (1995) Use of algae and other plants for monitoring rivers. Aust J Ecol 20:45–56 Yamauchi Y, Furutera A, Seki K, Toyoda Y, Tanaka K, Sugimoto Y (2008) Malondialdehyde generated from peroxidized linolenic acid causes protein modification in heat-stressed plants. Plant Physiol Biochem 46:786–793 Yang H, Duan S (2010) The ecological toxic effects of dibutyl phthalate on Phaeodactylum tricornutum. Ecol Environ Sci 19:2155–2159 (in Chinese)
