Theriogenology xxx (2014) 1–7
Contents lists available at ScienceDirect
Theriogenology journal homepage: www.theriojournal.com
The endometrial expression of prostaglandin cascade components in lactating dairy cows fed different polyunsaturated fatty acids E. Dirandeh a, *, A. Towhidi b, Z. Ansari Pirsaraei a, T. Saberifar b, A. Akhlaghi c, A. Rezaei Roodbari b a
Department of Animal Science, Sari Agricultural Sciences and Natural Resources University, Sari, Iran Department of Animal Science, Faculty of Agricultural Science and Engineering, College of Agriculture and Natural Resources, University of Tehran, Karaj, Iran c Department of Animal Science, Shiraz University, Shiraz, Iran b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 24 May 2014 Received in revised form 1 September 2014 Accepted 10 September 2014
Feeding n-6 polyunsaturated fatty acids (PUFA) increases the endometrial percentages of linoleic and arachidonic acids (AA), enhances the synthesis of prostaglandin F2a (PGF2a), and improves uterine health. In contrary, the n-3 PUFA, eicosapentaenoic acid, and docosahexaenoic acid may play pivotal roles by suppressing the synthesis of uterine PGF2a, a component being centrally involved in the control of the bovine estrous cycle and in early embryo survival. The objectives of the present study were to determine the effect of feeding a diet enriched in either a-linolenic acid (n-3) or linolenic acid (n-6) on the uterine expression of genes related to prostaglandin cascade and uterine release of PGF2a (measured as 13, 14-dihydro-15-keto PGF2a [PGFM]). From calving to 60 days in milk, cows (n ¼ 24) were fed isonitrogenous, isocaloric, and isolipidic diets that differed in the ratio of n-3/n-6 PUFA. Treatments including palm oil ([PLM]; saturated FA, n ¼ 8), soybean whole roast ([SOY]; n-6, n ¼ 8), and linseed extruded ([LIN]; n-3, n ¼ 8). At 30 days in milk, the ovulatory cycles of cows were synchronized using 2 injections of PGF2a with a 14-day interval. On day 15 postovulation, cows were injected with oxytocin and blood samples were collected to monitor the uterine release of PGF2a (measured as PGFM) and uterine endometrial biopsies were prepared to evaluate the expression of genes related to prostaglandin cascade (prostaglandin F synthase [PGFS], prostaglandin E synthase [PGES], prostaglandin endoperoxide synthase-2 [PGHS-2]), phospholipase A2 (PLA2), peroxisome proliferator-activated receptors [PPAR]). Results showed that uterine endometrial PPARd genes were higher in cows fed LIN (3.17-fold) compared with cows fed PLM or SOY (P < 0.05). The messenger RNA (mRNA) level of PGES in the LIN group was threefold as high as those found in SOY and PLM diets (P < 0.05). The mean relative gene expression of PLA2 and PGFS was increased in animals fed the SOY diet (2.4- and 1.7-fold, respectively) compared with LIN and PLM diets (P < 0.05). The expression of mRNA for the PGHS-2, PPAR-a, and PPAR-g was not influenced by the diet effect. Dietary inclusion of soy FAs was associated with an increase in the PGFM concentration, possibly through an increase in the expression of genes involved in prostaglandin cascade. The uterine concentration of PGFM, however, was decreased in cows fed diets containing n-3 FAs. Ó 2014 Elsevier Inc. All rights reserved.
Keywords: Endometrium PGES PGFS PLA2 PPAR Real-time PCR
* Corresponding author. Sari Agricultural sciences and Natural Resources University, Sari, Mazandaran 578, Iran. Tel.: þ981133687565; fax: þ981133682741. E-mail address: [email protected] (E. Dirandeh). 0093-691X/$ – see front matter Ó 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.theriogenology.2014.09.011
2
E. Dirandeh et al. / Theriogenology xxx (2014) 1–7
1. Introduction The endometrium plays a critical role in regulating the estrous cycle and establishment of pregnancy, primarily through the processing of arachidonic acid (AA) and synthesis of prostaglandin F2a (PGF2a) [1]. Studies on a variety of species have shown that dietary polyunsaturated fatty acids (PUFA) may modulate prostaglandin synthesis and metabolism [1,2]. The most biologically active two series prostaglandins are derived from AA, but the less active three series prostaglandins are enzymatically produced from eicosapentaenoic acid by the same enzymes [2]. The AA released by phospholipid hydrolysis is converted to prostaglandin endoperoxide synthase (PGHS)-2 prostaglandin H2 by PGHS, which is then converted to PGF by a reductase. Two forms of PGHS have been characterized, a constitutively expressed PGHS-1, and an induced PGHS-2 [3]. In cattle, the synthesis and activity of PGHS-2 must be attenuated to maintain pregnancy [4]. Peroxisome proliferator-activated receptors (PPAR) are a group of ligand-activated transcription factors regulating multiple physiologic processes [5]. MacLaren et al. [6] reported a comparable endometrial messenger RNA (mRNA) expression of PPAR-a and PPAR-d in cyclic and pregnant Holstein cows. Agonists of PPAR-d and PPAR-a had a profound stimulatory effect on PGH synthase (PGHS-2) mRNA levels and the synthesis of PGF2a and PGE2, which seems to be mediated, at least in part, through PPAR-d [5,6]. Feeding n-3 fatty acids (FA) may attenuate the endometrial PGF2a production [7,8]. Dirandeh et al. [9] demonstrated that FA from flaxseed reduced plasma 13,14-dihydro-15-keto PGF2a (PGFM) concentrations compared with feeding soybean whole roast and palm oil (PLM) after an oxytocin challenge in dairy cows. Dairy cows fed fish oil during the transition period had greater eicosapentaenoic acid and docosahexaenoic acid concentrations in caruncular tissues and reduced postpartum concentrations of PGFM compared with cows fed olive oil [10]. Conversely, feeding fat sources rich in n-6 FA increased plasma concentration of PGFM after an oxytocin challenge [2]. Thus, supplemental lipids can either inhibit or stimulate prostaglandin secretion depending on their specific FA profile. The aim of the present study was to determine the effect of dietary supplementation with n-3 and n-6 PUFA on the mRNA expression of key genes (PGFS, PGES, PGHS-2, PLA2, PPARs) involved in prostaglandin biosynthesis and circulatory PGFM concentration in dairy cows to improve fertility in dairy cows. 2. Material and methods 2.1. Cows and treatments Twenty-four multiparous cows were blocked according to calving date and parity, and were allocated randomly to three experimental diets fed during a period between calving through 60 days in milk. There was no difference among groups (mean standard error of the mean) in parity (3.1 0.9) or body condition score at calving (3.2 0.07). The cows were fed on diets containing PLM (saturated FA; n ¼ 8), soybean whole roast (n-6; n ¼ 8; SOY), or linseed extruded (n-3; n ¼ 8; LIN). The diets were isonitrogenous,
isoenergetic, and isolipidic, and were formulated to meet or exceed NRC [11] nutrient requirements (Table 1). The omega6 to omega-3 FA ratios were 4.2, 3.2, and 1.0 fortreatments SOY, PLM, and LIN, respectively (Table 2). Fatty acid profile (g/100 g of FA) of fat supplements presented in Table 3. The total mixed ration was sampled weekly throughout the trial and their DM content was determined by drying at 110 C for 18 hours. Diets were provided twice per day (0800 and 1600 hours) for ad libitum intake (10% of refusals on as-fed basis) from calving through day 70 postpartum. Total mixed ration were sampled each week and pooled each month. Compositional and ingredient analyzed for total mixed ration. Briefly, the dry matter of feed sample was determined by placing it in a drying oven at 100 C for 48 hours (AOAC, 1990, Method 930.15). Crude protein was determined using the Dumas Method and a Leco FP-528 (LECO Corporation, St. Joseph’s, MI, USA). Acid detergent fiber and neutral detergent fiber concentrations were determined [12]. The cows were milked 3 times per day at 0700, 1400, and 2300 hours, and the milk yields were recorded automatically. 2.2. Synchronization of the estrous cycle The cows were synchronized for ovulation beginning on day 30 via two intramuscular injections of PGF2a (Synchromate, 150 mg cloprostenol sodium, Aburaihan Company, Tehran, Iran) given with a 14-day interval [13]. 2.3. Monitoring uterine conditions On days 5, 10, 15, 20, and 30 postpartum, blood samples were collected from eight cows per treatment to determine PGFM concentrations, also on day 14 of the synchronized estrous cycle, a catheter was inserted in the jugular vein of cows that calved which showed no difference in blood PGFM concentrations among the experimental diets on days 5 and 10 postpartum along with no uterine problems (n ¼ 8 per treatment). On day 15, the cows were injected intravenously at 1300 hours with 100 IU of oxytocin as described by Dirandeh et al. [9] to monitor the uterine secretion of PGFM. Blood samples were collected into vacutainer tubes containing EDTA (10.5 mg, Monoject; Sherwood Medical, St. Louis, MO, USA) at 15-minute intervals for 1 hour before oxytocin injection and at 15minute intervals for 4 hours after the oxytocin injection. The blood sample was centrifuged at 2600 g for 30 minutes and the plasma was frozen at 20 C for subsequent assay of PGFM using an ELISA kit (Cayman Chemical, Ann Arbor, MI, USA) with an ELISA reader (Stat fax 2100, Awareness Technologies, UK). Inter- and intra-assay coefficients of variation for one reference sample (1.85 ng/mL; [9]) were 6.34% and 7.10%, respectively. The sensitivity of the assay was 0.02 ng/mL. 2.4. Uterine biopsy 2.4.1. Tissue sampling On day 15 of the synchronized estrous cycle, uterine endometrial biopsies were collected immediately after the fulfillment of the oxytocin challenge and blood sampling
E. Dirandeh et al. / Theriogenology xxx (2014) 1–7
sequence by passing a biopsy tool through the cervix into the uterine horn ipsilateral to the corpus luteum by using transrectal manipulation [14]. No previous manipulation of the uterus had occurred before biopsy. The open jaws of the biopsy basket (2 1 mm) were pressed against the endometrium and samples (approximately 100 mg) of endometrium were removed. Uterine samples were washed with sterile PBS, placed in a screw-cap micro centrifuge tube (Sigma–Aldrich Chemie GmbH, Taufkirchen, Germany), snap-frozen in liquid nitrogen, and stored at 80 C until RNA extraction. 2.4.2. RNA extraction and cDNA synthesis Total RNA was extracted from uterus samples using the RNXTM solution (RN7713C, Qiagen Inc., Tehran, Iran) according to the manufacturer’s instructions. The integrity of extracted RNA was verified by an agarose gel (1%) electrophoresis. The RNA concentrations were determined using an ultraviolet absorbance (260 nm). 2.4.3. Real-time PCR Gene expression was assessed by relative real-time RTPCR. Total RNA (1 mg) was first treated with 1 U DNase
Table 1 Ingredient and chemical composition of diets based on protected palm oil (PLM), extruded linseed (LIN) or roasted whole soybeans (SOY). Ingredient
Ingredient (% of dry matter) Alfalfa hay (mid bloom) Corn silage Dehydrated beet pulp Ground corn grain Rolled barley grain Molasses Wheat bran Soybean meal (48% crude protein) Roasted whole soybeans Corn gluten meal (60% crude protein) Cottonseed meal Whole cottonseed Extruded linseeda Canola meal (solvent) Wheat rolled PLMb Limestone Vitamin and mineral premixc Dicalcium phosphate Magnesium oxide Salt Sodium bicarbonate Chemical composition Net energy for lactation (Mcal/kg of dry matter) Fat (% of dry matter) Crude protein (% of dry matter) Neutral detergent fiber (% of dry matter) DF Acid detergent fiber (% of dry matter) a
Treatments PLM
LIN
SOY
26.72 22.1 2.97 9.74 9.65 0.78 0.32 8.81 0 1.83 3.39 1.51 0 4.6 2.64 1.41 0.45 0.89 0.54 0.20 0.45 1.00
26.72 22.1 2.97 9.74 9.65 0.76 0.20 7.93 0 1.83 3.08 1.48 4.06 3.26 2.69 0 0.45 0.89 0.54 0.20 0.45 1.00
26.72 22.1 2.97 9.74 9.65 0.78 0.71 3.03 7.31 1.83 3.14 1.51 0 4.4 2.69 0 0.45 0.89 0.54 0.20 0.45 1.00
1.58
1.58
1.58
4.00 17.90 34.40
4.00 17.85 33.90
4.00 17.85 34.10
20.40
20.50
20.40
Omegalin, NUTRI ADVANCE, France. Energizer- RP10, IFFCO, Johor BahruJohor, Malaysia. c Contained (per kilogram): 16,000,000 IU of vitamin A; 3,200,000 IU of vitamin D; 48,000 IU of vitamin E; 24.0 g of Mn; 24.0 g of Zn; 24.0 g of Fe; 12.8 g of Cu; 1.44 g of I; 0.32 g of Se; and 0.32 g of Co. b
3
Table 2 Fatty acid (FA) profile (g/100 g of FA) of diets based on protected palm oil (PLM), extruded linseed (LIN) or roasted whole soybeans (SOY). FA
Treatments
C < 12 C14:0 C16:0 C16:1 C18:0 C18:1 C18:2 C18:3 C20:0/1 SFA1 MUFA2 PUFA3 Omega-3 Omega-6 Omega-6 to omega-3 FA ratio
PLM
LIN
SOY
0.382 0.470 33.2 1.014 16.08 12.18 26.78 8.33 1.52 51.7 13.20 35.11 8.33 26.78 3.2
0.365 3.035 12.3 0.936 2.75 18.47 30.93 29.73 1.45 19.9 19.41 60.66 29.73 30.93 1.0
0.377 0.502 14.3 1.054 3.02 20.58 47.42 11.25 1.50 19.7 21.63 58.67 11.25 47.42 4.2
Abbreviations: MUFA, monounsaturated fatty acids; PUFA, polyunsaturated fatty acids; SFA, saturated fatty acids.
(Invitrogen) to digest any contaminating DNA. The RNA was reversely transcribed in the presence of 1 mmol/L oligo (dT) primer and 4 U Omniscript RTase (Omniscript RT Kit; Qiagen, Mississauga, Ontario, Canada) according to the manufacturer’s instructions. Real-time PCR was conducted in an ABI Prism 7300 instrument (Rotor gene 3000, Corbett Life Science, Concorde, NSW, Australia) with Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and bovinespecific primers (Table 4). Common thermal cycling parameters (3 minutes at 95 C, 40 cycles of 15 seconds at 95 C, 30 seconds at 60 C, and 30 seconds at 72 C) were used to amplify each transcript. Product identity was verified by sequencing and melting curve analyses were performed in all PCR runs to verify generation of single amplicons. Samples were run in duplicate and were expressed relative to ubiquitin as a housekeeping gene, which was stable under the culture conditions used. Data were normalized to a calibrator sample using the DDCt method with correction for amplification efficiency [15]. 2.5. Statistical analyses Non-normally distributed data (Shapiro–Wilk test) were transformed to logarithms. Homogeneity of
Table 3 Fatty acid (FA) profile (g/100 g of FA) of fat supplements protected palm oil (PLM), extruded linseed (LIN) or roasted whole soybeans (SOY). FA
C14:0 C16:0 C16:1 C18:0 C18:1 C18:2, n-6 C18:3, n-3 C20:4, n-6
Fat supplements (g/100 g of FA) PLM
LIN
SOY
1.2 46.6 0.0 0.1 4.3 38.2 9.3 0.3
0.6 5.8 0.0 3.7 16.7 16.5 56.7 0.0
0.1 12.0 0.1 3.9 20.2 56.0 7.7
4
E. Dirandeh et al. / Theriogenology xxx (2014) 1–7
3. Results
Table 4 Bovine oligonucleotide primers. Gene
Sequence (50 to 30 )
Accession number
PPAR-a
F: TTGTGGCTGCTATCATTTGC R: AGAGGAAGACGTCGTCAGGA F: CACTCTCACTGCTGGACCAA R: GCAGATCCGCTCACATTTCT F: GTGAAGCCCATTGAGGACAT F: AGCTGCACGTGTTCTGTCAC F: TTT TGG TAG GTC TTC TGG TG R: GCA TGG CCT GTA CAA CCT CAA F: TCC CGG TGT TAG GGT TCA CA R: GTA ACC CGT TGA ACC CCA TT F: CGGCTGATTTGGAACTGTTT R: CTGTTTGCTTTTCCCAGCAT F:TCAAGCACACGACAGGAAAG R: AAGGAACTTGGTGCCACATC F: AGATCCAGGATAAGGAAGGCA R: GCTCCACCTCCAGGGTGAT
NM_001034036
PPAR-d PPAR-g PGHS-2 PGFS PGES PLA2 UBQ
NM_001083636
3.1. Milk production Milk yield was not affected by diets (P ¼ 0.47, 35.3 kg/d, 36.1 kg/d, and 35.7 kg/d in PLM, LIN, and SOY respectively).
NM_181024 AF004944 NM_001035367 NM_174443 NM_001075820 NM_174133
Abbreviations: PGES, prostaglandin E synthase; PGFS, prostaglandin F synthase; PLA2, phospholipase; PPAR, peroxisome proliferator-activated receptor; UBQ, ubiquitin.
variance was tested with O’Brien and Brown-Forsythe tests. The analysis of variance was performed with JMP software (SAS Institute, 2000, Cary, NC, USA) with treatment as the main effect and culture replicate as the random variable in the F-test. Differences among means were tested with the Tukey–Kramer honest significant difference test for multiple comparisons Differences were considered significant at P < 0.05 and the data are presented as mean values standard error of the mean.
3.2. Gene expression Uterine endometrial PPAR-d and PGES genes were found to be differentially expressed in the LIN group compared with other groups (P < 0.05). The mRNA level of PGES in the LIN group was threefold as high as those found in SOY and PLM diets (P < 0.05; Fig. 1). Mean PGFS mRNA expression was increased by 1.5-fold in animals fed SOY diet compared with LIN and PLM diets (P < 0.05; Fig. 1). The mean relative gene expression of PLA2 was increased by 1.5-fold in animals fed SOY diet than those fed with LIN and PLM diets (P < 0.05; Fig. 1). Expression of mRNA for the PGHS-2, PPAR-a, and PPAR-g did not differ among the experimental groups between the controls and experimental groups (Figs. 1 and 2). 3.3. Plasma concentration of PGFM The concentrations of plasma PGFM during the first 10 days postpartum averaged 1870, 1930, and 1830 pg/mL respectively for PLM, LIN, and SOY diets, which were not different (P ¼ 0.71; Fig. 3). Plasma concentrations of PGFM remained higher for cows fed SOY compared with those fed LIN and PLM on days 20, 25, and 30 postpartum, which was
Fig. 1. Relative messenger RNA (mRNA) of endometrial prostaglandin endoperoxide synthase-2 (PGHS-2), phospholipase A2 (PLA2), prostaglandin F synthase (PGFS), and prostaglandin E synthase (PGES) in lactating dairy cows fed n-3 or n-6 polyunsaturated fatty acids. a,bDifferent letters denote differences (P < 0.05). LIN, extruded linseed oil; PLM, palm oil; SOY, roasted whole soybeans.
E. Dirandeh et al. / Theriogenology xxx (2014) 1–7
5
60 minutes after the oxytocin injection was obtained for cows fed SOY and the lowest response was observed in cows fed LIN (Fig. 4). Cows fed PLM had intermediate values for PGFM. The plasma PGFM concentrations from 45 to 120 minutes after the oxytocin injection were lower in cows fed LIN (55.0 2.1 pg/mL) compared with those fed PLM (74.5 1.9 pg/mL) and SOY (93.8 2.8 pg/mL). 4. Discussion
Fig. 2. Relative messenger RNA (mRNA) of peroxisome proliferator-activated receptors (PPAR-a, b, d) in lactating dairy cows fed n-3 or n-6 polyunsaturated fatty acids. a,bDifferent letters denote differences (P < 0.05). LIN, extruded linseed oil; PLM, palm oil; SOY, roasted whole soybeans.
indicated by an interaction between diet and time (P ¼ 0.01). Diet and time also interacted to influence the plasma concentration of PGFM determined during the oxytocin challenge (P ¼ 0.04). The highest PGFM response at
To our knowledge, this is the first study dealing with the effect of n-3 and n-6 PUFA supplementation on the expression of prostaglandin cascade components in bovine endometrium. Previous researches mainly focused on n-3 PUFA supplementation [1,8]. In agreement with the previous studies [9,16,17], the present work showed that PGFM concentrations was increased after oxytocin injection in cows fed SOY compared with those fed PLM or LIN. A diet enriched with a source of linolenic acid such as LIN treatment in the present experiment may suppress PGF2a production. In beef cows fed with fish meal-derived n-3 FAs, a reduction in the endometrial secretion of AA was reported [18]. In the current study, mRNA expression of genes coding PLA2 was decreased in cows fed n-3 PUFA compared with cows fed n-6 PUFA or palm. In accordance with this finding, Coyne et al. [1] reported a 2.2-fold decrease in PLA2 mRNA expression after n-3 PUFA supplementation in bovine endometrium. PLA2 catalyzes the liberation of AA from membrane phospholipids. A reduction in PLA2 mRNA expression after dietary supplementation with n-3 could further reduce the AA available to PG production [8]. Endometrial AA concentrations were decreased in animals offered a high n-3 PUFA compared with a control diet [16]). Therefore, a reduction in serum PLA2 enzyme concentration after decreased gene expression could further reduce the AA available for series 2 PG production [3]. Expression of the gene coding PGHS-2 did not differ among the treatment groups, which was consistent with the previous studies [6,19]. Caldari-Torres et al. [20] reported that incubating bovine endometrial cells with eicosapentaenoic acid and docosahexaenoic acid decreased the secretion of PGF2a. In addition, Mattos et al. [21] reported that bovine endometrial cells incubated with eicosapentaenoic acid, docosahexaenoic acid, or AA did not affect the concentrations of PGHS-2 protein. Expression of PGFS was decreased in cows fed n-3 PUFA compared with other treatments. PGFS converts prostaglandin H2 (as an unstable intermediate in the PG biosynthetic pathway) into PGF2a [22]; the expression of PGES, which in turn augments PGE2 synthesis, also increased after dietary n-3 PUFA supplementation. Endometrial mRNA expression of PGFS and PGES has been reported respectively to be decreased and increased by interferon-s, which is followed by a consequent decrease in PGF2a production in cattle [23]. Hence, establishment of pregnancy may depend not only on inhibition of PGF2a production, but also on increased PGE2 production in pig [24]. A higher PGE2 concentration in the uterine fluid has been reported to be associated with an enhanced
6
E. Dirandeh et al. / Theriogenology xxx (2014) 1–7
Fig. 3. Mean plasma 13, 14-dihydro-15-keto PGF2a (PGFM) concentrations in Holstein cows fed diets based on protected palm oil (PLM; n ¼ 8), extruded linseed (LIN; n ¼ 8), or roasted whole soybeans (SOY; n ¼ 8), (*P < 0.05).
embryonic development and survival rates in rat [25]. Coyne et al. [1] reported the luteotrophic effects of dietary n-3 PUFA through increased mRNA expression of mPGES1, the enzyme critical in PGE2 production in bovine endometrium. PPARs are molecular sensors of FAs and FA derivatives, which control the metabolism [26]. PPAR-d is expressed in a wide range of tissues and cells, including the endometrium, which is vital for normal fertility. It serves as a regulator of PG production and is required for implantation in rodent models [27]. MacLaren et al. [6] suggested a
similar endometrial mRNA expression of PPAR-a and PPARd in cyclic and pregnant Holstein cows. In the present work, the expression of PPAR-a and PPAR-g was not affected after n-3 supplementation, which is in accordance with previous reports [1,6,28]. There is evidence suggesting that PPAR-d is involved in the pregnancy recognition process in cattle and may mediate at least some beneficial effects of long chain n-3 PUFA supplementation [6]. In mice, PPAR-d deficiency results in placental defects and mid gestational mortality [29], suggesting that this nuclear receptor may make a
Fig. 4. Mean plasma 13, 14-dihydro-15-keto PGF2a (PGFM) concentrations after an oxytocin challenge (time ¼ 0) on day 15 of estrous cycle in lactating dairy cows fed diets based on protected palm oil (PLM; n ¼ 20), extruded linseed (LIN; n ¼ 20), or roasted whole soybeans (SOY; n ¼ 20). a-fDifferent letters within a time denote differences (*P < 0.05 and **P < 0.01).
E. Dirandeh et al. / Theriogenology xxx (2014) 1–7
critical contribution to controlling reproductive processes in mammals. In the current study, gene expression of PPARd was increased in cows fed n-3 PUFA compared with other treatment groups. Ding et al. [30] showed that PPARd mRNA is regulated in uterine epithelium during early pregnancy period in rodents and is induced in uterine subluminal stroma by the presence of the blastocyst. 4.1. Conclusions
[9]
[10]
[11] [12]
Overall, uterine endometrial PPAR-d and PGES genes were differentially expressed in cows in the LIN group compared with other experimental groups (P < 0.05). Mean relative gene expression of PLA2 and PGFS was increased in animals fed a SOY diet compared with LIN and PLM diets (P < 0.05). The expression of mRNA for the PGHS-2, PPAR-a, and PPAR-g was not dietarily affected. Dietary inclusion of linseed FAs was associated with a decrease in the PGFM concentration, possibly through a decrease in the expression of genes involved in the PG cascade. The uterine concentration of PGFM, however, was increased in cows fed diets containing n-6 FAs. Investigations as to underlying cellular and molecular mechanisms involved in the effect of diet on alternative intermediate contributing genes in endometrial prostaglandin synthesis would also be of interest.
[13]
[14]
[15] [16]
[17]
[18]
Acknowledgments [19]
This research was funded by Sari agricultural Sciences and natural Resources University (grant number 03-139205). The authors thank the managers and staff of the Mahdasht dairy farm in Sari, northern Iran, and R. Jean François Le Roux, and D. Manager (Nutri Advance Feed and Ingredients, France) for their assistance. References [1] Coyne GS, Kenny DA, Childs S, Sreenan JM, Waters SM. Dietary n3polyunsaturated fatty acids alter the expression of genes involved in prostaglandin biosynthesis in the bovine uterus. Theriogenology 2008;70:772–82. [2] Robinson RS, Pushpakumara PGA, Cheng Z, Peters AR, Abayasekara DEE, Wathes DC. Effects of dietary polyunsaturated fatty acids on ovarian and uterine function in lactating dairy cows. Reproduction 2002;124:119–31. [3] Smith WL, Garavito RM, DeWitt DL. Prostaglandin endoperoxide H synthases (cyclooxygenases)-1 and -2. J Biol Chem 1996;271: 33157–60. [4] Thatcher WW, Binelli M, Burke JM, Staples CR, Ambrose JD, Coelho S. Antiluteolytic signals between conceptus and endometrium. Theriogenology 1997;47:131–40. [5] Santos JEP, Bilby TR, Thatcher WW, Staples CR, Silvestre FT. Long chain fatty acids of diet as factors influencing reproduction in cattle. Reprod Dom Anim 2008;43:23–30. [6] MacLaren LA, Guzeloglu A, Michel F, Thatcher WW. Peroxisome proliferator-activated receptor (PPAR) expression in cultured bovine endometrial cells and response to n-3 fatty acid, growth hormone and agonist stimulation in relation to series 2 prostaglandin production. Dom Anim Endocrinol 2006;30:155–69. [7] Richardson GF, McNiven MA, Petit HV, Duynisveld JL. The effects of dietary n fatty acids on pregnancy rate, plasma prostaglandin metabolite levels, serum progesterone levels, and milk fatty-acid profile in beef cows. Can J Vet Res 2013;77:314–8. [8] Waters SM, Coyne GS, Kenny DA, MacHugh DE, Morris DG. Dietary n-3 polyunsaturated fatty acid supplementation alters the
[20]
[21]
[22]
[23]
[24]
[25] [26] [27]
[28]
[29]
[30]
7
expression of genes involved in the control of fertility in the bovine uterine endometrium. Physiol Genomics 2012;44:878–88. Dirandeh E, Towhidi A, Ansari Pirsaraei Z, Adib Hashemi F, Ganjkhanlou M, Zeinoaldini S, et al. Plasma concentrations of PGFM and uterine and ovarian responses in early lactation dairy cows fed n-3 and n-6 fatty acids. Theriogenology 2013;80:131–7. Mattos R, Staples CR, Arteche A, Wiltbank MC, Diaz FJ, Jenkins TC, et al. The effects of feeding fish oil on uterine secretion of PGF2alpha, milk composition, and metabolic status of periparturient Holstein cows. J Dairy Sci 2004;87:921–32. NRC. Nutrient requirements of dairy cattle. Seventh edition. Washington, DC: National Academy of Science; 2001. Dirandeh E, Towhidi A, Zeinoaldini S, Ganjkhanlou M, Ansari Pirsaraei Z. Effects of different PUFAs supplementation during the postpartum periods of early lactating dairy cows, I: milk yield, metabolic. J Anim Sci 2013;90:1–9. Van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral detergent fiber and non-starch polysaccharides in relation to animal nutrition. J Dairy Sci 1991;74:3583–97. Garoussi MT, Sasani F, Hovareshti P. The histopathological survey of uterine tissue in Holstein dairy cows with or without recorded reproductive disorders. Iranian J Vet Sci Technol 2010;2:101–8. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001;29:e45. Childs S, Carter F, Lynch CO, Sreenan JM, Lonergan P, Hennessy AA, et al. Embryo yield and quality following dietary supplementation of beef heifers with n-3 polyunsaturated fatty acids (PUFA). Theriogenology 2008;70:992–1003. Silvestre FT, Carvalho TS, Francisco N, Santos JE, Staples CR, Jenkins T, et al. Effects of differential supplementation of fatty acids during the peripartum and breeding periods of Holstein cows: I. Uterine and metabolic responses, reproduction, and lactation. J Dairy Sci 2011;94:189–204. Burns PD, Engle TE, Harris MA, Enns RM, Whittier JC. Effect of fish meal supplementation on plasma and endometrial fatty acid composition in nonlactating beef cows. J Anim Sci 2003;81:2840–6. Thatcher WW, Guzeloglu A, Mattos R, Binelli M, Hansen TR, Pru JK. Uterine-conceptus interactions and reproductive failure in cattle. Theriogenology 2001;56:1435–50. Caldari-Torres C, Rodriguez-Sallaberry C, Greene ES, Badinga L. Differential effects of n-3 and n-6 fatty acids on prostaglandin F2a production by bovine endometrial cells. J Dairy Sci 2006;89:971–7. Mattos R, Guzeloglu A, Badinga L, Staples CR, Thatcher WW. Polyunsaturated fatty acids and bovine interferon-s modify phorbol ester-induced secretion of prostaglandin F2a and expression of prostaglandin endoperoxide synthase-2 and phospholipase-A2 in bovine endometrial cells. Biol Reprod 2003;69:780–7. Lindstrom T, Bennett P. Transcriptional regulation of genes for enzymes of the prostaglandin biosynthetic pathway. Prostaglandins Leukot Essent Fatty Acids 2004;70:115–35. Arosh JA, Banu SK, Kimmins S, Chapdelaine P, Maclaren LA, Fortier MA. Effect of interferon-tau on prostaglandin biosynthesis, transport, and signalling at the time of maternal recognition of pregnancy in cattle: evidence of polycrine actions of prostaglandin E2. Endocrinology 2004;145:5280–93. Geisert RD, Zavy MT, Moffatt RJ, Blair RM, Yellin T. Embryonic steroids and the establishment of pregnancy in pigs. J Reprod Fertil Suppl 1990;40:293–305. Kennedy TG. Evidence for a role for prostaglandins in the initiation of blastocyst implantation in the rat. Biol Reprod 1977;16:286–91. Poulsen LL, Siersbæk M, Mandrup S. PPARs: fatty acid sensors controlling metabolism. Semin Cell Dev Biol 2012;23:631–9. Lim H, Gupta RA, Ma WG, Paria BC, Moller DE, Morrow JD, et al. Cyclooxygenase-2-derived prostacyclin mediates embryo implantation in the mouse via PPARd. Gene Dev 1999;13:1561–74. Sheldrick EL, Derecka K, Marshall E, Chin EC, Hodges L, Wathes DC, et al. Peroxisome-proliferator-activated receptors and the control of levels of prostaglandin-endoperoxide synthase 2 by arachidonic acid in the bovine uterus. Biochem J 2007;406:175–83. Barak Y, Liao D, He W, Ong ES, Nelson MC, Olefsky JM, et al. Effects of peroxisome proliferator-activated receptor d on placentation, adiposity, and colorectal cancer. Proc Natl Acad Sci U S A 2002;99: 303–8. Ding NZ, Teng CB, Ma H, Ni H, Ma XH, Xu LB, et al. Peroxisome proliferator-activated receptor d expression and regulation in mouse uterus during embryo implantation and decidualization. Mol Reprod Dev 2003;66:218–24.
Contents lists available at ScienceDirect
Theriogenology journal homepage: www.theriojournal.com
The endometrial expression of prostaglandin cascade components in lactating dairy cows fed different polyunsaturated fatty acids E. Dirandeh a, *, A. Towhidi b, Z. Ansari Pirsaraei a, T. Saberifar b, A. Akhlaghi c, A. Rezaei Roodbari b a
Department of Animal Science, Sari Agricultural Sciences and Natural Resources University, Sari, Iran Department of Animal Science, Faculty of Agricultural Science and Engineering, College of Agriculture and Natural Resources, University of Tehran, Karaj, Iran c Department of Animal Science, Shiraz University, Shiraz, Iran b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 24 May 2014 Received in revised form 1 September 2014 Accepted 10 September 2014
Feeding n-6 polyunsaturated fatty acids (PUFA) increases the endometrial percentages of linoleic and arachidonic acids (AA), enhances the synthesis of prostaglandin F2a (PGF2a), and improves uterine health. In contrary, the n-3 PUFA, eicosapentaenoic acid, and docosahexaenoic acid may play pivotal roles by suppressing the synthesis of uterine PGF2a, a component being centrally involved in the control of the bovine estrous cycle and in early embryo survival. The objectives of the present study were to determine the effect of feeding a diet enriched in either a-linolenic acid (n-3) or linolenic acid (n-6) on the uterine expression of genes related to prostaglandin cascade and uterine release of PGF2a (measured as 13, 14-dihydro-15-keto PGF2a [PGFM]). From calving to 60 days in milk, cows (n ¼ 24) were fed isonitrogenous, isocaloric, and isolipidic diets that differed in the ratio of n-3/n-6 PUFA. Treatments including palm oil ([PLM]; saturated FA, n ¼ 8), soybean whole roast ([SOY]; n-6, n ¼ 8), and linseed extruded ([LIN]; n-3, n ¼ 8). At 30 days in milk, the ovulatory cycles of cows were synchronized using 2 injections of PGF2a with a 14-day interval. On day 15 postovulation, cows were injected with oxytocin and blood samples were collected to monitor the uterine release of PGF2a (measured as PGFM) and uterine endometrial biopsies were prepared to evaluate the expression of genes related to prostaglandin cascade (prostaglandin F synthase [PGFS], prostaglandin E synthase [PGES], prostaglandin endoperoxide synthase-2 [PGHS-2]), phospholipase A2 (PLA2), peroxisome proliferator-activated receptors [PPAR]). Results showed that uterine endometrial PPARd genes were higher in cows fed LIN (3.17-fold) compared with cows fed PLM or SOY (P < 0.05). The messenger RNA (mRNA) level of PGES in the LIN group was threefold as high as those found in SOY and PLM diets (P < 0.05). The mean relative gene expression of PLA2 and PGFS was increased in animals fed the SOY diet (2.4- and 1.7-fold, respectively) compared with LIN and PLM diets (P < 0.05). The expression of mRNA for the PGHS-2, PPAR-a, and PPAR-g was not influenced by the diet effect. Dietary inclusion of soy FAs was associated with an increase in the PGFM concentration, possibly through an increase in the expression of genes involved in prostaglandin cascade. The uterine concentration of PGFM, however, was decreased in cows fed diets containing n-3 FAs. Ó 2014 Elsevier Inc. All rights reserved.
Keywords: Endometrium PGES PGFS PLA2 PPAR Real-time PCR
* Corresponding author. Sari Agricultural sciences and Natural Resources University, Sari, Mazandaran 578, Iran. Tel.: þ981133687565; fax: þ981133682741. E-mail address: [email protected] (E. Dirandeh). 0093-691X/$ – see front matter Ó 2014 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.theriogenology.2014.09.011
2
E. Dirandeh et al. / Theriogenology xxx (2014) 1–7
1. Introduction The endometrium plays a critical role in regulating the estrous cycle and establishment of pregnancy, primarily through the processing of arachidonic acid (AA) and synthesis of prostaglandin F2a (PGF2a) [1]. Studies on a variety of species have shown that dietary polyunsaturated fatty acids (PUFA) may modulate prostaglandin synthesis and metabolism [1,2]. The most biologically active two series prostaglandins are derived from AA, but the less active three series prostaglandins are enzymatically produced from eicosapentaenoic acid by the same enzymes [2]. The AA released by phospholipid hydrolysis is converted to prostaglandin endoperoxide synthase (PGHS)-2 prostaglandin H2 by PGHS, which is then converted to PGF by a reductase. Two forms of PGHS have been characterized, a constitutively expressed PGHS-1, and an induced PGHS-2 [3]. In cattle, the synthesis and activity of PGHS-2 must be attenuated to maintain pregnancy [4]. Peroxisome proliferator-activated receptors (PPAR) are a group of ligand-activated transcription factors regulating multiple physiologic processes [5]. MacLaren et al. [6] reported a comparable endometrial messenger RNA (mRNA) expression of PPAR-a and PPAR-d in cyclic and pregnant Holstein cows. Agonists of PPAR-d and PPAR-a had a profound stimulatory effect on PGH synthase (PGHS-2) mRNA levels and the synthesis of PGF2a and PGE2, which seems to be mediated, at least in part, through PPAR-d [5,6]. Feeding n-3 fatty acids (FA) may attenuate the endometrial PGF2a production [7,8]. Dirandeh et al. [9] demonstrated that FA from flaxseed reduced plasma 13,14-dihydro-15-keto PGF2a (PGFM) concentrations compared with feeding soybean whole roast and palm oil (PLM) after an oxytocin challenge in dairy cows. Dairy cows fed fish oil during the transition period had greater eicosapentaenoic acid and docosahexaenoic acid concentrations in caruncular tissues and reduced postpartum concentrations of PGFM compared with cows fed olive oil [10]. Conversely, feeding fat sources rich in n-6 FA increased plasma concentration of PGFM after an oxytocin challenge [2]. Thus, supplemental lipids can either inhibit or stimulate prostaglandin secretion depending on their specific FA profile. The aim of the present study was to determine the effect of dietary supplementation with n-3 and n-6 PUFA on the mRNA expression of key genes (PGFS, PGES, PGHS-2, PLA2, PPARs) involved in prostaglandin biosynthesis and circulatory PGFM concentration in dairy cows to improve fertility in dairy cows. 2. Material and methods 2.1. Cows and treatments Twenty-four multiparous cows were blocked according to calving date and parity, and were allocated randomly to three experimental diets fed during a period between calving through 60 days in milk. There was no difference among groups (mean standard error of the mean) in parity (3.1 0.9) or body condition score at calving (3.2 0.07). The cows were fed on diets containing PLM (saturated FA; n ¼ 8), soybean whole roast (n-6; n ¼ 8; SOY), or linseed extruded (n-3; n ¼ 8; LIN). The diets were isonitrogenous,
isoenergetic, and isolipidic, and were formulated to meet or exceed NRC [11] nutrient requirements (Table 1). The omega6 to omega-3 FA ratios were 4.2, 3.2, and 1.0 fortreatments SOY, PLM, and LIN, respectively (Table 2). Fatty acid profile (g/100 g of FA) of fat supplements presented in Table 3. The total mixed ration was sampled weekly throughout the trial and their DM content was determined by drying at 110 C for 18 hours. Diets were provided twice per day (0800 and 1600 hours) for ad libitum intake (10% of refusals on as-fed basis) from calving through day 70 postpartum. Total mixed ration were sampled each week and pooled each month. Compositional and ingredient analyzed for total mixed ration. Briefly, the dry matter of feed sample was determined by placing it in a drying oven at 100 C for 48 hours (AOAC, 1990, Method 930.15). Crude protein was determined using the Dumas Method and a Leco FP-528 (LECO Corporation, St. Joseph’s, MI, USA). Acid detergent fiber and neutral detergent fiber concentrations were determined [12]. The cows were milked 3 times per day at 0700, 1400, and 2300 hours, and the milk yields were recorded automatically. 2.2. Synchronization of the estrous cycle The cows were synchronized for ovulation beginning on day 30 via two intramuscular injections of PGF2a (Synchromate, 150 mg cloprostenol sodium, Aburaihan Company, Tehran, Iran) given with a 14-day interval [13]. 2.3. Monitoring uterine conditions On days 5, 10, 15, 20, and 30 postpartum, blood samples were collected from eight cows per treatment to determine PGFM concentrations, also on day 14 of the synchronized estrous cycle, a catheter was inserted in the jugular vein of cows that calved which showed no difference in blood PGFM concentrations among the experimental diets on days 5 and 10 postpartum along with no uterine problems (n ¼ 8 per treatment). On day 15, the cows were injected intravenously at 1300 hours with 100 IU of oxytocin as described by Dirandeh et al. [9] to monitor the uterine secretion of PGFM. Blood samples were collected into vacutainer tubes containing EDTA (10.5 mg, Monoject; Sherwood Medical, St. Louis, MO, USA) at 15-minute intervals for 1 hour before oxytocin injection and at 15minute intervals for 4 hours after the oxytocin injection. The blood sample was centrifuged at 2600 g for 30 minutes and the plasma was frozen at 20 C for subsequent assay of PGFM using an ELISA kit (Cayman Chemical, Ann Arbor, MI, USA) with an ELISA reader (Stat fax 2100, Awareness Technologies, UK). Inter- and intra-assay coefficients of variation for one reference sample (1.85 ng/mL; [9]) were 6.34% and 7.10%, respectively. The sensitivity of the assay was 0.02 ng/mL. 2.4. Uterine biopsy 2.4.1. Tissue sampling On day 15 of the synchronized estrous cycle, uterine endometrial biopsies were collected immediately after the fulfillment of the oxytocin challenge and blood sampling
E. Dirandeh et al. / Theriogenology xxx (2014) 1–7
sequence by passing a biopsy tool through the cervix into the uterine horn ipsilateral to the corpus luteum by using transrectal manipulation [14]. No previous manipulation of the uterus had occurred before biopsy. The open jaws of the biopsy basket (2 1 mm) were pressed against the endometrium and samples (approximately 100 mg) of endometrium were removed. Uterine samples were washed with sterile PBS, placed in a screw-cap micro centrifuge tube (Sigma–Aldrich Chemie GmbH, Taufkirchen, Germany), snap-frozen in liquid nitrogen, and stored at 80 C until RNA extraction. 2.4.2. RNA extraction and cDNA synthesis Total RNA was extracted from uterus samples using the RNXTM solution (RN7713C, Qiagen Inc., Tehran, Iran) according to the manufacturer’s instructions. The integrity of extracted RNA was verified by an agarose gel (1%) electrophoresis. The RNA concentrations were determined using an ultraviolet absorbance (260 nm). 2.4.3. Real-time PCR Gene expression was assessed by relative real-time RTPCR. Total RNA (1 mg) was first treated with 1 U DNase
Table 1 Ingredient and chemical composition of diets based on protected palm oil (PLM), extruded linseed (LIN) or roasted whole soybeans (SOY). Ingredient
Ingredient (% of dry matter) Alfalfa hay (mid bloom) Corn silage Dehydrated beet pulp Ground corn grain Rolled barley grain Molasses Wheat bran Soybean meal (48% crude protein) Roasted whole soybeans Corn gluten meal (60% crude protein) Cottonseed meal Whole cottonseed Extruded linseeda Canola meal (solvent) Wheat rolled PLMb Limestone Vitamin and mineral premixc Dicalcium phosphate Magnesium oxide Salt Sodium bicarbonate Chemical composition Net energy for lactation (Mcal/kg of dry matter) Fat (% of dry matter) Crude protein (% of dry matter) Neutral detergent fiber (% of dry matter) DF Acid detergent fiber (% of dry matter) a
Treatments PLM
LIN
SOY
26.72 22.1 2.97 9.74 9.65 0.78 0.32 8.81 0 1.83 3.39 1.51 0 4.6 2.64 1.41 0.45 0.89 0.54 0.20 0.45 1.00
26.72 22.1 2.97 9.74 9.65 0.76 0.20 7.93 0 1.83 3.08 1.48 4.06 3.26 2.69 0 0.45 0.89 0.54 0.20 0.45 1.00
26.72 22.1 2.97 9.74 9.65 0.78 0.71 3.03 7.31 1.83 3.14 1.51 0 4.4 2.69 0 0.45 0.89 0.54 0.20 0.45 1.00
1.58
1.58
1.58
4.00 17.90 34.40
4.00 17.85 33.90
4.00 17.85 34.10
20.40
20.50
20.40
Omegalin, NUTRI ADVANCE, France. Energizer- RP10, IFFCO, Johor BahruJohor, Malaysia. c Contained (per kilogram): 16,000,000 IU of vitamin A; 3,200,000 IU of vitamin D; 48,000 IU of vitamin E; 24.0 g of Mn; 24.0 g of Zn; 24.0 g of Fe; 12.8 g of Cu; 1.44 g of I; 0.32 g of Se; and 0.32 g of Co. b
3
Table 2 Fatty acid (FA) profile (g/100 g of FA) of diets based on protected palm oil (PLM), extruded linseed (LIN) or roasted whole soybeans (SOY). FA
Treatments
C < 12 C14:0 C16:0 C16:1 C18:0 C18:1 C18:2 C18:3 C20:0/1 SFA1 MUFA2 PUFA3 Omega-3 Omega-6 Omega-6 to omega-3 FA ratio
PLM
LIN
SOY
0.382 0.470 33.2 1.014 16.08 12.18 26.78 8.33 1.52 51.7 13.20 35.11 8.33 26.78 3.2
0.365 3.035 12.3 0.936 2.75 18.47 30.93 29.73 1.45 19.9 19.41 60.66 29.73 30.93 1.0
0.377 0.502 14.3 1.054 3.02 20.58 47.42 11.25 1.50 19.7 21.63 58.67 11.25 47.42 4.2
Abbreviations: MUFA, monounsaturated fatty acids; PUFA, polyunsaturated fatty acids; SFA, saturated fatty acids.
(Invitrogen) to digest any contaminating DNA. The RNA was reversely transcribed in the presence of 1 mmol/L oligo (dT) primer and 4 U Omniscript RTase (Omniscript RT Kit; Qiagen, Mississauga, Ontario, Canada) according to the manufacturer’s instructions. Real-time PCR was conducted in an ABI Prism 7300 instrument (Rotor gene 3000, Corbett Life Science, Concorde, NSW, Australia) with Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) and bovinespecific primers (Table 4). Common thermal cycling parameters (3 minutes at 95 C, 40 cycles of 15 seconds at 95 C, 30 seconds at 60 C, and 30 seconds at 72 C) were used to amplify each transcript. Product identity was verified by sequencing and melting curve analyses were performed in all PCR runs to verify generation of single amplicons. Samples were run in duplicate and were expressed relative to ubiquitin as a housekeeping gene, which was stable under the culture conditions used. Data were normalized to a calibrator sample using the DDCt method with correction for amplification efficiency [15]. 2.5. Statistical analyses Non-normally distributed data (Shapiro–Wilk test) were transformed to logarithms. Homogeneity of
Table 3 Fatty acid (FA) profile (g/100 g of FA) of fat supplements protected palm oil (PLM), extruded linseed (LIN) or roasted whole soybeans (SOY). FA
C14:0 C16:0 C16:1 C18:0 C18:1 C18:2, n-6 C18:3, n-3 C20:4, n-6
Fat supplements (g/100 g of FA) PLM
LIN
SOY
1.2 46.6 0.0 0.1 4.3 38.2 9.3 0.3
0.6 5.8 0.0 3.7 16.7 16.5 56.7 0.0
0.1 12.0 0.1 3.9 20.2 56.0 7.7
4
E. Dirandeh et al. / Theriogenology xxx (2014) 1–7
3. Results
Table 4 Bovine oligonucleotide primers. Gene
Sequence (50 to 30 )
Accession number
PPAR-a
F: TTGTGGCTGCTATCATTTGC R: AGAGGAAGACGTCGTCAGGA F: CACTCTCACTGCTGGACCAA R: GCAGATCCGCTCACATTTCT F: GTGAAGCCCATTGAGGACAT F: AGCTGCACGTGTTCTGTCAC F: TTT TGG TAG GTC TTC TGG TG R: GCA TGG CCT GTA CAA CCT CAA F: TCC CGG TGT TAG GGT TCA CA R: GTA ACC CGT TGA ACC CCA TT F: CGGCTGATTTGGAACTGTTT R: CTGTTTGCTTTTCCCAGCAT F:TCAAGCACACGACAGGAAAG R: AAGGAACTTGGTGCCACATC F: AGATCCAGGATAAGGAAGGCA R: GCTCCACCTCCAGGGTGAT
NM_001034036
PPAR-d PPAR-g PGHS-2 PGFS PGES PLA2 UBQ
NM_001083636
3.1. Milk production Milk yield was not affected by diets (P ¼ 0.47, 35.3 kg/d, 36.1 kg/d, and 35.7 kg/d in PLM, LIN, and SOY respectively).
NM_181024 AF004944 NM_001035367 NM_174443 NM_001075820 NM_174133
Abbreviations: PGES, prostaglandin E synthase; PGFS, prostaglandin F synthase; PLA2, phospholipase; PPAR, peroxisome proliferator-activated receptor; UBQ, ubiquitin.
variance was tested with O’Brien and Brown-Forsythe tests. The analysis of variance was performed with JMP software (SAS Institute, 2000, Cary, NC, USA) with treatment as the main effect and culture replicate as the random variable in the F-test. Differences among means were tested with the Tukey–Kramer honest significant difference test for multiple comparisons Differences were considered significant at P < 0.05 and the data are presented as mean values standard error of the mean.
3.2. Gene expression Uterine endometrial PPAR-d and PGES genes were found to be differentially expressed in the LIN group compared with other groups (P < 0.05). The mRNA level of PGES in the LIN group was threefold as high as those found in SOY and PLM diets (P < 0.05; Fig. 1). Mean PGFS mRNA expression was increased by 1.5-fold in animals fed SOY diet compared with LIN and PLM diets (P < 0.05; Fig. 1). The mean relative gene expression of PLA2 was increased by 1.5-fold in animals fed SOY diet than those fed with LIN and PLM diets (P < 0.05; Fig. 1). Expression of mRNA for the PGHS-2, PPAR-a, and PPAR-g did not differ among the experimental groups between the controls and experimental groups (Figs. 1 and 2). 3.3. Plasma concentration of PGFM The concentrations of plasma PGFM during the first 10 days postpartum averaged 1870, 1930, and 1830 pg/mL respectively for PLM, LIN, and SOY diets, which were not different (P ¼ 0.71; Fig. 3). Plasma concentrations of PGFM remained higher for cows fed SOY compared with those fed LIN and PLM on days 20, 25, and 30 postpartum, which was
Fig. 1. Relative messenger RNA (mRNA) of endometrial prostaglandin endoperoxide synthase-2 (PGHS-2), phospholipase A2 (PLA2), prostaglandin F synthase (PGFS), and prostaglandin E synthase (PGES) in lactating dairy cows fed n-3 or n-6 polyunsaturated fatty acids. a,bDifferent letters denote differences (P < 0.05). LIN, extruded linseed oil; PLM, palm oil; SOY, roasted whole soybeans.
E. Dirandeh et al. / Theriogenology xxx (2014) 1–7
5
60 minutes after the oxytocin injection was obtained for cows fed SOY and the lowest response was observed in cows fed LIN (Fig. 4). Cows fed PLM had intermediate values for PGFM. The plasma PGFM concentrations from 45 to 120 minutes after the oxytocin injection were lower in cows fed LIN (55.0 2.1 pg/mL) compared with those fed PLM (74.5 1.9 pg/mL) and SOY (93.8 2.8 pg/mL). 4. Discussion
Fig. 2. Relative messenger RNA (mRNA) of peroxisome proliferator-activated receptors (PPAR-a, b, d) in lactating dairy cows fed n-3 or n-6 polyunsaturated fatty acids. a,bDifferent letters denote differences (P < 0.05). LIN, extruded linseed oil; PLM, palm oil; SOY, roasted whole soybeans.
indicated by an interaction between diet and time (P ¼ 0.01). Diet and time also interacted to influence the plasma concentration of PGFM determined during the oxytocin challenge (P ¼ 0.04). The highest PGFM response at
To our knowledge, this is the first study dealing with the effect of n-3 and n-6 PUFA supplementation on the expression of prostaglandin cascade components in bovine endometrium. Previous researches mainly focused on n-3 PUFA supplementation [1,8]. In agreement with the previous studies [9,16,17], the present work showed that PGFM concentrations was increased after oxytocin injection in cows fed SOY compared with those fed PLM or LIN. A diet enriched with a source of linolenic acid such as LIN treatment in the present experiment may suppress PGF2a production. In beef cows fed with fish meal-derived n-3 FAs, a reduction in the endometrial secretion of AA was reported [18]. In the current study, mRNA expression of genes coding PLA2 was decreased in cows fed n-3 PUFA compared with cows fed n-6 PUFA or palm. In accordance with this finding, Coyne et al. [1] reported a 2.2-fold decrease in PLA2 mRNA expression after n-3 PUFA supplementation in bovine endometrium. PLA2 catalyzes the liberation of AA from membrane phospholipids. A reduction in PLA2 mRNA expression after dietary supplementation with n-3 could further reduce the AA available to PG production [8]. Endometrial AA concentrations were decreased in animals offered a high n-3 PUFA compared with a control diet [16]). Therefore, a reduction in serum PLA2 enzyme concentration after decreased gene expression could further reduce the AA available for series 2 PG production [3]. Expression of the gene coding PGHS-2 did not differ among the treatment groups, which was consistent with the previous studies [6,19]. Caldari-Torres et al. [20] reported that incubating bovine endometrial cells with eicosapentaenoic acid and docosahexaenoic acid decreased the secretion of PGF2a. In addition, Mattos et al. [21] reported that bovine endometrial cells incubated with eicosapentaenoic acid, docosahexaenoic acid, or AA did not affect the concentrations of PGHS-2 protein. Expression of PGFS was decreased in cows fed n-3 PUFA compared with other treatments. PGFS converts prostaglandin H2 (as an unstable intermediate in the PG biosynthetic pathway) into PGF2a [22]; the expression of PGES, which in turn augments PGE2 synthesis, also increased after dietary n-3 PUFA supplementation. Endometrial mRNA expression of PGFS and PGES has been reported respectively to be decreased and increased by interferon-s, which is followed by a consequent decrease in PGF2a production in cattle [23]. Hence, establishment of pregnancy may depend not only on inhibition of PGF2a production, but also on increased PGE2 production in pig [24]. A higher PGE2 concentration in the uterine fluid has been reported to be associated with an enhanced
6
E. Dirandeh et al. / Theriogenology xxx (2014) 1–7
Fig. 3. Mean plasma 13, 14-dihydro-15-keto PGF2a (PGFM) concentrations in Holstein cows fed diets based on protected palm oil (PLM; n ¼ 8), extruded linseed (LIN; n ¼ 8), or roasted whole soybeans (SOY; n ¼ 8), (*P < 0.05).
embryonic development and survival rates in rat [25]. Coyne et al. [1] reported the luteotrophic effects of dietary n-3 PUFA through increased mRNA expression of mPGES1, the enzyme critical in PGE2 production in bovine endometrium. PPARs are molecular sensors of FAs and FA derivatives, which control the metabolism [26]. PPAR-d is expressed in a wide range of tissues and cells, including the endometrium, which is vital for normal fertility. It serves as a regulator of PG production and is required for implantation in rodent models [27]. MacLaren et al. [6] suggested a
similar endometrial mRNA expression of PPAR-a and PPARd in cyclic and pregnant Holstein cows. In the present work, the expression of PPAR-a and PPAR-g was not affected after n-3 supplementation, which is in accordance with previous reports [1,6,28]. There is evidence suggesting that PPAR-d is involved in the pregnancy recognition process in cattle and may mediate at least some beneficial effects of long chain n-3 PUFA supplementation [6]. In mice, PPAR-d deficiency results in placental defects and mid gestational mortality [29], suggesting that this nuclear receptor may make a
Fig. 4. Mean plasma 13, 14-dihydro-15-keto PGF2a (PGFM) concentrations after an oxytocin challenge (time ¼ 0) on day 15 of estrous cycle in lactating dairy cows fed diets based on protected palm oil (PLM; n ¼ 20), extruded linseed (LIN; n ¼ 20), or roasted whole soybeans (SOY; n ¼ 20). a-fDifferent letters within a time denote differences (*P < 0.05 and **P < 0.01).
E. Dirandeh et al. / Theriogenology xxx (2014) 1–7
critical contribution to controlling reproductive processes in mammals. In the current study, gene expression of PPARd was increased in cows fed n-3 PUFA compared with other treatment groups. Ding et al. [30] showed that PPARd mRNA is regulated in uterine epithelium during early pregnancy period in rodents and is induced in uterine subluminal stroma by the presence of the blastocyst. 4.1. Conclusions
[9]
[10]
[11] [12]
Overall, uterine endometrial PPAR-d and PGES genes were differentially expressed in cows in the LIN group compared with other experimental groups (P < 0.05). Mean relative gene expression of PLA2 and PGFS was increased in animals fed a SOY diet compared with LIN and PLM diets (P < 0.05). The expression of mRNA for the PGHS-2, PPAR-a, and PPAR-g was not dietarily affected. Dietary inclusion of linseed FAs was associated with a decrease in the PGFM concentration, possibly through a decrease in the expression of genes involved in the PG cascade. The uterine concentration of PGFM, however, was increased in cows fed diets containing n-6 FAs. Investigations as to underlying cellular and molecular mechanisms involved in the effect of diet on alternative intermediate contributing genes in endometrial prostaglandin synthesis would also be of interest.
[13]
[14]
[15] [16]
[17]
[18]
Acknowledgments [19]
This research was funded by Sari agricultural Sciences and natural Resources University (grant number 03-139205). The authors thank the managers and staff of the Mahdasht dairy farm in Sari, northern Iran, and R. Jean François Le Roux, and D. Manager (Nutri Advance Feed and Ingredients, France) for their assistance. References [1] Coyne GS, Kenny DA, Childs S, Sreenan JM, Waters SM. Dietary n3polyunsaturated fatty acids alter the expression of genes involved in prostaglandin biosynthesis in the bovine uterus. Theriogenology 2008;70:772–82. [2] Robinson RS, Pushpakumara PGA, Cheng Z, Peters AR, Abayasekara DEE, Wathes DC. Effects of dietary polyunsaturated fatty acids on ovarian and uterine function in lactating dairy cows. Reproduction 2002;124:119–31. [3] Smith WL, Garavito RM, DeWitt DL. Prostaglandin endoperoxide H synthases (cyclooxygenases)-1 and -2. J Biol Chem 1996;271: 33157–60. [4] Thatcher WW, Binelli M, Burke JM, Staples CR, Ambrose JD, Coelho S. Antiluteolytic signals between conceptus and endometrium. Theriogenology 1997;47:131–40. [5] Santos JEP, Bilby TR, Thatcher WW, Staples CR, Silvestre FT. Long chain fatty acids of diet as factors influencing reproduction in cattle. Reprod Dom Anim 2008;43:23–30. [6] MacLaren LA, Guzeloglu A, Michel F, Thatcher WW. Peroxisome proliferator-activated receptor (PPAR) expression in cultured bovine endometrial cells and response to n-3 fatty acid, growth hormone and agonist stimulation in relation to series 2 prostaglandin production. Dom Anim Endocrinol 2006;30:155–69. [7] Richardson GF, McNiven MA, Petit HV, Duynisveld JL. The effects of dietary n fatty acids on pregnancy rate, plasma prostaglandin metabolite levels, serum progesterone levels, and milk fatty-acid profile in beef cows. Can J Vet Res 2013;77:314–8. [8] Waters SM, Coyne GS, Kenny DA, MacHugh DE, Morris DG. Dietary n-3 polyunsaturated fatty acid supplementation alters the
[20]
[21]
[22]
[23]
[24]
[25] [26] [27]
[28]
[29]
[30]
7
expression of genes involved in the control of fertility in the bovine uterine endometrium. Physiol Genomics 2012;44:878–88. Dirandeh E, Towhidi A, Ansari Pirsaraei Z, Adib Hashemi F, Ganjkhanlou M, Zeinoaldini S, et al. Plasma concentrations of PGFM and uterine and ovarian responses in early lactation dairy cows fed n-3 and n-6 fatty acids. Theriogenology 2013;80:131–7. Mattos R, Staples CR, Arteche A, Wiltbank MC, Diaz FJ, Jenkins TC, et al. The effects of feeding fish oil on uterine secretion of PGF2alpha, milk composition, and metabolic status of periparturient Holstein cows. J Dairy Sci 2004;87:921–32. NRC. Nutrient requirements of dairy cattle. Seventh edition. Washington, DC: National Academy of Science; 2001. Dirandeh E, Towhidi A, Zeinoaldini S, Ganjkhanlou M, Ansari Pirsaraei Z. Effects of different PUFAs supplementation during the postpartum periods of early lactating dairy cows, I: milk yield, metabolic. J Anim Sci 2013;90:1–9. Van Soest PJ, Robertson JB, Lewis BA. Methods for dietary fiber, neutral detergent fiber and non-starch polysaccharides in relation to animal nutrition. J Dairy Sci 1991;74:3583–97. Garoussi MT, Sasani F, Hovareshti P. The histopathological survey of uterine tissue in Holstein dairy cows with or without recorded reproductive disorders. Iranian J Vet Sci Technol 2010;2:101–8. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001;29:e45. Childs S, Carter F, Lynch CO, Sreenan JM, Lonergan P, Hennessy AA, et al. Embryo yield and quality following dietary supplementation of beef heifers with n-3 polyunsaturated fatty acids (PUFA). Theriogenology 2008;70:992–1003. Silvestre FT, Carvalho TS, Francisco N, Santos JE, Staples CR, Jenkins T, et al. Effects of differential supplementation of fatty acids during the peripartum and breeding periods of Holstein cows: I. Uterine and metabolic responses, reproduction, and lactation. J Dairy Sci 2011;94:189–204. Burns PD, Engle TE, Harris MA, Enns RM, Whittier JC. Effect of fish meal supplementation on plasma and endometrial fatty acid composition in nonlactating beef cows. J Anim Sci 2003;81:2840–6. Thatcher WW, Guzeloglu A, Mattos R, Binelli M, Hansen TR, Pru JK. Uterine-conceptus interactions and reproductive failure in cattle. Theriogenology 2001;56:1435–50. Caldari-Torres C, Rodriguez-Sallaberry C, Greene ES, Badinga L. Differential effects of n-3 and n-6 fatty acids on prostaglandin F2a production by bovine endometrial cells. J Dairy Sci 2006;89:971–7. Mattos R, Guzeloglu A, Badinga L, Staples CR, Thatcher WW. Polyunsaturated fatty acids and bovine interferon-s modify phorbol ester-induced secretion of prostaglandin F2a and expression of prostaglandin endoperoxide synthase-2 and phospholipase-A2 in bovine endometrial cells. Biol Reprod 2003;69:780–7. Lindstrom T, Bennett P. Transcriptional regulation of genes for enzymes of the prostaglandin biosynthetic pathway. Prostaglandins Leukot Essent Fatty Acids 2004;70:115–35. Arosh JA, Banu SK, Kimmins S, Chapdelaine P, Maclaren LA, Fortier MA. Effect of interferon-tau on prostaglandin biosynthesis, transport, and signalling at the time of maternal recognition of pregnancy in cattle: evidence of polycrine actions of prostaglandin E2. Endocrinology 2004;145:5280–93. Geisert RD, Zavy MT, Moffatt RJ, Blair RM, Yellin T. Embryonic steroids and the establishment of pregnancy in pigs. J Reprod Fertil Suppl 1990;40:293–305. Kennedy TG. Evidence for a role for prostaglandins in the initiation of blastocyst implantation in the rat. Biol Reprod 1977;16:286–91. Poulsen LL, Siersbæk M, Mandrup S. PPARs: fatty acid sensors controlling metabolism. Semin Cell Dev Biol 2012;23:631–9. Lim H, Gupta RA, Ma WG, Paria BC, Moller DE, Morrow JD, et al. Cyclooxygenase-2-derived prostacyclin mediates embryo implantation in the mouse via PPARd. Gene Dev 1999;13:1561–74. Sheldrick EL, Derecka K, Marshall E, Chin EC, Hodges L, Wathes DC, et al. Peroxisome-proliferator-activated receptors and the control of levels of prostaglandin-endoperoxide synthase 2 by arachidonic acid in the bovine uterus. Biochem J 2007;406:175–83. Barak Y, Liao D, He W, Ong ES, Nelson MC, Olefsky JM, et al. Effects of peroxisome proliferator-activated receptor d on placentation, adiposity, and colorectal cancer. Proc Natl Acad Sci U S A 2002;99: 303–8. Ding NZ, Teng CB, Ma H, Ni H, Ma XH, Xu LB, et al. Peroxisome proliferator-activated receptor d expression and regulation in mouse uterus during embryo implantation and decidualization. Mol Reprod Dev 2003;66:218–24.
