Journal of Applied Microbiology ISSN 1364-5072
ORIGINAL ARTICLE
The endophyte Verticillium Vt305 protects cauliflower against Verticillium wilt € fte1 L. Tyvaert1*, S.C. Francßa1*, J. Debode2 and M. Ho 1 Laboratory of Phytopathology, Department of Crop Protection, Faculty of Bioscience Engineering, Ghent University, Ghent, Belgium 2 Plant Sciences Unit – Crop Protection, Institute for Agricultural and Fisheries Research (ILVO), Merelbeke, Belgium
Keywords biological control, Brassicaceae, colonization, cross-protection, Verticillium isaacii, Verticillium longisporum, Verticillium tricorpus. Correspondence €fte, Laboratory of Phytopathology, Monica Ho Department of Crop Protection, Faculty of Bioscience Engineering, Ghent University, Coupure links 653, Ghent, Belgium. E-mail: [email protected] *These authors contributed equally. 2013/2495: received 12 December 2013, revised 10 February 2014 and accepted 12 February 2014 doi:10.1111/jam.12481
Abstract Aims: To investigate the interaction between cauliflower and the isolate Verticillium Vt305, obtained from a field suppressive to Verticillium wilt of cauliflower, and to evaluate the ability of Verticillium Vt305 to control Verticillium wilt of cauliflower caused by V. longisporum. Methods and Results: Single and combined inoculations of Verticillium Vt305 and V. longisporum were performed on cauliflower seedlings. Symptom development was evaluated, and fungal colonization was measured in the roots, hypocotyl and stem with real-time PCR. No symptoms were observed after single inoculation of Verticillium Vt305, although it colonized the plant tissues. Pre-inoculation of Verticillium Vt305 reduced symptom development and colonization of plant tissues by V. longisporum. Conclusions: Verticillium Vt305 is an endophyte on cauliflower plants and showed effective biological control of V. longisporum in controlled conditions. Significance and Impact of the Study: This work can contribute to the development of a sustainable control measure of V. longisporum in Brassicaceae hosts, which is currently not available. Additionally, this study provides evidence for the different roles of Verticillium species present in the agro-ecosystem.
Introduction Verticillium longisporum is a soil-borne pathogen, causing vascular diseases on economic important Brassicaceae hosts, such as oilseed rape (Brassica napus) and cauliflower (Brassica oleracea L. var botrytis) (Koike et al. 1994; Heale and Karapapa 1999; Steventon et al. 2002; Debode et al. 2005). Verticillium longisporum is a close relative of Verticillium dahliae, but its host range seems to be restricted to crucifers (Karapapa et al. 1997; Johansson et al. 2006; Inderbitzin et al. 2011). Both Brassica vegetables and Brassica oilseeds are commonly grown in Europe. The demand for farming systems based on low use of pesticides has increased so much that Europe has put integrated pest management (IPM) at the top of its agenda (http://horizon2020projects.com/04/12/ 2013). Because an efficient control measure of V. longisporum is not available, development of IPM-compatible strategies to control Verticillium wilt is required. One potential strategy is the use of soil beneficial micro-organisms. Several Journal of Applied Microbiology © 2014 The Society for Applied Microbiology
studies have concentrated on beneficial rhizobacteria to control Verticillium wilt (Berg 1996; Graner et al. 2003; Danielsson et al. 2007; Debode et al. 2007; Abuamsha et al. 2011), but only few studies have focused on beneficial fungi (Alstrom 2000) as potential biological control agents. Different Verticillium species may occur simultaneously in soil. The well-known pathogenic species V. longisporum and V. dahliae have been detected concomitantly with the less-studied species V. tricorpus (Davis and Sorensen 1985; Huisman 1988; Davis et al. 2000; Goud et al. 2003; Debode et al. 2011; Francßa et al. 2013). Interestingly, the presence of V. tricorpus- or V. tricorpus-like organisms has been associated with soil suppressiveness to Verticillium wilt. This correlation was first reported in potato fields in USA (Davis and Sorensen 1985) and, recently, in a cauliflower field in Belgium (Francßa et al. 2013). An isolate of V. tricorpus from the potato suppressive fields was weakly pathogenic on potato in controlled conditions and, in addition, protected the plants against later infection by the pathogen V. dahliae. These findings suggest 1
Biocontrol by Verticillium Vt305
that the presence of V. tricorpus explained, at least in part, the suppressiveness observed in field (Davis and Sorensen 1985; Davis et al. 2000). Nevertheless, information about the pathogenic behaviour of V. tricorpus is conflicting. Some isolates were reported to be weakly or nonpathogenic to several hosts (Ebihara et al. 2003; Qin et al. 2008), while others were pathogenic to some hosts (Isaac 1953; Usami et al. 2011). The differences in pathogenicity among isolates are difficult to interpret, particularly due to limitations in the taxonomy of Verticillium. Recently, Inderbitzin et al. (2011) have shown that what was previously called V. tricorpus is in fact a mixture of multiple morphologically similar species. They have proposed to split V. tricorpus into three species: V. tricorpus, Verticillium klebahnii and Verticillium isaacii. So, it is possible that the isolates used in the different studies cited above belong to different species. Verticillium Vt305 is an isolate obtained from a field suppressive to Verticillium wilt of cauliflower in Belgium. Vt305 is morphologically similar to V. tricorpus, but its rDNA ITS region shows 100% identity with the new species Verticillium isaacii (Francßa et al. 2013). As the use of beneficial micro-organisms originally found in suppressive soils is a good approach for effective biological control of soil-borne pathogens (Cook 1985), it is worthwhile to investigate the role of Vt305 in the suppression of Verticillium wilt of cauliflower. The main objectives of this study were (i) to examine the interaction between Vt305 and cauliflower and (ii) to evaluate the ability of Vt305 to reduce V. longisporum colonization and Verticillium wilt of cauliflower. Materials and methods Verticillium isolates and inoculum preparation Two Verticillium isolates were used throughout this study: V. longisporum O1, isolated from cauliflower (Debode et al. 2005), and Verticillium Vt305, obtained from soil of a cauliflower field (Francßa et al. 2013). These isolates are subsequently referred in the figures to as Vl and Vt, respectively. Four-week-old colonies grown on potato dextrose agar plates at 24°C were used for inoculum preparation. Conidial suspension was obtained by adding sterile water to the plate, rubbing a sterile spatula over the colony and finally filtering the suspension through a sterile cheesecloth. The suspensions were adjusted to the final concentrations (1 9 104 or 1 9 106 conidia ml 1). Seedlings The cauliflower (Brassica oleracea L. var botrytis) cv Clapton was used in the experiments. This cultivar is 2
L. Tyvaert et al.
susceptible to V. longisporum and frequently grown in Belgium. Seeds were surface-sterilized for 1 min in 70% ethanol, followed by 15 min in 1% NaOCl and then rinsed four times in sterile water. Seeds were germinated at 21°C on moistened sterile filter paper in a Petri dish and subsequently placed in trays containing a 1 : 4 mixture of potting soil (universal type1 Structural, Snebbout N.V., Belgium; 20% organic matter, pH 5–65 and E.C of 300 lS cm 1) and sand. The seedlings were grown at 21°C and 16 h of light. Plant inoculation Plantlets were carefully removed from the substrate at the four-leaf stage, and the roots gently shaken and rinsed with tap water to remove residual substrate. The roots were dipped in the conidial suspensions or sterile water for 5 min. The first inoculation consisted of dipping the roots in a conidial suspension of Vt305 or sterile water. One week later, a second inoculation was carried out, using a conidial suspension of V. longisporum or sterile water. Two experiments were carried out using the same inoculation procedure. Verticillium Vt305 was inoculated 1 week before V. longisporum because protective strains have been reported to be more effective when applied a few days before the pathogen (Schnathorst and Mathre 1966; Robinson et al. 2007; Qin et al. 2008; Alabouvette et al. 2009). In experiment 1, two concentrations of V. longisporum were used (104 and 106 conidia ml 1, referred to as low concentration and high concentration, respectively). Vt305 was inoculated only in the concentration of 106 conidia ml 1. In experiment 2, two concentrations of Vt305 were used (104 and 106 conidia ml 1, referred to as low concentration and high concentration, respectively), while V. longisporum was inoculated only in the concentration of 104 conidia ml 1. After the first inoculation, the plants were grown in plastic pots filled with autoclaved substrate (mixture described above), routinely watered and weekly fertilized with Hoagland’s solution. Plants were grown at 18°C and 16 h of light. Disease assessment Four plants per treatment were sampled at 28, 49, 63 and 77 days post inoculation (dpi) in experiment 1 and eight plants per treatment at 27, 49 and 70 dpi, in experiment 2. Vascular discolouration was scored by cutting the stem longitudinally. A scale from 0 to 4 was used in which 0 = no vascular discolouration; 1 = vascular discolouration of ≤25% of stem length; 2 = vascular discolouration of 26–50% of stem length; 3 = vascular discolouration of 51–75% of stem length; and 4 = vascular discolouration of ≥76% of stem length. Journal of Applied Microbiology © 2014 The Society for Applied Microbiology
L. Tyvaert et al.
Biocontrol by Verticillium Vt305
analysis was performed in reactions of 50 ll containing 5 ll template, 300 nmol l 1 of the V. tricorpus primer pair or 200 nmol l 1 of the V. longisporum primer pair, and 25 ll Maxima SYBR Green master mix (Fermentas, St-Leon-Rot, Germany). The thermal profile consisted of an initial denaturation step at 95°C for 10 min, followed by 40 cycles consisting of a first step at 95°C for 15 s and a second step at 60°C for 1 min. Melting curves were obtained by heating the samples to 95°C for 15 s, cooling to 60°C for 15 s and heating again to 95°C for 15 s to verify specific amplification. The standard curve technique was used for quantification, and 10-fold dilution series of DNA (10–106 fg DNA per reaction) from the isolates V. longisporum O1 or Verticillium Vt305 in sterile water were used.
DNA extraction from plant tissues Samples for DNA analysis were taken from the roots and stem. Roots were carefully removed from the substrate and rinsed with tap water to remove residual substrate. Next, the roots and the shoot were weighed. In experiment 1, a 5-cm piece of the lower stem was sampled above the cotyledons. Roots and the stem tissue were transferred to extraction bags (Bioreba, Reinach, Switzerland); 01 mol l 1 Tris-HCl buffer (pH 8) was added and homogenized using the Homex (Homex 6, Bioreba). The obtained suspension was centrifuged at 22 000 g, 5°C for 5 min, the supernatant was discarded, and the pellet was used for further DNA extraction. In experiment 2, the hypocotyl (below cotyledons) and the lower part of the stem (between the first and second leaves) were sampled. The plant tissues were ground with mortar and pestle in liquid nitrogen. In both experiments, DNA was extracted using the Invisorb Spin Plant Mini DNA extraction kit (Invitek, Berlin, Germany). DNA was quantified using a Nanodrop spectrophotometer and stored at 20°C.
Data analysis Data were analysed with nonparametric statistics, using Kruskal–Wallis test (P < 005). Differences between treatments were detected based on Mann–Whitney U-test (P < 005). All data of the experiments were analysed using the software package SPSS 21.0 (Chicago, IL) for windows.
Measurement of fungal colonization with real-time PCR In both experiments, Verticillium Vt305 DNA was amplified using primer pair VtF4 (CCGGTGTTGGGGAT CTACT) and VtR2 (GTAGGGGGTTTAGAGGCTG) (Debode et al. 2011). Verticillium longisporum DNA in experiment 1 was quantified using primer pair VlTubF2 (GCAAAACCCTACCGGGTTATG) and VlTubR1 (AGAT ATCCATCGGACTGTTCGTA) (Debode et al. 2011). In experiment 2, a more sensitive primer pair was used: VlspF1 (AGCCTGAGTCACGAGAGATATGGG) and Vlsp R4 (CAAACCACGCCACTGCATTCTCGT) (Banno et al. 2011). Amplification and melting curve analysis were performed using an ABI PRISM 7900HT Sequence Detection System (Applied Biosystems, Foster city, CA) for experiment 1 and a MX3005P real-time PCR Detection System (Stratagene, Santa Clara, CA) for experiment 2. The
Results Disease assessment In the first experiment, external symptoms of Verticillium wilt were observed in plants inoculated with V. longisporum. Plants singly inoculated with the high concentration of V. longisporum (106 conidia ml 1) produced significantly more leaves than control plants (Table 1) and showed the typical stunted growth, as described by Koike et al. (1994). Plants singly inoculated with Vt305 (106 conidia ml 1) did not develop more leaves than control plants. In addition, leaves of plants inoculated with V. longisporum had a pale green colour (Fig. 1). This symptom was not observed in control plants and
Table 1 Number of leaves (median median absolute deviation) developed 28, 49, 63 and 77 dpi on cauliflower plants inoculated with Verticillium Vt305 (Vt), Verticillium longisporum O1 (Vl) and both (Vt + Vl) in experiment 1. Plants were inoculated twice with a 1-week interval. Control: water + water; Vt(6): 106 conidia of Vt305 ml 1 + water; Vl(4) and Vl(6): 104 or 106 conidia of V. longisporum ml 1 + water; Vt(6) + Vl(4) and Vt(6) + Vl(6): 106 conidia of Vt305 ml 1 + 104 or 106 conidia of V. longisporum ml 1 28 dpi Control Vt(6) Vl(4) Vt(6) + Vl(4) Vl(6) Vt(6) + Vl(6)
100 95 110 90 110 100
49 dpi 00bc 05cd 10ab 00d 10a 00ab
135 135 145 130 150 150
63 dpi 05a 05a 15a 05a 05a 10a
175 180 200 175 215 200
77 dpi 05b 05bc 15ab 05b 10a 10ac
205 200 230 190 250 245
05cd 00d 20abc 05bd 15a 20ab
Medians followed by the same letter are not significantly different according to Mann–Whitney U-test (P < 005)
Journal of Applied Microbiology © 2014 The Society for Applied Microbiology
3
Biocontrol by Verticillium Vt305
L. Tyvaert et al.
(a)
(b)
Vt(6)+Vl(4)
Vl(4)
Vt(6)+Vl(4)
Vl(4)
Figure 1 Symptoms caused by Verticillium longisporum on cauliflower plants and effects of pre-inoculation with Verticillium Vt305. Plants were inoculated with V. longisporum O1 (104 conidia ml 1; Vl(4)); or with Vt305 (106 conidia ml 1) followed by a second inoculation 1 week later with V. longisporum O1 (104 conidia ml 1; Vt(6) + Vl(4)). (a) Stunted growth of plants and (b) pale green colour of leaves after single inoculation of V. longisporum compared with normal growth and colour of the right plant. Plants were examined at 49 dpi.
)
)
(6
(6
VI
VI
)
)+ (6 Vt
a
b
a
a
b
3 2 1
)
)
VI (6
(6
)+ (6 Vt
)+ (6 Vt
VI
VI (4
)
(4 ) VI
) Vt (6
tro l
0
on
VI )+ Vt (6
(4 VI (6 Vt
b
4
(6 )
) (6
VI (4 )+ (6 Vt
VI
)
) (4 VI
Vt
(6
)
0
l
)+
on C (d)
Number of plants
1
tro
)
tro
(6 VI )+
2
on
0
(6 a
a
b
3
C
1
Vt
Vt a
b
b
4
2
)
) (6
(4 (6
C
)+
VI
VI
)
) (4 VI
(6 Vt
tro on
)
0
a
3
(4
1
a
b
ab
VI
2
b
b
4
l
3
(c)
Number of plants
(b)
)
a
(6
a
a
Number of plants
4
a
a
C
a
l
Number of plants
(a)
tration of V. longisporum (104 conidia ml 1) at all time points assessed, but not with the high concentration (106 conidia ml 1). In the second experiment, no external symptoms were observed after inoculation with V. longisporum at 104 conidia ml 1. At 70 dpi, vascular discolouration was found in three plants singly inoculated with V. longisporum and in
Vt
plants inoculated with Vt305 alone or in combination with the low concentration of V. longisporum (104 conidia ml 1). Figure 2 shows that single inoculation with V. longisporum caused vascular discolouration in the stem, while single inoculation with Vt305 did not. Preinoculation with Vt305 completely prevented vascular discolouration of plants challenged with the low concen-
Figure 2 Disease progression 28 dpi (a), 49 dpi (b), 63 dpi (c) and 77 dpi (d) on cauliflower plants inoculated with Vt305 (Vt), Verticillium longisporum O1 (Vl) and both isolates (Vt + Vl) in experiment 1. Plants were inoculated twice with a 1-week interval. Control: water + water; Vt(6): 106 conidia of Vt305 ml 1 + water; Vl(4) and Vl(6): 104 or 106 conidia of V. longisporum ml 1 + water; Vt(6) + Vl(4) and Vt(6) + Vl(6): 106 conidia of Vt305 ml 1 + 104 or 106 conidia of V. longisporum ml 1. Scores for vascular discolouration were used to assess the disease: 0 = no vascular discolouration (□); 1 = vascular discolouration of ≤25% of stem length ( ); 2 = vascular discolouration of 26–50% of stem length ( ); 3 = vascular discolouration of 51–75% of stem length ( ); and 4 = vascular discolouration of ≥76% of stem length (&). Bars indicated with the same letter are not significantly different with a Mann–Whitney U-test (P < 005).
4
Journal of Applied Microbiology © 2014 The Society for Applied Microbiology
L. Tyvaert et al.
Journal of Applied Microbiology © 2014 The Society for Applied Microbiology
ng Vl DNA/g root tissue
DNA levels of V. longisporum and Vt305 were quantified by qPCR. In the first experiment, V. longisporum was detected at all time points in most root samples of plants singly inoculated with both concentrations (104 and 106 conidia ml 1) of the fungus (Fig. 3a,b). Remarkably, at 28 and 49 dpi, V. longisporum was not detected in roots of any plant pre-inoculated with Vt305 (106 conidia ml 1) and challenged with the low concentration of the pathogen (104 conidia ml 1) (Fig. 3a). In addition, at these time points, Vt305 clearly reduced pathogen colonization in the roots of the plants challenged with the high concentration of V. longisporum (106 conidia ml 1) (Fig. 3b). Detection of V. longisporum in the stem was less frequent than that in the roots. At 28 dpi, V. longisporum was detected in the stem only when it was applied at high concentration (one plant in the single treatment and one in the combination with Vt305, data not shown). At later time points, the pathogen was detected in the stem of one plant per time point in the plants singly inoculated with the low concentration of V. longisporum, but not in the stem of any plant pre-inoculated with Vt305. At 63 dpi, most of the plants treated with the high concentration of V. longisporum contained the pathogen in the stem, and no difference in amount of DNA was found between single inoculation (012 0072 ng DNA per g stem tissue, n = 3) and combination with Vt305 (036 033 ng DNA per g stem tissue, n = 4). The frequency of detection at 77 dpi decreased in plants pre-inoculated with Vt305 (002 ng DNA per g stem tissue, n = 1), but remained high in plants singly inoculated (046 00057 ng DNA per g stem tissue, n = 3). Vt305 DNA was detected in the roots of all plants singly inoculated with Vt305 at 106 conidia ml 1 or in combination with V. longisporum (both concentrations) (Fig. 3c). When singly inoculated, Vt305 was detected in the stem of one plant at 28 dpi, one plant at 49 dpi and four plants at 63 dpi. When combined with V. longisporum, Vt305 was detected in the stem of one plant at each of the last two time points (63 and 77 dpi) in the low concentration and in one plant at 28 dpi in the high concentration (data not shown). In the second experiment, the levels of Vt305 DNA found in plant tissue were higher than those in the first experiment. This could be due to the different processing method used for grinding samples in the second experiment. The amount of V. longisporum DNA in the roots was decreased by pre-inoculation with Vt305 (Fig. 4a). At
2 (3) 1·5
(4)
1 (4) 0·5 (0)
(1)
(0)
(4)
(1)
0 28 dpi (b) 60 ng Vl DNA/g root tissue
Colonization of plant tissues
(a)
49 dpi
77 dpi
50 40 30 (4)
20
(4)
10 28 dpi
(c)
63 dpi
(4)
(3)
(4) (4)
(4) (3)
49 dpi
63 dpi
77 dpi
0
ng Vt305 DNA/g root tissue
one plant inoculated with the low concentration of Vt305 (104 conidia ml 1) and with V. longisporum.
Biocontrol by Verticillium Vt305
0·8 (4) 0·6 0·4
(4) (4)
(4)
(4)
(4)
0·2
(4)
(4) (4) (4)
0 28 dpi
49 dpi
63 dpi
(4)
(4)
77 dpi
Figure 3 Amount of Verticillium longisporum DNA (a and b) and Vt305 DNA (c) in the roots of cauliflower plants inoculated with V. longisporum O1 (Vl), Vt305 (Vt) and both (Vt + Vl) in experiment 1 at 28, 49, 63 and 77 dpi. Plants were inoculated twice with a 1-week interval. Control: water + water; Vt(6): 106 conidia of Vt305 ml 1 + water; Vl(4) and Vl(6): 104 or 106 conidia of V. longisporum ml 1 + water; Vt(6) + Vl(4) and Vt(6) + Vl(6): 106 conidia of Vt305 ml 1 + 104 or 106 conidia of V. longisporum ml 1. Four plants per treatment were analysed, and the number of plants with detection is indicated between brackets (n). Verticillium longisporum DNA was measured for treatments Vl(4) ( ), Vt(6) + Vl(4) (□), Vl(6) (■) and Vt(6) + Vl(6) ( ). Vt305 DNA was measured for treatments Vt(6) ( ), Vt(6) + Vl(4) ( ) and Vt(6) + Vl(6) ( ). Data are the median of the amount of DNA from the (n) plants, and vertical bars are the median absolute deviation of the amount of DNA from the (n) plants.
49 and 70 dpi, significant differences were found among plants singly inoculated with V. longisporum (104 conidia ml 1) and plants pre-inoculated with Vt305 at 104 or 106 conidia ml 1 (Fig. 4a). At 49 dpi, the hypocotyl and the stem were also clearly less colonized by the pathogen 5
Biocontrol by Verticillium Vt305
L. Tyvaert et al.
when plants were pre-inoculated with Vt305 (both concentrations) (Fig. 4b,c). At 70 dpi, the differences in stem colonization between plants singly inoculated and plants pre-inoculated with Vt305 remained remarkable for both concentrations. However, in the hypocotyl, the amount of V. longisporum DNA was reduced only when plants
were treated with the high dose of Vt305 (106 conidia ml 1) (Fig. 4b,c). As in the first experiment, Vt305 DNA was detected in the root system of all plants in the second experiment (Fig. 4d). Differently, the frequency of Vt305 detection in the shoot was higher in the second experiment than in
V. longisporum
(8) a
4·0 3·0
(8) a (8) (7) a a
(8) b (6) c
(6) (7) ab b
0·0 27 dpi (b)
120
(8) a
2·0 1·0
(8) a
(d) 140
5·0
49 dpi
ng DNA/g tissue
ng DNA/g tissue
Roots
(a)
Vt305
(8) a
100 80 60 40
(8) ab (8) b
20
(8) (8) a (8) a (8) a b
(8) a (8) (8) (8) bc ab c
0
70 dpi
27 dpi
49 dpi
70 dpi (8) a
(e) 210
0·6
0·4
(8) a
(8) a
ng DNA/g tissue
ng DNA/g tissue
Hypocotyl
180 (7) ab
0·2 (8) b
(8) b
(7) b
(8) (8) b c
(8) ab
(7) (8) a a
49 dpi
70 dpi
(f) 1·5
(8) a
0·1 0·05
(8) a
60
70 dpi
(8) a
(8) b
(8) b
(7) b
0
(6) ab
ng DNA/g tissue
ng DNA/g tissue
Stem
0·15
(8) a
90
0 49 dpi
0·2
120
30
0
(c)
150
(8) a
1·2 0·9 0·6 0·3
(7) (6) (7) b c bc
(8) a
(8) bc
(7) c
(8) b
0·0 49 dpi
70 dpi
49 dpi
70 dpi
Figure 4 Amount of Verticillium longisporum DNA (a–c) and Vt305 DNA (d–f) in the roots (a and d), the hypocotyl (b and e) and the stem (c and f) of cauliflower plants inoculated with V. longisporum O1 (Vl), Vt305 (Vt) and both isolates (Vt + Vl) in experiment 2 at 27, 49 and 70 dpi. Plants were inoculated twice with a 1-week interval. Control: water + water; Vt(4) and Vt(6): 104 or 106 conidia of Vt305 ml 1 + water; Vl(4): 104 conidia of V. longisporum ml 1 + water; Vt(4) + Vl(4) and Vt(6) + Vl(4): 104 or 106 conidia of Vt305 ml 1 + 104 conidia of V. longisporum ml 1. Eight plants per treatment were analysed, and the number of plants with detection is indicated between brackets (n). V. longisporum DNA was measured for treatments Vl(4) (■), Vt(4) + Vl(4) ( ), Vt(6) + Vl(4) (□). Vt305 DNA was measured for treatments Vt(4) ( ), Vt(4) + Vl(4) ( ), Vt(6) ( ) and Vt(6) + Vl(4) ( ). Data are the median of the amount of DNA from the (n) plants, and vertical bars are the median absolute deviation of the amount of DNA from the (n) plants. Within one time point, different letters indicate results, which differ significantly at P < 005 by the Mann–Whitney U-Test.
6
Journal of Applied Microbiology © 2014 The Society for Applied Microbiology
L. Tyvaert et al.
the first one: Vt305 was detected in nearly all plants in the different treatments (Fig. 4e,f). At 49 dpi, the levels of Vt305 DNA in the roots, hypocotyl and stem of plants singly inoculated with Vt305 were lower in the treatment with low concentration (104 conidia ml 1) than in that with high concentration (106 conidia ml 1) (Fig. 4d–f). Interestingly, the inoculation of V. longisporum in plants pre-inoculated with the low concentration of Vt305 markedly increased the amount of Vt305 DNA in the roots (27 and 49 dpi) and stem (70 dpi), compared with single inoculation with the same concentration (Fig. 4d, f). In both experiments, the amount of Vt305 and V. longisporum DNA in the roots declined over time. This was probably caused by a difference in growth rate between the Verticillium species and the roots. Discussion In this work, we have shown that Verticillium Vt305 could colonize the roots, hypocotyl and stem of cauliflower plants without inducing symptoms. This behaviour corresponds to an endophytic lifestyle (Petrini 1991). Vt305 was capable of controlling Verticillium wilt caused by V. longisporum on cauliflower, because colonization by the pathogen and symptom development were reduced on plants pre-inoculated with Vt305. Defence-related events, especially in roots, seemed to be involved in the cross-protection. Endophytism seems to be a common phenomenon in the genus Verticillium, although often overlooked (Lacy and Horner 1966; Malcolm et al. 2013). It has been demonstrated that certain isolates of V. dahliae, V. alboatrum and V. tricorpus can colonize their hosts and yet cause no or minor vascular discolouration and do not develop external symptoms (Skotland 1971; Ebihara et al. 2003; Chen et al. 2004; Robinson et al. 2006; Qin et al. 2008; Iglesias-Garcia et al. 2013; Malcolm et al. 2013). However, it is still unclear whether the endophytic behaviour is generally an intrinsic characteristic of certain isolates or rather the outcome of specific interactions between potential pathogenic isolates and some hosts (Malcolm et al. 2013). Currently, we are studying the interaction of Vt305 with other important cash and cover crops that may be grown in rotation with cauliflower. Verticillium endophytic isolates may belong to the above-mentioned Verticillium species or to new species. For example, the V. tricorpus isolates from California that asymptomatically colonize lettuce and artichoke (Qin et al. 2008) were recently reclassified into a new species, V. isaacii (Inderbitzin et al. 2011), interestingly, also Vt305 is morphologically similar to V. tricorpus, but its rDNA ITS region shows 100% identity with V. isaacii (Francßa et al. 2013). Symptom development and colonization by V. longisporum were clearly reduced by pre-inoculation of cauliJournal of Applied Microbiology © 2014 The Society for Applied Microbiology
Biocontrol by Verticillium Vt305
flower plants with Vt305. To our knowledge, this is the first study demonstrating cross-protection against V. longisporum on a member of the family Brassicaceae. In controlled conditions, cross-protection against V. dahliae and V. albo-atrum has been previously shown on other plant families, such as Asteraceae (lettuce), Solanaceae (tomato and potato) and Malvaceae (cotton) (Schnathorst and Mathre 1966; Matta and Garibaldi 1977; Davis and Sorensen 1985; Robinson et al. 2007; Qin et al. 2008; Shittu et al. 2009). The mechanisms by which endophytic Verticillium isolates protect plants against Verticillium wilt remain poorly understood. Antagonism is probably not involved in this type of protection. Vt305 did not affect the growth of V. longisporum on potato dextrose agar medium (data not shown). A similar interaction in vitro was observed between endophytic and pathogenic V. dahliae isolates of tomato (Shittu et al. 2009). Competition for infection sites and induced resistance are the most likely mechanisms, as suggested by Robinson et al. (2007), Qin et al. (2008) and Shittu et al. (2009). That root colonization by V. longisporum was consistently reduced in plants pre-inoculated with Vt305 points to the importance of defence-related events in roots. On the one hand, the application of Vt305 may have reduced the availability of specific sites on roots and hindered posterior colonization by V. longisporum, resulting in protection through competition. On the other hand, Vt305 may have induced resistance in the roots. A recent study concerning crossprotection of Fusarium wilt supports the latter mechanism (Aime et al. 2013). They have shown that the endophyte Fusarium oxysporum Fo47 induces resistance against a pathogenic F. oxysporum by priming the tomato roots for a stronger expression of defence responses in roots. It is also worthwhile to highlight the study of Iven et al. (2012) in which they emphasize the role of root defences against V. longisporum infection on oilseed rape. The authors suggested that tryptophan-derived metabolites produced in the infected roots are implicated in the defence against V. longisporum. Most of the phytoalexins of Brassica species, including cauliflower, are derived from tryptophan (Pedras et al. 2006). It would be interesting to investigate whether priming for phytoalexins or other defence-related compounds is involved in the Vt305-induced resistance to V. longisporum in cauliflower roots. The best levels of protection were achieved when Vt305 was applied in the high dose and the plant challenged with the low dose of V. longisporum. Our results are in agreement with other studies (Schnathorst and Mathre 1966; Shcherbakova et al. 2011) and indicate that both the dose of the endophyte and the dose of the pathogen influence the efficiency of disease control. 7
Biocontrol by Verticillium Vt305
The inoculation of V. longisporum in plants pre-inoculated with the low dose of Vt305 markedly increased the amount of Vt305 DNA in the roots and stem compared with single inoculation with the same concentration. We hypothesize that interplay between both fungi and the plant occurred. One possibility is that the plants attacked by V. longisporum produced chemical compounds that stimulated colonization by Vt305 and increased the chance of protection. This type of reaction has been shown to occur in the interaction between the beneficial rhizobacterium Bacillus subtilis FB17 and the foliar pathogen Pseudomonas syringae pv. tomato on Arabidopsis (Rudrappa et al. 2008). Upon pathogen attack, bacterial population was stimulated by root metabolites produced by Arabidopsis. Another more likely explanation concerns the mechanisms used by plant pathogens to suppress defence responses and colonize their hosts (Fradin and Thomma 2006; Nishimura and Dangl 2010). The low dose of Vt305 did not completely protect the plant against V. longisporum, allowing penetration by the pathogen that tried to suppress host defences to facilitate infection. Vt305 could have taken advantage of the transient lower level of plant resistance caused by the pathogen to colonize cauliflower roots and stem more extensively than in the absence of the pathogen. This hypothesis is supported by the observation that Vt305 DNA did not increase in the co-inoculation treatment with the pathogen at the high dose of Vt305 that effectively suppressed colonization by the pathogen (Fig. 4). In this study, we have demonstrated that Verticillium Vt305 is an endophyte on cauliflower and can control the pathogen V. longisporum in this host. These results indicate the potential of Vt305 to be developed as biological control agent of Verticillium wilt. Acknowledgements This work was part of a long-term collaboration with D. Callens and S. Pollet from Inagro and L. De Rooster and K. Spiessens from PSKW and was supported by the government agency for Innovation by Science and Technology (IWT). This research has benefitted from a statistical consult with Ghent University FIRE (Fostering Innovative Research based on Evidence). Conflict of interest No conflict of interest declared. References Abuamsha, R., Salman, M. and Ehlers, R. (2011) Differential resistance of oilseed rape cultivars (Brassica napus ssp 8
L. Tyvaert et al.
oleifera) to Verticillium longisporum infection is affected by rhizosphere colonisation with antagonistic bacteria, Serratia plymuthica and Pseudomonas chlororaphis. BioControl 56, 101–112. Aime, S., Alabouvette, C., Steinberg, C. and Olivain, C. (2013) The endophytic strain Fusarium oxysporum Fo47: a good candidate for priming the defense responses in tomato roots. Mol Plant Microbe In 26, 918–926. Alabouvette, C., Olivain, C., Migheli, Q. and Steinberg, C. (2009) Microbiological control of soil-borne phytopathogenic fungi with special emphasis on wiltinducing Fusarium oxysporum. New Phytol 184, 529–544. Alstrom, S. (2000) Root-colonizing fungi from oilseed rape and their inhibition of Verticillium dahliae. J Phytopathol 148, 417–423. Banno, S., Saito, H., Sakai, H., Urushibara, T., Ikeda, K., Kabe, T., Kemmochi, I. and Fujimura, M. (2011) Quantitative nested real-time PCR detection of Verticillium longisporum and V. dahliae in the soil of cabbage fields. J Gen Plant Pathol 77, 282–291. Berg, G. (1996) Rhizobacteria of oilseed rape antagonistic to Verticillium dahliae var longisporum Stark. J Plant Dis Prot 103, 20–30. Chen, P., Lee, B. and Robb, J. (2004) Tolerance to a non-host isolate of Verticillium dahliae in tomato. Physiol Mol Plant Pathol 64, 283–291. Cook, R.J. (1985) Biological control of plant pathogens: theory to application. Phytopathology 75, 25–29. Danielsson, J., Reva, O. and Meijer, J. (2007) Protection of oilseed rape (Brassica napus) toward fungal pathogens by strains of plant-associated Bacillus amyloliquefaciens. Microbial Ecol 54, 134–140. Davis, J.R. and Sorensen, L.H. (1985) Association of Verticillium tricorpus with Verticillium dahliae and potato early dying. Phytopathology 75, 1279. Davis, J.R., Everson, D.O., Sorensen, L.H. and Schneider, A.T. (2000) Association of Verticillium tricorpus with soil suppressiveness of Verticillium wilt of potato. In Advances in Verticillium Research and Disease Management ed. Tjamos, E.C., Rowe, R.C., Heale, J.B. and Fravel, D.R. pp 347–351. St. Paul: APS. Debode, J., Clewes, E., De Backer, G. and H€ ofte, M. (2005) Lignin is involved in the reduction of Verticillium dahliae var. longisporum inoculum in soil by crop residue incorporation. Soil Biol Biochem 37, 301–309. Debode, J., De Maeyer, K., Perneel, M., Pannecoucque, J., De Backer, G. and H€ ofte, M. (2007) Biosurfactants are involved in the biological control of Verticillium microsclerotia by Pseudomonas spp. J Appl Microbiol 103, 1184–1196. Debode, J., Van Poucke, K., Francßa, S.C., Maes, M., H€ ofte, M. and Heungens, K. (2011) Detection of multiple Verticillium species in soil using density flotation and real-time polymerase chain reaction. Plant Dis 95, 1571–1580.
Journal of Applied Microbiology © 2014 The Society for Applied Microbiology
L. Tyvaert et al.
Ebihara, Y., Nagao, H., Uematsu, S., Moriwaki, J. and Kimishima, E. (2003) First report of Verticillium tricorpus isolated from potato tubers in Japan. Mycoscience 44, 481–488. Fradin, E.F. and Thomma, B.P.H.J. (2006) Physiology and molecular aspects of Verticillium wilt diseases caused by V. dahliae and V. albo-atrum. Mol Plant Pathol 7, 71–86. Francßa, S.C., Spiessens, K., Pollet, S., Debode, J., De Rooster, L., Callens, D. and H€ ofte, M. (2013) Population dynamics of Verticillium species in cauliflower fields: influence of crop rotation, debris removal and ryegrass incorporation. Crop Prot 54, 134–141. Goud, J.K.C., Temorshuizen, A.J. and Gams, W. (2003) Morphology of Verticillium dahliae and V. tricorpus on semi-selective media used for the detection of V. dahliae in soil. Mycol Res 107, 822–830. Graner, G., Persson, P., Meijer, J. and Alstrom, S. (2003) A study on microbial diversity in different cultivars of Brassica napus in relation to its wilt pathogen, Verticillium longisporum. FEMS Microbiol Lett 224, 269–276. Heale, J.B. and Karapapa, V.K. (1999) The Verticillium threat to Canada’s major oilseed crop: canola. Can J Plant Pathol 21, 1–7. Huisman, O.C. (1988) Seasonal colonization of roots of fieldgrown cotton by Verticillium dahliae and Verticillium tricorpus. Phytopathology 78, 708–716. Iglesias-Garcia, A.M., Villarroel-Zeballos, M.I., Feng, C., du Toit, L.J. and Correll, J.C. (2013) Pathogenicity, virulence, and vegetative compatibility grouping of Verticillium isolates from Spinach Seed. Plant Dis 97, 1457–1469. Inderbitzin, P., Bostock, R.M., Davis, R.M., Usami, T., Platt, H.W. and Subbarao, K.V. (2011) Phylogenetics and taxonomy of the fungal vascular wilt pathogen Verticillium, with the descriptions of five new species. PLoS One 6, e28341. Isaac, I. (1953) A further comparative study of pathogenic isolates of Verticillium: V. nubilum Pethybr. and V. tricorpus sp. Nov. T Brit Mycol Soc 36, 180–195. Iven, T., K€ onig, S., Singh, S., Braus-Stromeyer, S.A., Bischoff, M., Tietze, L.F., Braus, G.H., Lipka, V. et al. (2012) Transcriptional activation and production of tryptophanderived secondary metabolites in Arabidopsis roots contributes to the defense against the fungal vascular pathogen Verticillium longisporum. Mol Plant 5, 1389–1402. Johansson, A., Goud, J.K.C. and Dixelius, C. (2006) Plant host range of Verticillium longisporum and microsclerotia density in Swedish soils. Eur J Plant Pathol 114, 139–149. Karapapa, V.K., Bainbridge, B.W. and Heale, J.B. (1997) Morphological and molecular characterization of Verticillium longisporum comb. Nov., pathogenic to oilseed rape. Mycol Res 101, 1281–1294. Koike, S.T., Subbarao, K.V., Davis, R.M., Gordon, T.R. and Hubbard, J.C. (1994) Verticillium wilt of cauliflower in California. Plant Dis 78, 1116–1121. Lacy, M.L. and Horner, C.E. (1966) Behavior of Verticillium dahliae in rhizosphere and on roots of plants
Journal of Applied Microbiology © 2014 The Society for Applied Microbiology
Biocontrol by Verticillium Vt305
susceptible resistant and immune to wilt. Phytopathology 56, 427–430. Malcolm, G.M., Kuldau, G.A., Gugino, B.K. and JimenezGasco, M.D. (2013) Hidden host plant associations of soilborne fungal pathogens: an ecological perspective. Phytopathology 103, 538–544. Matta, A. and Garibaldi, A. (1977) Control of Verticillium wilt of tomato by preinoculation with avirulent fungi. Neth J Pl Path 83, 457–462. Nishimura, M.T. and Dangl, J.L. (2010) Arabidopsis and the plant immune system. Plant J 61, 1053–1066. Pedras, M.S.C., Sarwar, M.G., Suchy, M. and Adio, A.M. (2006) The phytoalexins from cauliflower, caulilexins A, B and C: isolation, structure determination, syntheses and antifungal activity. Phytochemistry 67, 1503–1509. Petrini, O. (1991) Fungal endophytes of tree leaves. In Microbial Ecology of Leaves ed. Andrews, J.H. and Hirano, S.S. pp 179–187. New York: Springer-Verlag. Qin, Q., Valllad, G.E. and Subbarao, K.V. (2008) Characterization of Verticillium dahliae and V. tricorpus isolates from Lettuce and Artichoke. Plant Dis 92, 69–77. Robinson, N., Platt, H.W. and Hale, L. (2006) Potato plant and tuber infection and soil colonization by Verticillium tricorpus and Verticillium albo-atrum “group 2”. Can J Plant Pathol 28, 540–547. Robinson, N., Platt, H.W. and Lawrence, R.H. (2007) Interactions of various Verticillium species in combination with V. albo-atrum on Verticillium wilt disease development in potato. Am J Potato Res 84, 133–141. Rudrappa, T., Czymmek, K.J., Pare, P.W. and Bais, H.P. (2008) Root-secreted malic acid recruits beneficial soil bacteria. Plant Physiol 148, 1547–1556. Schnathorst, W.C. and Mathre, D.E. (1966) Cross-Protection in cotton with strains of Verticillium albo-atrum. Phytopathology 56, 1204–1209. Shcherbakova, L.A., Nazarova, T.A., Mikityuk, O.D. and Fravel, D.R. (2011) Fusarium sambucinum isolate FS-94 induces resistance against Fusarium wilt of tomato via activation and priming of a salicylic acid-dependent signaling system. Russ J Plant Physiol 58, 808–818. Shittu, H.O., Castroverd, D.C.M., Nazar, R.N. and Robb, J. (2009) Plant-endophyte interplay protects tomato against a virulent Verticillium. Planta 229, 415–426. Skotland, C.B. (1971) Pathogenic and nonpathogenic Verticillium species from South Central Washington. Phytopathology 61, 435–436. Steventon, L.A., Fahleson, J., Hu, Q. and Dixelius, C. (2002) Identification of the causal agent of Verticillium wilt of winter oilseed rape in Sweden, V. longisporum. Mycol Res 106, 570–578. Usami, T., Kanto, T., Inderbitzin, P., Itoh, M., Kisaki, G., Ebihara, Y., Suda, W., Amemiya, Y. et al. (2011) Verticillium tricorpus causing lettuce wilt in Japan differs genetically from California lettuce isolates. J Gen Plant Pathol 77, 17–23.
9
ORIGINAL ARTICLE
The endophyte Verticillium Vt305 protects cauliflower against Verticillium wilt € fte1 L. Tyvaert1*, S.C. Francßa1*, J. Debode2 and M. Ho 1 Laboratory of Phytopathology, Department of Crop Protection, Faculty of Bioscience Engineering, Ghent University, Ghent, Belgium 2 Plant Sciences Unit – Crop Protection, Institute for Agricultural and Fisheries Research (ILVO), Merelbeke, Belgium
Keywords biological control, Brassicaceae, colonization, cross-protection, Verticillium isaacii, Verticillium longisporum, Verticillium tricorpus. Correspondence €fte, Laboratory of Phytopathology, Monica Ho Department of Crop Protection, Faculty of Bioscience Engineering, Ghent University, Coupure links 653, Ghent, Belgium. E-mail: [email protected] *These authors contributed equally. 2013/2495: received 12 December 2013, revised 10 February 2014 and accepted 12 February 2014 doi:10.1111/jam.12481
Abstract Aims: To investigate the interaction between cauliflower and the isolate Verticillium Vt305, obtained from a field suppressive to Verticillium wilt of cauliflower, and to evaluate the ability of Verticillium Vt305 to control Verticillium wilt of cauliflower caused by V. longisporum. Methods and Results: Single and combined inoculations of Verticillium Vt305 and V. longisporum were performed on cauliflower seedlings. Symptom development was evaluated, and fungal colonization was measured in the roots, hypocotyl and stem with real-time PCR. No symptoms were observed after single inoculation of Verticillium Vt305, although it colonized the plant tissues. Pre-inoculation of Verticillium Vt305 reduced symptom development and colonization of plant tissues by V. longisporum. Conclusions: Verticillium Vt305 is an endophyte on cauliflower plants and showed effective biological control of V. longisporum in controlled conditions. Significance and Impact of the Study: This work can contribute to the development of a sustainable control measure of V. longisporum in Brassicaceae hosts, which is currently not available. Additionally, this study provides evidence for the different roles of Verticillium species present in the agro-ecosystem.
Introduction Verticillium longisporum is a soil-borne pathogen, causing vascular diseases on economic important Brassicaceae hosts, such as oilseed rape (Brassica napus) and cauliflower (Brassica oleracea L. var botrytis) (Koike et al. 1994; Heale and Karapapa 1999; Steventon et al. 2002; Debode et al. 2005). Verticillium longisporum is a close relative of Verticillium dahliae, but its host range seems to be restricted to crucifers (Karapapa et al. 1997; Johansson et al. 2006; Inderbitzin et al. 2011). Both Brassica vegetables and Brassica oilseeds are commonly grown in Europe. The demand for farming systems based on low use of pesticides has increased so much that Europe has put integrated pest management (IPM) at the top of its agenda (http://horizon2020projects.com/04/12/ 2013). Because an efficient control measure of V. longisporum is not available, development of IPM-compatible strategies to control Verticillium wilt is required. One potential strategy is the use of soil beneficial micro-organisms. Several Journal of Applied Microbiology © 2014 The Society for Applied Microbiology
studies have concentrated on beneficial rhizobacteria to control Verticillium wilt (Berg 1996; Graner et al. 2003; Danielsson et al. 2007; Debode et al. 2007; Abuamsha et al. 2011), but only few studies have focused on beneficial fungi (Alstrom 2000) as potential biological control agents. Different Verticillium species may occur simultaneously in soil. The well-known pathogenic species V. longisporum and V. dahliae have been detected concomitantly with the less-studied species V. tricorpus (Davis and Sorensen 1985; Huisman 1988; Davis et al. 2000; Goud et al. 2003; Debode et al. 2011; Francßa et al. 2013). Interestingly, the presence of V. tricorpus- or V. tricorpus-like organisms has been associated with soil suppressiveness to Verticillium wilt. This correlation was first reported in potato fields in USA (Davis and Sorensen 1985) and, recently, in a cauliflower field in Belgium (Francßa et al. 2013). An isolate of V. tricorpus from the potato suppressive fields was weakly pathogenic on potato in controlled conditions and, in addition, protected the plants against later infection by the pathogen V. dahliae. These findings suggest 1
Biocontrol by Verticillium Vt305
that the presence of V. tricorpus explained, at least in part, the suppressiveness observed in field (Davis and Sorensen 1985; Davis et al. 2000). Nevertheless, information about the pathogenic behaviour of V. tricorpus is conflicting. Some isolates were reported to be weakly or nonpathogenic to several hosts (Ebihara et al. 2003; Qin et al. 2008), while others were pathogenic to some hosts (Isaac 1953; Usami et al. 2011). The differences in pathogenicity among isolates are difficult to interpret, particularly due to limitations in the taxonomy of Verticillium. Recently, Inderbitzin et al. (2011) have shown that what was previously called V. tricorpus is in fact a mixture of multiple morphologically similar species. They have proposed to split V. tricorpus into three species: V. tricorpus, Verticillium klebahnii and Verticillium isaacii. So, it is possible that the isolates used in the different studies cited above belong to different species. Verticillium Vt305 is an isolate obtained from a field suppressive to Verticillium wilt of cauliflower in Belgium. Vt305 is morphologically similar to V. tricorpus, but its rDNA ITS region shows 100% identity with the new species Verticillium isaacii (Francßa et al. 2013). As the use of beneficial micro-organisms originally found in suppressive soils is a good approach for effective biological control of soil-borne pathogens (Cook 1985), it is worthwhile to investigate the role of Vt305 in the suppression of Verticillium wilt of cauliflower. The main objectives of this study were (i) to examine the interaction between Vt305 and cauliflower and (ii) to evaluate the ability of Vt305 to reduce V. longisporum colonization and Verticillium wilt of cauliflower. Materials and methods Verticillium isolates and inoculum preparation Two Verticillium isolates were used throughout this study: V. longisporum O1, isolated from cauliflower (Debode et al. 2005), and Verticillium Vt305, obtained from soil of a cauliflower field (Francßa et al. 2013). These isolates are subsequently referred in the figures to as Vl and Vt, respectively. Four-week-old colonies grown on potato dextrose agar plates at 24°C were used for inoculum preparation. Conidial suspension was obtained by adding sterile water to the plate, rubbing a sterile spatula over the colony and finally filtering the suspension through a sterile cheesecloth. The suspensions were adjusted to the final concentrations (1 9 104 or 1 9 106 conidia ml 1). Seedlings The cauliflower (Brassica oleracea L. var botrytis) cv Clapton was used in the experiments. This cultivar is 2
L. Tyvaert et al.
susceptible to V. longisporum and frequently grown in Belgium. Seeds were surface-sterilized for 1 min in 70% ethanol, followed by 15 min in 1% NaOCl and then rinsed four times in sterile water. Seeds were germinated at 21°C on moistened sterile filter paper in a Petri dish and subsequently placed in trays containing a 1 : 4 mixture of potting soil (universal type1 Structural, Snebbout N.V., Belgium; 20% organic matter, pH 5–65 and E.C of 300 lS cm 1) and sand. The seedlings were grown at 21°C and 16 h of light. Plant inoculation Plantlets were carefully removed from the substrate at the four-leaf stage, and the roots gently shaken and rinsed with tap water to remove residual substrate. The roots were dipped in the conidial suspensions or sterile water for 5 min. The first inoculation consisted of dipping the roots in a conidial suspension of Vt305 or sterile water. One week later, a second inoculation was carried out, using a conidial suspension of V. longisporum or sterile water. Two experiments were carried out using the same inoculation procedure. Verticillium Vt305 was inoculated 1 week before V. longisporum because protective strains have been reported to be more effective when applied a few days before the pathogen (Schnathorst and Mathre 1966; Robinson et al. 2007; Qin et al. 2008; Alabouvette et al. 2009). In experiment 1, two concentrations of V. longisporum were used (104 and 106 conidia ml 1, referred to as low concentration and high concentration, respectively). Vt305 was inoculated only in the concentration of 106 conidia ml 1. In experiment 2, two concentrations of Vt305 were used (104 and 106 conidia ml 1, referred to as low concentration and high concentration, respectively), while V. longisporum was inoculated only in the concentration of 104 conidia ml 1. After the first inoculation, the plants were grown in plastic pots filled with autoclaved substrate (mixture described above), routinely watered and weekly fertilized with Hoagland’s solution. Plants were grown at 18°C and 16 h of light. Disease assessment Four plants per treatment were sampled at 28, 49, 63 and 77 days post inoculation (dpi) in experiment 1 and eight plants per treatment at 27, 49 and 70 dpi, in experiment 2. Vascular discolouration was scored by cutting the stem longitudinally. A scale from 0 to 4 was used in which 0 = no vascular discolouration; 1 = vascular discolouration of ≤25% of stem length; 2 = vascular discolouration of 26–50% of stem length; 3 = vascular discolouration of 51–75% of stem length; and 4 = vascular discolouration of ≥76% of stem length. Journal of Applied Microbiology © 2014 The Society for Applied Microbiology
L. Tyvaert et al.
Biocontrol by Verticillium Vt305
analysis was performed in reactions of 50 ll containing 5 ll template, 300 nmol l 1 of the V. tricorpus primer pair or 200 nmol l 1 of the V. longisporum primer pair, and 25 ll Maxima SYBR Green master mix (Fermentas, St-Leon-Rot, Germany). The thermal profile consisted of an initial denaturation step at 95°C for 10 min, followed by 40 cycles consisting of a first step at 95°C for 15 s and a second step at 60°C for 1 min. Melting curves were obtained by heating the samples to 95°C for 15 s, cooling to 60°C for 15 s and heating again to 95°C for 15 s to verify specific amplification. The standard curve technique was used for quantification, and 10-fold dilution series of DNA (10–106 fg DNA per reaction) from the isolates V. longisporum O1 or Verticillium Vt305 in sterile water were used.
DNA extraction from plant tissues Samples for DNA analysis were taken from the roots and stem. Roots were carefully removed from the substrate and rinsed with tap water to remove residual substrate. Next, the roots and the shoot were weighed. In experiment 1, a 5-cm piece of the lower stem was sampled above the cotyledons. Roots and the stem tissue were transferred to extraction bags (Bioreba, Reinach, Switzerland); 01 mol l 1 Tris-HCl buffer (pH 8) was added and homogenized using the Homex (Homex 6, Bioreba). The obtained suspension was centrifuged at 22 000 g, 5°C for 5 min, the supernatant was discarded, and the pellet was used for further DNA extraction. In experiment 2, the hypocotyl (below cotyledons) and the lower part of the stem (between the first and second leaves) were sampled. The plant tissues were ground with mortar and pestle in liquid nitrogen. In both experiments, DNA was extracted using the Invisorb Spin Plant Mini DNA extraction kit (Invitek, Berlin, Germany). DNA was quantified using a Nanodrop spectrophotometer and stored at 20°C.
Data analysis Data were analysed with nonparametric statistics, using Kruskal–Wallis test (P < 005). Differences between treatments were detected based on Mann–Whitney U-test (P < 005). All data of the experiments were analysed using the software package SPSS 21.0 (Chicago, IL) for windows.
Measurement of fungal colonization with real-time PCR In both experiments, Verticillium Vt305 DNA was amplified using primer pair VtF4 (CCGGTGTTGGGGAT CTACT) and VtR2 (GTAGGGGGTTTAGAGGCTG) (Debode et al. 2011). Verticillium longisporum DNA in experiment 1 was quantified using primer pair VlTubF2 (GCAAAACCCTACCGGGTTATG) and VlTubR1 (AGAT ATCCATCGGACTGTTCGTA) (Debode et al. 2011). In experiment 2, a more sensitive primer pair was used: VlspF1 (AGCCTGAGTCACGAGAGATATGGG) and Vlsp R4 (CAAACCACGCCACTGCATTCTCGT) (Banno et al. 2011). Amplification and melting curve analysis were performed using an ABI PRISM 7900HT Sequence Detection System (Applied Biosystems, Foster city, CA) for experiment 1 and a MX3005P real-time PCR Detection System (Stratagene, Santa Clara, CA) for experiment 2. The
Results Disease assessment In the first experiment, external symptoms of Verticillium wilt were observed in plants inoculated with V. longisporum. Plants singly inoculated with the high concentration of V. longisporum (106 conidia ml 1) produced significantly more leaves than control plants (Table 1) and showed the typical stunted growth, as described by Koike et al. (1994). Plants singly inoculated with Vt305 (106 conidia ml 1) did not develop more leaves than control plants. In addition, leaves of plants inoculated with V. longisporum had a pale green colour (Fig. 1). This symptom was not observed in control plants and
Table 1 Number of leaves (median median absolute deviation) developed 28, 49, 63 and 77 dpi on cauliflower plants inoculated with Verticillium Vt305 (Vt), Verticillium longisporum O1 (Vl) and both (Vt + Vl) in experiment 1. Plants were inoculated twice with a 1-week interval. Control: water + water; Vt(6): 106 conidia of Vt305 ml 1 + water; Vl(4) and Vl(6): 104 or 106 conidia of V. longisporum ml 1 + water; Vt(6) + Vl(4) and Vt(6) + Vl(6): 106 conidia of Vt305 ml 1 + 104 or 106 conidia of V. longisporum ml 1 28 dpi Control Vt(6) Vl(4) Vt(6) + Vl(4) Vl(6) Vt(6) + Vl(6)
100 95 110 90 110 100
49 dpi 00bc 05cd 10ab 00d 10a 00ab
135 135 145 130 150 150
63 dpi 05a 05a 15a 05a 05a 10a
175 180 200 175 215 200
77 dpi 05b 05bc 15ab 05b 10a 10ac
205 200 230 190 250 245
05cd 00d 20abc 05bd 15a 20ab
Medians followed by the same letter are not significantly different according to Mann–Whitney U-test (P < 005)
Journal of Applied Microbiology © 2014 The Society for Applied Microbiology
3
Biocontrol by Verticillium Vt305
L. Tyvaert et al.
(a)
(b)
Vt(6)+Vl(4)
Vl(4)
Vt(6)+Vl(4)
Vl(4)
Figure 1 Symptoms caused by Verticillium longisporum on cauliflower plants and effects of pre-inoculation with Verticillium Vt305. Plants were inoculated with V. longisporum O1 (104 conidia ml 1; Vl(4)); or with Vt305 (106 conidia ml 1) followed by a second inoculation 1 week later with V. longisporum O1 (104 conidia ml 1; Vt(6) + Vl(4)). (a) Stunted growth of plants and (b) pale green colour of leaves after single inoculation of V. longisporum compared with normal growth and colour of the right plant. Plants were examined at 49 dpi.
)
)
(6
(6
VI
VI
)
)+ (6 Vt
a
b
a
a
b
3 2 1
)
)
VI (6
(6
)+ (6 Vt
)+ (6 Vt
VI
VI (4
)
(4 ) VI
) Vt (6
tro l
0
on
VI )+ Vt (6
(4 VI (6 Vt
b
4
(6 )
) (6
VI (4 )+ (6 Vt
VI
)
) (4 VI
Vt
(6
)
0
l
)+
on C (d)
Number of plants
1
tro
)
tro
(6 VI )+
2
on
0
(6 a
a
b
3
C
1
Vt
Vt a
b
b
4
2
)
) (6
(4 (6
C
)+
VI
VI
)
) (4 VI
(6 Vt
tro on
)
0
a
3
(4
1
a
b
ab
VI
2
b
b
4
l
3
(c)
Number of plants
(b)
)
a
(6
a
a
Number of plants
4
a
a
C
a
l
Number of plants
(a)
tration of V. longisporum (104 conidia ml 1) at all time points assessed, but not with the high concentration (106 conidia ml 1). In the second experiment, no external symptoms were observed after inoculation with V. longisporum at 104 conidia ml 1. At 70 dpi, vascular discolouration was found in three plants singly inoculated with V. longisporum and in
Vt
plants inoculated with Vt305 alone or in combination with the low concentration of V. longisporum (104 conidia ml 1). Figure 2 shows that single inoculation with V. longisporum caused vascular discolouration in the stem, while single inoculation with Vt305 did not. Preinoculation with Vt305 completely prevented vascular discolouration of plants challenged with the low concen-
Figure 2 Disease progression 28 dpi (a), 49 dpi (b), 63 dpi (c) and 77 dpi (d) on cauliflower plants inoculated with Vt305 (Vt), Verticillium longisporum O1 (Vl) and both isolates (Vt + Vl) in experiment 1. Plants were inoculated twice with a 1-week interval. Control: water + water; Vt(6): 106 conidia of Vt305 ml 1 + water; Vl(4) and Vl(6): 104 or 106 conidia of V. longisporum ml 1 + water; Vt(6) + Vl(4) and Vt(6) + Vl(6): 106 conidia of Vt305 ml 1 + 104 or 106 conidia of V. longisporum ml 1. Scores for vascular discolouration were used to assess the disease: 0 = no vascular discolouration (□); 1 = vascular discolouration of ≤25% of stem length ( ); 2 = vascular discolouration of 26–50% of stem length ( ); 3 = vascular discolouration of 51–75% of stem length ( ); and 4 = vascular discolouration of ≥76% of stem length (&). Bars indicated with the same letter are not significantly different with a Mann–Whitney U-test (P < 005).
4
Journal of Applied Microbiology © 2014 The Society for Applied Microbiology
L. Tyvaert et al.
Journal of Applied Microbiology © 2014 The Society for Applied Microbiology
ng Vl DNA/g root tissue
DNA levels of V. longisporum and Vt305 were quantified by qPCR. In the first experiment, V. longisporum was detected at all time points in most root samples of plants singly inoculated with both concentrations (104 and 106 conidia ml 1) of the fungus (Fig. 3a,b). Remarkably, at 28 and 49 dpi, V. longisporum was not detected in roots of any plant pre-inoculated with Vt305 (106 conidia ml 1) and challenged with the low concentration of the pathogen (104 conidia ml 1) (Fig. 3a). In addition, at these time points, Vt305 clearly reduced pathogen colonization in the roots of the plants challenged with the high concentration of V. longisporum (106 conidia ml 1) (Fig. 3b). Detection of V. longisporum in the stem was less frequent than that in the roots. At 28 dpi, V. longisporum was detected in the stem only when it was applied at high concentration (one plant in the single treatment and one in the combination with Vt305, data not shown). At later time points, the pathogen was detected in the stem of one plant per time point in the plants singly inoculated with the low concentration of V. longisporum, but not in the stem of any plant pre-inoculated with Vt305. At 63 dpi, most of the plants treated with the high concentration of V. longisporum contained the pathogen in the stem, and no difference in amount of DNA was found between single inoculation (012 0072 ng DNA per g stem tissue, n = 3) and combination with Vt305 (036 033 ng DNA per g stem tissue, n = 4). The frequency of detection at 77 dpi decreased in plants pre-inoculated with Vt305 (002 ng DNA per g stem tissue, n = 1), but remained high in plants singly inoculated (046 00057 ng DNA per g stem tissue, n = 3). Vt305 DNA was detected in the roots of all plants singly inoculated with Vt305 at 106 conidia ml 1 or in combination with V. longisporum (both concentrations) (Fig. 3c). When singly inoculated, Vt305 was detected in the stem of one plant at 28 dpi, one plant at 49 dpi and four plants at 63 dpi. When combined with V. longisporum, Vt305 was detected in the stem of one plant at each of the last two time points (63 and 77 dpi) in the low concentration and in one plant at 28 dpi in the high concentration (data not shown). In the second experiment, the levels of Vt305 DNA found in plant tissue were higher than those in the first experiment. This could be due to the different processing method used for grinding samples in the second experiment. The amount of V. longisporum DNA in the roots was decreased by pre-inoculation with Vt305 (Fig. 4a). At
2 (3) 1·5
(4)
1 (4) 0·5 (0)
(1)
(0)
(4)
(1)
0 28 dpi (b) 60 ng Vl DNA/g root tissue
Colonization of plant tissues
(a)
49 dpi
77 dpi
50 40 30 (4)
20
(4)
10 28 dpi
(c)
63 dpi
(4)
(3)
(4) (4)
(4) (3)
49 dpi
63 dpi
77 dpi
0
ng Vt305 DNA/g root tissue
one plant inoculated with the low concentration of Vt305 (104 conidia ml 1) and with V. longisporum.
Biocontrol by Verticillium Vt305
0·8 (4) 0·6 0·4
(4) (4)
(4)
(4)
(4)
0·2
(4)
(4) (4) (4)
0 28 dpi
49 dpi
63 dpi
(4)
(4)
77 dpi
Figure 3 Amount of Verticillium longisporum DNA (a and b) and Vt305 DNA (c) in the roots of cauliflower plants inoculated with V. longisporum O1 (Vl), Vt305 (Vt) and both (Vt + Vl) in experiment 1 at 28, 49, 63 and 77 dpi. Plants were inoculated twice with a 1-week interval. Control: water + water; Vt(6): 106 conidia of Vt305 ml 1 + water; Vl(4) and Vl(6): 104 or 106 conidia of V. longisporum ml 1 + water; Vt(6) + Vl(4) and Vt(6) + Vl(6): 106 conidia of Vt305 ml 1 + 104 or 106 conidia of V. longisporum ml 1. Four plants per treatment were analysed, and the number of plants with detection is indicated between brackets (n). Verticillium longisporum DNA was measured for treatments Vl(4) ( ), Vt(6) + Vl(4) (□), Vl(6) (■) and Vt(6) + Vl(6) ( ). Vt305 DNA was measured for treatments Vt(6) ( ), Vt(6) + Vl(4) ( ) and Vt(6) + Vl(6) ( ). Data are the median of the amount of DNA from the (n) plants, and vertical bars are the median absolute deviation of the amount of DNA from the (n) plants.
49 and 70 dpi, significant differences were found among plants singly inoculated with V. longisporum (104 conidia ml 1) and plants pre-inoculated with Vt305 at 104 or 106 conidia ml 1 (Fig. 4a). At 49 dpi, the hypocotyl and the stem were also clearly less colonized by the pathogen 5
Biocontrol by Verticillium Vt305
L. Tyvaert et al.
when plants were pre-inoculated with Vt305 (both concentrations) (Fig. 4b,c). At 70 dpi, the differences in stem colonization between plants singly inoculated and plants pre-inoculated with Vt305 remained remarkable for both concentrations. However, in the hypocotyl, the amount of V. longisporum DNA was reduced only when plants
were treated with the high dose of Vt305 (106 conidia ml 1) (Fig. 4b,c). As in the first experiment, Vt305 DNA was detected in the root system of all plants in the second experiment (Fig. 4d). Differently, the frequency of Vt305 detection in the shoot was higher in the second experiment than in
V. longisporum
(8) a
4·0 3·0
(8) a (8) (7) a a
(8) b (6) c
(6) (7) ab b
0·0 27 dpi (b)
120
(8) a
2·0 1·0
(8) a
(d) 140
5·0
49 dpi
ng DNA/g tissue
ng DNA/g tissue
Roots
(a)
Vt305
(8) a
100 80 60 40
(8) ab (8) b
20
(8) (8) a (8) a (8) a b
(8) a (8) (8) (8) bc ab c
0
70 dpi
27 dpi
49 dpi
70 dpi (8) a
(e) 210
0·6
0·4
(8) a
(8) a
ng DNA/g tissue
ng DNA/g tissue
Hypocotyl
180 (7) ab
0·2 (8) b
(8) b
(7) b
(8) (8) b c
(8) ab
(7) (8) a a
49 dpi
70 dpi
(f) 1·5
(8) a
0·1 0·05
(8) a
60
70 dpi
(8) a
(8) b
(8) b
(7) b
0
(6) ab
ng DNA/g tissue
ng DNA/g tissue
Stem
0·15
(8) a
90
0 49 dpi
0·2
120
30
0
(c)
150
(8) a
1·2 0·9 0·6 0·3
(7) (6) (7) b c bc
(8) a
(8) bc
(7) c
(8) b
0·0 49 dpi
70 dpi
49 dpi
70 dpi
Figure 4 Amount of Verticillium longisporum DNA (a–c) and Vt305 DNA (d–f) in the roots (a and d), the hypocotyl (b and e) and the stem (c and f) of cauliflower plants inoculated with V. longisporum O1 (Vl), Vt305 (Vt) and both isolates (Vt + Vl) in experiment 2 at 27, 49 and 70 dpi. Plants were inoculated twice with a 1-week interval. Control: water + water; Vt(4) and Vt(6): 104 or 106 conidia of Vt305 ml 1 + water; Vl(4): 104 conidia of V. longisporum ml 1 + water; Vt(4) + Vl(4) and Vt(6) + Vl(4): 104 or 106 conidia of Vt305 ml 1 + 104 conidia of V. longisporum ml 1. Eight plants per treatment were analysed, and the number of plants with detection is indicated between brackets (n). V. longisporum DNA was measured for treatments Vl(4) (■), Vt(4) + Vl(4) ( ), Vt(6) + Vl(4) (□). Vt305 DNA was measured for treatments Vt(4) ( ), Vt(4) + Vl(4) ( ), Vt(6) ( ) and Vt(6) + Vl(4) ( ). Data are the median of the amount of DNA from the (n) plants, and vertical bars are the median absolute deviation of the amount of DNA from the (n) plants. Within one time point, different letters indicate results, which differ significantly at P < 005 by the Mann–Whitney U-Test.
6
Journal of Applied Microbiology © 2014 The Society for Applied Microbiology
L. Tyvaert et al.
the first one: Vt305 was detected in nearly all plants in the different treatments (Fig. 4e,f). At 49 dpi, the levels of Vt305 DNA in the roots, hypocotyl and stem of plants singly inoculated with Vt305 were lower in the treatment with low concentration (104 conidia ml 1) than in that with high concentration (106 conidia ml 1) (Fig. 4d–f). Interestingly, the inoculation of V. longisporum in plants pre-inoculated with the low concentration of Vt305 markedly increased the amount of Vt305 DNA in the roots (27 and 49 dpi) and stem (70 dpi), compared with single inoculation with the same concentration (Fig. 4d, f). In both experiments, the amount of Vt305 and V. longisporum DNA in the roots declined over time. This was probably caused by a difference in growth rate between the Verticillium species and the roots. Discussion In this work, we have shown that Verticillium Vt305 could colonize the roots, hypocotyl and stem of cauliflower plants without inducing symptoms. This behaviour corresponds to an endophytic lifestyle (Petrini 1991). Vt305 was capable of controlling Verticillium wilt caused by V. longisporum on cauliflower, because colonization by the pathogen and symptom development were reduced on plants pre-inoculated with Vt305. Defence-related events, especially in roots, seemed to be involved in the cross-protection. Endophytism seems to be a common phenomenon in the genus Verticillium, although often overlooked (Lacy and Horner 1966; Malcolm et al. 2013). It has been demonstrated that certain isolates of V. dahliae, V. alboatrum and V. tricorpus can colonize their hosts and yet cause no or minor vascular discolouration and do not develop external symptoms (Skotland 1971; Ebihara et al. 2003; Chen et al. 2004; Robinson et al. 2006; Qin et al. 2008; Iglesias-Garcia et al. 2013; Malcolm et al. 2013). However, it is still unclear whether the endophytic behaviour is generally an intrinsic characteristic of certain isolates or rather the outcome of specific interactions between potential pathogenic isolates and some hosts (Malcolm et al. 2013). Currently, we are studying the interaction of Vt305 with other important cash and cover crops that may be grown in rotation with cauliflower. Verticillium endophytic isolates may belong to the above-mentioned Verticillium species or to new species. For example, the V. tricorpus isolates from California that asymptomatically colonize lettuce and artichoke (Qin et al. 2008) were recently reclassified into a new species, V. isaacii (Inderbitzin et al. 2011), interestingly, also Vt305 is morphologically similar to V. tricorpus, but its rDNA ITS region shows 100% identity with V. isaacii (Francßa et al. 2013). Symptom development and colonization by V. longisporum were clearly reduced by pre-inoculation of cauliJournal of Applied Microbiology © 2014 The Society for Applied Microbiology
Biocontrol by Verticillium Vt305
flower plants with Vt305. To our knowledge, this is the first study demonstrating cross-protection against V. longisporum on a member of the family Brassicaceae. In controlled conditions, cross-protection against V. dahliae and V. albo-atrum has been previously shown on other plant families, such as Asteraceae (lettuce), Solanaceae (tomato and potato) and Malvaceae (cotton) (Schnathorst and Mathre 1966; Matta and Garibaldi 1977; Davis and Sorensen 1985; Robinson et al. 2007; Qin et al. 2008; Shittu et al. 2009). The mechanisms by which endophytic Verticillium isolates protect plants against Verticillium wilt remain poorly understood. Antagonism is probably not involved in this type of protection. Vt305 did not affect the growth of V. longisporum on potato dextrose agar medium (data not shown). A similar interaction in vitro was observed between endophytic and pathogenic V. dahliae isolates of tomato (Shittu et al. 2009). Competition for infection sites and induced resistance are the most likely mechanisms, as suggested by Robinson et al. (2007), Qin et al. (2008) and Shittu et al. (2009). That root colonization by V. longisporum was consistently reduced in plants pre-inoculated with Vt305 points to the importance of defence-related events in roots. On the one hand, the application of Vt305 may have reduced the availability of specific sites on roots and hindered posterior colonization by V. longisporum, resulting in protection through competition. On the other hand, Vt305 may have induced resistance in the roots. A recent study concerning crossprotection of Fusarium wilt supports the latter mechanism (Aime et al. 2013). They have shown that the endophyte Fusarium oxysporum Fo47 induces resistance against a pathogenic F. oxysporum by priming the tomato roots for a stronger expression of defence responses in roots. It is also worthwhile to highlight the study of Iven et al. (2012) in which they emphasize the role of root defences against V. longisporum infection on oilseed rape. The authors suggested that tryptophan-derived metabolites produced in the infected roots are implicated in the defence against V. longisporum. Most of the phytoalexins of Brassica species, including cauliflower, are derived from tryptophan (Pedras et al. 2006). It would be interesting to investigate whether priming for phytoalexins or other defence-related compounds is involved in the Vt305-induced resistance to V. longisporum in cauliflower roots. The best levels of protection were achieved when Vt305 was applied in the high dose and the plant challenged with the low dose of V. longisporum. Our results are in agreement with other studies (Schnathorst and Mathre 1966; Shcherbakova et al. 2011) and indicate that both the dose of the endophyte and the dose of the pathogen influence the efficiency of disease control. 7
Biocontrol by Verticillium Vt305
The inoculation of V. longisporum in plants pre-inoculated with the low dose of Vt305 markedly increased the amount of Vt305 DNA in the roots and stem compared with single inoculation with the same concentration. We hypothesize that interplay between both fungi and the plant occurred. One possibility is that the plants attacked by V. longisporum produced chemical compounds that stimulated colonization by Vt305 and increased the chance of protection. This type of reaction has been shown to occur in the interaction between the beneficial rhizobacterium Bacillus subtilis FB17 and the foliar pathogen Pseudomonas syringae pv. tomato on Arabidopsis (Rudrappa et al. 2008). Upon pathogen attack, bacterial population was stimulated by root metabolites produced by Arabidopsis. Another more likely explanation concerns the mechanisms used by plant pathogens to suppress defence responses and colonize their hosts (Fradin and Thomma 2006; Nishimura and Dangl 2010). The low dose of Vt305 did not completely protect the plant against V. longisporum, allowing penetration by the pathogen that tried to suppress host defences to facilitate infection. Vt305 could have taken advantage of the transient lower level of plant resistance caused by the pathogen to colonize cauliflower roots and stem more extensively than in the absence of the pathogen. This hypothesis is supported by the observation that Vt305 DNA did not increase in the co-inoculation treatment with the pathogen at the high dose of Vt305 that effectively suppressed colonization by the pathogen (Fig. 4). In this study, we have demonstrated that Verticillium Vt305 is an endophyte on cauliflower and can control the pathogen V. longisporum in this host. These results indicate the potential of Vt305 to be developed as biological control agent of Verticillium wilt. Acknowledgements This work was part of a long-term collaboration with D. Callens and S. Pollet from Inagro and L. De Rooster and K. Spiessens from PSKW and was supported by the government agency for Innovation by Science and Technology (IWT). This research has benefitted from a statistical consult with Ghent University FIRE (Fostering Innovative Research based on Evidence). Conflict of interest No conflict of interest declared. References Abuamsha, R., Salman, M. and Ehlers, R. (2011) Differential resistance of oilseed rape cultivars (Brassica napus ssp 8
L. Tyvaert et al.
oleifera) to Verticillium longisporum infection is affected by rhizosphere colonisation with antagonistic bacteria, Serratia plymuthica and Pseudomonas chlororaphis. BioControl 56, 101–112. Aime, S., Alabouvette, C., Steinberg, C. and Olivain, C. (2013) The endophytic strain Fusarium oxysporum Fo47: a good candidate for priming the defense responses in tomato roots. Mol Plant Microbe In 26, 918–926. Alabouvette, C., Olivain, C., Migheli, Q. and Steinberg, C. (2009) Microbiological control of soil-borne phytopathogenic fungi with special emphasis on wiltinducing Fusarium oxysporum. New Phytol 184, 529–544. Alstrom, S. (2000) Root-colonizing fungi from oilseed rape and their inhibition of Verticillium dahliae. J Phytopathol 148, 417–423. Banno, S., Saito, H., Sakai, H., Urushibara, T., Ikeda, K., Kabe, T., Kemmochi, I. and Fujimura, M. (2011) Quantitative nested real-time PCR detection of Verticillium longisporum and V. dahliae in the soil of cabbage fields. J Gen Plant Pathol 77, 282–291. Berg, G. (1996) Rhizobacteria of oilseed rape antagonistic to Verticillium dahliae var longisporum Stark. J Plant Dis Prot 103, 20–30. Chen, P., Lee, B. and Robb, J. (2004) Tolerance to a non-host isolate of Verticillium dahliae in tomato. Physiol Mol Plant Pathol 64, 283–291. Cook, R.J. (1985) Biological control of plant pathogens: theory to application. Phytopathology 75, 25–29. Danielsson, J., Reva, O. and Meijer, J. (2007) Protection of oilseed rape (Brassica napus) toward fungal pathogens by strains of plant-associated Bacillus amyloliquefaciens. Microbial Ecol 54, 134–140. Davis, J.R. and Sorensen, L.H. (1985) Association of Verticillium tricorpus with Verticillium dahliae and potato early dying. Phytopathology 75, 1279. Davis, J.R., Everson, D.O., Sorensen, L.H. and Schneider, A.T. (2000) Association of Verticillium tricorpus with soil suppressiveness of Verticillium wilt of potato. In Advances in Verticillium Research and Disease Management ed. Tjamos, E.C., Rowe, R.C., Heale, J.B. and Fravel, D.R. pp 347–351. St. Paul: APS. Debode, J., Clewes, E., De Backer, G. and H€ ofte, M. (2005) Lignin is involved in the reduction of Verticillium dahliae var. longisporum inoculum in soil by crop residue incorporation. Soil Biol Biochem 37, 301–309. Debode, J., De Maeyer, K., Perneel, M., Pannecoucque, J., De Backer, G. and H€ ofte, M. (2007) Biosurfactants are involved in the biological control of Verticillium microsclerotia by Pseudomonas spp. J Appl Microbiol 103, 1184–1196. Debode, J., Van Poucke, K., Francßa, S.C., Maes, M., H€ ofte, M. and Heungens, K. (2011) Detection of multiple Verticillium species in soil using density flotation and real-time polymerase chain reaction. Plant Dis 95, 1571–1580.
Journal of Applied Microbiology © 2014 The Society for Applied Microbiology
L. Tyvaert et al.
Ebihara, Y., Nagao, H., Uematsu, S., Moriwaki, J. and Kimishima, E. (2003) First report of Verticillium tricorpus isolated from potato tubers in Japan. Mycoscience 44, 481–488. Fradin, E.F. and Thomma, B.P.H.J. (2006) Physiology and molecular aspects of Verticillium wilt diseases caused by V. dahliae and V. albo-atrum. Mol Plant Pathol 7, 71–86. Francßa, S.C., Spiessens, K., Pollet, S., Debode, J., De Rooster, L., Callens, D. and H€ ofte, M. (2013) Population dynamics of Verticillium species in cauliflower fields: influence of crop rotation, debris removal and ryegrass incorporation. Crop Prot 54, 134–141. Goud, J.K.C., Temorshuizen, A.J. and Gams, W. (2003) Morphology of Verticillium dahliae and V. tricorpus on semi-selective media used for the detection of V. dahliae in soil. Mycol Res 107, 822–830. Graner, G., Persson, P., Meijer, J. and Alstrom, S. (2003) A study on microbial diversity in different cultivars of Brassica napus in relation to its wilt pathogen, Verticillium longisporum. FEMS Microbiol Lett 224, 269–276. Heale, J.B. and Karapapa, V.K. (1999) The Verticillium threat to Canada’s major oilseed crop: canola. Can J Plant Pathol 21, 1–7. Huisman, O.C. (1988) Seasonal colonization of roots of fieldgrown cotton by Verticillium dahliae and Verticillium tricorpus. Phytopathology 78, 708–716. Iglesias-Garcia, A.M., Villarroel-Zeballos, M.I., Feng, C., du Toit, L.J. and Correll, J.C. (2013) Pathogenicity, virulence, and vegetative compatibility grouping of Verticillium isolates from Spinach Seed. Plant Dis 97, 1457–1469. Inderbitzin, P., Bostock, R.M., Davis, R.M., Usami, T., Platt, H.W. and Subbarao, K.V. (2011) Phylogenetics and taxonomy of the fungal vascular wilt pathogen Verticillium, with the descriptions of five new species. PLoS One 6, e28341. Isaac, I. (1953) A further comparative study of pathogenic isolates of Verticillium: V. nubilum Pethybr. and V. tricorpus sp. Nov. T Brit Mycol Soc 36, 180–195. Iven, T., K€ onig, S., Singh, S., Braus-Stromeyer, S.A., Bischoff, M., Tietze, L.F., Braus, G.H., Lipka, V. et al. (2012) Transcriptional activation and production of tryptophanderived secondary metabolites in Arabidopsis roots contributes to the defense against the fungal vascular pathogen Verticillium longisporum. Mol Plant 5, 1389–1402. Johansson, A., Goud, J.K.C. and Dixelius, C. (2006) Plant host range of Verticillium longisporum and microsclerotia density in Swedish soils. Eur J Plant Pathol 114, 139–149. Karapapa, V.K., Bainbridge, B.W. and Heale, J.B. (1997) Morphological and molecular characterization of Verticillium longisporum comb. Nov., pathogenic to oilseed rape. Mycol Res 101, 1281–1294. Koike, S.T., Subbarao, K.V., Davis, R.M., Gordon, T.R. and Hubbard, J.C. (1994) Verticillium wilt of cauliflower in California. Plant Dis 78, 1116–1121. Lacy, M.L. and Horner, C.E. (1966) Behavior of Verticillium dahliae in rhizosphere and on roots of plants
Journal of Applied Microbiology © 2014 The Society for Applied Microbiology
Biocontrol by Verticillium Vt305
susceptible resistant and immune to wilt. Phytopathology 56, 427–430. Malcolm, G.M., Kuldau, G.A., Gugino, B.K. and JimenezGasco, M.D. (2013) Hidden host plant associations of soilborne fungal pathogens: an ecological perspective. Phytopathology 103, 538–544. Matta, A. and Garibaldi, A. (1977) Control of Verticillium wilt of tomato by preinoculation with avirulent fungi. Neth J Pl Path 83, 457–462. Nishimura, M.T. and Dangl, J.L. (2010) Arabidopsis and the plant immune system. Plant J 61, 1053–1066. Pedras, M.S.C., Sarwar, M.G., Suchy, M. and Adio, A.M. (2006) The phytoalexins from cauliflower, caulilexins A, B and C: isolation, structure determination, syntheses and antifungal activity. Phytochemistry 67, 1503–1509. Petrini, O. (1991) Fungal endophytes of tree leaves. In Microbial Ecology of Leaves ed. Andrews, J.H. and Hirano, S.S. pp 179–187. New York: Springer-Verlag. Qin, Q., Valllad, G.E. and Subbarao, K.V. (2008) Characterization of Verticillium dahliae and V. tricorpus isolates from Lettuce and Artichoke. Plant Dis 92, 69–77. Robinson, N., Platt, H.W. and Hale, L. (2006) Potato plant and tuber infection and soil colonization by Verticillium tricorpus and Verticillium albo-atrum “group 2”. Can J Plant Pathol 28, 540–547. Robinson, N., Platt, H.W. and Lawrence, R.H. (2007) Interactions of various Verticillium species in combination with V. albo-atrum on Verticillium wilt disease development in potato. Am J Potato Res 84, 133–141. Rudrappa, T., Czymmek, K.J., Pare, P.W. and Bais, H.P. (2008) Root-secreted malic acid recruits beneficial soil bacteria. Plant Physiol 148, 1547–1556. Schnathorst, W.C. and Mathre, D.E. (1966) Cross-Protection in cotton with strains of Verticillium albo-atrum. Phytopathology 56, 1204–1209. Shcherbakova, L.A., Nazarova, T.A., Mikityuk, O.D. and Fravel, D.R. (2011) Fusarium sambucinum isolate FS-94 induces resistance against Fusarium wilt of tomato via activation and priming of a salicylic acid-dependent signaling system. Russ J Plant Physiol 58, 808–818. Shittu, H.O., Castroverd, D.C.M., Nazar, R.N. and Robb, J. (2009) Plant-endophyte interplay protects tomato against a virulent Verticillium. Planta 229, 415–426. Skotland, C.B. (1971) Pathogenic and nonpathogenic Verticillium species from South Central Washington. Phytopathology 61, 435–436. Steventon, L.A., Fahleson, J., Hu, Q. and Dixelius, C. (2002) Identification of the causal agent of Verticillium wilt of winter oilseed rape in Sweden, V. longisporum. Mycol Res 106, 570–578. Usami, T., Kanto, T., Inderbitzin, P., Itoh, M., Kisaki, G., Ebihara, Y., Suda, W., Amemiya, Y. et al. (2011) Verticillium tricorpus causing lettuce wilt in Japan differs genetically from California lettuce isolates. J Gen Plant Pathol 77, 17–23.
9
