The Gene bldA, a regulator of morphological differentiation and antibiotic production in streptomyces.

ARCH PHARM

Arch. Pharm. Chem. Life Sci. 2015, 348, 1–8

Archiv der Pharmazie

Review Article The Gene bldA, a Regulator of Morphological Differentiation and Antibiotic Production in Streptomyces Stefanie Hackl and Andreas Bechthold Department of Pharmaceutical Biology and Biotechnology, Institute of Pharmaceutical Sciences, Albert-Ludwig University of Freiburg, Freiburg, Germany Streptomyces species are well known for their particular features of morphological differentiation. On solid agar, a mold-like aerial mycelium is formed and spores are produced, in which the bld genes play a crucial role. In S. coelicolor, mutations in one specific bld gene called bldA led to a “naked” phenotype lacking aerial hyphae and spores. This peculiar behavior became a major interest for scientific research in the past and it was revealed that bldA is coding for a unique tRNA able to translate a UUA codon into the amino acid leucine. UUA codons are a very rare property of G þ C-rich Streptomyces genomes. The impact of bldA on morphology can in parts be attributed to the regulatory effect of bldA on the translational level, because TTA-containing genes can only be translated into their corresponding protein in the presence of a fully functioning bldA gene. In addition to the visible effect of bldA expression on the phenotype of S. coelicolor, bldA mutants were also deficient in antibiotic production. This led to the assumption that the role of bldA must exceed translational control. Many TTA-containing genes are coding for transcriptional regulators which are activating or repressing the transcription of many more genes. Proteomics and transcriptomics are two powerful methods for identifying bldA target genes and it was possible to assign also post-translational regulation to bldA. This review wants to give a short overview on the importance of bldA as a regulator of morphological differentiation and antibiotic production by switching on “silent” gene clusters in Streptomyces. Keywords: Antibacterial activity / Antibiotic production / Antimicrobial activity / Morphological differentiation / Rational drug design Received: February 23, 2015; Revised: March 23, 2015; Accepted: March 24, 2015 DOI 10.1002/ardp.201500073

Introduction

Correspondence: Prof. Andreas Bechthold, Department of Pharmaceutical Biology and Biotechnology, Institute of Pharmaceutical Sciences, Albert-Ludwig University of Freiburg, Stefan-MeierStr. 19, 79104 Freiburg, Germany. E-mail: [email protected] Fax: þ49-761-2038383

implying a high potential for discovering new antibiotics. Unfortunately, under laboratory conditions, hardly any secondary metabolites are produced which makes it necessary to establish methods for “waking up” these gene clusters. Over the last years, many distinct attempts have been made focusing on different production media [1], mutations in genes enhancing transcription and translation [2], overexpression or disruption of regulatory genes [3, 4], and on the overexpression of “silent” gene clusters in heterologous hosts [5, 6]. A new, promising approach described by Kalan et al. [7] is exploiting the function of one particular gene called bldA. BldA became a major interest when it was discovered that mutations in this gene did not only result in a lack of aerial mycelium and spores, typical for the life cycle of Streptomyces, but also in a deficiency in antibiotic production compared to the wild type [8]. BldA is coding for a tRNA which is capable of translating a UUA codon into the amino acid

ß 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim

www.archpharm.com

The majority of therapeutically used antibiotics of natural origin are produced from soil bacteria of the genus Streptomyces. Due to the development of multidrug resistance of many pathogens against common antibiotics, it is necessary to search for new compounds with chemotherapeutic profile. Genome mining of Streptomyces revealed an extensive, unexploited pool of “sleeping” gene clusters

1

ARCH PHARM

Arch. Pharm. Chem. Life Sci. 2015, 348, 1–8 S. Hackl and A. Bechthold

leucine. Characteristic for the genus Streptomyces is a genome with a high G þ C content of more than 70%. TTA codons are, therefore, rare with the model organism S. coelicolor having 145 genes containing a TTA codon out of a total amount of 7825 genes. In Kalan et al. [7], the “bald” phenotype of S. calvus was investigated and genome sequencing uncovered a point mutation in the bldA gene (Fig. 1) which led to a misfolded leu-tRNAUUA defective in translating the UUA codon (Fig. 2). Complementation of S. calvus with a functional bldA gene cured “baldness” (Fig. 3) and led to a phenotype with aerial hyphae and spores. In addition, a cryptic gene cluster was switched on and novel secondary metabolites (4-E/4-Z-annimycin) were produced (Fig. 4). This showed that complementation of bldA respectively constitutive expression of bldA is an astonishing new method that can be used as a tool to trigger antibiotic production in Streptomyces, having still a big variety of cryptic gene clusters encoded in their genome. The purpose of this review was to show the crucial role of the gene bldA in morphological differentiation and antibiotic production through the research work published over the last couple of years.

The role of bldA in morphological differentiation As already mentioned above, Streptomyces displays a distinct phenotype similar to that of fungi. The life cycle was described already in 1967 by Hopwood [9]. It starts with a free spore from which two germ tubes emerge and finally form a substrate mycelium. After 2–3 days, an aerial mycelium begins to grow on the surface of the agar plate. Aerial hyphae are then subdivided into pre-spore compartments and finally spores detach from the mycelium to repeat the cycle (Fig. 5). Of crucial importance for the formation of an aerial mycelium are a set of genes called bld (derived from “bald”). The cascade of bld gene interplay is still not completely clear, but Chater and Chandra [10] made a very promising attempt. This review focuses only on one particular bld gene called bldA. The bldA gene does not code for a protein but for a tRNA

S. calvus


molecule which is the only tRNA in the entire genome able to translate a rare UUA codon into the amino acid leucine. There are in total six different codons responsible for the integration of leucine in the growing protein chain, but UUA is the rarest of them. Genes containing a TTA codon (145 in S. coelicolor) can only be translated into a protein when a functional bldA gene is expressed and a leu-tRNAUUA is provided. Already in 1987, Lawlor et al. [8] discovered that bldA mutants of S. coelicolor were defective in the development of aerial hyphae and spores and were at the same time deficient in antibiotic production. Besides bldA, in S. coelicolor as well as S. griseus, another gene was elucidated to play an important role in morphological differentiation, adpA which contains a TTA codon [11, 12]. Mutants of adpA were like the bldA mutants “bald” and not able to grow an aerial mycelium or form spores. Replacing the TTA codon in adpA with one of the other five available leucine codons could partially restore aerial mycelium formation and sporulation. This indicated that adpA was the main target of bldA leading to the morphological differentiation manifested in S. coelicolor and S. girseus. An additional set of 21 TTA-containing genes was disrupted in S. coelicolor surprisingly not having any obvious effect on the phenotype in comparison to the wild type [13]. S. calvus is another very good example to acknowledge the role of bldA in morphological differentiation, because it lacks the ability of displaying an aerial mycelium like the S. coelicolor bldA mutants [7]. After discovering a point mutation in the bldA gene, complementation with a correct copy of bldA was performed which led to the restoration of aerial mycelium formation and sporulation. So far, it is not clear what role AdpA plays in S. calvus.

The role of bldA as a trigger for antibiotic production BldA mutants are not only studied for their phenotype, but also foremost in the context of antibiotic production. Predicted gene clusters for antibiotic production of several Streptomyces strains were examined and 110 of these predicted antibiotic gene clusters had at least one gene

GCCCGGAUGGUGGAAUGCAGGCACGGCGAGCUUAAACCUCGCUGCCCCUCAGCGGGCGUGCCGGUUCAAGUCCGGCUCCGGGCAC

S. avermitilis GCCCGGAUGGUGGAAUGCAG ACACGGCGAGCUUAAACCUCGCUGCCCCUC-GCGGGCGUACCGGUUCAAGUCCGGUUCCGGGCAC S. coelicolor

GCCCGGAUGGUGGAAUGCAGACACGGCGAGCUUAAACCUCGCUGCCCCUUCGAGGGCGUGCCGGUUCAAGUCCGGCUCCGGGCAC

S. flavogr.

GCCCGGGUGGUGGAAUGCAGACACGGCGAGCUUAAACCUCGCUGCCUCCUCGGGGGCGUGCCGGUUCGAGUCCGGCUCCGGGCAC

S. clavuli.

GCCCGGAUGGUGGAAUGCAGACACGGCGAGCUUAAACCUCGCUGGCCUUC-AUGGCCGUGCCGGUUCGAGUCCGGCUCCGGGCAC ****** *************A*********************** *

** *** ******* ******* *********

Figure 1. Alignment of the Leu tRNAUUA sequences for S. calvus ATCC 13382 and other Streptomyces strains (S. flavogr. ¼ S. flavogriseus; S. clavuli. ¼ S. clavuligerus). The A21G point mutation in S. calvus bldA is indicated with an arrow.


www.archpharm.com

2

ARCH PHARM

Arch. Pharm. Chem. Life Sci. 2015, 348, 1–8 A Central Regulator in Streptomyces


Figure 2. leu-tRNAUUA molecules. (A) The secondary structure of the misfolded leu-tRNAUUA molecule of S. calvus wild type with a point mutation in the bldA gene [7]. The mutated nucleotide (G instead of A) derived from the point mutation in the sequence of bldA is marked in blue. The mutated nucleotide is forming a hydrogen bond with the complementary nucleotide which is marked in orange. (B) The secondary structure of the functional leu-tRNAUUA molecule after complementation of bldA in S. calvus [7]. The corrected nucleotide due to complementation of the bldA gene is marked in blue. The complementary nucleotide from the misfolded leu-tRNAUUA molecule is now in a different position which is marked in orange.

containing a TTA codon [14] whereas 34 clusters were free of any TTA codon. This showed that TTA codons are highly represented among genes of secondary metabolism. Sixtytwo genes containing a TTA codon even had putative regulatory functions, and it seems likely that bldA plays a central role in the regulation of antibiotic production on the transcriptional level of gene expression. The above-mentioned bldA mutants of S. coelicolor were not only defective in aerial mycelium formation and sporulation but also in the ability to produce the S. coelicolor wild-type antibiotics actinorhodin, undecylprodigiosin (red), and methylenomycin [15]. In all these biosynthetic gene clusters, TTA-containing genes are present [14]. The TTA-containing gene actII-ORF4 in the actinorhodin gene cluster has for example a regulatory

function. When this TTA codon of a S. coelicolor bldA mutant was replaced with one of the other five leucine codons, actinorhodin production was restored which proved the triggering effect of bldA on antibiotic production. The same result was achieved with the replacement of the TTA codon of redZ located in the undecylprodigiosin gene cluster and with the replacement of the TTA codon in each of the genes mmyB and mmfL from the methylenomycin gene cluster in the S. coelicolor bldA mutant (Fig. 4) [16]. In S. griseus bldA mutants were also unable to produce streptomycin (Fig. 4) which can be explained through the TTA-containing gene in the streptomycin biosynthetic gene cluster as well as pathwayspecific effects mediated through adpA (also containing a TTA codon). Also in S. calvus, antibiotic production was switched


www.archpharm.com

3

ARCH PHARM



production (Fig. 4). In S. globisporus 1912, lndI expression started after 24 h and reached a maximum between 48 and 60 h. Afterward, the expression level of lndI decreased. When the TTA codon in lndI was replaced by another leucine codon, this delay was canceled and lndI expression already started after 12 h. The explanation for this delay between 12 and 24 h was that tRNAUUA was only available after 24 h which led to a gap between lndI transcription and subsequent translation.

Transcriptomic and proteomic approaches help to understand bldA effects

The expression of bldA is crucial for the formation of aerial hyphae and therefore tRNAUUA accumulation in S. coelicolor starts and increases through the onset of morphological differentiation [17]. After a culture growth time of 42 h, the concentration of tRNAUUA reached a maximum followed by a decrease until 64 h. This reflected the increasing amount of proteins (encoded by TTA-containing genes) produced during aerial mycelium formation and sporulation. In an article by Rebets et al. [18], this late accumulation of tRNAUUA was illustrated by the delay between lndI transcription and translation in S. globisporus 1912. LndI contains a TTA codon and codes for a transcriptional activator of landomycin

The gene bldA plays, as already mentioned above, a major role in transcriptional and translational regulation of genes involved in morphological differentiation, secondary metabolism, and probably many more cellular processes. Therefore, proteomics and transcriptomics are promising approaches to understand bldA effects better. A lot of proteomic research was done on the model organism S. coelicolor and results confirmed that mutations in the bldA gene have a big effect on stationary phase [19]. Only in stationary phase, the leutRNAUUA encoded by bldA is expressed in significant amounts leading to changes in morphology and secondary metabolism. Combined proteomic and transcriptomic analyses revealed that during stationary phase, 147 genes were upregulated in the wild type in comparison to the bldA mutant strain through mRNA or protein data. A total of 63 of these 147 genes were identified with transcriptomic analysis and 74 with proteomic analysis. Only an additional 11 genes were identified through both methods which indicates a small correlation between those two methods. Unexpectedly at the end of growth phase and at transition phase about 100 genes, including many genes coding for ribosomal proteins, were differentially transcribed and up-regulated in the wild-type strain. This implied that bldA might also influence the transcription of some genes during growth. A reason for this could be the increased level of ppGpp in the mutant strain. ppGpp is a signal molecule involved in the response of bacteria to nutritional stress. This stringent factor is responsible for the transcriptional control of rRNA. In Hesketh et al. [19], the concentrations of ppGpp were measured using HPLC analysis and it was uncovered that the ppGpp level in the mutant strain was two to six times higher than in the wild type. Also remarkable was the under-representation of TTA-containing genes in the transcriptomic as well as the proteomic dataset. Only two of the 147 genes had a TTA codon (S. coelicolor has a total of 145 TTA-containing genes). This led to the assumption that many bldA effects are of indirect nature. Hesketh et al. [19] mentioned three possible indirect effects of bldA. First, some of the bldA-influenced genes are regulated by TTA-containing genes, most of which are expressed at levels too low to make them amenable to the analytical procedures employed. Second, co-transcription of genes with TTA-containing genes resulted in mRNAs with a UUA codon displaying a


www.archpharm.com

Figure 3. Expression of a correct copy of bldA in S. calvus from the replicative plasmid pUWL-bldA or integrative plasmid pTESa-bldA restored sporulation. S. calvus containing the empty pUWL plasmid exhibits the bald phenotype (“MS Pho200 Apr50” indicates the kind of medium and the antibiotic used to maintain the plasmids).

on after complementation of bldA and the structure of 4-E/4Z-annimycin was elucidated [7]. Surprisingly, there was no TTA codon present in the biosynthetic gene cluster of 4-E/4-Zannimycin, leaving it unexplained how this gene cluster could have been switched on with the help of bldA. To summarize this, complementation of defective bldA genes or their coexpression could be established as a new method to switch on antibiotic production which is applicable also for other Streptomyces strains.

The gene product of bldA, a tRNAUUA, accumulates only at a late stage of growth

4

ARCH PHARM



Figure 4. Structures of compounds mentioned in this review. Annimycins were produced after S. calvus was complemented with a functional bldA gene. The biosynthesis of actinorhodin, undecylprodigiosin, and methylenomycin is dependent on a functional bldA gene in S. coelicolor. Streptomycin is produced by S. griseus and landomycin E by S. globisporus 1912.

reduced half-life and which are therefore not translated into their protein. Third, changes in ppGpp abundance lead to an increased transcription of ribosomal protein genes. Many proteins could not be detected through proteomic analysis because of limitations like molecular size of proteins, pI of

proteins (strips with a pH range of 4.5–5.5 and 5.5–6.7 used) or their occurrence in the secreted or membrane protein fraction (only intracellular protein fraction isolated). Primary metabolism seemed to be not affected by bldA except for nutritional stress. Very surprising was the finding of extensive post-

Figure 5. Streptomyces life cycle and the role of bld genes in morphological differentiation [9] with supplemented function of bldA leading to antibiotic production.


www.archpharm.com

5

ARCH PHARM


translational modification also beneath those genes affected by bldA which makes it likely that bldA also controls posttranscriptional processes. Post-translationally modified proteins were discovered because the same protein occurred several times on the 2D gel but with different pI or molecular weight. In contrast to primary metabolism, bldA appeared to have a big impact on the production of secondary metabolites reflected by the up-regulation of protein levels of at least 1 gene of 7 gene clusters out of a total of 21 gene clusters predicted for S. coelicolor. These 7 gene clusters include the actinorhodin, undecylprodigiosin, calcium-dependent antibiotic, a deoxysugar/glycosyltransferase, a type III PKS cluster, a coelichelin biosynthetic cluster, and a desferrioxamine biosynthetic cluster. The effects of bldA to some extent led also to an up-regulation of genes in the S. coelicolor mutant strain which indicated repressing effects of bldA. Another article by Kim et al. [20], also comparing the proteome of S. coelicolor wild type with a bldA mutant, focuses on the extracellular proteome within a pH range of 4–7. Here 21 genes were identified to be differentially expressed between the two strains. None of these differentially expressed genes had a TTA codon. One gene product from the actinorhodin cluster and one from the coelichelin biosynthetic cluster were found in the secreted proteome and to be more abundant in the wild type. The effects of bldA on the transcriptional, translational, and post-translational level of gene expression are summarized in Fig. 6.

The function of AdpA (A-factor-dependent protein) in different Streptomyces strains The AdpA–BldA feedback loop for S. griseus was established by Higo et al. [11]. The adpA gene, also called bldH, contains a


TTA codon and, therefore, makes it a direct target of bldA regulation. It codes for a transcriptional regulator which, in the case of S. griseus, starts a cascade of gene activation leading to morphological differentiation and secondary metabolism (Fig. 7). Introduction of a mutation in the bldA or the adpA gene led to the same “bald” phenotype of S. griseus and also to a deficiency of streptomycin production. The gene sequence of adpA is conserved in Streptomyces and a TTA codon is located in the same position in the sequenced genomes of different Streptomyces strains available on NCBI. In S. griseus, different experiments were conducted, where bldA and many other TTA-containing genes were deleted or TTA codons replaced with other leucine codons. One of these experiments showed that bldA was hardly transcribed in a S. griseus mutant with a deletion of adpA which resulted in a “bald” phenotype and a deficiency to produce antibiotics. The same effect had been already observed before in bldA mutants. This led to the assumption that not only bldA activates adpA translation, but also AdpA is essential for the activation of bldA transcription through a region upstream of the bldA promoter. During the early stage of growth, ArpA (A-factor-specific receptor) binds to the operator of adpA and represses its transcription. The AdpA cascade starts when the concentration of A-factor reaches a critical level and binds its receptor ArpA which subsequently dissociates from the promoter of adpA and adpA can be transcribed. The production of A-factor requires AfsA, the A-factor biosynthesis enzyme. The translation of adpA into AdpA is only successful in the presence of a functioning bldA gene coding for the right leu-tRNAUUA molecule. The generated AdpA AraC/XylS family transcriptional regulator activates, on the one hand, bldA transcription and, on the other hand, starts a whole cascade of subsequent gene activation leading to morphological differentiation and the production of secondary metabolites. Therefore, in S. griseus, AdpA is the key

Figure 6. The regulatory effects of bldA on transcriptional, translational, and post-translational levels of gene expression.


www.archpharm.com

6

ARCH PHARM



Figure 7. AdpA–BldA feedback loop established for S. griseus by Higo et al. [11] with auto-regulatory mechanisms of AdpA [23].

regulator responsible for both morphological differentiation and secondary metabolism. Also in S. coelicolor like in S. griseus, adpA contains a TTA codon and the response cascade of AdpA concerning morphological differentiation results in a similar “bald” phenotype [12], but it is missing the triggering effect on secondary metabolite production. Furthermore, the adpA gene of S. coelicolor is in contrast to S. griseus not dependent on A-factor [21]. In the article by Higo et al. [11], the main bldA effects in S. griseus were reduced to two target genes containing a TTA codon, adpA, and amfR. AmfR is a gene coding for a transcriptional activator crucial for the formation of aerial hyphae and it is also part of the AdpA feedback cascade. This was revealed

after replacement of the TTA codon in adpA with one of the other leucine codons in a bldA mutant strain which led only to an incomplete restoration of aerial mycelium formation and sporulation [22]. Only after the additional replacement of the TTA codon in the amfR gene, aerial mycelium formation and sporulation was fully restored which makes it clear that also amfR expression is necessary for complete morphological differentiation. Transcription of amfR is activated by AdpA and its translation by BldA in S. griseus. AmfR is a very good example for an interplay of transcriptional control through AdpA and translational control through BldA. Another example for a double-controlled target gene is strR (containing a TTA codon), a

Table 1. The function of AdpA in different Streptomyces strains. Experiment S. griseus Introduction of a mutation in the adpA gene

S. coelicolor Introduction of a mutation in the adpA gene S. lividans Introduction of a mutation in the adpA gene


Result AdpA controles bldA transcription and therefore the expression of TTA codons containing genes AdpA controls amfR transcription and therefore controls aerial mycelium formation AdpA controls strR and strN transcription and therefore streptomycin production AdpA controls aerial mycelium formation AdpA does not control secondary metabolite production AdpA controls aerial mycelium formation AdpA influenced the expression of many genes

www.archpharm.com

7

ARCH PHARM


transcriptional activator of streptomycin production. Also the transcriptional regulator of the streptomycin cluster, strN, contains two TTA codons and is therefore regulated through the AdpA–BldA feedback loop. In comparison to S. griseus, in S. coelicolor, actinorhodin (actII-orf4 containing TTA codon) was also produced in an adpA mutant, proving that actinorhodin production is independent of AdpA. In addition to the postulated positive feedback loop between BldA and AdpA, an auto-regulatory mechanism of AdpA was also investigated for S. griseus in the article by Kato et al. [23] (Fig. 7). When AdpA reaches a critical level, it binds to the promoter of its own gene and inhibits its transcription as well as the transcription of asfA and therefore the production of A-factor by AsfA is repressed. A recent study of S. lividans showed that deletion of adpA, besides failure of aerial mycelium formation, influenced the expression of hundreds of genes including 11 TTA-containing genes [24]. All these results of research work done concerning AdpA hint to its key role in the bldA regulation which makes it likely to be also applicable for the genus Streptomyces in general. Table 1 and Fig. 7 summarize the function of AdpA in Streptomyces and its regulation by BldA.

Conclusion The intention of this review was to re-elucidate the role of bldA concerning the development of new antibiotics. BldA has shown to have major effects on the control of biosynthetic gene clusters which can be observed through transcriptomic and proteomic analyses. Complementation of defective bldA or constitutive expression of bldA could be used as a method to switch on antibiotic production and could help in the struggle to find new chemotherapeutic drugs against resistant pathogens.

References € fs, A. Zeeck, Chembiochem [1] H. B. Bode, B. Bethe, R. Ho 2002, 3, 619–627. [2] K. Ochi, Biosci. Biotechnol. Biochem. 2007, 71, 1373– 1386. [3] S. Behnken, T. Lincke, F. Kloss, K. Ishida, C. Hertweck, Angew. Chem. 2012, 51, 2425–2428.



[4] N. L. McKenzie, M. Thaker, K. Koteva, D. W. Hughes, G. D. Wright, J. R. Nodwell, J. Antibiot. 2010, 63, 177–182. [5] R. H. Baltz, J. Ind. Microbiol. Biotechnol. 2011, 38, 657– 666. [6] J. M. Winter, S. Behnken, C. Hertweck, Curr. Opin. Chem. Biol. 2011, 15, 22–31. [7] L. Kalan, A. Gessner, M. N. Thaker, N. Waglechner, X. Zhu, A. Szawiola, A. Bechthold, G. D. Wright, D. L. Zechel, Chem. Biol. 2013, 20, 1214–1224. [8] E. J. Lawlor, H. A. Baylis, K. F. Chater, Genes Dev. 1987, 1, 1305–1310. [9] D. Hopwood, Bacteriol. Rev. 1967, 31, 373–403. [10] K. F. Chater, G. Chandra, FEMS Microbiol. Rev. 2006, 30, 651–672. [11] A. Higo, S. Horinouchi, Y. Ohnishi, Mol. Microbiol. 2011, 81, 1607–1622. [12] E. Takano, M. Tao, F. Long, M. J. Bibb, L. Wang, W. Li, M. J. Buttner, M. J. Bibb, Z. X. Deng, K. F. Chater, Mol. Microbiol. 2003, 50, 475–486. [13] W. Li, J. Wu, W. Tao, C. Zhao, Y. Wang, X. He, G. Chandra, X. Zhou, Z. Deng, K. F. Chater, M. Tao, FEMS Microbiol. Lett. 2007, 266, 20–28. [14] K. F. Chater, G. Chandra, J. Microbiol. 2008, 46, 1–11. [15] E. P. Guthrie, K. F. Chater, J. Bacteriol. 1990, 172, 6189– 6193. [16] S. O’Rourke, A. Wietzorrek, K. Fowler, C. Corre, G. L. Challis, K. F. Chater, Mol. Microbiol. 2009, 71, 763–778. [17] B. M. Pettersson, L. A. Kirsebom, Mol. Microbiol. 2011, 79, 1602–1614. [18] Y. V. Rebets, B. O. Ostash, M. Fukuhara, T. Nakamura, V. O. Fedorenko, FEMS Microbiol. Lett. 2006, 256, 30–37. [19] A. Hesketh, G. Bucca, E. Laing, F. Flett, G. Hotchkiss, C. P. Smith, K. F. Chater, BMC Genomics 2007, 8, 261. [20] D. W. Kim, K. Chater, K. J. Lee, A. Hesketh, J. Bacteriol. 2005, 187, 2957–2966. [21] E. Takano, R. Chakraburtty, T. Nihira, Y. Yamada, M. J. Bibb, Mol. Microbiol. 2001, 41, 1015–1028. [22] K. T. Nguyen, J. Tenor, H. Stettler, L. T. Nguyen, L. D. Nguyen, C. J. Thompson, J. Bacteriol. 2003, 185, 7291–7296. [23] J. Y. Kato, Y. Ohnishi, S. Horinouchi, J. Mol. Biol. 2005, 350, 12–26. [24] A. Guyet, N. Benaroudj, C. Proux, M. Gominet, e, P. Mazodier, BMC Microbiol. 2014, 14, 81. J. Y. Coppe

www.archpharm.com

8

Redox-sensing regulator Rex regulates aerobic metabolism, morphological differentiation, and avermectin production in Streptomyces avermitilis.

Deciphering the regulon of Streptomyces coelicolor AbrC3, a positive response regulator of antibiotic production.

6S RNA modulates growth and antibiotic production in Streptomyces coelicolor.

Improved antibiotic production and silent gene activation in Streptomyces diastatochromogenes by ribosome engineering.

The level of a transcript required for production of a Streptomyces coelicolor antibiotic is conditionally dependent on a tRNA gene.

The SCL gene product: a positive regulator of erythroid differentiation.

In conditions of over-expression, WblI, a WhiB-like transcriptional regulator, has a positive impact on the weak antibiotic production of Streptomyces lividans TK24.

Identification of AstG1, A LAL family regulator that positively controls ansatrienins production in Streptomyces sp. XZQH13.

DptR2, a DeoR-type auto-regulator, is required for daptomycin production in Streptomyces roseosporus.

Sultriecin, a new antifungal and antitumor antibiotic from Streptomyces roseiscleroticus. Production, isolation, structure and biological activity.

Control of Morphological Differentiation of Streptomyces coelicolor A3(2) by Phosphorylation of MreC and PBP2.

Cloning and characterization of a gene of Streptomyces griseus that increases production of extracellular enzymes in several species of Streptomyces.

Effect of dissolved oxygen control on growth and antibiotic production in Streptomyces clavuligerus fermentations.

abaA, a new pleiotropic regulatory locus for antibiotic production in Streptomyces coelicolor.

Biomass-derived molecules modulate the behavior of Streptomyces coelicolor for antibiotic production.

Streptomyces natalensis programmed cell death and morphological differentiation are dependent on oxidative stress.

Aldecalmycin, a new antimicrobial antibiotic from Streptomyces.

Killing of Mycolic Acid-Containing Bacteria Aborted Induction of Antibiotic Production by Streptomyces in Combined-Culture.

Identification of a novel unpaired histidine sensor kinase affecting secondary metabolism and morphological differentiation in Streptomyces acidiscabies ATCC 49003.

Development of an antibiotic marker-free platform for heterologous protein production in Streptomyces.

Production of polypeptide antibiotic from Streptomyces parvulus and its antibacterial activity.

The Absence of Pupylation (Prokaryotic Ubiquitin-Like Protein Modification) Affects Morphological and Physiological Differentiation in Streptomyces coelicolor.

Bioprocess intensification of antibiotic production by Streptomyces coelicolor A3(2) in micro-porous culture.

Disruption of Macrodomain Protein SCO6735 Increases Antibiotic Production in Streptomyces coelicolor.