Somatic Cell and Molecular Genetics, Vol. 17, No. O, 1991, pp. 609-615
Brief Communication
The Gonadotropin-Releasing Hormone (Gnrh) Gene Maps to Mouse Chromosome 14 and Identifies a Homologous Region on Human Chromosome 8 Penny Williamson, ~ Jill Lang, 2 and Yvonne Boyd ~ ~Genetics' Division (Harwell), MRC Radiobiology Unit, Chilton, Didcot, Oxon OXI ] ORD, Englan& and 2Department of Human Anatomy, University of Oxford, South Parks"Road, Oxford OX1 3QX, England Received 22 May 1991--Final 7 August 1991
AbstractmThe routine gonadotropin-releasing hormone (Gnrh) locus has been mapped to mouse chromosome 14 using a mouse x Chinese hamster somatic cell hybrid panel. The equivalent human locus, known as luteinizing hormone-releasing hormone (LHRH), has been previously mapped to 8p21-8p11.2. Four other loci mapping to the human chromosome 8 short arm have been mapped to mouse chromosome & two of these (PLAT, GSR) lie proximal to LHRH, and two (LPL, DEFt) lie distal to LItRH. The localization of Gnrh, the mulJne homoIog of LHRH, to mouse chromosome 14 therefore defines a hitherto unrecognized block of homology between man and mouse. Furthermore, it indicates that the region of homology between the human chromosome 8 short arm and mouse chromosome 8 is composed of two separate blocks.
INTRODUCTION
Correct expression of the gene encoding gonadotropin-releasing-hormone and its associated peptide, is essential for normal reproductive function in mammals (1). These peptides are released at intervals into the portal vascular system that connects the hypothalamus with the pituitary, where they stimulate the secretion of gonadotropins and repress prolactin secretion (2-4). The importance of this locus for reproductive capability is also indicated by its expression in mammary glands, gonads, and placental tissues (5). Human, rat, and mouse copies of the gene have been cloned and sequenced (5, 6). The human locus, referred to as luteinizing hormone-releasing hormone (LHRtt), has been mapped to human chromosome 8 by somatic cell genetics and to 8p21-8p11.2 by in
situ hybridization (7). The homologous locus in the mouse is referred to as the gonadotropin-releasing hormone locus and has been given the symbol Gnrh. A deletion of the distal half of the Gnrh locus has been shown to be responsible for the hereditary hypogonadism in the hpg mouse (6, 8, 9). This mouse mutant has been well-characterized (8) and provides a useful animal model for autosomally inherited familial hypogonadism in man. Homozygous hpg male and female mice can be recognized by visual inspection of the gonads but heterozygotes are phenotypicatly normal. Maintenance of hpg stocks has been simplified by the development of an assay based on the polymerase chain reaction (PCR), which differentiates between the normal and deleted loci (10). This assay has been successfully used to identify heterozygotes and to
609
0740-7750/91/1100-0609506.50/0 ~ 1991 Plenum Publishing Corporation
610
Williamson et aL
confirm the Mendelian inheritance pattern of the gene. The mouse mutant locus has not been mapped by classical mouse genetics because of the infertility of hpg homozygotes and previous difficulties in recognizing the heterozygotes. We have recently developed a panel of mouse x Chinese hamster somatic cell hybrids (CV series) for mapping cloned genes in the mouse (Williamson et al., in preparation). This paper describes the use of the CV hybrid panel together with the PCR assay to provide a chromosomal assignment for the Gnrh locus. MATERIALS
AND METHODS
Hybrid Cells. The CV series of hybrid lines used in this study were derived from a fusion between mouse splenocytes (CBA) and Chinese hamster cells (V79) and were selected in H A T medium (Eagle's minimal essential medium supplemented with 10% fetal calf serum, 20 mM glutamine, 10 -4 M hypoxanthine, 10 5 M methotrexate, and 1.6 x 10 -5 M thymidine). Hybrids CV7/311 and CV7/211, which retained only mouse chromosomes 1, 14, 16, and X, were derived by sequential cloning (three times) of the hybrid line CV7. Nine hybrid lines were obtained after further cloning of CV7/311,
Chromosome
Hybrid lines CV7/211R and CV10/311R were selected in 6-thioguanine (10 fxg/ml) in order to induce segregation of the mouse X chromosome. The mouse chromosome content was checked by PCR analysis of each hybrid using chromosome-specific primers (Williamson et at., in preparation). The absence of interspecific rearrangements was confirmed by in situ hybridization with biotinylated total mouse genomic DNA.
PCR Assays for Mouse Chromosomes X, 1, 14, and 16. The mouse chromosome contents of CV7/211 and all CV7/311 derivatives were checked using mouse chromosomespecific primers. The primer sequences and appropriate conditions for the differentiation of the amplification products generated from mouse and Chinese hamster DNAs are given in Table 1. Primer sequences for chromosomes 1, 14, and X were taken from references 11 and 12; primer sequences for chromosome 16 were designed from the published sequence of murine interferoninduced protein Mx (13, t4). Reactions were carried out in a buffer containing 600 ng template DNA, 1.6 lxM primer, 10 mM Tris pH 8.3, 50 mM KC1, 0.1% gelatin, 0.1% sodium phosphate, 0.1 mM dNTP, 1-5 mM MgC12 (optimal concentration was determined empirically) and 0.2 units of Taq polymerase (Perkin-Elmer or Life Technolo-
Table 1. Chromosome-SpecificPrimers for Mouse Chromosomes1, 14, 16, and X Map PCR position product T(,~ (cM) Locus 5' Primer sequence 3' size (hp) (°C)°
1
17
Acrg
14
18
Tcra
14
38
Nfl
16
59
Mx
X
23
Hprt
X
56
Pip
ACCGTTCACAGCTGACCTAGT GGGACACAGATGTACTAAGCT GTCTTTAGTGGTCCTCACATA TTGCTCCTTCCTGTAAATAAG GCAATTAATCACTGCAGTCCATTA ATTCTTTTAGCCAGGGTCGCAT CTCTGGCTATCCFGGAACTAA GTTI'GGGTACTATCAGTGGAA TGACAACTTCTGTCCTCAACA ATGCCGTCC'ITFATCTAGAAC TAATATAACAGATAACCAACCATTC CATTTTGTAAGATGAGTFTCTA
"T(~= annealing temperature in degrees centigrade.
Mg2+ (mM)
112
55
1
129
55
2
197
56
1
180
58
1
97
57
1
120
56
2
GnrhMaps to Mouse
Chromosome 14
gies) in a total volume of 25 ~xl. All three reactions were performed using a PerkinElmer thermocycler programmed for an initial denaturation period of 10 min at 94°C, followed by thirty reaction cycles of 94°C, 1 min; 50-60°C, 1 rain; 72°C, 1 rain; and a final extension period of 10 min at 72°C. After completion, a 12-~1 aliquot was analyzed by electrophoresis through 3% agarose. The size of the amplification product was confirmed by comparison with the migration of bands from a standard kilobase ladder (Life Technologies). PCR Assay for Gnrh Locus. Primers A and C were designed to amplify a 710-bp product from normal mouse D N A (10). Primer A (5'CACATCTGTAGCCACAGTCC) covers from 2223 to 2242, and primer C ( 5 ' G C T T G G A G A G C T G T C C G GTC) from 2913 to 2932 of the sequence given by Mason et al. (9). The polymerase chain reaction was performed as described previously (10) on purified D N A in a buffer containing 4 pmol of each primer, 2 mM MgC12, 0.2 mM (dNTP), 0.5 units Taq polymerase, 50 mM KC1, and 10 mM Tris pH 8.2. The reaction was programmed as follows: one cycle of 92°C, 5 min; 60°C, 15 sec; 72°C, 1 rain; 20 cycles of 92°C, 15 sec; 60°C, 15 sec; 72°C, 1 rain; 8 cycles of 92°C, 15 sec; 60°C, 15 sec; 72°C, 2 rain. Under these conditions no amplification products were observed when control Chinese hamster (V79) D N A was used as a template.
611
hybrids allowed us to eliminate the possibility of X-localization and to map the locus to chromosome 14. Firstly, Gnrh was present in two hybrid lines, CV10/311R and CV7/211R, which had lost the mouse X chromosome (Fig. 1; see Materials and Methods). To confirm loss of the entire X chromosome, these hybrids were checked for the absence of loci from the proximal (DXF34h), central (Hprt) and distal (Plp) regions of the X chromosome (Table 2) (15, 16). The retention of chromosome 14 was confirmed after amplification of hybrid D N A with the chromosome 14-specific primers from the Tcra and Nfl loci (Table 2). Secondly, Gnrh was absent in a series of additional hybrid subclones isolated from CV7/311, all of which had lost mouse chromosome 14, but which had retained the mouse X chromosome. During the initial screening of somatic cell hybrids, we observed that the amount of product produced with the chromosome 14 specific primers was comparatively reduced in hybrid CV7/311, which suggested that chromosome 14 was
RESULTS Amplification of D N A from the CV panel of 22 mouse x Chinese hamster cell hybrids using Gnrh primers indicated concordance of the presence of the Gnrh locus with mouse chromosomes X and 14. The X chromosome (under selection) and chromosome 14 (by chance) were retained in all hybrids and all produced a 710-bp amplification product with the Gnrh primers. Construction and analysis of two further sets of
Fig. 1. Amplification products from the Gnrh locus in hybrids with and without the mouse X chromosome. Hybrids 7/211 and 10/311 retain the mouse X chromosome and some autosomes. Hybrids 7/211R and 10/311R are derivativesof these hybridsselected for loss of the mouse X chromosome;the amplificationproducts from two independent template preparations are shown for these revertants. The major product of 710 bp is arrowed; the origin of the upper band is unclear and is occasionallyobserved as a product in this amplification reaction.
612
W i l l i a m s o n et al.
Table
P C R A n a l y s i s o f H y b r i d s S e g r e g a t i n g C h r o m o s o m e s X a n d 14"
2.
Chromosome 1
C h r o m o s o m e 14
C h r o m o s o m e 16
X chromosome
Hybrid
Acrg
Tcra
Nfl
Mx
Hprt
Plp
CV10/311 CV10/311R C V 7 '211 CV7 211R CV7 311 CV7 311-1 CV7 311-2 CV7 311-4 C V 7 '311-5 CV7 311-6 CV7 311-7 CV7 311-8 CV7 311-9 CV7 311-10
+
+
+
+
+
+
+
Not tested +
+ +
+ +
. +
+
+
+ +
Not tested +
+ +
+ +
+
+
+
+ +
_
_
+
+
+
-
--
_
+
+
+
--
_
_
+
+
+
-........
,.,
+ +
+ +
+ +
--
+
+
+
-
+
+
+
-
+
+
+
-
+
+
+
-
+
+ + .
.
.
.
.
.
.
.
+
. . . . . .
+
-
+
.
_. .
.
.
.
.
.
.
.
Gnrh
" H y b r i d C V 1 0 / 3 1 1 r e t a i n s m o u s e c h r o m o s o m e s 6, 7, 8,13, 17, a n d 18. C V 1 0 / 3 1 1 R a n d C V 1 0 / 2 1 1 R w e r e o n l y t e s t e d f o r t h e s e g r e g a t i o n o f r e l e v a n t m o u s e c h r o m o s o m e s a n d w e r e also f o u n d to h a v e lost t h e p r o x i m a l X c h r o m o s o m e m a r k e r , D X F 3 4 h , b y S o u t h e r n b l o t analysis.
segregating in this hybrid line. We therefore isolated nine sublines from CV7/311 by cloning. All these clones, along with CV7/ 311, CV7/211, and mouse and Chinese hamster control DNAs, were analyzed in PCR-based assays for the presence or absence of the 710-bp PCR product and mouse chromosomes X, 1, 14, and 16 as only these four chromosomes were present in the parental hybrid lines (Fig. 2, Table 2). Complete concordance between the absence of the Gnrh locus and the absence of the amplification product from mouse chromosome 14 was observed. The pooled data obtained from analysis of the revertants, the CV7/311 subclones, and the 22 hybrids of the original CV panel are given in Table 3. Chromosome 14 is the only mouse chromosome that shows complete concordance with the Gnrh locus. DISCUSSION
We have mapped the locus encoding the gonadotropin-releasing hormone (Gnrh) gene to mouse chromosome 14. The equivalent human locus, referred to as luteinizing
hormone-releasing hormone (LHRH), has been mapped to human chromosome 8 by somatic cell genetics and to 8p21-p11.2 by in situ hybridization (7). Glutathione reductase (GSR, Gr-1), which lies close to the LHRH locus on the short arm of human chromosome 8, lies on mouse chromosome 8 (17), an observation which led to the suggestion that the mouse homologue of LHRH, Gnrh, would also lie on this chromosome (7). ttowever, the data presented here unequivocally map this locus to mouse chromosome 14 and eliminate the possibility of a localization to mouse chromosome 8 by the demonstration that only 36% concordance was observed between chromosome 8 and the Gnrh locus (Table 3). Therefore the mapping of Gnrh defines a homologous region between mouse chromosome 14 and human chromosome 8. After the completion of this work, further support of the existence of this homologous chromosomal segment was provided by Todd et al. (18), who have mapped both the hpg and Nfl loci to mouse chromosome 14 using microsatellite polymorphisms identified from the published sequences of Gnrh and Nfl (17). These results support our
Gnrh Maps to Mouse Chromosome 14
613
Table 3. Chromosomal Mapping of Gnrh Locus"
Fig. 2. Amplification products observed after PCR analysis of hybrids with and without mouse chromosome 14 using (a) chromosome 14-specific primers (Tcra), (b) Gnrh primers, (c) X chromosome primers (Hprt). In each case, the mouse amplification product is arrowed and the size indicated. (a) the lower band represents products from the hamster genome and is present in the V79 control track and all hybrids. (c) a faint band of the same size as the mouse Hprt product can be seen in the V79 control track; this is also consistently observed in controls without template DNA (not shown) and is therefore assumed to be due to a primer complex.
assignment of Gnrh to mouse chromosome 14 and are of further interest because the human homologue of Nil, the locus encoding the neurofilament light polypeptide gene (NEFL), has been mapped to 8p21 by in situ hybridization (19, 20). The extent of the homology between the human chromosome 8 short arm and the proximal region of mouse chromosome 8 is defined by the locus encoding glutathione reductase and three further homologous loci that have been positioned by in situ hybridization on human chromosome 8 and mapped into the proximal region of mouse chromosome 8 by linkage analysis (Fig. 3). The
Chromosome
Discordant hybrids
Concordant hybrids
% Concordance
1 2 3 4 5 6 7 8 9 lO 11 12 13 14 15 16 17 18 19 X Y
15 12 15 14 21 5 7 14 21 19 22 19 9 0 13 18 7 11 18 11 20
16 10 7 8 11 17 15 8 11 3 0 13 19 33 9 15 24 11 4 22 (2)
52 45 32 36 33 77 68 36 34 [4 0 41 68 100 41 45 77 50 18 67 9
°Concordant hybrids are those in which the chromosome and Gnrh were both present or both absent; discordant hybrids are those in which either the chromosome was absent and Gnrh present or vice versa. Note that different numbers of hybrids were analyzed for each chromosome because of pooling the data from the revertants and the CV7/311 subclones with the fully analysed CV panel.
8p23 8p22 8p21 8p12
human 8
DEF1 I LPL , GSR PLAT
tD LHRH NEFL
- G r - 1 , Plat Lpl - Defcr _
mouse 8
Fig. 3. The positions of homologous loci depicted on the cytogenetic map of human chromosome 8 and the genetic map of the proximal region of mouse chromosome 8. LttRIt and NEFL, which lie between two groups of loci with murine homologs on mouse chromosome 8, have been mapped to mouse chromosome 14 (this paper, ref. 18),
614
plasminogen activating factor (PLAT, Plat) and G S R (Gr-1) have been m a p p e d to proximal 8p in man and close to each other in the mouse (17, 21, 22). Lipoprotein lipase (LPL, L p l ) and defensin (DEF1, Defcr) have been positioned in 8p22-pter in man (21, 23) and 16-19 centimorgans from Plat and Gr-1 on the mouse consensus genetic map (24, 25). The in situ hybridization data for L H R H and N E F L suggest that both loci lie between these two groups of loci on the human chromosome 8 short arm. Theretbre the localization of the homologous murine loci to mouse chromosome 14 indicates that the region of homology between human chromosome 8 and mouse chromosome 8, which encompasses DEF1, L P L , GSR, and P L A T is composed of two separate blocks, with two evolutionary breaks flanking the L H R H and N E F L loci (Fig. 3). An alternative possibility is that the subregional assignments by in situ hybridization in man are misleading and that there is a single evolutionary break between L H R H and the other four loci. More detailed comparative mapping and ordering of loci on the h u m a n chromosome 8 short arm is needed to clarify the situation. In conclusion, we have demonstrated that the locus for gonatropin-releasing horm o n e lies on mouse chromosome 14 by analysis of somatic cell hybrids. F u r t h e r m o r e Gnrh, along with the locus that encodes the neurofilament light polypeptide gene, identify a hitherto unrecognized region of homology between the short arm of human chromosome 8 and mouse chromosome 14.
ACKNOWLEDGMENTS
We are grateful to Sheila Holt for advice and assistance with tissue culture and in situ hybridization studies; Adrian Ford, Kevin Glover, and Elton Evans for photography; Val Cooper and Janet Jones for primer syntheses; and Dr. Bruce Cattanach for interest and encouragement. This work was
Williamson et al.
supported by grants fi'om the M R C H G M P Directed Programme and the Wellcome Trust. LITERATURE C I T E D 1. Schally, A,V., Arimura, A., Kastin, A.J,, Matsuo, H., Baba, Y., Redding, T.W., Nair, R.M.G., and Debeljuk L. (1971). Science 173:1036-1038. 2. Burgus, R., Butcher, M., Amoss, M., Ling, N., Monahan, M., Rivier, J., Fellows, R., Blackwell,R., Vale, W., and Guilleman, R. (1972). Proc. Natl. Acad. Sci. U.S.A. 69:278-282. 3. Nikolics, K., Mason, A.J., Szonyi, E., Ramachandran, J., and Seeburg, P.H. (1985). Nature 316:511517. 4. Matsuo, H., Baba, Y., Nair, R.M.G., Arimura, A., and Schally, A.V. (1971). Biochem. Biophys. Res. Commun. 43:1334-1339. 5. Adelman, J.P., Mason, A.J., Hayflick, J.S., and Seeburg, P.H. (1983). Proc. Natl. Acad. Sci. U.S.A. 83:179-183. 6. Mason, A.J., Hayflick, J.S., Zoeller, R.T., Young, W.S., Phillips, H., Nikolics, K., and Seeburg, P.H. (1986). Science 234:1366-1371. 7. Yan-Feng, T.L., Seeburg, P.H., and Franke, U. (1986). Somat. Cell. Mol. Gen. 12:95-100. 8. Cattanach, B.M., Iddon, C.A., Charlton, H.M., Chiappa, S.A., and Fink, G. (1977). Nature 269:338-340. 9. Mason, A.J., Pitts, S.L., Nikotics, K., Szonyi, E., Wilcox, J.N., Seeburg, P.H., and Stewart, T.A. (1986). Science 234:1372-1378. t0. Lang,J. (199t). Mouse Genome (in press). ll. Love, J., Knight, A., McAleer, M., and Todd, J. (1990). NAR 18:4123-4130. 12. Hearne, C.M., McAleer, M.A., Loce, J,M., Aitman, T.J., Cornall, R.J., Ghosh, S., Knight, A., Prins, J.-B,, and Todd, J.A. (1991). Mammal Genome (in press). 13. Hug, H., Costas, M., Staehli, P., Aebi, M., and Weissmann, C. (1988). MoL Cell BioL 8:3065-3079. 14. Lyon,M.F., and Kirby, M. (1991). Mouse Genome 89:54. 15. Laval, S.H., and Boyd, Y. (1991). 6},togenet. Cell Genet. (in press). 16. Brown, S,D.M., Avner, P.A., Chapman, V.M., Hamvas, R.M.J., and Herman, G.E. (1991). Mammal Genome 1:$318-$331. 17. Nichols, E.A., and Ruddle, F.H. (1975). Biochem. Genet. 13:323-329. 18. Todd, J.A, Aitman, T.J., Cornall, R.J., Ghoso, S., Hall, J.R.S., Hearne, C.M., Knight, A.M., Love, J.M., McAleer, M.A, Prins, J-B., Rodrigues, N., Lathrop, M., Pressey, A., DeLarato, N.H., Peterson, L.B., and Wicker, L.S. (1991). Nature 351:542547. 19. Hurst, J., Flavell, D., Julien, J.-P., Meijer, D., Mushynski, W., and Grosveld, F. (1987). Cytogenet. Cell Genet. 45:30-32.
Gnrh Maps to Mouse Chromosome 14
20. Somerville, M.J., and McLachlan, D.R. (1988). Genome 30:499-500. 2l. Tsui, L.-C., Farrall, M., and Donis-Keller, H. (1989). Cytogenet. Cell Genet. 51:166-201. 22. Ceci, J.D., Justice, M.J., Lock, L.F., Jenkins, N.A., and Copeland, N.G. (1990). Genomics 6:72-79. 23. Sparkes, R.S., Zollman, S., Klisak, I., Kirchgessner, T.G., Komaromy, M.C., Mohandas, T., Schotz, M.C., and Lusis, A.J. (1987). Genomics 1:138M44.
615 24. Oulette, A.J., Pratchevna, D., Ruddle, F.H., and James, M. (1989). Genomics 5:233-239. 25. Doolittle, D.P., Davisson, M.T., Roderick, T.H., and Hfllyard, A.L. (1990). Mouse Genome 87:20. 26. Lalley, P.A., Davisson, M.T., Graves, J.A.M., O'Brien, S J , Womack, J.E, Roderick, T.H., Creau-Goldberg, N., Hillyard, A.L., Doolittle, D.P., and Rogers, J.A. (1989). Cytogenet. Cell Genet. 51:503-532.
Brief Communication
The Gonadotropin-Releasing Hormone (Gnrh) Gene Maps to Mouse Chromosome 14 and Identifies a Homologous Region on Human Chromosome 8 Penny Williamson, ~ Jill Lang, 2 and Yvonne Boyd ~ ~Genetics' Division (Harwell), MRC Radiobiology Unit, Chilton, Didcot, Oxon OXI ] ORD, Englan& and 2Department of Human Anatomy, University of Oxford, South Parks"Road, Oxford OX1 3QX, England Received 22 May 1991--Final 7 August 1991
AbstractmThe routine gonadotropin-releasing hormone (Gnrh) locus has been mapped to mouse chromosome 14 using a mouse x Chinese hamster somatic cell hybrid panel. The equivalent human locus, known as luteinizing hormone-releasing hormone (LHRH), has been previously mapped to 8p21-8p11.2. Four other loci mapping to the human chromosome 8 short arm have been mapped to mouse chromosome & two of these (PLAT, GSR) lie proximal to LHRH, and two (LPL, DEFt) lie distal to LItRH. The localization of Gnrh, the mulJne homoIog of LHRH, to mouse chromosome 14 therefore defines a hitherto unrecognized block of homology between man and mouse. Furthermore, it indicates that the region of homology between the human chromosome 8 short arm and mouse chromosome 8 is composed of two separate blocks.
INTRODUCTION
Correct expression of the gene encoding gonadotropin-releasing-hormone and its associated peptide, is essential for normal reproductive function in mammals (1). These peptides are released at intervals into the portal vascular system that connects the hypothalamus with the pituitary, where they stimulate the secretion of gonadotropins and repress prolactin secretion (2-4). The importance of this locus for reproductive capability is also indicated by its expression in mammary glands, gonads, and placental tissues (5). Human, rat, and mouse copies of the gene have been cloned and sequenced (5, 6). The human locus, referred to as luteinizing hormone-releasing hormone (LHRtt), has been mapped to human chromosome 8 by somatic cell genetics and to 8p21-8p11.2 by in
situ hybridization (7). The homologous locus in the mouse is referred to as the gonadotropin-releasing hormone locus and has been given the symbol Gnrh. A deletion of the distal half of the Gnrh locus has been shown to be responsible for the hereditary hypogonadism in the hpg mouse (6, 8, 9). This mouse mutant has been well-characterized (8) and provides a useful animal model for autosomally inherited familial hypogonadism in man. Homozygous hpg male and female mice can be recognized by visual inspection of the gonads but heterozygotes are phenotypicatly normal. Maintenance of hpg stocks has been simplified by the development of an assay based on the polymerase chain reaction (PCR), which differentiates between the normal and deleted loci (10). This assay has been successfully used to identify heterozygotes and to
609
0740-7750/91/1100-0609506.50/0 ~ 1991 Plenum Publishing Corporation
610
Williamson et aL
confirm the Mendelian inheritance pattern of the gene. The mouse mutant locus has not been mapped by classical mouse genetics because of the infertility of hpg homozygotes and previous difficulties in recognizing the heterozygotes. We have recently developed a panel of mouse x Chinese hamster somatic cell hybrids (CV series) for mapping cloned genes in the mouse (Williamson et al., in preparation). This paper describes the use of the CV hybrid panel together with the PCR assay to provide a chromosomal assignment for the Gnrh locus. MATERIALS
AND METHODS
Hybrid Cells. The CV series of hybrid lines used in this study were derived from a fusion between mouse splenocytes (CBA) and Chinese hamster cells (V79) and were selected in H A T medium (Eagle's minimal essential medium supplemented with 10% fetal calf serum, 20 mM glutamine, 10 -4 M hypoxanthine, 10 5 M methotrexate, and 1.6 x 10 -5 M thymidine). Hybrids CV7/311 and CV7/211, which retained only mouse chromosomes 1, 14, 16, and X, were derived by sequential cloning (three times) of the hybrid line CV7. Nine hybrid lines were obtained after further cloning of CV7/311,
Chromosome
Hybrid lines CV7/211R and CV10/311R were selected in 6-thioguanine (10 fxg/ml) in order to induce segregation of the mouse X chromosome. The mouse chromosome content was checked by PCR analysis of each hybrid using chromosome-specific primers (Williamson et at., in preparation). The absence of interspecific rearrangements was confirmed by in situ hybridization with biotinylated total mouse genomic DNA.
PCR Assays for Mouse Chromosomes X, 1, 14, and 16. The mouse chromosome contents of CV7/211 and all CV7/311 derivatives were checked using mouse chromosomespecific primers. The primer sequences and appropriate conditions for the differentiation of the amplification products generated from mouse and Chinese hamster DNAs are given in Table 1. Primer sequences for chromosomes 1, 14, and X were taken from references 11 and 12; primer sequences for chromosome 16 were designed from the published sequence of murine interferoninduced protein Mx (13, t4). Reactions were carried out in a buffer containing 600 ng template DNA, 1.6 lxM primer, 10 mM Tris pH 8.3, 50 mM KC1, 0.1% gelatin, 0.1% sodium phosphate, 0.1 mM dNTP, 1-5 mM MgC12 (optimal concentration was determined empirically) and 0.2 units of Taq polymerase (Perkin-Elmer or Life Technolo-
Table 1. Chromosome-SpecificPrimers for Mouse Chromosomes1, 14, 16, and X Map PCR position product T(,~ (cM) Locus 5' Primer sequence 3' size (hp) (°C)°
1
17
Acrg
14
18
Tcra
14
38
Nfl
16
59
Mx
X
23
Hprt
X
56
Pip
ACCGTTCACAGCTGACCTAGT GGGACACAGATGTACTAAGCT GTCTTTAGTGGTCCTCACATA TTGCTCCTTCCTGTAAATAAG GCAATTAATCACTGCAGTCCATTA ATTCTTTTAGCCAGGGTCGCAT CTCTGGCTATCCFGGAACTAA GTTI'GGGTACTATCAGTGGAA TGACAACTTCTGTCCTCAACA ATGCCGTCC'ITFATCTAGAAC TAATATAACAGATAACCAACCATTC CATTTTGTAAGATGAGTFTCTA
"T(~= annealing temperature in degrees centigrade.
Mg2+ (mM)
112
55
1
129
55
2
197
56
1
180
58
1
97
57
1
120
56
2
GnrhMaps to Mouse
Chromosome 14
gies) in a total volume of 25 ~xl. All three reactions were performed using a PerkinElmer thermocycler programmed for an initial denaturation period of 10 min at 94°C, followed by thirty reaction cycles of 94°C, 1 min; 50-60°C, 1 rain; 72°C, 1 rain; and a final extension period of 10 min at 72°C. After completion, a 12-~1 aliquot was analyzed by electrophoresis through 3% agarose. The size of the amplification product was confirmed by comparison with the migration of bands from a standard kilobase ladder (Life Technologies). PCR Assay for Gnrh Locus. Primers A and C were designed to amplify a 710-bp product from normal mouse D N A (10). Primer A (5'CACATCTGTAGCCACAGTCC) covers from 2223 to 2242, and primer C ( 5 ' G C T T G G A G A G C T G T C C G GTC) from 2913 to 2932 of the sequence given by Mason et al. (9). The polymerase chain reaction was performed as described previously (10) on purified D N A in a buffer containing 4 pmol of each primer, 2 mM MgC12, 0.2 mM (dNTP), 0.5 units Taq polymerase, 50 mM KC1, and 10 mM Tris pH 8.2. The reaction was programmed as follows: one cycle of 92°C, 5 min; 60°C, 15 sec; 72°C, 1 rain; 20 cycles of 92°C, 15 sec; 60°C, 15 sec; 72°C, 1 rain; 8 cycles of 92°C, 15 sec; 60°C, 15 sec; 72°C, 2 rain. Under these conditions no amplification products were observed when control Chinese hamster (V79) D N A was used as a template.
611
hybrids allowed us to eliminate the possibility of X-localization and to map the locus to chromosome 14. Firstly, Gnrh was present in two hybrid lines, CV10/311R and CV7/211R, which had lost the mouse X chromosome (Fig. 1; see Materials and Methods). To confirm loss of the entire X chromosome, these hybrids were checked for the absence of loci from the proximal (DXF34h), central (Hprt) and distal (Plp) regions of the X chromosome (Table 2) (15, 16). The retention of chromosome 14 was confirmed after amplification of hybrid D N A with the chromosome 14-specific primers from the Tcra and Nfl loci (Table 2). Secondly, Gnrh was absent in a series of additional hybrid subclones isolated from CV7/311, all of which had lost mouse chromosome 14, but which had retained the mouse X chromosome. During the initial screening of somatic cell hybrids, we observed that the amount of product produced with the chromosome 14 specific primers was comparatively reduced in hybrid CV7/311, which suggested that chromosome 14 was
RESULTS Amplification of D N A from the CV panel of 22 mouse x Chinese hamster cell hybrids using Gnrh primers indicated concordance of the presence of the Gnrh locus with mouse chromosomes X and 14. The X chromosome (under selection) and chromosome 14 (by chance) were retained in all hybrids and all produced a 710-bp amplification product with the Gnrh primers. Construction and analysis of two further sets of
Fig. 1. Amplification products from the Gnrh locus in hybrids with and without the mouse X chromosome. Hybrids 7/211 and 10/311 retain the mouse X chromosome and some autosomes. Hybrids 7/211R and 10/311R are derivativesof these hybridsselected for loss of the mouse X chromosome;the amplificationproducts from two independent template preparations are shown for these revertants. The major product of 710 bp is arrowed; the origin of the upper band is unclear and is occasionallyobserved as a product in this amplification reaction.
612
W i l l i a m s o n et al.
Table
P C R A n a l y s i s o f H y b r i d s S e g r e g a t i n g C h r o m o s o m e s X a n d 14"
2.
Chromosome 1
C h r o m o s o m e 14
C h r o m o s o m e 16
X chromosome
Hybrid
Acrg
Tcra
Nfl
Mx
Hprt
Plp
CV10/311 CV10/311R C V 7 '211 CV7 211R CV7 311 CV7 311-1 CV7 311-2 CV7 311-4 C V 7 '311-5 CV7 311-6 CV7 311-7 CV7 311-8 CV7 311-9 CV7 311-10
+
+
+
+
+
+
+
Not tested +
+ +
+ +
. +
+
+
+ +
Not tested +
+ +
+ +
+
+
+
+ +
_
_
+
+
+
-
--
_
+
+
+
--
_
_
+
+
+
-........
,.,
+ +
+ +
+ +
--
+
+
+
-
+
+
+
-
+
+
+
-
+
+
+
-
+
+ + .
.
.
.
.
.
.
.
+
. . . . . .
+
-
+
.
_. .
.
.
.
.
.
.
.
Gnrh
" H y b r i d C V 1 0 / 3 1 1 r e t a i n s m o u s e c h r o m o s o m e s 6, 7, 8,13, 17, a n d 18. C V 1 0 / 3 1 1 R a n d C V 1 0 / 2 1 1 R w e r e o n l y t e s t e d f o r t h e s e g r e g a t i o n o f r e l e v a n t m o u s e c h r o m o s o m e s a n d w e r e also f o u n d to h a v e lost t h e p r o x i m a l X c h r o m o s o m e m a r k e r , D X F 3 4 h , b y S o u t h e r n b l o t analysis.
segregating in this hybrid line. We therefore isolated nine sublines from CV7/311 by cloning. All these clones, along with CV7/ 311, CV7/211, and mouse and Chinese hamster control DNAs, were analyzed in PCR-based assays for the presence or absence of the 710-bp PCR product and mouse chromosomes X, 1, 14, and 16 as only these four chromosomes were present in the parental hybrid lines (Fig. 2, Table 2). Complete concordance between the absence of the Gnrh locus and the absence of the amplification product from mouse chromosome 14 was observed. The pooled data obtained from analysis of the revertants, the CV7/311 subclones, and the 22 hybrids of the original CV panel are given in Table 3. Chromosome 14 is the only mouse chromosome that shows complete concordance with the Gnrh locus. DISCUSSION
We have mapped the locus encoding the gonadotropin-releasing hormone (Gnrh) gene to mouse chromosome 14. The equivalent human locus, referred to as luteinizing
hormone-releasing hormone (LHRH), has been mapped to human chromosome 8 by somatic cell genetics and to 8p21-p11.2 by in situ hybridization (7). Glutathione reductase (GSR, Gr-1), which lies close to the LHRH locus on the short arm of human chromosome 8, lies on mouse chromosome 8 (17), an observation which led to the suggestion that the mouse homologue of LHRH, Gnrh, would also lie on this chromosome (7). ttowever, the data presented here unequivocally map this locus to mouse chromosome 14 and eliminate the possibility of a localization to mouse chromosome 8 by the demonstration that only 36% concordance was observed between chromosome 8 and the Gnrh locus (Table 3). Therefore the mapping of Gnrh defines a homologous region between mouse chromosome 14 and human chromosome 8. After the completion of this work, further support of the existence of this homologous chromosomal segment was provided by Todd et al. (18), who have mapped both the hpg and Nfl loci to mouse chromosome 14 using microsatellite polymorphisms identified from the published sequences of Gnrh and Nfl (17). These results support our
Gnrh Maps to Mouse Chromosome 14
613
Table 3. Chromosomal Mapping of Gnrh Locus"
Fig. 2. Amplification products observed after PCR analysis of hybrids with and without mouse chromosome 14 using (a) chromosome 14-specific primers (Tcra), (b) Gnrh primers, (c) X chromosome primers (Hprt). In each case, the mouse amplification product is arrowed and the size indicated. (a) the lower band represents products from the hamster genome and is present in the V79 control track and all hybrids. (c) a faint band of the same size as the mouse Hprt product can be seen in the V79 control track; this is also consistently observed in controls without template DNA (not shown) and is therefore assumed to be due to a primer complex.
assignment of Gnrh to mouse chromosome 14 and are of further interest because the human homologue of Nil, the locus encoding the neurofilament light polypeptide gene (NEFL), has been mapped to 8p21 by in situ hybridization (19, 20). The extent of the homology between the human chromosome 8 short arm and the proximal region of mouse chromosome 8 is defined by the locus encoding glutathione reductase and three further homologous loci that have been positioned by in situ hybridization on human chromosome 8 and mapped into the proximal region of mouse chromosome 8 by linkage analysis (Fig. 3). The
Chromosome
Discordant hybrids
Concordant hybrids
% Concordance
1 2 3 4 5 6 7 8 9 lO 11 12 13 14 15 16 17 18 19 X Y
15 12 15 14 21 5 7 14 21 19 22 19 9 0 13 18 7 11 18 11 20
16 10 7 8 11 17 15 8 11 3 0 13 19 33 9 15 24 11 4 22 (2)
52 45 32 36 33 77 68 36 34 [4 0 41 68 100 41 45 77 50 18 67 9
°Concordant hybrids are those in which the chromosome and Gnrh were both present or both absent; discordant hybrids are those in which either the chromosome was absent and Gnrh present or vice versa. Note that different numbers of hybrids were analyzed for each chromosome because of pooling the data from the revertants and the CV7/311 subclones with the fully analysed CV panel.
8p23 8p22 8p21 8p12
human 8
DEF1 I LPL , GSR PLAT
tD LHRH NEFL
- G r - 1 , Plat Lpl - Defcr _
mouse 8
Fig. 3. The positions of homologous loci depicted on the cytogenetic map of human chromosome 8 and the genetic map of the proximal region of mouse chromosome 8. LttRIt and NEFL, which lie between two groups of loci with murine homologs on mouse chromosome 8, have been mapped to mouse chromosome 14 (this paper, ref. 18),
614
plasminogen activating factor (PLAT, Plat) and G S R (Gr-1) have been m a p p e d to proximal 8p in man and close to each other in the mouse (17, 21, 22). Lipoprotein lipase (LPL, L p l ) and defensin (DEF1, Defcr) have been positioned in 8p22-pter in man (21, 23) and 16-19 centimorgans from Plat and Gr-1 on the mouse consensus genetic map (24, 25). The in situ hybridization data for L H R H and N E F L suggest that both loci lie between these two groups of loci on the human chromosome 8 short arm. Theretbre the localization of the homologous murine loci to mouse chromosome 14 indicates that the region of homology between human chromosome 8 and mouse chromosome 8, which encompasses DEF1, L P L , GSR, and P L A T is composed of two separate blocks, with two evolutionary breaks flanking the L H R H and N E F L loci (Fig. 3). An alternative possibility is that the subregional assignments by in situ hybridization in man are misleading and that there is a single evolutionary break between L H R H and the other four loci. More detailed comparative mapping and ordering of loci on the h u m a n chromosome 8 short arm is needed to clarify the situation. In conclusion, we have demonstrated that the locus for gonatropin-releasing horm o n e lies on mouse chromosome 14 by analysis of somatic cell hybrids. F u r t h e r m o r e Gnrh, along with the locus that encodes the neurofilament light polypeptide gene, identify a hitherto unrecognized region of homology between the short arm of human chromosome 8 and mouse chromosome 14.
ACKNOWLEDGMENTS
We are grateful to Sheila Holt for advice and assistance with tissue culture and in situ hybridization studies; Adrian Ford, Kevin Glover, and Elton Evans for photography; Val Cooper and Janet Jones for primer syntheses; and Dr. Bruce Cattanach for interest and encouragement. This work was
Williamson et al.
supported by grants fi'om the M R C H G M P Directed Programme and the Wellcome Trust. LITERATURE C I T E D 1. Schally, A,V., Arimura, A., Kastin, A.J,, Matsuo, H., Baba, Y., Redding, T.W., Nair, R.M.G., and Debeljuk L. (1971). Science 173:1036-1038. 2. Burgus, R., Butcher, M., Amoss, M., Ling, N., Monahan, M., Rivier, J., Fellows, R., Blackwell,R., Vale, W., and Guilleman, R. (1972). Proc. Natl. Acad. Sci. U.S.A. 69:278-282. 3. Nikolics, K., Mason, A.J., Szonyi, E., Ramachandran, J., and Seeburg, P.H. (1985). Nature 316:511517. 4. Matsuo, H., Baba, Y., Nair, R.M.G., Arimura, A., and Schally, A.V. (1971). Biochem. Biophys. Res. Commun. 43:1334-1339. 5. Adelman, J.P., Mason, A.J., Hayflick, J.S., and Seeburg, P.H. (1983). Proc. Natl. Acad. Sci. U.S.A. 83:179-183. 6. Mason, A.J., Hayflick, J.S., Zoeller, R.T., Young, W.S., Phillips, H., Nikolics, K., and Seeburg, P.H. (1986). Science 234:1366-1371. 7. Yan-Feng, T.L., Seeburg, P.H., and Franke, U. (1986). Somat. Cell. Mol. Gen. 12:95-100. 8. Cattanach, B.M., Iddon, C.A., Charlton, H.M., Chiappa, S.A., and Fink, G. (1977). Nature 269:338-340. 9. Mason, A.J., Pitts, S.L., Nikotics, K., Szonyi, E., Wilcox, J.N., Seeburg, P.H., and Stewart, T.A. (1986). Science 234:1372-1378. t0. Lang,J. (199t). Mouse Genome (in press). ll. Love, J., Knight, A., McAleer, M., and Todd, J. (1990). NAR 18:4123-4130. 12. Hearne, C.M., McAleer, M.A., Loce, J,M., Aitman, T.J., Cornall, R.J., Ghosh, S., Knight, A., Prins, J.-B,, and Todd, J.A. (1991). Mammal Genome (in press). 13. Hug, H., Costas, M., Staehli, P., Aebi, M., and Weissmann, C. (1988). MoL Cell BioL 8:3065-3079. 14. Lyon,M.F., and Kirby, M. (1991). Mouse Genome 89:54. 15. Laval, S.H., and Boyd, Y. (1991). 6},togenet. Cell Genet. (in press). 16. Brown, S,D.M., Avner, P.A., Chapman, V.M., Hamvas, R.M.J., and Herman, G.E. (1991). Mammal Genome 1:$318-$331. 17. Nichols, E.A., and Ruddle, F.H. (1975). Biochem. Genet. 13:323-329. 18. Todd, J.A, Aitman, T.J., Cornall, R.J., Ghoso, S., Hall, J.R.S., Hearne, C.M., Knight, A.M., Love, J.M., McAleer, M.A, Prins, J-B., Rodrigues, N., Lathrop, M., Pressey, A., DeLarato, N.H., Peterson, L.B., and Wicker, L.S. (1991). Nature 351:542547. 19. Hurst, J., Flavell, D., Julien, J.-P., Meijer, D., Mushynski, W., and Grosveld, F. (1987). Cytogenet. Cell Genet. 45:30-32.
Gnrh Maps to Mouse Chromosome 14
20. Somerville, M.J., and McLachlan, D.R. (1988). Genome 30:499-500. 2l. Tsui, L.-C., Farrall, M., and Donis-Keller, H. (1989). Cytogenet. Cell Genet. 51:166-201. 22. Ceci, J.D., Justice, M.J., Lock, L.F., Jenkins, N.A., and Copeland, N.G. (1990). Genomics 6:72-79. 23. Sparkes, R.S., Zollman, S., Klisak, I., Kirchgessner, T.G., Komaromy, M.C., Mohandas, T., Schotz, M.C., and Lusis, A.J. (1987). Genomics 1:138M44.
615 24. Oulette, A.J., Pratchevna, D., Ruddle, F.H., and James, M. (1989). Genomics 5:233-239. 25. Doolittle, D.P., Davisson, M.T., Roderick, T.H., and Hfllyard, A.L. (1990). Mouse Genome 87:20. 26. Lalley, P.A., Davisson, M.T., Graves, J.A.M., O'Brien, S J , Womack, J.E, Roderick, T.H., Creau-Goldberg, N., Hillyard, A.L., Doolittle, D.P., and Rogers, J.A. (1989). Cytogenet. Cell Genet. 51:503-532.
