International Journal of Food Microbiology 178 (2014) 113–119

Contents lists available at ScienceDirect

International Journal of Food Microbiology journal homepage: www.elsevier.com/locate/ijfoodmicro

The influence of salt (NaCl) on ochratoxin A biosynthetic genes, growth and ochratoxin A production by three strains of Penicillium nordicum on a dry-cured ham-based medium Alicia Rodríguez a,b,⁎, Ángel Medina a, Juan J. Córdoba b, Naresh Magan a a b

Applied Mycology Group, Cranfield Soil and AgriFood Institute, Cranfield University, Bedfordshire MK43 0AL, UK Food Hygiene and Safety, Faculty of Veterinary Sciences, University of Extremadura, Cáceres, 10003, Spain

a r t i c l e

i n f o

Article history: Received 20 November 2013 Received in revised form 13 February 2014 Accepted 6 March 2014 Available online 15 March 2014 Keywords: NaCl Ham Ochratoxin A Ochratoxin A genes Penicillium nordicum RT-qPCR

a b s t r a c t Iberian dry-cured ham is colonised by moulds during the ripening process. The environmental conditions occurring during the process including the salt content predisposes the surface to colonisation by Penicillium species, including Penicillium nordicum which can contaminate the curing ham with ochratoxin A (OTA). The objective of this study was to examine the effect of NaCl (10% and 22% = 0.94 and 0.87 water activity (aw)) on the activation of two genes involved in the biosynthetic pathway for OTA production, otapksPN and otanpsPN, relative growth and phenotypic OTA production by three strains of P. nordicum (CBS 110.769, FHSCC1 and FHSCC2) on a ham-based medium over a period of 12 days at 25 °C. Growth of the three strains was faster at 0.87 than 0.94 aw on the ham-based media. However, some intra- and inter-strain differences were observed. Of the three strains, only two (CBS 110.789; FHSCC2) were able to express the two genes involved in the biosynthesis of OTA in the two salt treatments. RT-qPCR showed that the temporal expression of the two genes (otapksPN and otanpsPN) was relatively similar for the wild type strain (FHSCC2) at both 0.94 and 0.87 aw over the 12 day period. However, in the type strain (CBS 110.769) expression increased rapidly at 0.94 aw but was significantly lower at 0.87 aw. Expression of these two genes occurred after 3 day incubation, while phenotypic OTA production was observed only after 6 days in the two toxigenic strains. The other strain did not produce any OTA. The OTA concentrations confirmed the results observed with the molecular tools. This suggests that the RT-qPCR gene expression of these two genes may be a good early indicator of potential contamination of dry-cured ham with OTA during dry-cured ham ripening. © 2014 Elsevier B.V. All rights reserved.

1. Introduction The ripening process of dry-cured Iberian ham consists of three fundamental stages: dry-salting, resting (post-salting) and drying/ ageing. During the salting stage, hams are salted in piles with alternate beds of hams and sea salt at b 5 °C from 9 to 15 days depending on the weight of the hams (Martín et al., 1998). After this, diffusion of salt (NaCl) into the inner muscles of the hams, results in a reduction of the water activity (aw), over 2–3 additional months in the post-salting stage at b5 °C. Then, hams are transferred to drying chambers for 3 months and finally aged in cellars for 18–24 months of ripening at controlled temperature and relative humidity. Because of this long ripening time, the concentration of NaCl can vary between 10 and 20% dry matter (Arnau et al., 1995). These special ecological conditions occurring throughout the ripening process favour surface growth of a

⁎ Corresponding author at: Applied Mycology Group, Cranfield Soil and AgriFood Institute, Cranfield University, Bedfordshire MK43 0AL, UK. E-mail addresses: a.rodriguezjimenez@cranfield.ac.uk, [email protected] (A. Rodríguez).

http://dx.doi.org/10.1016/j.ijfoodmicro.2014.03.007 0168-1605/© 2014 Elsevier B.V. All rights reserved.

mycobiota population very well adapted to this environment, mainly at the drying and cellar stages, where temperatures reach 25 °C. Although in general the mould colonisation contributes to improvement of the quality of this product (Comi and Iacumin, 2013), some species may contaminate dry-cured ham with mycotoxins (Núñez et al., 1996). Ochratoxin A (OTA) is the most important mycotoxin encountered in dry-cured meat products (Bertuzzi et al., 2013; Comi and Iacumin, 2013; Markov et al., 2013; Perši et al., 2014; Pleadin et al., 2013; Rodríguez et al., 2012). OTA is undesirable in foods because of its nephrotoxic, hepatotoxic and immunotoxic properties (Petzinger and Ziegler, 2000), with the kidney and liver the main targets of this toxin. It has been rated as a Group 2B carcinogen by the International Agency for Research of Cancer (IARC, 1993). The EU has set maximum levels of OTA in meat products after a report about the dietary intake of OTA. In addition to this, an opinion of the scientific panel on contaminants in the food chain (EFSA-Q-2005, 2006) considered that pork meat is one of the seven food categories representing the main contributors to OTA exposure. For this reason, some producer countries such as Italy have recommended a maximum amount of OTA in dry-cured ham of 1 μg/kg (Ministero della Sanità, 1999).

114

A. Rodríguez et al. / International Journal of Food Microbiology 178 (2014) 113–119

The presence of OTA in dry-cured meat products could be the result of either carry over from animals exposed to naturally contaminated feed (Dall'Asta et al., 2010; Pleadin et al., 2013; Perši et al., 2014) or direct contamination with moulds (Bertuzzi et al., 2013; Rodríguez et al., 2012). Recently however, Bertuzzi et al. (2013) demonstrated that the high OTA contamination risk for dry-cured ham was due to the growth of moulds on the surface during the long maturation time. Because of this several studies have characterised the mould populations isolated from the surfaces of dry-cured meat products (Battilani et al., 2007; Bogs et al., 2006; Schmidt-Heydt et al., 2011a). In those studies, they found that Penicillium nordicum, an important and consistent producer of OTA, often occurs in this NaCl and protein rich commodity. Indeed, P. nordicum has also been found in pure NaCl (Butinar et al., 2011; Larsen et al., 2001; Sonjak et al., 2011) which showed that this was a potential source of contamination in hams (Sonjak et al., 2011). In spite of this, there is practically no information on the effect of NaCl/ham as substrate for growth and OTA production by P. nordicum under different environmental conditions occurring in dry-cured ham processing. Recently, some studies (Schmidt-Heydt et al., 2012, 2013; Stoll et al., 2013) examined the ecological reasons for the frequent occurrence of several OTA-producing species in saltrich habitats. They were able to demonstrate that in P. nordicum the biosynthesis of OTA plays an adaptive role in this specialised ecological habitat. Although the OTA biosynthetic pathway has yet not been completely elucidated (Dao et al., 2005; Färber and Geisen, 2004), Karolewiez and Geisen (2005) cloned a 10 kb genomic DNA fragment of P. nordicum. This fragment contains two genes of the OTA biosynthetic pathway, namely the OTA polyketide synthase gene (otapksPN) and the OTA non-ribosomal peptide synthetase gene (otanpsPN). Both genes have been demonstrated to be necessary in OTA biosynthesis and they have been used as targets to detect and quantify OTA-producing moulds by molecular techniques such as conventional PCR (Bogs et al., 2006; Luque et al., 2013) or quantitative PCR (qPCR; Geisen et al., 2004; Rodríguez et al., 2011; Schmidt-Heydt et al., 2007). Among molecular tools, the reverse transcription qPCR (RT-qPCR) technique makes it possible to analyse the temporal expression of genes involved in the mycotoxin biosynthetic pathway. RT-qPCR is highly sensitive and allows quantification of small changes in gene expression (Abdel-Hadi et al., 2010). Several studies have attempted to correlate the effect of ecophysiological conditions with expression of mycotoxin biosynthesis genes and phenotypic production of toxins (Ferracin et al., 2012; Gallo et al., 2010; Lozano-Ojalvo et al., 2013; Marín et al., 2010; Medina et al., 2013; Schmidt-Heydt et al., 2009, 2011b). However, to our knowledge, none has studied the relationship between the growth of P. nordicum, expression of the biosynthetic genes involved in OTA biosynthesis and OTA production under ecological regimes similar to that for dry-cured ham ripening. The study of the influence of these parameters at a phenotypic level only would allow end-point determinations regarding OTA biosynthesis. However, from the food safety perspective, the evaluation of the induction of the OTA biosynthesis genes can be a good indicator for determining the risk from specific toxigenic species. The gene transcription always precedes phenotypic production. If the window between gene activation and phenotypic production is long enough, predictions could be made and some preventive or corrective actions taken in the meat industry that could minimise or prevent OTA accumulation in dry-cured ham. The objectives of this study were to (a) examine the effect of NaCl (10 and 22% = 0.94 and 0.87 aw) on growth, otapksPN and otanpsPN genes expression and OTA production by P. nordicum on a ham-based medium at 25 °C, (b) to evaluate any intra- or inter-P. nordicum strain differences, and (c) to analyse the temporal changes of the otapksPN and otanpsPN genes in relation to growth of P. nordicum and its phenotypic OTA production.

2. Material and methods 2.1. Fungal strains Three OTA-producing strains of P. nordicum were screened in the study. One of them was used as reference strain and was obtained from the Centraalbureau voor Schimmelcultures (CBS) fungal collection (Utrecht, The Netherlands) (CBS 110.769). The other two were isolated from the surface of dry-cured ham and are held in the Culture Collection of Food Hygiene and Safety at the University of Extremadura, Spain (FHSCC1 and FHSCC2). All strains showed the ability to produce OTA when incubated at 25 °C for 7 days on Malt Extract agar, Potato Dextrose agar and Rose Bengal Chloramphenicol agar (data not shown). 2.2. Inoculum preparation and inoculation The strains were initially inoculated by spreading on Yeast Extract Sucrose Agar (YES; Yeast Extract 20 g, sucrose 150 g, MgSO4 2 g, technical agar 20 g, 1,000 mL of water) and incubated at 25 °C for 7 days. The spores were collected using 10 mL sterile water containing 0.05% Tween 80 (Acros Organics, USA) and rubbing the surface with a glass rod in order to remove conidia. The spore suspensions were maintained in glycerol solutions at − 80 °C and new starter cultures were used for each experiment. The spore suspensions were counted using a haemocytometer (Fisher Scientific, United Kingdom) and adjusted to 107 conidia mL−1 and used as an inoculum. For growth and OTA analyses, agar plates were centrally inoculated with 2 μL of the spore suspension. For gene expression studies, a 0.2 mL aliquot was spread plated on the surface of YES. To obtain an inoculum, this was incubated for 24 h. Then 3 mm agar discs containing germinated conidia were used to inoculate cellophane overlays in 3 places equidistant from each other. All experiments were done with three replicates per treatment and repeated once. 2.3. Experimental settings The ham medium used in this study was prepared with 30 g of lyophilised dry-cured Iberian ham, 20 g of technical agar and 1000 mL of water. The freeze-dried cured ham was prepared in a freeze dryer “Scanvac” (LaboGene ApS, Denmark). The basic medium was modified with 10 and 22% NaCl to obtain water activity (aw) treatments of 0.94 and 0.87 respectively. In addition, pH of these media was adjusted up to 6 to simulate values of this parameter throughout the ripening process. For differential otapksPN and otanpsPN gene expression, nonmodified ham medium (without added salt) was also used. The culture media were prepared by autoclaving for 20 min at 121 °C (103 kPa). The medium was vigorously shaken prior to pouring into 9-cm diameter Petri plates. The aw was measured with an Aqualab device (Decagon Devices, Inc., USA) to confirm the accuracy of the target treatments. The treatments were enclosed in separate polyethylene bags to maintain the aw level and incubated at 25 °C for up to 12 days to simulate the conditions used in curing of ham. 2.4. Growth assessment The diameter of the colonies was measured in two directions at right angles to each other every two days. In order to determine the relative growth rates of strains, primary modelling was carried out on the temporal radial colony expansion data. Data plots showed, after a lag phase, a linear trend with time. Data was fitted using a linear model obtained by plotting the results against time. Only the linear parts were used. From this primary model the growth rates (μm) were obtained (García et al., 2009).

A. Rodríguez et al. / International Journal of Food Microbiology 178 (2014) 113–119

2.5. Gene expression studies For gene expression studies, sampling was performed every three days in triplicate. After each incubation time, the cellophane discs containing whole colonies were collected under sterile conditions, quickly frozen in liquid nitrogen and stored at − 80 °C until RNA extraction. 2.5.1. RNA extraction RNA was extracted according to the bead-beating method described by Leite et al. (2012). A sample of 150 mg of frozen biomass was placed into a 2 mL extraction tube containing 0.5 mm sized glass beads. 750 μL of RLT buffer (provided by the RNeasy® Plant Mini Kit) (Qiagen, Germany) supplemented with 7.5 μL of β-mercaptoethanol was added. After a quick vortex the tubes were quickly frozen in liquid nitrogen to help disrupt the mycelium. Next, samples were thawed on ice. The extraction was carried out in a bead beater Precellys 24 (Bertin Technologies, Montigny le Bretonneux, France) with 3D motion at 6500 rpm. The tubes were agitated for 25 s followed by a 5 s interval and another 25 s of agitation. This mixture was centrifuged at 10,000 rpm for 5 min at 4 °C in a temperature controlled centrifuge system. The supernatant was collected in a pre-frozen 2 mL Safe-Lock tube (Eppendorf, Germany). The RNA purification was carried out in an automated QIAcube® (Qiagen, Germany) using the RNeasy® Plant Mini Kit. To remove genomic DNA contamination, samples were treated with an on-column DNase digestion using the RNase-Free DNase Set kit (Qiagen, UK). The RNA concentration and purity (A260/A280 ratio) were determined spectrophotometrically using a 2.5 μL aliquot on the Picodrop™ (Spectra Services Inc., USA). 2.5.2. RT-qPCR assays and relative quantification RT-qPCR assays were used to amplify the otapksPN and otanpsPN genes as target genes, and the β-tubulin gene as control gene. 2.5.2.1. Primers and probes. The primer pairs F/R-npstr and PV-bentaqfor/rev, previously designed from the otanpsPN gene involved in the OTA biosynthetic pathway (Rodríguez et al., 2011) and the β-tubulin gene (Leite, 2013), respectively, were used. The primer pair F/R-pkstr was designed on the basis of the published partial sequence of the otapksPN gene involved in the OTA production of P. nordicum (GeneBank accession no. AY557343), and designed using the Primer Express software (Applied Biosystems, Foster City, USA). Primers were designed on exon–exon junctions in the target mRNA to prevent amplification of genomic DNA template. Nucleotide sequences of primers used in the RT-qPCR assays are shown in Table 1. 2.5.2.2. cDNA synthesis and qPCR. cDNA was synthesised using 5 μL of total RNA (500 ng) according to the Omniscript RT kit protocol (Qiagen) as described by the manufacturer and it was subsequently used for qPCR. The Rotor-Gene Q system (Qiagen) was used to carry out the RTqPCR assays. They were prepared in triplicate of 12.5 μL reaction

115

mixture in strip Safe-Lock tubes (0.1 mL) (Qiagen). Three replicates of a RNA control sample together with a template-free negative control were also included in the runs. The SYBR Green system with the designed primers was used in all cases. The reaction mixture consisted of 6.25 μL of SYBR® Premix Ex Taq™ (Takara Bio Inc., Otsu, Shiga, Japan), 300 nM of each primer, and 2.5 μL of cDNA template in a final volume of 12.5 μL. After an activation step of 10 min at 95 °C, all subsequent 40 cycles were performed according to the following temperature regime: 95 °C for 15 s and 60 °C for 30 s. After the final PCR cycle, melting curve analysis of the PCR products was performed by heating to 72–95 °C and continuous measurement of the fluorescence to verify the PCR product. Ct determinations were automatically performed by the instrument using default parameters. 2.5.2.3. Relative gene expression. Data analysis was carried out using the software Rotor-Gene Q Series Software (Qiagen). Relative quantification of the expression of otapksPN and otanpsPN genes was performed using the housekeeping gene β-tubulin as an endogenous control to normalise the quantification of the mRNA target for differences in the amount of total cDNA added to each reaction in the relative quantification assays. The expression ratio was calculated as has been previously described by Livak and Schmittgen (2001). Before using the above method, it was tested to show that experimental treatments did not influence expression of the internal control gene, and the amplification efficiencies of the target and reference genes were practically equal (94.5% for otapksPN, 91.8% for otanpsPN and 98.4% for β-tubulin genes, respectively). This method allows calculation of the expression ratio of a target gene between a tested sample and its relative calibrator (“control” sample). In this work, these calibrators corresponded to cultures grown under the same conditions, only one condition was changed depending on the study conducted. Thus, a non-modified ham-based medium was used to evaluate the effect of salt on target gene expression at each time point. For the temporal measurements of these factors on the otapksPN and otanpsPN gene expression, samples incubated for 3 days were used as controls. 2.6. Extraction and quantification of OTA 2.6.1. Sample preparation Using a cork borer, five to seven discs of agar with a diameter of 3 mm weighing 0.75 g were removed from the fungal cultures and placed in previously weighed 2 mL volume Safe-Lock tube (Eppendorf, Germany). All replicates per treatment were collected, weighed, immediately frozen at −20 °C and stored. 2.6.2. OTA extraction procedure Extraction was made using the methodology described by Sáez et al. (2004) with some modifications. Samples were transferred to Falcon tubes, thawed, and extracted by mixing the agar plugs with 3 mL of an aqueous solution containing 5% NaHCO3 and 1% PEG 8000. The tubes were vortexed for 2 min. The pH was adjusted to 8.5 with 1 M solution

Table 1 Nucleotide sequences of primers for RT-qPCR assays designed on the basis of the otapksPN, otanpsPN and β-tubulin genes. Primer pairs

Gene

Nucleotide sequences (5′–3′)

F-pkstr R-pkstr F-npstr R-npstr PV-bentaq-for PV-bentaq-rev

otapksPN

CGAAGATGTCTCCACGGAAT TTGCGAGTGTCTTTGGTCAG GCCGCCCTCTGTCATTCCAAG GCCATCTCCAAACTCAAGCGTG CTAGGCCAGCGGTGACAAGT CTAGGTACCGGGCTCCAA

a b c

otanpsPN β-tubulin

Product size 60 117 63

Position

Reference

1527a 1586a 5090b 5185b 320c 363c

This study

Positions are in accordance with the published sequence of the otapksPN gene of P. nordicum (GeneBank accession no. AY557343). Positions are in accordance with the published sequence of the otanpsPN gene of P. nordicum (GeneBank accession no. AY557343). Positions are in accordance with the published sequence of the β-tubulin gene of P. nordicum (GeneBank accession no. HM103380.1).

Rodríguez et al. (2011) Leite (2013)

116

A. Rodríguez et al. / International Journal of Food Microbiology 178 (2014) 113–119

CBS 110.769

of NaOH. The resulting solution was filtered through Whatman paper No. 1 to remove any solids. Then, 6 mL of an aqueous solution containing 3.4% of phosphoric acid (85%) and 11.8% of NaCl were added to the filtered solution. The mixture was shaken for 5 min and its pH was measured (the pH solution should be b1.5). Then, it was briefly and vigorously mixed by vortex with 3 mL of chloroform. The organic phase was separated by centrifugation (3000 rpm for 5 min) and then transferred to a new tube. The aqueous phase was extracted again with 3 mL of chloroform, mixed, and centrifuged. The organic extracts were combined and dried in a stream of nitrogen. Dry extracts were redissolved in 500 μL of water/acetonitrile/acetic acid (41:57:2 v/v/v) and filtered into a 2 mL chromatography silanised amber vial.

2.7. Statistical analysis Statistical analysis was performed using the SPSS v.15.0 software. Data on maximum growth rates, otapksPN and otanpsPN gene expression and toxin production were tested for normality using the Shapiro–Wilk test. Due to the sample size, the appropriate independent samples t-test (assuming or without assuming equal variances) was carried out to evaluate any significant difference of maximum growth rates of the three strains used in the different media tested (comparing two sets of data). The gene expression and OTA production data sets failed the normality test and variable transformation was performed in order to improve normality or homogenise the variances without success. The Univariate General Linear Model was used to analyse otapksPN and otanpsPN gene expression data sets. Afterwards, comparison of means was performed by Tukey's test. However, the OTA production data analyses were performed using the non-parametric Kruskal–Wallis test to determine any significant differences on the OTA produced by the three strains of P. nordicum grown in different conditions tested. Subsequently, the Mann–Whitney test was applied to compare the mean values obtained. The statistical significance was set at p ≤ 0.05.

Growth rate (mm of radium/day)

2.6.3. Quantification of OTA by HPLC-FLD The HPLC equipment consisted of an Agilent 1200 series system (Agilent, Berks., UK) with a fluorescence detector (FLD, G1321A, Agilent), an autosampler (ALS, G1329A, Agilent), autosampler thermostat (G1330B, Agilent), Thermostatted Column Compartment (G1316A, Agilent), on-line degasser (G1379B, Agilent), and binary pump (G1312A, Agilent). The column was a Phenomenex® Luna C18, 150 mm × 4.6 mm, 5 μm (Phenomenex, Macclesfield, UK) preceded by a pre-column (security guard, 4 mm × 3 mm cartridge, Phenomenex® Luna). Analysis was done in the isocratic mode and the mobile phase was water/acetonitrile/acetic acid (41:57:2 v/v/v). The flow rate was 1 mL/min and injection volume was 50 μL. FLD detection was performed using 330 nm and 460 nm excitation and emission wavelengths respectively. The run time for samples was 15 min with OTA being detected at 5.75 min. Signals were processed by Agilent ChemStation software Ver. B Rev: 03.01 [317] (Agilent Technologies, Palo Alto, CA, USA).

FHSCC1 1.6

FHSCC2

1.4 1.2 1 0.8 0.6 0.4 0.2 0 10%

Fig. 1. Effect of NaCl concentration of ham on growth of the three strains of P. nordicum grown on a ham-based medium at 25 °C over a 12 day incubation period. Bars indicate standard deviation of the means.

in Table 2. This shows the significant intra- and inter-strain differences in relation to growth. 3.2. Effect on NaCl concentration on otapksPN and otanpsPN gene expression Only two strains (CBS 110.769, FHSCC2) showed expression of the two biosynthetic cluster genes examined. Strain FHSCC1 did not show any expression of these two genes based on qPCR. The influence of NaCl concentration in ham on the otapksPN and otanpsPN relative expression at different sampling times was evaluated and compared with the control samples when P. nordicum strains were grown on a non-modified ham-based medium. There were inter-strain differences in the transcription levels of both genes (p ≤ 0.01, Fig. 2). Also, there were intra-strain differences in the relative expression values of the two strains in the two aw conditions evaluated (p ≤ 0.01, Fig. 2). Comparing expression levels of both OTA biosynthetic genes (otapksPN, otanpsPN), in general the otapksPN expression levels were much higher than the otanpsPN ones (p ≤ 0.01). Furthermore, the NaCl concentration significantly affected otapksPN and otanpsPN expression levels (p ≤ 0.01). The effect of NaCl concentration in the ham medium on temporal otapksPN and otanpsPN gene expression over the 12 day incubation period for these two strains was also evaluated (Fig. 3). The data are based on those relative to the control samples (samples taken at 3 days of incubation). There were different relative expression profiles of these two genes (otapksPN, otanpsPN). Significant differences were found between transcription levels on the different sampling days. Table 2 t-Test statistical analysis performed with maximum growth rate data for P. nordicum strains grown in ham-based medium. Factor studied

3. Results 3.1. The effect of NaCl concentration on growth of three strains of P. nordicum The mean growth rates for the three strains of P. nordicum are shown in Fig. 1. In general, growth rates were higher in the drier 0.87 (22% NaCl) than the 0.94 (10% NaCl) aw treatment on the ham-based medium. However, there were inter-strain differences comparing the two conditions tested. In addition, there were intra-strain differences in growth of the two strains isolated from dry-cured ham in these two aw treatment conditions. The statistical analyses of data are included

22%

% NaCl and P. nordicum strains

Two sets of data used

P-valuea

10%–22% NaCl

0.157 0.006* 0.001*

CBS 110.769–FHSCC1 CBS 110.769–FHSCC2 FHSCC1–FHSCC2 CBS 110.769–FHSCC1 CBS 110.769–FHSCC2 FHSCC1–FHSCC2

0.002* 0.035* 0.005* 0.004* 0.064 0.002*

b

Intra-strain differences CBS 110.769 FHSCC1 FHSCC2 Inter-strain differences 10% NaCl

22% NaCl

a b

* Indicates statistical differences. t-Test was performed assuming equal variances.

Relative expression of the otapks PN gene

A. Rodríguez et al. / International Journal of Food Microbiology 178 (2014) 113–119

CBS 110.769

7

d

FHSCC2 b 1 *

1

6

9x107

10% NaCl

5

8x107

22% NaCl

c 4 3 2

b

a 1

*

4 3

7x107

a

*

1

20

0

* 2

c

*

2

0 6

9

12

c 18

3

a

*

400

16 12

b

10

6

9

12

*

300

4

2

14

b

20

*

*

15

8

c 10

6 4 2

a

*

10

2 3

Relative expression of the otanps PN gene

*

117

a

1

1

5

a* 3

2

b*

*

4

3

0

0 3

6

9

3

12

Days of incubation

6

9

12

Days of incubation

Fig. 2. Relative gene expression values of otapksPN and otanpsPN gene expression in two P. nordicum strains grown on ham-based medium incubated at 25 °C for 3, 6, 9 and 12 days with regard to non-modified ham-based medium used as calibrator. Mean values of the otapksPN and otanpsPN gene expression at each incubation time at 10% NaCl (aw = 0.94) indicated with different letters are significantly different (p ≤ 0.01). Mean values of the otapksPN and otanpsPN gene expression at each incubation time at 22% NaCl (aw = 0.87) indicated with different numbers are significantly different (p ≤ 0.01). Significant differences between mean values of the otapksPN and otanpsPN gene expression at different NaCl concentrations at the same incubation day are indicated by an asterisk (p ≤ 0.01). There was no expression of these genes in P. nordicum FHSCC1.

Relative expression of the otapksPN gene

Again, the temporal otapksPN relative expression values were much higher than those of otanpsPN (p ≤ 0.05). For the type strain, the highest expression levels of both genes were found when this strain was grown on the 10% NaCl ham-based medium, whereas the highest expression for the wild-type strain was found when it was inoculated on the non-modified ham-based medium (Fig. 3).

CBS 110.769

500 450 400 350 300 250 200 150 100 50 0

Relative expression of the otanpsPN gene

3

6

9

3.3. Temporal phenotypic OTA production and NaCl concentration in ham Fig. 4 shows that only two of the three strains produced OTA when analysed by HPLC. The FHSCC1 strain isolated from cured ham did not produce any OTA over the 12 day incubation period. The wild type strain FHSCC2 isolated from cured ham began producing OTA in both 10 and

FHSCC2

10 9 8 7 6 5 4 3 2 1 0

22% NaCl

3

12

10% NaCl

6

9

12

6

9

12

10 9 8 7 6 5 4 3 2 1 0

10 9 8 7 6 5 4 3 2 1 0 3

6

9

Days of incubation

12

3

Days of incubation

Fig. 3. Effect of NaCl concentration of ham on temporal otapksPN and otanpsPN gene expression by P. nordicum strains grown on a ham-based medium at 25 °C over a 12 day incubation period for the two strains whose genes were induced under experimental conditions.

A. Rodríguez et al. / International Journal of Food Microbiology 178 (2014) 113–119

Ochratoxin A concentration (ng/g agar)

118

16 CBS 110.769 10% NaCl (=0.94 aw)

14

CBS 110.769 22% NaCl (=0.87 aw)

12

FHSCC2 10% NaCl (=0.94 aw)

10

FHSCC2 22% NaCl (=0.87 aw)

8 6 4 2 0 2

4

6

8

10

12

Time (days) Fig. 4. Effect of NaCl concentration of ham on temporal phenotypic ochratoxin A production by P. nordicum strains grown on a ham-based medium at 25 °C over a 12 day incubation period. The numbers refer to the two strains that produced ochratoxin A in the two conditions tested.

22% NaCl by day 6 with much less being produced by the type strain (CBS 110.769). Overall, the strain isolated from ham (FHSCC2) produced much higher concentrations of OTA than the type strain with little difference between the two NaCl levels. However, for the type strain significantly more OTA was produced on the ham-based medium at 10% NaCl (=0.94 aw) than with 22% NaCl (=0.87 aw). 4. Discussion This is the first study to examine the influence of NaCl on relative quantification of the two key genes involved in OTA biosynthesis in relation to temporal phenotypic OTA production and the growth of three strains of P. nordicum on a ham-based medium at incubation conditions usually found throughout the ripening process of dry-cured ham. The present study also showed that there were some differences between the P. nordicum strains. In general colonisation for the three strains of P. nordicum on ham-based medium was faster on this supplemented with 22% of NaCl (0.87 aw). This is quite interesting because normally more available water is more conducive to growth of toxigenic moulds. This suggests that the OTA-producing P. nordicum strains are ecologically adapted to NaCl rich foods which they can effectively colonise with less competition from other mycobiota (Lund and Frisvad, 2003; Schmidt-Heydt et al., 2011a). Previous studies have shown the effect of up to 8% salt on growth of P. nordicum strains (Schmidt-Heydt et al., 2012) but not on ham-based media and not at the levels (10–22% NaCl) usually found in the ham during curing. Studies by Leggieri et al. (2011) on ham-based media examined the effect of aw (0.98–0.80) on colony growth of toxigenic and non-toxigenic strains of P. nordicum which showed limited growth at 0.80–0.85 aw. However, modifications were done using the non-ionic solute glycerol. Optimum colony size was at 0.95 aw in these experiments after 14 days incubation. The molecular studies showed early activation of both biosynthetic OTA genes before OTA could be detected, confirming the predictive nature of the molecular analyses. There was some relationship between the temporal relative expression of otapksPN and otanpsPN genes over time and phenotypic OTA production by the two strains which produced OTA. For the type strain (CBS 110.679) the increased activity of the two genes was observed with 10% NaCl (= 0.94 aw) ham media, which was consistent with the OTA production. This contrasted with the wild type strain (FHSCC2) isolated from maturing ham, where the expression of the genes at 10% and 22% NaCl was similar, correlating with similar OTA production in these two conditions. This suggests that the relative expression profiles of both these genes could give critical information on the ecological conditions that will influence the

OTA biosynthesis by P. nordicum during ham curing before any OTA is produced. This is useful because the molecular indicator genes are expressed a few days before any OTA can be detected. Previous studies have reported a high relationship between genes involved in OTA biosynthesis by P. nordicum and the subsequent OTA production on YES medium or in minimal media which supported or suppressed the OTA production (Geisen, 2004) or in response to light (Schmidt-Heydt et al., 2010). Thus, Schmidt-Heydt et al. (2012) only showed the effect of up to 8% NaCl concentration which is below the levels used for ham curing. Furthermore, the previous studies on OTA biosynthesis in ochratoxigenic Penicillia, used one biosynthetic gene (otapksPN) as the target, although the otanpsPN gene has also been described as a key gene (Karolewiez and Geisen, 2005). Therefore, the present study used both these genes as they have been shown to correlate with the production of OTA. In this regard, quantification of both genes using RT-qPCR systems, based on the relative expression of these genes to a housekeeping gene (β-tubulin gene) provides very useful information to relate molecular changes under different ecological conditions in an easier and faster way than other techniques such as microarrays (Müller et al., 2012; Postollec et al., 2011). With regard to OTA production we found some intra- and interdifferences between the P. nordicum strains examined. One strain, isolated from dry-cured ham did not produce any OTA on the ham-based medium. Previously, it was found to produce OTA when incubated at 25 °C for 7 days on different OTA conducive culture media (data not shown). Our studies represented relatively short incubation times. Normally, dry-cured hams are aged for several months (between 6 and 24) at 15–25 °C with potentially toxigenic moulds on their surface (Asefa et al., 2009; Núñez et al., 1996; Rojas et al., 1991; Tabuc et al., 2004). The non-detection of OTA in FHSCC1 could be attributed to the reaction of OTA with some amino acids present in dry-cured ham (Córdoba et al., 1994) to form abducts (Bailly et al., 2005) in a way similar to that described for penicillic acid (Ciegler et al., 1972) or aflatoxins (Ashoor and Chu, 1975). Previously, some variability in mycotoxin production among producing strains has been found (Khalesi and Khatib, 2011). In the present work, OTA production was at levels which were higher than the legal limit established in Italian legislation for pork meat and derived products (Ministerio della Sanità, 1999). 5. Conclusions This study has shown that P. nordicum strains isolated from ham were able to grow slightly better in the presence of 22% than 10% NaCl (0.87 and 0.94 aw respectively). However, there were some intra- and inter-differences between P. nordicum strains. Two of the three strains were shown to express the two biosynthetic genes (otapksPN, otanpsPN) in the kinetics study. This was confirmed by analysis of OTA production. Different transcriptional level profiles were observed in the two OTA producers which were related to their OTA production. The molecular measurement was more sensitive than the analytical quantification of OTA since the gene expression occurred after 3 days and the OTA detected at 6 days of incubation. This certainly suggests that RT-qPCR for these two genes may be a useful approach to predict early OTA production by P. nordicum before its detection under the ecological conditions for ham ripening. This type of data will be beneficial for an understanding of the ecophysiological and functional importance of specific regulatory genes involved in OTA contamination of ham and in the development of effective control approaches to minimise OTA contamination in dry-cured ham ripening. Acknowledgements Dr Alicia Rodríguez was supported by a Grant of the Spanish Foundation “Alfonso Martín Escudero”. Nowadays, she is the recipient of a postdoctoral contract (PO12016) from the Gobierno

A. Rodríguez et al. / International Journal of Food Microbiology 178 (2014) 113–119

de Extremadura, Consejería de Empleo, Empresa e Innovación, and the Fondo Social Europeo (FSE) at Cranfield University.

References Abdel-Hadi, A., Carter, D., Magan, N., 2010. Temporal monitoring of the nor-1 (aflD) gene of Aspergillus flavus in relation to aflatoxin B1 production during storage of peanuts under different water activity levels. J. Appl. Microbiol. 109, 1914–1922. Arnau, J., Guerrero, L., Casademont, G., Gou, P., 1995. Physical and chemical changes in different zones of normal and PSE dry-cured ham during processing. Food Chem. 52, 63–69. Asefa, D.T., Gjerde, R.O., Sidhu, M.S., Langsrud, S., Kure, C.F., Nesbakken, T., Skaar, I., 2009. Moulds contaminants on Norwegian dry-cured meat products. Int. J. Food Microbiol. 128, 435–439. Ashoor, S.H., Chu, F.S., 1975. Interaction of aflatoxin B2a with amino acids and proteins. Biochem. Pharmacol. 24, 1799–1805. Bailly, J.D., Tabuc, C., Quérin, A., Guerre, P., 2005. Production and stability of patulin, ochratoxin A, citrinin, and cyclopiazonic acid on dry cured ham. J. Food Prot. 68, 1516–1520. Battilani, P., Pietri, A., Giorni, O., Formenti, S., Bertuzzi, T., Toscani, T., Virgili, R., Kozakiewicz, Z., 2007. Penicillium populations in dry-cured ham manufacturing plants. J. Food Prot. 70, 975–980. Bertuzzi, T., Gualla, A., Morlacchini, M., Pietri, A., 2013. Direct and indirect contamination with ochratoxin A of ripened pork products. Food Control 34, 79–83. Bogs, C., Battilani, P., Geisen, R., 2006. Development a molecular detection and differentiation system for ochratoxin A producing Penicillium species and its application to analyse the occurrence of Penicillium nordicum in cured meats. Int. J. Food Microbiol. 107, 39–47. Butinar, L., Frisvad, J.C., Gunde-Cimerman, N., 2011. Hypersaline waters — a potential source of foodborne toxigenic Aspergilli and Penicillia. FEMS Microbiol. Ecol. 77, 186–199. Ciegler, A., Mintzlaff, H.J., Weisleder, D., Leistner, L., 1972. Potential production and detoxification of penicillic acid in mold fermented sausage (salami). Appl. Microbiol. 24, 114–119. Comi, G., Iacumin, L., 2013. Ecology of moulds during the pre-ripening and ripening of San Daniele dry-cured ham. Food Res. Int. 54, 1113–1119. Córdoba, J.J., Antequera, T., García, C., Ventanas, J., López-Bote, C., Asensio, M.A., 1994. Evolution of free amino acids and amines during ripening of Iberian cured ham. J. Agric. Food Chem. 42, 2296–2301. Dall'Asta, C., Galaverna, G., Bertuzzi, T., Noseriti, A., Pietri, A., Dossena, A., Marchelli, R., 2010. Occurrence of ochratoxin A in raw ham muscle, salami and dry-cured ham from pigs fed with contaminated diet. Food Chem. 120, 978–983. Dao, H.P., Mathieu, F., Lebrihi, A., 2005. Two primer pairs to detect OTA producers by PCR method. Int. J. Food Microbiol. 36, 215–220. EFSA-Q-2005–154, 2006. Opinion of the scientific panel on contaminants in the food chain on a request from the commission related to ochratoxin A in food. The EFSA Journal 365, 1–56. Färber, P., Geisen, R., 2004. Analysis of differentially-expressed ochratoxin A biosynthesis genes of Penicillium nordicum. Eur. J. Plant Pathol. 110, 661–669. Ferracin, L.M., Fier, C.B., Vieira, M.L.C., Monteiro-Vitorello, C.B., Varani, A.D., Rossi, M.M., Muller-Santos, M., Taniwaki, M.H., Iamanaka, B.T., Fungaro, M.H.P., 2012. Strain specific polyketide synthase genes of Aspergillus niger. Int. J. Food Microbiol. 155, 137–145. Gallo, A., Epifani, F., Bonsegna, S., Pascale, M., Santino, A., Perrone, G., 2010. Analysis of genes early expressed during Aspergillus flavus colonisation of hazelnut. Int. J. Food Microbiol. 137, 111–115. García, D., Ramos, A.J., Sanchís, V., Marín, S., 2009. Predicting mycotoxins in foods: a review. Food Microbiol. 26, 757–769. Geisen, R., 2004. Molecular monitoring of environmental conditions influencing the induction of ochratoxin A biosynthesis genes in Penicillium nordicum. Mol. Nutr. Food Res. 48, 532–540. Geisen, R., Mayer, Z., Karolewiez, A., Färber, P., 2004. Development of a real time PCR system for detection of Penicillium nordicum and for monitoring ochratoxin A production in foods by targeting the ochratoxin polyketide synthase gene. Syst. Appl. Microbiol. 27, 501–507. IARC (International Agency for Research on Cancer), 1993. Ochratoxin A. Some naturally occurring substances: food items and constituents, heterocyclic aromatic amines and mycotoxins. IARC Monograph on the Evolution of Carcinogenic Risks to Humans, 56 489–521. Karolewiez, A., Geisen, R., 2005. Cloning a part of the ochratoxin A biosynthetic gene cluster of Penicillium nordicum and characterization of the ochratoxin polyketide synthase gene. Syst. Appl. Microbiol. 28, 588–595. Khalesi, M., Khatib, N., 2011. The effects of different ecophysiological factors on ochratoxin A production. Environ. Toxicol. Pharmacol. 32, 113–121. Larsen, T.O., Svendsen, A., Smedsgaard, J., 2001. Biochemical characterization of ochratoxin A-producing strains of the genus Penicillium. Appl. Environ. Microbiol. 67, 3630–3635. Leggieri, M.C., Pont, N.P., Battilani, P., Magan, N., 2011. Detection and discrimination between ochratoxin producer and non-producer strains of Penicillium nordicum on a ham-based medium using an electronic nose. Mycotoxin Res. 27, 29–35. Leite, G., 2013. Potential for Control of Spoilage and Mycotoxigenic Species Using Mixtures of Anti-Oxidants, Aliphatic Acids and Molecular Approaches Using RNAi. Cranfield University, United Kingdom (Doctoral Thesis).

119

Leite, G., Magan, N., Medina, A., 2012. Comparison of different bead-beating RNA extraction strategies: an optimized method for filamentous fungi. J. Microbiol. Methods 88, 413–418. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2 (−ΔΔCT) method. Methods 25, 402–408. Lozano-Ojalvo, D., Rodríguez, A., Bernáldez, V., Córdoba, J.J., Rodríguez, M., 2013. Influence of temperature and substrate conditions on the omt-1 gene expression of Aspergillus parasiticus in relation to its aflatoxin production. Int. J. Food Microbiol. 166, 263–269. Lund, F., Frisvad, J.C., 2003. Penicillium verrucosum in wheat and barley indicates presence of ochratoxin A. J. Appl. Microbiol. 95, 1117–1123. Luque, M.I., Córdoba, J.J., Rodríguez, A., Núñez, F., Andrade, M.J., 2013. Development of a PCR protocol to detect ochratoxin A producing moulds in food products. Food Control 29, 270–278. Marín, P., Jurado, M., Magan, N., Vázquez, C., González-Jaén, M.T., 2010. Effect of solute stress and temperature on growth rate and TRI5 gene expression using real time RTPCR in Fusarium graminearum from Spanish wheat. Int. J. Food Microbiol. 140, 169–174. Markov, K., Pleadin, J., Bevardi, M., Vahčić, N., Sokolić-Mihalak, D., Frece, J., 2013. Natural occurrence of aflatoxin B1, ochratoxin A and citrinin in Croatian fermented meat products. Food Control 34, 312–317. Martín, L., Córdoba, J.J., Antequera, T., Timón, M.L., Ventanas, J., 1998. Effect of salt and temperature on proteolysis during ripening of Iberian hams. Meat Sci. 49, 145–153. Medina, A., Schmidt-Heydt, M., Cárdenas-Chávez, D.L., Parra, R., Geisen, R., Magan, N., 2013. Integrating toxin gene expression, growth and fumonisin B1 and B2 production by a strain of Fusarium verticilloides under different environmental factors. J. R. Soc. Interface 10. Ministero della Sanità, 1999. Circolare 09.06.1999. In: Sanità, M.D. (Ed.), Circolare 09.06. 1999, vol. 135. Gazzetta Ufficiale, Repubblica Italiana (11.06.1999). Müller, S., Baldin, C., Groth, M., Reinhard Guthke, R., Kniemeyer, O., Brakhage, A., Valiante, V., 2012. Comparison of transcriptome technologies in the pathogenic fungus Aspergillus fumigatus reveals novel insights into the genome and MpkA dependent gene expression. Biomed. Central Genom. 13, 519–533. Núñez, F., Rodríguez, M.M., Bermúdez, E., Córdoba, J.J., Asensio, M.A., 1996. Composition and toxigenic potential of the mould population on dry-cured Iberian ham. Int. J. Food Microbiol. 32, 185–197. Perši, N., Pleadin, J., Kovačevic, D., Scortichini, G., Milone, S., 2014. Ochratoxin A in raw materials and cooked meat products made from OTA-treated pigs. Meat Sci. 96, 203–210. Petzinger, E., Ziegler, K., 2000. Ochratoxin A from a toxicological perspective. J. Vet. Pharmacol. Ther. 23, 91–98. Pleadin, J., Perši, N., Kovačevic, D., Vahčić, N., Scortichini, G., Milone, S., 2013. Ochratoxin A in traditional dry-cured meat products produced from sub-chronic-exposed pigs. Food Addit. Contam. Part A 30, 1827–1836. Postollec, F., Falentin, H., Pavan, S., Combrisson, J., Sohier, D., 2011. Recent advances in quantitative PCR (qPCR) applications in food microbiology. Food Microbiol. 28, 848–861. Rodríguez, A., Rodríguez, M., Luque, M.I., Justesen, A.F., Córdoba, J.J., 2011. Quantification of ochratoxin A-producing molds in food products by SYBR Green and TaqMan real-time PCR methods. Int. J. Food Microbiol. 149, 226–235. Rodríguez, A., Rodríguez, M., Martín, A., Delgado, J., Córdoba, J.J., 2012. Presence of ochratoxin A on the surface of dry-cured Iberian ham after initial fungal growth in the drying stage. Meat Sci. 90, 728–734. Rojas, F.J., Jodral, M., Gosalvez, F., Pozo, R., 1991. Mycoflora and toxigenic Aspergillus flavus in Spanish dry-cured ham. Int. J. Food Microbiol. 13, 249–256. Sáez, J.M., Medina, A., Gimeno-Adelantado, J.V., Mateo, R., Jiménez, M., 2004. Comparison of different simple treatments for the analysis of ochratoxin A in must, wine and beer. J. Chromatogr. A 1029, 125–133. Schmidt-Heydt, M., Baxter, E., Geisen, R., Magan, N., 2007. Physiological relationship between food preservatives, environmental factors, ochratoxin and otapksPV gene expression by Penicillium verrucosum. Int. J. Food Microbiol. 119, 277–283. Schmidt-Heydt, M., Abdel-Hadi, A., Magan, N., Geisen, R., 2009. Complex regulation of the aflatoxin biosynthesis gene cluster of Aspergillus flavus in relation to various combinations of water activity and temperature. Int. J. Food Microbiol. 135, 231–237. Schmidt-Heydt, M., Bode, H., Raupp, F., Geisen, R., 2010. Influence of light on ochratoxin biosynthesis by Penicillium. Mycotoxin Res. 26, 1–8. Schmidt-Heydt, M., Graf, E., Batzler, J., Geisen, R., 2011a. The application of transcriptomics to understand the ecological reason of ochratoxin A biosynthesis by Penicillium nordicum on sodium chloride rich dry cured foods. Trends Food Sci. Technol. 22, S39–S48. Schmidt-Heydt, M., Parra, R., Geisen, R., Magan, N., 2011b. Modelling the relationship between environmental factors, transcriptional genes and deoxynivalenol mycotoxin production by strains of two Fusarium species. J. R. Soc. Interface 8, 117–126. Schmidt-Heydt, M., Graf, E., Stoll, D., Geisen, R., 2012. The biosynthesis of ochratoxin A by Penicillium as one mechanism for adaptation to NaCl rich foods. Food Microbiol. 29, 233–241. Schmidt-Heydt, M., Stoll, D., Mrohs, J., Geisen, R., 2013. Intraspecific variability of HOG1 phosphorylation in Penicillium verrucosum reflects different adaptation levels to salt rich habitats. Int. J. Food Microbiol. 165, 246–250. Sonjak, S., Ličen, M., Frisvad, J.C., Gunde-Cimerman, N., 2011. Salting of dry-cured meat — a potential cause of contamination with ochratoxin A-producing species Penicillium nordicum. Food Microbiol. 28, 111–116. Stoll, D., Schmidt-Heydt, M., Geisen, R., 2013. Differences in the regulation of ochratoxin A by the HOG pathway in Penicillium and Aspergillus in response to high osmolar environments. Toxins 5, 1282–1298. Tabuc, C., Bailly, J.D., Bailly, S., Querin, A., Guerre, P., 2004. Toxigenic potential of fungal mycoflora isolated from dry cured meat products: preliminary study. Rev. Med. Vet. 156, 287–291.