PHYTOTHERAPY RESEARCH Phytother. Res. (2014) Published online in Wiley Online Library (wileyonlinelibrary.com) DOI: 10.1002/ptr.5143
The Influence of Selected Flavonoids from the Leaves of Cirsium palustre (L.) Scop. on Collagen Expression in Human Skin Fibroblasts Jolanta Nazaruk1* and Anna Galicka2 1
Department of Pharmacognosy, Medical University of Bialystok, Mickiewicza 2a, 15-089 Bialystok, Poland Department of Medical Chemistry, Medical University of Bialystok, Mickiewicza 2a, 15-089 Bialystok, Poland
2
Ten flavonoids belonging to the subclasses of flavones, flavanones and aurones were isolated from methanolic extract of Cirsium palustre leaves after multistep chromatographic separation. Their structures were elucidated with spectroscopic methods. All compounds, except for luteolin 7-O-glucoside, were isolated for the first time. Four compounds—eriodictyol 7-O-glucoside (6), 6-hydroxyluteolin 7-O-glucoside (11), scutellarein 7-O-glucoside (12) and pedalitin (14)—were tested for their effect on collagen expression in normal human dermal fibroblasts. Among them, compound 11 at 40 μM and compound 14, at all concentrations used (1, 20, 40 μM), significantly enhanced the level of total collagen secreted into the medium. Furthermore, compound 11 significantly stimulated type I collagen expression, whereas compound 14 activated type I and III collagen expression at the mRNA level, depending on concentration. MMP-2 activity was inhibited by all study compounds, with the greatest effect recorded with compound 14 at 20 μM. The lack of effect on collagen content in the medium of compound 6- and compound 12-treated cells, besides an increase in COL1A1 and COL1A2 expression, might be caused by diminished expression of HSP47 gene, resulting in decreased procollagen secretion. Future study of compounds 11 and 14 for their potential therapeutic use in conditions connected with collagen biosynthesis deficiency is required. Copyright © 2014 John Wiley & Sons, Ltd. Keywords: Cirsium palustre (L.) Scop; flavonoids; collagen type I, III and Hsp47 expression; MMP-2; human skin fibroblasts.
INTRODUCTION Cirsium palustre (L.) Scop., marsh thistle (family Asteraceae, subtribe Cardueae), is a herbaceous biennial plant widely distributed in Europe found on marshes, hedgerows and moorland pastures (Tutin, 1976). Well-recognized constituents of this plant include polyphenols, particularly flavonoids isolated from flower heads, and phenolic acids, which determine its antioxidant and antimicrobial activity (Nazaruk and Szoka, 2009; Nazaruk, 2009; Nazaruk, 2008; Nazaruk et al. 2008). Flavonoids constitute a widely present group of compounds in the genus Cirsium and can be considered its chemosystematic marker. Flavonoid compounds demonstrate multidirectional pharmacological activity, with anti-inflammatory, antioxidant, antiallergic, hepatoprotective, antithrombotic, antimicrobial and anticarcinogenic properties. They are recognized as free radical scavengers and metal chelators, and may significantly affect the function of various mammalian cellular systems (Havsteen, 2002). Since preliminary comparative chromatographic analysis showed differences in flavonoid composition of inflorescences and leaves of C. palustre, and since only luteolin 7-O-glucopyranoside was previously isolated from leaves (Shelyuto et al., 1972), the aim of current research was to isolate and identify flavonoids from marsh thistle leaves. Since our previous examinations * Correspondence to: Jolanta Nazaruk, Department of Pharmacognosy, Medical University of Bialystok, Poland. E-mail: [email protected]
Copyright © 2014 John Wiley & Sons, Ltd.
revealed that this group of compounds could affect collagen biosynthesis (Galicka and Nazaruk, 2007), we attempted to search for the up-regulated effect of selected constituents of C. palustre leaves on collagen content in the medium of normal human skin fibroblasts.
MATERIALS AND METHODS General experimental procedures. The UV spectra were measured on a UV–Vis Specord 40 spectrophotometer (Analytic Jena GmbH). The 1H and 13C NMR analysis was performed on a Bruker Avance II 400 spectrometer at 400 and 100 MHz, respectively, in CDCl3 (compound 1, 2), Py-d5 (compound 3) and DMSO-d6 (compounds 4–14). For the extraction of plant material and isolation of compounds, analytical pure organic solvents—hexane (fraction from kerosene), ethyl acetate, methanol, nbutanol and benzene purchased from POCh and Chempur, Poland—were used. For column chromatography silica gel (mesh 0.2–0.5 mm, Merck), polyamide (Roth), cellulose powder (Roth) and Sephadex LH-20 (Pharmacia) were applied. Plant material. Leaves of C. palustre were collected in July 2008 in the vicinity of Bialystok (Poland) and were identified by the first author. A voucher specimen (CP 06014) was kept in the Herbarium of Department of Pharmacognosy, Medical University of Bialystok, Poland. Received 15 September 2013 Revised 17 February 2014 Accepted 18 February 2014
J. NAZARUK AND A. GALICKA
Extraction and isolation. The air-dried grinded leaves of C. palustre (180 g) were extracted with MeOH for 2 h (3 × 2.5 L). Total filtrate was concentrated in vacuo at 40 °C, and the obtained extract (61.9 g) was chromatographed over silica gel column using mixed solvents of C6H14 and EtOAc (100:0-0:100, gradient) and EtOAc-MeOH (100:0-0:100, gradient). Collected subfractions (149) of 250 mL were monitored by TLC (Si gel, Merck) in the same system as the eluent when the first mixture of solvents was used with respect to lipophilic compounds, and then by TLC (Cellulose, Merck) in the BAW system [n-butanol-acetic acid-water (4:1:5) upper phase] with respect to flavonoids. The same subfractions were combined to obtain 16 fractions. From fraction 3 eluted with C6H14–EtOAc (95:5), compound 1 (580 mg) was isolated and from fraction 4 eluted with C6H14–EtOAc (8:2) compound 2 (182 mg) was obtained. After changing the polarity of the eluent, in fractions 12–14 the mixtures of polyphenolic compounds were found. For further separation, the residues that crystallized from methanolic solutions were used. The residue (917 mg) from fraction 12 [eluted with EtOAc-MeOH (9:1)] was subjected to column chromatography (polyamide, EtOAc-MeOH step gradient). Pure compound 3 (42 mg) was obtained from the initial fractions eluted with EtOAc. Compound 4 (5 mg) and compound 5 (4 mg) were obtained from the first fraction eluted with the solvents in the 9:1 ratio and then after gel filtration on Sephadex LH-20 (isocratic elution of MeOH). The next fractions eluted with the same solvent system were separated on the cellulose column with nBuOH saturated with H2O, and pure compounds 6 (28 mg) and 7 (5 mg) were obtained. The residue (1514 mg) from fraction 13 [EtOAc-MeOH (9:1 and 8:2)] was chromatographed on a cellulose column with H2O–MeOH as eluent and fractions eluted with 40–80% MeOH yielded 630 mg of compound 8. Fraction 14 eluted with EtOAc–MeOH (7:3) gave 14.61 g of the residue. After its separation on a polyamide column (EtOAc–MeOH step gradient), fractions eluted with solvents in the 8:2 ratio yielded 224 mg of compound 9. Next fractions eluted with the same eluent, containing a mixture of two compounds, were rechromatographed on a cellulose column (n-BuOH saturated with water) to obtain 945 mg of compound 8 and 120 mg of compound 9. Fractions eluted with EtOAc–MeOH (7:3) were subjected to a polyamide column and H2O–MeOH step gradient was used as eluent. Fractions eluted with 50% MeOH yielded compound 10 (19 mg), with 70% MeOH compound 11 (457 mg), with 80% MeOH compound 12 (8 mg) and a mixture of compounds. Chromatographic separation of this mixture on the polyamide column using C6H6–MeOH step gradient for elution afforded compound 13 (6 mg) and compound 14 (22 mg), when the eluents were in the 9:1 and 8:2 ratios, respectively. Fibroblast cultures. Normal human skin fibroblast lines were initiated from forearm skin biopsies obtained from healthy volunteers. Cells were grown to confluence in Dulbecco’s modified Eagle’s medium (DMEM) with 10% FBS, 50 U/mL penicillin, 50 μg/mL streptomycin and 2 mmol/l L-glutamine at 37 °C in a 5% CO2 incubator. The biopsies were obtained with the approval of the Ethics Committee of the Medical University of Copyright © 2014 John Wiley & Sons, Ltd.
Bialystok and with written consent. Cells were counted in a hemocytometer and cultured at a density of 1 × 106 cells/well in 2 mL growth medium in six-well plates (Costar). For experiments, confluent cells were used to eliminate growth-related events. Estimation of biological action of flavonoids in skin fibroblasts. Confluent cells were preincubated in fresh serum-free medium for 2 h. The flavonoids dissolved in DMSO were added to the medium to a final concentration of 1, 20 and 40 μM, and incubated for 24 h. The same concentration of DMSO solution was used as control in order to rule out the possible effect of DMSO on fibroblasts. After incubation, the exposure medium was removed and stored for analysis of collagen content and MMP activity. The monolayers were washed four times with sterile 10 mM PBS pH 7.4, and cell membranes were disrupted using a sonicator (Sonics Vibra cell). Aliquots of the homogenate were removed for the protein measurement with BCA Protein Assay Kit (Pierce), and the remaining homogenate was used for isolation of RNA. Collagen content assay. Three dosages of the compounds (1, 20 and 40 μM) were added to wells of the plates and incubated in serum-free medium for 24 h. Then, the medium in each well was collected to measure collagen levels using Sircol soluble collagen assay (Biocolor Assays, Ireland). Briefly, to the samples of the medium Sircol dye reagent was added and mixed for 30 min on an orbital shaker. The samples were then centrifuged and the dye bound to the collagen pellet was solubilized with an alkali reagent. The absorbance of the samples was measured at 555 nm using a microplate reader (Infinite M200, TECAN). A calibration standard of type I collagen was used to obtain the standard curve. MMP assay. Gelatinolytic activity of conditioned medium was determined according to the method of Unemori and Werb (1986). Equal amounts (10 μg) of protein were electrophoresed under non-reducing conditions on 10% polyacrylamide gel impregnated with 1 mg/mL gelatin (Sigma) as a substrate. After electrophoresis, the gel was washed twice for 15 min with 2% Triton X-100 and then incubated overnight at 37 °C in 50 mM Tris/HCl, pH 8.0, containing 5 mM CaCl2. The gel was stained with 0.5% Coomassie Brilliant Blue R-250. Clear bands on the blue background which represented areas of substrate-degrading enzymes were quantified using an imaging densitometer (G:BOX, Syngene). Real-time PCR. Total RNA was isolated using the MasterPureTM RNA Purification Kit (Akor Laboratories). The RNA extracts were treated with RNase-free DNase Ι to remove contaminating DNA, quantified on a spectrophotometer (Nanodrop 2000, ThermoScientific) and stored at 80 °C. Real-time PCR assays performed in CFX96 Real-Time System (Bio-Rad) were used to quantify mRNA levels of type I collagen, type III collagen and Hsp47 (heat-shock protein). As housekeeping gene GAPDH (glyceraldehyde-3-phosphate dehydrogenase) Phytother. Res. (2014)
THE INFLUENCE OF FLAVONOIDS OF CIRSIUM PALUSTRE ON COLLAGEN EXPRESSION
was evaluated. Total RNA (1 μg) in a total volume of 20 μL was reverse transcribed using a Tetro cDNA Synthesis Kit (Bioline) and 1 μl oligo(dT) primer. Real-time PCR was carried out using 2 μL of the cDNA product, 400 nM each primer and the SensiFAST™ SYBR Kit (Bioline). Forward and reverse primer sequences are listed in Table 1. Cycling parameters were: 95 °C for 1 min to activate the DNA polymerase, then 40 cycles of denaturation for 10 s at 95 °C, annealing for 15 s at 59 °C, and extension for 20 s at 72 °C. The reaction was then subjected to a melting protocol from 55 °C to 95 °C with a 0.2 °C increment and 1 s holding at each increment to check the specificity of the amplified products. Single product formation was confirmed by melting point analysis and agarose gel electrophoresis. For negative control, water instead of mRNA samples was used. Samples were run in triplicate and the ΔΔCT method was applied for a statistical analysis of the CT-values. The relative gene expression levels were standardized with those measured in the untreated control. Assay for cell viability. The assay was performed according to the method of Carmichael et al. (1987) using MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide]. Confluent cells cultured with the tested compounds for 20 h at 37 °C were washed with PBS and then incubated for 4 h in 1 mL of MTT solution (0.5 mg/mL). The medium was removed, and 1 mL of 0.1 M HCl in absolute isopropanol was added to the cells. Absorbance of converted dye in living cells was measured at a wavelength of 570 nm.
Statistical analysis. In all experiments, the mean values for three assays ± SD were calculated. The results were submitted to statistical analysis using one-way analysis of variance (ANOVA), followed by the Duncan’s multiple range post hock test. Differences were recognized as statistically significant at p < 0.05. Spearman rank correlation analysis was conducted to investigate the relationship between enzyme degrading collagen (MMP-2) activity and collagen concentration in the conditioned media. All the calculations were performed using Statistica 9.0 package (StatSoft, Tulsa, OK, USA).
RESULTS AND DISCUSSION Identification of components of methanolic extract from C. palustre leaves Fourteen pure compounds were isolated from the methanolic extract of C. palustre leaves as a result of
multistep chromatographic separations. The structures of the isolates were elucidated on the basis of spectral analysis including UV (method according to Mabry et al., 1970), 1H and 13C NMR, DEPT and additionally HSQC for compound 7, and compared with compounds previously obtained in our laboratory, as well as compared with literary data. Among isolated compounds were palmitic acid methyl ester (1) (Kawsar et al., 2009), lupeol acetate (2) (Sholichin et al., 1980), β-sitosterol 3-O-β-glucoside (3) (Faizi et al., 2001), naringenin 7O-β-glucoside (4) (Agrawal, 1989; Harborne 1996), luteolin (5) (Harborne, 1996), eriodictyol 7-O-β-glucoside (6) (Harborne, 1996; Pan et al., 2008), cernuoside (7) (Güçlütürk et al., 2011), luteolin 7-O-β-glucoside (8) (Harborne, 1996), apigenin 7-O-β-glucoside (9) (Harborne, 1996), chlorogenic acid (10) (Nishizawa et al., 1988), 6hydroxyluteolin 7-O-β-glucoside (11) (Lu and Foo, 2000), scutellarein 7-O-β-glucoside (12) (Malikov and Yuldashev, 2002), sorbifolin (13) (Eshbakova et al., 1996) and pedalitin (14) (Bisio et al., 1997), respectively. Spectroscopic data was enclosed as a supplementary document. The structures of the isolated compounds were shown in Fig. 1. The isolated flavonoids belong to three various subclasses and constitute the main group of compounds in the leaves of C. palustre. Previously, only luteolin 7O-β-glucoside has been described as a component of this source. In our study, it was isolated in large amounts (1575 g of pure compound and about 2 g in combination with other compounds). Luteolin 7-O-β-glucoside is also the main component of flower heads of C. palustre (Nazaruk, 2009). The plant can, therefore, be rated among the chemotype with common 7-O-glycosides (Iwashina, 2000). Besides, unusual metoxylated 6hydroxyflavone aglycones sorbifolin, pedalitin and flavanones, which are also rarely encountered in subtribe Cardueae (Skaltsa et al., 2000), were determined in marsh thistle leaves. This is the first report on the presence of aurone cernuoside in the genus Cirsium. Effect of selected flavonoids on collagen expression The selected flavonoids–compounds 6, 11, 12 and 14–were tested for their effect on collagen expression in normal human dermal fibroblasts. The fibroblasts were exposed to a final concentration of 1, 20 and 40 μM for 24 h, and the level of total collagen in the medium was determined by Sirius Red-based colorimetric assay. As shown in Fig. 2, the flavonoids exerted various effects on collagen content in the fibroblast medium. Among these compounds, compound 11 at a concentration of 40 μM and compound 14 at all used concentrations, significantly enhanced the amount of collagen secreted into the medium. Compound 11 at 40 μM increased collagen content 2.5-times as compared to the control. The compound 14 increased collagen
Table 1. Sequences of primers used for real-time quantitative RT-PCR Gene COL1A1 COL1A2 COL3A1 Hsp47 GAPDH
Forward primer (5′ → 3′)
Reverse primer (5′ → 3′)
References
ATGTCTAGGGTCTAGACATGTTCA AAAACATCCCAGCCAAGAACTG TGGTCCCCAAGGTGTCAAAG AACTGCGAGCACTCCAAGA ACCACAGTCCATGCCATCAC
CCTTGCCGTTGTCGCAGACG AAACTGGCTGCCAGCATTG GGGGGTCCTGGGTTACCATTA ATGAAGCCACGGTTGTCC TCCACCACCCTGTTGCTGTA
Tancred et al., 2009 Xiao et al., 2012 Zong et al., 2012 Xiao et al., 2012 Xiao et al., 2012
Copyright © 2014 John Wiley & Sons, Ltd.
Phytother. Res. (2014)
J. NAZARUK AND A. GALICKA
Figure 1. Chemical structures of compounds isolated from C. palustre leaves.
Figure 2. Effect of the compounds 6, 11, 12 and 14 on the collagen content in the medium of human skin fibroblasts. The results 6 were expressed as micrograms of total collagen per 10 cells. Values ± standard deviation (SD) are the mean of triplicate cultures. Statistical significant differences versus respective control were marked with an asterisk (* for P < 0.05, ** for P < 0.001).
level in a dose-dependent manner. At concentrations of 1, 20 and 40 μM, collagen content in the medium was significantly increased, 1.9-, 3.4- and 6.6-fold, respectively, compared with the untreated control. There was no statistical difference in collagen content between compound 6- and compound 12-treated, and untreated cells. We also confirmed that the compounds showed no Copyright © 2014 John Wiley & Sons, Ltd.
cytotoxicity and did not affect the overall protein concentration at concentrations up to 40 μM (data not shown). The Sircol collagen assay used to determine collagen content in the medium of the compound-treated fibroblasts is a quantitative dye-binding method designed for the analysis of total collagen and does not differentiate between types of collagen. In the skin, there are two major types of collagen, collagen I and collagen III, that form a specialized network binding cells together, acting as a reservoir for growth factors, and providing tensile strength and support to human skin (Gelse et al., 2003). Therefore, we assessed the expression level of type I and III collagen mRNA subunits in fibroblast cells exposed to the compounds by real-time PCR. An increase in the expression of COL1A1 and COL1A2 genes encoding collagen type I subunits was demonstrated in cells treated with all four compounds, whereas a decrease was observed in type III collagen expression at mRNA level in cells treated with compounds 6 and 12 (Fig. 3). Since in healthy human skin, type I collagen comprises 80–85% and type III only 10–15% (Riekki et al., 2002), the significant increase in type I and decrease in type III collagen gene expression cannot explain the results obtained for compounds 6 and 12 at the protein level. Therefore, the expression of collagen chaperone Hsp47, being important in collagen secretion, was studied. In the cells exposed to compounds Phytother. Res. (2014)
THE INFLUENCE OF FLAVONOIDS OF CIRSIUM PALUSTRE ON COLLAGEN EXPRESSION
Figure 3. Effect of the compounds 6, 11, 12 and 14 on the expression of collagen type I (A,B), collagen type III (C) and Hsp47 (D) genes. The mRNA expression of target genes was normalized to that of GAPDH and a value of 1.0 was assigned to the mRNA expression of target genes in the control group. Statistically significant differences versus respective control were marked with an asterisk (* for P < 0.05, ** for P < 0.001).
11 and 14, no change or increase in chaperone expression, respectively, was observed (Fig. 3). In contrast, significant inhibition was noted in the cells treated with 6 and 12, suggesting that these results could be attributable to the level of collagen secreted into media (Fig 2). Hsp47, also called ‘SERPINH1,’ is an ER-resident chaperone which preferentially recognizes the folded triple-helical conformation of procollagen and stabilizes structure during its secretion across the Golgi apparatus to the extracellular matrix (Ono et al., 2012). Collagen secreted by cells that either lack Hsp47 or possess only reduced levels was shown to be more susceptible to protease digestion, unlike collagen produced by normal cells (Nagai et al., 2000). The increased expression of
collagen genes observed in the flavonoid-treated cells could result in stimulation of collagen biosynthesis. However, in the cells where Hsp47 expression was diminished, the secretion of procollagens into the medium could be decreased due to triple-helix structure failure, resulting in their retention in the ER and increased intracellular degradation. Different amounts of collagen in the medium of the compound-treated cells may also be the result of their impact on MMP activity. Using zymography, we detected the presence of MMP-2 (72 kDa) and demonstrated a significant inhibition of its activity in the medium of the compound-treated cells, with the greatest effect of compound 14 at 20 μM (Fig. 4). However, no
Figure 4. A. Representative zymograph of gelatinase A (MMP-2) activity in the medium of 6-, 11-, 12-, 14-treated and untreated (control—C) skin fibroblasts, M—molecular mass of the standards. B. The densitometric intensity of the zymography bands expressed as percent of the control. Values ± standard deviation (SD) are the mean of triplicate cultures. Statistically significant differences versus respective control were marked with an asterisk (* for P < 0.05, ** for P < 0.001). Copyright © 2014 John Wiley & Sons, Ltd.
Phytother. Res. (2014)
J. NAZARUK AND A. GALICKA
significant correlations occurred between enzyme activity and collagen concentration in the conditioned media (p > 0.05). Flavonoids have been found to have inhibitory activities toward MMPs. Ende and Gebhardt (2004) tested eight compounds and showed that these flavonoids inhibit MMP-2 and MMP-9 similarly to our finding in the micromolar range. It was observed that flavonoids, depending on their structure, can stimulate or inhibit collagen biosynthesis (Stipcevic et al., 2006, Galicka and Nazaruk, 2007). We have previously demonstrated that the stimulation of collagen type I biosynthesis by flavonoid glycosides may have potential therapeutic use in the treatment of osteogenesis imperfecta (OI) type I (Galicka and Nazaruk, 2007). These glycosides enhanced collagen type I biosynthesis without affecting type III collagen in OI fibroblasts. Here, we found two more flavonoids, pedalitin (14) and 6-hydroxyluteolin 7-O-β-glucoside (11), which increased collagen content in the medium of normal skin fibroblasts. Compound 11 at 40 μM caused a significant increase in collagen type I expression without any effect on type III collagen. Compound 14 at 1 μM significantly stimulated collagen type I and at higher concentrations (20 and 40 μM) type I as well as type III collagen expression. Type I and III collagen synthesis decreases with age, causing changes in skin tension, elasticity and healing (Cheng et al., 2011). Age-related changes in the rates of collagen synthesis are accompanied by elevated MMP activity and greater collagen degradation (Rittie and Fisher, 2002). Compounds 11 and 14, by increasing collagen content and decreasing activity of MMP-2 in fibroblast medium, might be potential therapeutic agents to prevent and treat skin aging. However, further investigation is needed.
It is necessary to emphasize, that unlike in in vitro conditions, in living organism flavonoids are not active in such form, because they are modified in the small intestine epithelial cells and in the liver. Therefore, it is difficult to transfer results obtained in vitro directly into biological effects in vivo. It suggests that more studies in vivo should be done to answer the question whether biological effects of flavonoids in vitro have any relevance in vivo (Williamson, 2002). The analysis of the structure of the compounds examined shows that their activity is probably dependent on the presence of two orto-hydroxyl groups at ring B and a methoxy group at C-7 of the flavone molecule and to a smaller degree on two hydroxyl groups at the ring A. Ende and Gebhardt (2004) observed that inhibitory effect of flavonoids on MMPs is largely dependent on hydroxyl groups, especially at position 3′ and 4′ of ring B. Detailed determination of the structure–activity relationship requires additional experiments.
Acknowledgements The authors acknowledge financial support from the Medical University of Bialystok (project no. 133-12553F). This study was conducted with the use of equipment purchased by the Medical University of Bialystok as part of the OP DEP 2007-2013, Priority Axis I.3, contract No POPW.01.03.00-20-022/09.
Conflict of Interest The authors have declare that there is no conflict of interest.
REFERENCES Agrawal PK. 1989. Carbon-13 NMR of flavonoids. Elsevier: Amsterdam. Bisio A, Romussi G, Ciarallo G, De Tommasi N. 1997. Flavonoide und Triterpenoide aus Salvia blepharophylla Brandegee ex Epling. Pharmazie 52: 330–331. Carmichael J, Degraff W, Gazdar A, Minna J, Mitchell J. 1987. Evaluation of a tetrazolinium-based semiautomated colorimetric assay: assessment of chemosensitivity testing. Cancer Res 47: 936–942. Cheng W, Yan-hua R, Fang-gang N, Guo-an Z. 2011. The content and ratio of type I and III collagen in skin differ with age and injury. Afr J Biotechnol 10: 2524–2529. Ende C, Gebhardt R. 2004. Inhibition of matrix metalloproteinase2 and 9 activities by selected flavonoids. Planta Med 70: 1006–1008. Eshbakova KA, Sagitdinova GV, Malikov VM, Melibaev S. 1996. Flavone sorbifolin from Pulicaria uliginosa. Chem Nat Comp 32: 82. 1 Faizi S, Ali M, Saleem R, Irfanullah, BS. 2001. Complete H and 13 C NMR assignments of stigma-5-en-3-O-β-glucoside and its acetyl derivative. Magn Reson Chem 39: 399–405. Galicka A, Nazaruk J. 2007. Stimulation of collagen biosynthesis by flavonoid glycosides in skin fibroblasts of osteogenesis imperfecta type I and the potential mechanism of their action. Int J Mol Med 20: 889–895. Gelse K, Pöschl E, Aigner T. 2003. Collagens-structure, function, and biosynthesis. Adv Drug Deliv Rev 55: 1531–1546. Güçlütürk I, Detsi A, Weiss EK, Ioannou E, Roussisc V, Kefalas P. 2011. Evaluation of anti-oxidant activity and identification of major polyphenolics of the invasive weed Oxalis pes-caprae. Phytochem Anal 23: 642–646. Harborne JB. (Ed.) 1996. The flavonoids. Advances in research 1986. Chapman & Hall: London. Copyright © 2014 John Wiley & Sons, Ltd.
Havsteen BH. 2002. The biochemistry and medical significance of the flavonoids. Pharmacol Therapeut 96: 67–202. Iwashina T. 2000. The structure and distribution of the flavonoids in plants. J Plant Res 113: 287–299. Kawsar SMA, Mostafa G, Huq E, Nahar N, Ozeki Y. 2009. Chemical constituents and hemolytic activity of Macrotyloma uniflorum. Int J Biol Chem 3: 42–48. Lu Y, Foo LY. 2000. Flavonoid and phenolic glycosides from Salvia officinalis. Phytochemistry 55: 263–267. Mabry TJ, Markham KR, Thomas MB. 1970. The systematic identification of flavonoids. Springer-Verlag: Berlin. Malikov VM, Yuldashev MP. 2002. Phenolic compounds of plants of the Scutellaria L. genus. Distribution, structure, and properties. Chem Nat Comp 38: 358–406. Nagai N, Hosokawa M, Itohara S, Adach E, Matsushita T, Hosokawa N, Nagata K. 2000. Embryonic lethality of molecular chaperone Hsp47 knockout mice is associated with defects in collagen biosynthesis. J Biol Chem 150: 1499–1505. Nazaruk J. 2008. Antioxidant activity and total phenolic content in Cirsium five species from north-east region of Poland. Fitoterapia 79: 194–196. Nazaruk J. 2009. Flavonoid compounds from Cirsium palustre (L.) Scop. flower heads. Biochem Syst Ecol 37: 525–527. Nazaruk J, Czechowska SK, Markiewicz R, Borawska MH. 2008. Polyphenolic compounds and in vitro antimicrobial and antioxidant activity of aqueous extracts from leaves of some Cirsium species. Nat Prod Res 22: 1583–1588. Nazaruk J, Szoka L. 2009. The qualitative and quantitative analysis of phenolic acids and flavonoids in Cirsium spp. Herba Pol 55: 32–37. Nishizawa M, Izuhara R, Kaneko K, Koshihara Y, Fujimoto Y. 1988. 5-Lipooxygenase inhibitors isolated from Gardeniae fructus. Chem Pharm Bull 36: 87–95. Phytother. Res. (2014)
THE INFLUENCE OF FLAVONOIDS OF CIRSIUM PALUSTRE ON COLLAGEN EXPRESSION Ono T, Miyazaki T, Ishida Y, Uehata M, Nagata K. 2012. Direct in vitro and in vivo evidence for interaction between Hsp47 protein and collagen triple helix. J Biol Chem 287: 6810–6818. Pan J, Zhang S, Yan L, Tai J, Xiao Q, Zou K, Zhou Y, Wu J. 2008. Separation of flavanone enantiomers and flavanone glucoside diastereoisomers from Balanophora involucrata Hook. f. by capillary electrophoresis and reversed-phase highperformance liquid chromatography on a C18 column. J Chromatogr A 1185: 117–129. Riekki R, Parikka M, Jukkola A, Salo T, Risteli J, Oikarinen A. 2002. Increased expression of collagen type I and III in human skin as a consequence of radiotherapy. Arch Dermatol Res 294: 178–184. Rittie L, Fisher GJ. 2002. UV-light-induced signal cascades and skin aging. Ageing Res Rev 1: 705–720. Shelyuto VL, Glyzin VI, Bubon NT. 1972. The flavonoids of Cirsium palustre. Chem Nat Prod 8: 238. 13 Sholichin M, Yamasaki K, Kasai, R, Tanaka O. 1980. C nuclear magnetic resonance of lupane-type triterpenes, lupeol, betulin and betulinic acid. Chem Pharm Bull 28: 1006–1008. Skaltsa H, Lazari D, Constantinidis T. 2000. Flavonoid compounds of Lamyropsis cynaroides. Biochem Syst Ecol 28: 809–811. Stipcevic T, Piljac J, Vanden BD. 2006. Effect of different flavonoids on collagen synthesis in human fibroblasts. Plant Foods Hum Nutr 61: 29–34. Tancred TM, Belch AR, Reiman T, Pilarski LM, Kirshner J. 2009. Altered expression of fibronectin and collagens I and IV in multiple myeloma and monoclonal gammopathy
Copyright © 2014 John Wiley & Sons, Ltd.
of undetermined significance. J Histochem Cytochem 57: 239–247. Tutin TG (Ed.) 1976. Flora Europaea, vol. 4. Cambridge University Press: Cambridge, pp. 241. Unemori EN, Werb Z. 1986. Reorganization of polymerized actin: a possible trigger for induction of procollagenase in fibroblasts cultured in and on collagen gels. J Cell Biol 103: 1021–1031. Williamson G. 2002. The use of flavonoid aglycones in in vitro systems to test biological activities: based on bioavailability data, is this a valid approach? Phytochemistry Rev 1: 215–222. Xiao H-b, L R-h, L G-h, Xiao L, X Y-c, L F-y, Li J, L Y-h, C Q-k, L J-l, Zhan M, Y S-k, Kanwar YS, Sun L. 2012. HSP47 regulates ECM accumulation in renal proximal tubular cells induced by TGF-1 through ERK1/2 and JNK MAPK pathways. Am J Physiol Renal Physiol 303: F757–F765. Zong L, Qu Y, X M-i, Dong Y-w, Lu L-g. 2012. 18α-Glycyrrhetinic acid down-regulates expression of type I and III collagen via TGF-Β1/Smad signaling pathway in human and rat hepatic stellate cells. Int J Med Sci 9: 370–379.
SUPPORTING INFORMATION Additional supporting information may be found in the online version of this article at the publisher’s web site.
Phytother. Res. (2014)
The Influence of Selected Flavonoids from the Leaves of Cirsium palustre (L.) Scop. on Collagen Expression in Human Skin Fibroblasts Jolanta Nazaruk1* and Anna Galicka2 1
Department of Pharmacognosy, Medical University of Bialystok, Mickiewicza 2a, 15-089 Bialystok, Poland Department of Medical Chemistry, Medical University of Bialystok, Mickiewicza 2a, 15-089 Bialystok, Poland
2
Ten flavonoids belonging to the subclasses of flavones, flavanones and aurones were isolated from methanolic extract of Cirsium palustre leaves after multistep chromatographic separation. Their structures were elucidated with spectroscopic methods. All compounds, except for luteolin 7-O-glucoside, were isolated for the first time. Four compounds—eriodictyol 7-O-glucoside (6), 6-hydroxyluteolin 7-O-glucoside (11), scutellarein 7-O-glucoside (12) and pedalitin (14)—were tested for their effect on collagen expression in normal human dermal fibroblasts. Among them, compound 11 at 40 μM and compound 14, at all concentrations used (1, 20, 40 μM), significantly enhanced the level of total collagen secreted into the medium. Furthermore, compound 11 significantly stimulated type I collagen expression, whereas compound 14 activated type I and III collagen expression at the mRNA level, depending on concentration. MMP-2 activity was inhibited by all study compounds, with the greatest effect recorded with compound 14 at 20 μM. The lack of effect on collagen content in the medium of compound 6- and compound 12-treated cells, besides an increase in COL1A1 and COL1A2 expression, might be caused by diminished expression of HSP47 gene, resulting in decreased procollagen secretion. Future study of compounds 11 and 14 for their potential therapeutic use in conditions connected with collagen biosynthesis deficiency is required. Copyright © 2014 John Wiley & Sons, Ltd. Keywords: Cirsium palustre (L.) Scop; flavonoids; collagen type I, III and Hsp47 expression; MMP-2; human skin fibroblasts.
INTRODUCTION Cirsium palustre (L.) Scop., marsh thistle (family Asteraceae, subtribe Cardueae), is a herbaceous biennial plant widely distributed in Europe found on marshes, hedgerows and moorland pastures (Tutin, 1976). Well-recognized constituents of this plant include polyphenols, particularly flavonoids isolated from flower heads, and phenolic acids, which determine its antioxidant and antimicrobial activity (Nazaruk and Szoka, 2009; Nazaruk, 2009; Nazaruk, 2008; Nazaruk et al. 2008). Flavonoids constitute a widely present group of compounds in the genus Cirsium and can be considered its chemosystematic marker. Flavonoid compounds demonstrate multidirectional pharmacological activity, with anti-inflammatory, antioxidant, antiallergic, hepatoprotective, antithrombotic, antimicrobial and anticarcinogenic properties. They are recognized as free radical scavengers and metal chelators, and may significantly affect the function of various mammalian cellular systems (Havsteen, 2002). Since preliminary comparative chromatographic analysis showed differences in flavonoid composition of inflorescences and leaves of C. palustre, and since only luteolin 7-O-glucopyranoside was previously isolated from leaves (Shelyuto et al., 1972), the aim of current research was to isolate and identify flavonoids from marsh thistle leaves. Since our previous examinations * Correspondence to: Jolanta Nazaruk, Department of Pharmacognosy, Medical University of Bialystok, Poland. E-mail: [email protected]
Copyright © 2014 John Wiley & Sons, Ltd.
revealed that this group of compounds could affect collagen biosynthesis (Galicka and Nazaruk, 2007), we attempted to search for the up-regulated effect of selected constituents of C. palustre leaves on collagen content in the medium of normal human skin fibroblasts.
MATERIALS AND METHODS General experimental procedures. The UV spectra were measured on a UV–Vis Specord 40 spectrophotometer (Analytic Jena GmbH). The 1H and 13C NMR analysis was performed on a Bruker Avance II 400 spectrometer at 400 and 100 MHz, respectively, in CDCl3 (compound 1, 2), Py-d5 (compound 3) and DMSO-d6 (compounds 4–14). For the extraction of plant material and isolation of compounds, analytical pure organic solvents—hexane (fraction from kerosene), ethyl acetate, methanol, nbutanol and benzene purchased from POCh and Chempur, Poland—were used. For column chromatography silica gel (mesh 0.2–0.5 mm, Merck), polyamide (Roth), cellulose powder (Roth) and Sephadex LH-20 (Pharmacia) were applied. Plant material. Leaves of C. palustre were collected in July 2008 in the vicinity of Bialystok (Poland) and were identified by the first author. A voucher specimen (CP 06014) was kept in the Herbarium of Department of Pharmacognosy, Medical University of Bialystok, Poland. Received 15 September 2013 Revised 17 February 2014 Accepted 18 February 2014
J. NAZARUK AND A. GALICKA
Extraction and isolation. The air-dried grinded leaves of C. palustre (180 g) were extracted with MeOH for 2 h (3 × 2.5 L). Total filtrate was concentrated in vacuo at 40 °C, and the obtained extract (61.9 g) was chromatographed over silica gel column using mixed solvents of C6H14 and EtOAc (100:0-0:100, gradient) and EtOAc-MeOH (100:0-0:100, gradient). Collected subfractions (149) of 250 mL were monitored by TLC (Si gel, Merck) in the same system as the eluent when the first mixture of solvents was used with respect to lipophilic compounds, and then by TLC (Cellulose, Merck) in the BAW system [n-butanol-acetic acid-water (4:1:5) upper phase] with respect to flavonoids. The same subfractions were combined to obtain 16 fractions. From fraction 3 eluted with C6H14–EtOAc (95:5), compound 1 (580 mg) was isolated and from fraction 4 eluted with C6H14–EtOAc (8:2) compound 2 (182 mg) was obtained. After changing the polarity of the eluent, in fractions 12–14 the mixtures of polyphenolic compounds were found. For further separation, the residues that crystallized from methanolic solutions were used. The residue (917 mg) from fraction 12 [eluted with EtOAc-MeOH (9:1)] was subjected to column chromatography (polyamide, EtOAc-MeOH step gradient). Pure compound 3 (42 mg) was obtained from the initial fractions eluted with EtOAc. Compound 4 (5 mg) and compound 5 (4 mg) were obtained from the first fraction eluted with the solvents in the 9:1 ratio and then after gel filtration on Sephadex LH-20 (isocratic elution of MeOH). The next fractions eluted with the same solvent system were separated on the cellulose column with nBuOH saturated with H2O, and pure compounds 6 (28 mg) and 7 (5 mg) were obtained. The residue (1514 mg) from fraction 13 [EtOAc-MeOH (9:1 and 8:2)] was chromatographed on a cellulose column with H2O–MeOH as eluent and fractions eluted with 40–80% MeOH yielded 630 mg of compound 8. Fraction 14 eluted with EtOAc–MeOH (7:3) gave 14.61 g of the residue. After its separation on a polyamide column (EtOAc–MeOH step gradient), fractions eluted with solvents in the 8:2 ratio yielded 224 mg of compound 9. Next fractions eluted with the same eluent, containing a mixture of two compounds, were rechromatographed on a cellulose column (n-BuOH saturated with water) to obtain 945 mg of compound 8 and 120 mg of compound 9. Fractions eluted with EtOAc–MeOH (7:3) were subjected to a polyamide column and H2O–MeOH step gradient was used as eluent. Fractions eluted with 50% MeOH yielded compound 10 (19 mg), with 70% MeOH compound 11 (457 mg), with 80% MeOH compound 12 (8 mg) and a mixture of compounds. Chromatographic separation of this mixture on the polyamide column using C6H6–MeOH step gradient for elution afforded compound 13 (6 mg) and compound 14 (22 mg), when the eluents were in the 9:1 and 8:2 ratios, respectively. Fibroblast cultures. Normal human skin fibroblast lines were initiated from forearm skin biopsies obtained from healthy volunteers. Cells were grown to confluence in Dulbecco’s modified Eagle’s medium (DMEM) with 10% FBS, 50 U/mL penicillin, 50 μg/mL streptomycin and 2 mmol/l L-glutamine at 37 °C in a 5% CO2 incubator. The biopsies were obtained with the approval of the Ethics Committee of the Medical University of Copyright © 2014 John Wiley & Sons, Ltd.
Bialystok and with written consent. Cells were counted in a hemocytometer and cultured at a density of 1 × 106 cells/well in 2 mL growth medium in six-well plates (Costar). For experiments, confluent cells were used to eliminate growth-related events. Estimation of biological action of flavonoids in skin fibroblasts. Confluent cells were preincubated in fresh serum-free medium for 2 h. The flavonoids dissolved in DMSO were added to the medium to a final concentration of 1, 20 and 40 μM, and incubated for 24 h. The same concentration of DMSO solution was used as control in order to rule out the possible effect of DMSO on fibroblasts. After incubation, the exposure medium was removed and stored for analysis of collagen content and MMP activity. The monolayers were washed four times with sterile 10 mM PBS pH 7.4, and cell membranes were disrupted using a sonicator (Sonics Vibra cell). Aliquots of the homogenate were removed for the protein measurement with BCA Protein Assay Kit (Pierce), and the remaining homogenate was used for isolation of RNA. Collagen content assay. Three dosages of the compounds (1, 20 and 40 μM) were added to wells of the plates and incubated in serum-free medium for 24 h. Then, the medium in each well was collected to measure collagen levels using Sircol soluble collagen assay (Biocolor Assays, Ireland). Briefly, to the samples of the medium Sircol dye reagent was added and mixed for 30 min on an orbital shaker. The samples were then centrifuged and the dye bound to the collagen pellet was solubilized with an alkali reagent. The absorbance of the samples was measured at 555 nm using a microplate reader (Infinite M200, TECAN). A calibration standard of type I collagen was used to obtain the standard curve. MMP assay. Gelatinolytic activity of conditioned medium was determined according to the method of Unemori and Werb (1986). Equal amounts (10 μg) of protein were electrophoresed under non-reducing conditions on 10% polyacrylamide gel impregnated with 1 mg/mL gelatin (Sigma) as a substrate. After electrophoresis, the gel was washed twice for 15 min with 2% Triton X-100 and then incubated overnight at 37 °C in 50 mM Tris/HCl, pH 8.0, containing 5 mM CaCl2. The gel was stained with 0.5% Coomassie Brilliant Blue R-250. Clear bands on the blue background which represented areas of substrate-degrading enzymes were quantified using an imaging densitometer (G:BOX, Syngene). Real-time PCR. Total RNA was isolated using the MasterPureTM RNA Purification Kit (Akor Laboratories). The RNA extracts were treated with RNase-free DNase Ι to remove contaminating DNA, quantified on a spectrophotometer (Nanodrop 2000, ThermoScientific) and stored at 80 °C. Real-time PCR assays performed in CFX96 Real-Time System (Bio-Rad) were used to quantify mRNA levels of type I collagen, type III collagen and Hsp47 (heat-shock protein). As housekeeping gene GAPDH (glyceraldehyde-3-phosphate dehydrogenase) Phytother. Res. (2014)
THE INFLUENCE OF FLAVONOIDS OF CIRSIUM PALUSTRE ON COLLAGEN EXPRESSION
was evaluated. Total RNA (1 μg) in a total volume of 20 μL was reverse transcribed using a Tetro cDNA Synthesis Kit (Bioline) and 1 μl oligo(dT) primer. Real-time PCR was carried out using 2 μL of the cDNA product, 400 nM each primer and the SensiFAST™ SYBR Kit (Bioline). Forward and reverse primer sequences are listed in Table 1. Cycling parameters were: 95 °C for 1 min to activate the DNA polymerase, then 40 cycles of denaturation for 10 s at 95 °C, annealing for 15 s at 59 °C, and extension for 20 s at 72 °C. The reaction was then subjected to a melting protocol from 55 °C to 95 °C with a 0.2 °C increment and 1 s holding at each increment to check the specificity of the amplified products. Single product formation was confirmed by melting point analysis and agarose gel electrophoresis. For negative control, water instead of mRNA samples was used. Samples were run in triplicate and the ΔΔCT method was applied for a statistical analysis of the CT-values. The relative gene expression levels were standardized with those measured in the untreated control. Assay for cell viability. The assay was performed according to the method of Carmichael et al. (1987) using MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide]. Confluent cells cultured with the tested compounds for 20 h at 37 °C were washed with PBS and then incubated for 4 h in 1 mL of MTT solution (0.5 mg/mL). The medium was removed, and 1 mL of 0.1 M HCl in absolute isopropanol was added to the cells. Absorbance of converted dye in living cells was measured at a wavelength of 570 nm.
Statistical analysis. In all experiments, the mean values for three assays ± SD were calculated. The results were submitted to statistical analysis using one-way analysis of variance (ANOVA), followed by the Duncan’s multiple range post hock test. Differences were recognized as statistically significant at p < 0.05. Spearman rank correlation analysis was conducted to investigate the relationship between enzyme degrading collagen (MMP-2) activity and collagen concentration in the conditioned media. All the calculations were performed using Statistica 9.0 package (StatSoft, Tulsa, OK, USA).
RESULTS AND DISCUSSION Identification of components of methanolic extract from C. palustre leaves Fourteen pure compounds were isolated from the methanolic extract of C. palustre leaves as a result of
multistep chromatographic separations. The structures of the isolates were elucidated on the basis of spectral analysis including UV (method according to Mabry et al., 1970), 1H and 13C NMR, DEPT and additionally HSQC for compound 7, and compared with compounds previously obtained in our laboratory, as well as compared with literary data. Among isolated compounds were palmitic acid methyl ester (1) (Kawsar et al., 2009), lupeol acetate (2) (Sholichin et al., 1980), β-sitosterol 3-O-β-glucoside (3) (Faizi et al., 2001), naringenin 7O-β-glucoside (4) (Agrawal, 1989; Harborne 1996), luteolin (5) (Harborne, 1996), eriodictyol 7-O-β-glucoside (6) (Harborne, 1996; Pan et al., 2008), cernuoside (7) (Güçlütürk et al., 2011), luteolin 7-O-β-glucoside (8) (Harborne, 1996), apigenin 7-O-β-glucoside (9) (Harborne, 1996), chlorogenic acid (10) (Nishizawa et al., 1988), 6hydroxyluteolin 7-O-β-glucoside (11) (Lu and Foo, 2000), scutellarein 7-O-β-glucoside (12) (Malikov and Yuldashev, 2002), sorbifolin (13) (Eshbakova et al., 1996) and pedalitin (14) (Bisio et al., 1997), respectively. Spectroscopic data was enclosed as a supplementary document. The structures of the isolated compounds were shown in Fig. 1. The isolated flavonoids belong to three various subclasses and constitute the main group of compounds in the leaves of C. palustre. Previously, only luteolin 7O-β-glucoside has been described as a component of this source. In our study, it was isolated in large amounts (1575 g of pure compound and about 2 g in combination with other compounds). Luteolin 7-O-β-glucoside is also the main component of flower heads of C. palustre (Nazaruk, 2009). The plant can, therefore, be rated among the chemotype with common 7-O-glycosides (Iwashina, 2000). Besides, unusual metoxylated 6hydroxyflavone aglycones sorbifolin, pedalitin and flavanones, which are also rarely encountered in subtribe Cardueae (Skaltsa et al., 2000), were determined in marsh thistle leaves. This is the first report on the presence of aurone cernuoside in the genus Cirsium. Effect of selected flavonoids on collagen expression The selected flavonoids–compounds 6, 11, 12 and 14–were tested for their effect on collagen expression in normal human dermal fibroblasts. The fibroblasts were exposed to a final concentration of 1, 20 and 40 μM for 24 h, and the level of total collagen in the medium was determined by Sirius Red-based colorimetric assay. As shown in Fig. 2, the flavonoids exerted various effects on collagen content in the fibroblast medium. Among these compounds, compound 11 at a concentration of 40 μM and compound 14 at all used concentrations, significantly enhanced the amount of collagen secreted into the medium. Compound 11 at 40 μM increased collagen content 2.5-times as compared to the control. The compound 14 increased collagen
Table 1. Sequences of primers used for real-time quantitative RT-PCR Gene COL1A1 COL1A2 COL3A1 Hsp47 GAPDH
Forward primer (5′ → 3′)
Reverse primer (5′ → 3′)
References
ATGTCTAGGGTCTAGACATGTTCA AAAACATCCCAGCCAAGAACTG TGGTCCCCAAGGTGTCAAAG AACTGCGAGCACTCCAAGA ACCACAGTCCATGCCATCAC
CCTTGCCGTTGTCGCAGACG AAACTGGCTGCCAGCATTG GGGGGTCCTGGGTTACCATTA ATGAAGCCACGGTTGTCC TCCACCACCCTGTTGCTGTA
Tancred et al., 2009 Xiao et al., 2012 Zong et al., 2012 Xiao et al., 2012 Xiao et al., 2012
Copyright © 2014 John Wiley & Sons, Ltd.
Phytother. Res. (2014)
J. NAZARUK AND A. GALICKA
Figure 1. Chemical structures of compounds isolated from C. palustre leaves.
Figure 2. Effect of the compounds 6, 11, 12 and 14 on the collagen content in the medium of human skin fibroblasts. The results 6 were expressed as micrograms of total collagen per 10 cells. Values ± standard deviation (SD) are the mean of triplicate cultures. Statistical significant differences versus respective control were marked with an asterisk (* for P < 0.05, ** for P < 0.001).
level in a dose-dependent manner. At concentrations of 1, 20 and 40 μM, collagen content in the medium was significantly increased, 1.9-, 3.4- and 6.6-fold, respectively, compared with the untreated control. There was no statistical difference in collagen content between compound 6- and compound 12-treated, and untreated cells. We also confirmed that the compounds showed no Copyright © 2014 John Wiley & Sons, Ltd.
cytotoxicity and did not affect the overall protein concentration at concentrations up to 40 μM (data not shown). The Sircol collagen assay used to determine collagen content in the medium of the compound-treated fibroblasts is a quantitative dye-binding method designed for the analysis of total collagen and does not differentiate between types of collagen. In the skin, there are two major types of collagen, collagen I and collagen III, that form a specialized network binding cells together, acting as a reservoir for growth factors, and providing tensile strength and support to human skin (Gelse et al., 2003). Therefore, we assessed the expression level of type I and III collagen mRNA subunits in fibroblast cells exposed to the compounds by real-time PCR. An increase in the expression of COL1A1 and COL1A2 genes encoding collagen type I subunits was demonstrated in cells treated with all four compounds, whereas a decrease was observed in type III collagen expression at mRNA level in cells treated with compounds 6 and 12 (Fig. 3). Since in healthy human skin, type I collagen comprises 80–85% and type III only 10–15% (Riekki et al., 2002), the significant increase in type I and decrease in type III collagen gene expression cannot explain the results obtained for compounds 6 and 12 at the protein level. Therefore, the expression of collagen chaperone Hsp47, being important in collagen secretion, was studied. In the cells exposed to compounds Phytother. Res. (2014)
THE INFLUENCE OF FLAVONOIDS OF CIRSIUM PALUSTRE ON COLLAGEN EXPRESSION
Figure 3. Effect of the compounds 6, 11, 12 and 14 on the expression of collagen type I (A,B), collagen type III (C) and Hsp47 (D) genes. The mRNA expression of target genes was normalized to that of GAPDH and a value of 1.0 was assigned to the mRNA expression of target genes in the control group. Statistically significant differences versus respective control were marked with an asterisk (* for P < 0.05, ** for P < 0.001).
11 and 14, no change or increase in chaperone expression, respectively, was observed (Fig. 3). In contrast, significant inhibition was noted in the cells treated with 6 and 12, suggesting that these results could be attributable to the level of collagen secreted into media (Fig 2). Hsp47, also called ‘SERPINH1,’ is an ER-resident chaperone which preferentially recognizes the folded triple-helical conformation of procollagen and stabilizes structure during its secretion across the Golgi apparatus to the extracellular matrix (Ono et al., 2012). Collagen secreted by cells that either lack Hsp47 or possess only reduced levels was shown to be more susceptible to protease digestion, unlike collagen produced by normal cells (Nagai et al., 2000). The increased expression of
collagen genes observed in the flavonoid-treated cells could result in stimulation of collagen biosynthesis. However, in the cells where Hsp47 expression was diminished, the secretion of procollagens into the medium could be decreased due to triple-helix structure failure, resulting in their retention in the ER and increased intracellular degradation. Different amounts of collagen in the medium of the compound-treated cells may also be the result of their impact on MMP activity. Using zymography, we detected the presence of MMP-2 (72 kDa) and demonstrated a significant inhibition of its activity in the medium of the compound-treated cells, with the greatest effect of compound 14 at 20 μM (Fig. 4). However, no
Figure 4. A. Representative zymograph of gelatinase A (MMP-2) activity in the medium of 6-, 11-, 12-, 14-treated and untreated (control—C) skin fibroblasts, M—molecular mass of the standards. B. The densitometric intensity of the zymography bands expressed as percent of the control. Values ± standard deviation (SD) are the mean of triplicate cultures. Statistically significant differences versus respective control were marked with an asterisk (* for P < 0.05, ** for P < 0.001). Copyright © 2014 John Wiley & Sons, Ltd.
Phytother. Res. (2014)
J. NAZARUK AND A. GALICKA
significant correlations occurred between enzyme activity and collagen concentration in the conditioned media (p > 0.05). Flavonoids have been found to have inhibitory activities toward MMPs. Ende and Gebhardt (2004) tested eight compounds and showed that these flavonoids inhibit MMP-2 and MMP-9 similarly to our finding in the micromolar range. It was observed that flavonoids, depending on their structure, can stimulate or inhibit collagen biosynthesis (Stipcevic et al., 2006, Galicka and Nazaruk, 2007). We have previously demonstrated that the stimulation of collagen type I biosynthesis by flavonoid glycosides may have potential therapeutic use in the treatment of osteogenesis imperfecta (OI) type I (Galicka and Nazaruk, 2007). These glycosides enhanced collagen type I biosynthesis without affecting type III collagen in OI fibroblasts. Here, we found two more flavonoids, pedalitin (14) and 6-hydroxyluteolin 7-O-β-glucoside (11), which increased collagen content in the medium of normal skin fibroblasts. Compound 11 at 40 μM caused a significant increase in collagen type I expression without any effect on type III collagen. Compound 14 at 1 μM significantly stimulated collagen type I and at higher concentrations (20 and 40 μM) type I as well as type III collagen expression. Type I and III collagen synthesis decreases with age, causing changes in skin tension, elasticity and healing (Cheng et al., 2011). Age-related changes in the rates of collagen synthesis are accompanied by elevated MMP activity and greater collagen degradation (Rittie and Fisher, 2002). Compounds 11 and 14, by increasing collagen content and decreasing activity of MMP-2 in fibroblast medium, might be potential therapeutic agents to prevent and treat skin aging. However, further investigation is needed.
It is necessary to emphasize, that unlike in in vitro conditions, in living organism flavonoids are not active in such form, because they are modified in the small intestine epithelial cells and in the liver. Therefore, it is difficult to transfer results obtained in vitro directly into biological effects in vivo. It suggests that more studies in vivo should be done to answer the question whether biological effects of flavonoids in vitro have any relevance in vivo (Williamson, 2002). The analysis of the structure of the compounds examined shows that their activity is probably dependent on the presence of two orto-hydroxyl groups at ring B and a methoxy group at C-7 of the flavone molecule and to a smaller degree on two hydroxyl groups at the ring A. Ende and Gebhardt (2004) observed that inhibitory effect of flavonoids on MMPs is largely dependent on hydroxyl groups, especially at position 3′ and 4′ of ring B. Detailed determination of the structure–activity relationship requires additional experiments.
Acknowledgements The authors acknowledge financial support from the Medical University of Bialystok (project no. 133-12553F). This study was conducted with the use of equipment purchased by the Medical University of Bialystok as part of the OP DEP 2007-2013, Priority Axis I.3, contract No POPW.01.03.00-20-022/09.
Conflict of Interest The authors have declare that there is no conflict of interest.
REFERENCES Agrawal PK. 1989. Carbon-13 NMR of flavonoids. Elsevier: Amsterdam. Bisio A, Romussi G, Ciarallo G, De Tommasi N. 1997. Flavonoide und Triterpenoide aus Salvia blepharophylla Brandegee ex Epling. Pharmazie 52: 330–331. Carmichael J, Degraff W, Gazdar A, Minna J, Mitchell J. 1987. Evaluation of a tetrazolinium-based semiautomated colorimetric assay: assessment of chemosensitivity testing. Cancer Res 47: 936–942. Cheng W, Yan-hua R, Fang-gang N, Guo-an Z. 2011. The content and ratio of type I and III collagen in skin differ with age and injury. Afr J Biotechnol 10: 2524–2529. Ende C, Gebhardt R. 2004. Inhibition of matrix metalloproteinase2 and 9 activities by selected flavonoids. Planta Med 70: 1006–1008. Eshbakova KA, Sagitdinova GV, Malikov VM, Melibaev S. 1996. Flavone sorbifolin from Pulicaria uliginosa. Chem Nat Comp 32: 82. 1 Faizi S, Ali M, Saleem R, Irfanullah, BS. 2001. Complete H and 13 C NMR assignments of stigma-5-en-3-O-β-glucoside and its acetyl derivative. Magn Reson Chem 39: 399–405. Galicka A, Nazaruk J. 2007. Stimulation of collagen biosynthesis by flavonoid glycosides in skin fibroblasts of osteogenesis imperfecta type I and the potential mechanism of their action. Int J Mol Med 20: 889–895. Gelse K, Pöschl E, Aigner T. 2003. Collagens-structure, function, and biosynthesis. Adv Drug Deliv Rev 55: 1531–1546. Güçlütürk I, Detsi A, Weiss EK, Ioannou E, Roussisc V, Kefalas P. 2011. Evaluation of anti-oxidant activity and identification of major polyphenolics of the invasive weed Oxalis pes-caprae. Phytochem Anal 23: 642–646. Harborne JB. (Ed.) 1996. The flavonoids. Advances in research 1986. Chapman & Hall: London. Copyright © 2014 John Wiley & Sons, Ltd.
Havsteen BH. 2002. The biochemistry and medical significance of the flavonoids. Pharmacol Therapeut 96: 67–202. Iwashina T. 2000. The structure and distribution of the flavonoids in plants. J Plant Res 113: 287–299. Kawsar SMA, Mostafa G, Huq E, Nahar N, Ozeki Y. 2009. Chemical constituents and hemolytic activity of Macrotyloma uniflorum. Int J Biol Chem 3: 42–48. Lu Y, Foo LY. 2000. Flavonoid and phenolic glycosides from Salvia officinalis. Phytochemistry 55: 263–267. Mabry TJ, Markham KR, Thomas MB. 1970. The systematic identification of flavonoids. Springer-Verlag: Berlin. Malikov VM, Yuldashev MP. 2002. Phenolic compounds of plants of the Scutellaria L. genus. Distribution, structure, and properties. Chem Nat Comp 38: 358–406. Nagai N, Hosokawa M, Itohara S, Adach E, Matsushita T, Hosokawa N, Nagata K. 2000. Embryonic lethality of molecular chaperone Hsp47 knockout mice is associated with defects in collagen biosynthesis. J Biol Chem 150: 1499–1505. Nazaruk J. 2008. Antioxidant activity and total phenolic content in Cirsium five species from north-east region of Poland. Fitoterapia 79: 194–196. Nazaruk J. 2009. Flavonoid compounds from Cirsium palustre (L.) Scop. flower heads. Biochem Syst Ecol 37: 525–527. Nazaruk J, Czechowska SK, Markiewicz R, Borawska MH. 2008. Polyphenolic compounds and in vitro antimicrobial and antioxidant activity of aqueous extracts from leaves of some Cirsium species. Nat Prod Res 22: 1583–1588. Nazaruk J, Szoka L. 2009. The qualitative and quantitative analysis of phenolic acids and flavonoids in Cirsium spp. Herba Pol 55: 32–37. Nishizawa M, Izuhara R, Kaneko K, Koshihara Y, Fujimoto Y. 1988. 5-Lipooxygenase inhibitors isolated from Gardeniae fructus. Chem Pharm Bull 36: 87–95. Phytother. Res. (2014)
THE INFLUENCE OF FLAVONOIDS OF CIRSIUM PALUSTRE ON COLLAGEN EXPRESSION Ono T, Miyazaki T, Ishida Y, Uehata M, Nagata K. 2012. Direct in vitro and in vivo evidence for interaction between Hsp47 protein and collagen triple helix. J Biol Chem 287: 6810–6818. Pan J, Zhang S, Yan L, Tai J, Xiao Q, Zou K, Zhou Y, Wu J. 2008. Separation of flavanone enantiomers and flavanone glucoside diastereoisomers from Balanophora involucrata Hook. f. by capillary electrophoresis and reversed-phase highperformance liquid chromatography on a C18 column. J Chromatogr A 1185: 117–129. Riekki R, Parikka M, Jukkola A, Salo T, Risteli J, Oikarinen A. 2002. Increased expression of collagen type I and III in human skin as a consequence of radiotherapy. Arch Dermatol Res 294: 178–184. Rittie L, Fisher GJ. 2002. UV-light-induced signal cascades and skin aging. Ageing Res Rev 1: 705–720. Shelyuto VL, Glyzin VI, Bubon NT. 1972. The flavonoids of Cirsium palustre. Chem Nat Prod 8: 238. 13 Sholichin M, Yamasaki K, Kasai, R, Tanaka O. 1980. C nuclear magnetic resonance of lupane-type triterpenes, lupeol, betulin and betulinic acid. Chem Pharm Bull 28: 1006–1008. Skaltsa H, Lazari D, Constantinidis T. 2000. Flavonoid compounds of Lamyropsis cynaroides. Biochem Syst Ecol 28: 809–811. Stipcevic T, Piljac J, Vanden BD. 2006. Effect of different flavonoids on collagen synthesis in human fibroblasts. Plant Foods Hum Nutr 61: 29–34. Tancred TM, Belch AR, Reiman T, Pilarski LM, Kirshner J. 2009. Altered expression of fibronectin and collagens I and IV in multiple myeloma and monoclonal gammopathy
Copyright © 2014 John Wiley & Sons, Ltd.
of undetermined significance. J Histochem Cytochem 57: 239–247. Tutin TG (Ed.) 1976. Flora Europaea, vol. 4. Cambridge University Press: Cambridge, pp. 241. Unemori EN, Werb Z. 1986. Reorganization of polymerized actin: a possible trigger for induction of procollagenase in fibroblasts cultured in and on collagen gels. J Cell Biol 103: 1021–1031. Williamson G. 2002. The use of flavonoid aglycones in in vitro systems to test biological activities: based on bioavailability data, is this a valid approach? Phytochemistry Rev 1: 215–222. Xiao H-b, L R-h, L G-h, Xiao L, X Y-c, L F-y, Li J, L Y-h, C Q-k, L J-l, Zhan M, Y S-k, Kanwar YS, Sun L. 2012. HSP47 regulates ECM accumulation in renal proximal tubular cells induced by TGF-1 through ERK1/2 and JNK MAPK pathways. Am J Physiol Renal Physiol 303: F757–F765. Zong L, Qu Y, X M-i, Dong Y-w, Lu L-g. 2012. 18α-Glycyrrhetinic acid down-regulates expression of type I and III collagen via TGF-Β1/Smad signaling pathway in human and rat hepatic stellate cells. Int J Med Sci 9: 370–379.
SUPPORTING INFORMATION Additional supporting information may be found in the online version of this article at the publisher’s web site.
Phytother. Res. (2014)
