Genetica 86: 85-97, 1992. © 1992 Kluwer Academic Publishers. Printed in the Netherlands.

The intracisternal A particle derived solo LTR promoter of the rat oncomodulin gene is not present in the mouse gene D. Banville, M. Rotaru & Y. Boie National Research Council of Canada, Biotechnology Research Institute, 6100 Royalmount Avenue, Montreal, Quebec H4P 2R2, Canada Received and accepted 19 March 1992

Key words: Calcium binding protein, intracisternal A particle (IAP), long terminal repeat (LTR), oncomodulin Abstract The rat gene encoding oncomodulin, a small calcium-binding protein related to parvalbumin, is under the control of a solo long terminal repeat (LTR) derived from an endogenous intracisternal A-particle (lAP). This gene was the first example of a mammalian gene regulated in normal cells by a promoter of retroviral origin (see also article by D. Robins and L. Samuelson in this volume). We show here that the oncomodulin LTR is a member of a small subset of sequence related solo LTR elements present in the rat genome and that a full length IAP genome containing LTRs of this type is no longer present in the rat genome. We have assayed the transcriptional activity of the oncomodulin LTR coupled to the human growth hormone gene as a reporter. Transfections in both Hela cells and 293 cells indicate the oncomodulin LTR promoter is sufficient to efficiently initiate transcription. In 293 cells (human embryo kidney, cells transformed with human adenovirus type 5 DNA), the oncomodulin LTR is a strong promoter, capable of bidirectional transcription. Finally, we have determined the structure and the sequence of the mouse oncomodulin gene. Our results suggest that the integration of the IAP particle genome within the rat oncomodulin gene occurred after the rat and the mouse became distinct species.

Introduction Intracisternal-A particles (IAPs) are non-infectious endogenous retroviral elements present in 500 to 1000 copies dispersed in the genome of rodents (for a review, see Kuff & Lueders, 1988). These elements have the overall organisation of infectious retroviruses with 5' and 3' long terminal repeats (LTRs) and coding sequences for the pol and gag genes but they lack the env region and cannot be transmitted from cell to cell. In the mouse and the hamster, IAP sequences represent a class of homogeneous units of approximately 7 kb in length (Mietz et al., 1987) but the rat IAP sequences appear to be much more heterogeneous and share only a limited sequence homology to the mouse IAPs (Lueders & Kuff, 1983). Several studies have demonstrated that at least some of these particles are

still fully functional transposable elements, and many cases of transpositions of an IAP genome resulting in dramatic changes in gene expression have been reported. In some instances, the insertion of an IAP particle resulted in the inactivation of a previously expressed gene as reported for two mutant mouse hybridoma cell lines defective in immunoglobulin kappa light chains production (Kuff et al., 1983a; Hawley, Shulman & Hozumi, 1984). In other cases, transposition of the IAP genome resulted in the activation of a gene located at or near the insertion site such as described for the c-mos oncogene in the plasmacytoma cell line XRPC20 (Canaani et al., 1983; Kuff et al., 1983b; Horowitz et aL, 1984), the interleuldn-3 and the Hox 2.4 genes in the myeloid leukemic cell line WEHI-3B (Ymer et al., 1985, 1986; Kongsuwan, Allen & Adams, 1989; Ben-David et al., 1991) and the in-

86

ATG

/

TAA

t

:'EcoRV :" (-690)

Pst I (-178)

Pst I (32)

.... " ' " " - . .

""-..

, .... " " ' " " - - .

/ I . . i ~

i

30 bp repeats

~

I

I

LTR

~

30 bp repeats

q

2

1

3 Fig. 1. Schematic representation of the rat oncomodulin gene structure. The boxes represent the exons. The black boxes represent the coding sequence. The region containing the first exon and the LTR promoter of the rat oncomodulin gene is enlarged to show the location of the probes used in the screening of the rat library and the Southern analysis of genomic rat DNA. Probe 1 is a 21 mer oligonucleotide whose sequence was complementary to a sequence, underlined in Figure 4, chosen for its high conservation between the oncomodulin LTR and the Syrian hamster LTR (see Banville & Boie, 1989); probe 2 is a 209 bp Pstl fragment whose sequence is shown in Figure 4; probe 3 is an EcoRV-Pstl fragmem of 518 bp containing several co~)ies of a repeated motif of 30 base pairs (Banville & Boie, 1989).

terleukin-6 gene in a mouse plasmacytoma (Blankenstein et al., 1990). Other cases of intracisternalA particle mediated activation of cytokine genes were recently described in a murine myelomonocytic leukemia cell-line WEHI-274 in which the functional IL-3 and GM-CSF mRNAs were generated by splicing of IAP sequences to IL-3 or GMCSF coding sequences (Leslie, Lee & Schrader, 1991). Each case of transposition mentioned above represents a unique event which occurred in a single cell and involves a full length IAP particle. The changes in the genomic organisation of the cell were not transmitted to the descendants of the organism in which the transposition occurred. Therefore these events are considered to have taken place recently. The more ancient transposition of an IAP particle was postulated to account for the structure of the rat gene encoding oncomodulin, a tumour associated calcium binding protein (Banville & Boie, 1989). Indeed, we have shown that the first exon of the rat oncomodulin gene is derived almost entirely from the sequence of an integrated IAP LTR and that transcription of the rat gene is initiated within the endogenous retroviral sequence.

The DNA sequence flanking the LTR showed that no other lAP sequence was present, suggesting that an intramolecular recombination has occurred within the integrated IAP element leaving a single LTR at the oncomodulin locus. In addition, we have shown that this peculiar structural and functional arrangement was not particular to a single cell line, but rather that it was observed in all tissues examined and even in different species of rat. This finding represented the first example of a mammalian gene transcribed in both normal and cancer cells from a promoter of viral origin. A second example of cellular gene expression directed by an lAP LTR has now been reported for a mouse gene expressed in the placenta, the MIPP gene (mouse IAP promoted placenta expressed gene) (Chang-Yeh, Mold & Huang, 1991). These two examples may be isolated 'accidents'. Alternatively, they may be an indication that the process of acquisition of promotor elements derived from the genome of endogenous IAP transposable elements may be more common than previously suspected. In this report, we further characterise the rat oncomodulin LTR. In particular, we show that it belongs to a subset of LTRs present as solitary LTRs

87 in the rat genome. We show that upon transfection into transformed human cells, the oncomodulin LTR is a strong promoter, capable of bidirectional transcription. In addition, we present the structure of the mouse oncomodulin gene suggesting that the transposition of the IAP particle upstream from the oncomodulin sequence occurred after the mouse and the rat became distinct species.

Materials and methods

Genomic libraries The rat LTR clones were isolated from a size selected (18-20 kb) rat liver DNA genomic library in hEMBL3 (Banville & Boie, 1989). The mouse oncomodulin clones were isolated from a library of Balb/C mouse liver DNA in hEMBL3 obtained from Clontech Laboratories, Ca. The probes used in the screening of the rat library are shown in Figure 1. The probe used for screening the mouse library was the rat oncomodulin cDNA (Gillen et al., 1987) which was labelled by the random primer method of Feinberg and Vogelstein (1984). DNA sequencing Genomic DNA fragments were subcloned into the plasmid pTZ18R (Pharmacia) using standard procedures (Sambrook, Fritsch & Maniatis, 1982). DNA sequencing reactions were performed using the dideoxynucleotide method with doublestranded DNA prepared according to Holmes and Quigley (1981), which was denatured with 0.2 M NaOH, 0.2 mM EDTA prior to hybridisation with the sequencing primer essentially as described by Chen and Seeburg (1985). Transfection, RNA extraction and primer extension analysis Human growth hormone transient expression assay plasmids (Selden et aL, 1986) were obtained from the Nichols Institute, Ca. Ten p,g of CsCI gradient purified plasmid DNA was used to transfect Hela cells and 293 cells (Graham et al., 1977) essentially as described in the procedure of Graham and Van der Eb (1973). Twenty four hours posttransfection, total RNA was prepared from the cells by the guanidinium isothiocyanate technique of Chirgwin et aL (1979). Primer extension analyses were performed as described by Devine et al. (1982).

Briefly, 15 ~g of total RNA was hybridised overnight in sealed capillaries with an excess primer at 50°C. The primer was a 21 nucleotide synthetic oligomer whose sequence 5'GCCAGGGCAGGCAGAGCAGGC - was derived from the second exon of the human growth hormone gene (DeNoto, Moore & Goodman, 1981) and which was labelled with 32p using polynucleotide kinase (Pharmacia). The products of the extension reactions were analysed on 7 M urea/8% polyacrylamide denaturing gels.

Results

The rat genome contains a subclass of solo LTRs related to the oncomodulin promoter

The expression of the rat oncomodulin gene is controlled by an element of retroviral origin (Banville & Boie, 1989). Indeed, the sequence of the promoter of the rat oncomodulin gene, together with that of the first exon of the oncomodulin message, possess all the features of a solo LTR and is very similar to that of a Syrian Hamster intracistemal-A particle (IAP) LTR. The structure of the oncomodulin locus in the rat is presented schematically in Figure 1. This arrangement suggested that transposition of a full length IAP element within the oncomodulin locus followed by recombination of the LTRs gave rise to this peculiar gene structure. In order to identify further potentially transposable IAP elements of the type that did transpose upstream from the rat oncomodulin coding sequence, we screened a rat genomic library with an oligonucleotide probe derived from the 5' non-coding sequence of the rat oncomodulin gene (Fig. l, probe 1). Approximately 10 6 phage plaques were screened and several hundred clones hybridised strongly to this probe. Four clones were picked at random and plaque purified. DNA fragments which hybridised to the probe were subcloned and partial nucleotide sequence was determined using the oligonucleotide probe as the sequencing primer. A comparison of the sequences obtained from two such fragments is shown in Figure 2a. Figure 2b shows an alignment of the sequence of one of the two fragments, 6B1, with that of the Syrian Hamster IAP LTR originally observed to share a high degree of homology with the oncomodulin LTR

88

A n

LTR-6BI LTR-7B1

CAA

I0

20

30

•

o

•

TACGCAAGACCTGGTAAATTCC

40

50

o

•

TCACTCAGGGGGACACGTACTGCTGTGGT

CCTAGCCTCCGCCGCGCCAGCCGACTTCCTTTCAGGAAGTTAACTGTGTGCGTATGTGCA 60

70

80

90

i00

o

.

.

•

e

110

LTR-6B1

A CGT

LTR-TB1

AGAGTGCCTCATGCCAGGTCTTTGCCCACTCCGGGGTGTGCCTATGAGATCATGGGTAAG

LTR-6BI LTR-7BI

CATC

TGGCAGCGTTTGGCAGCGACCAGCCTGTGTGTGACATGTCCTAGGTGAG

120

130

140

150

160

170

t

•

o

•

•

•

GATCAGTTTCCTATATAAGGGGTGGTCTTTCCCTCACTTGGGGTCTCCGTATTGTAAGC CGACCAATCAGGTGTGGACGCTGCGCT

AGGGTGTATATAAGCAGCGCCATTCTG

180

190

200

.

o

o

LTR-6B1

TTGTGT

LTR-7B1

TCAGGTCTCTCCTCTTCAAGATGTAATAAACGCTTTGCT

GGGC

TCTCGCTCTCAAGATGCATTAAAGCTTTTTCT

B. 60

70

80

90

LTR-6B1

CGTCATCTGGCAGCGTTTGGCAGCGACCAG

SH 3'LTR

CGTCATCTGGGGTGATGTGCAAACCACCAATCCCGGCTCT

100

110

CCTGTGTGTGACATGTCCTAGGTGAGGAT ACACGTCTCACTCGGAGCT

120

130

140

150

160

•

.

•

o

•

170

LTR-6B1

CAGTTTCCTATATAAGGGGTGGTCTTTCCCTCACTTGGGGTCTCCGTATTGTAAGCTTGT

SH 3'LTR

CCTAGGCTTATATAAGGGGCTGGGTTTCT

*

*

180

***********

*

190

****

•

**********e,

,

,

*****

,

TAGCTTGGGGTCTCCCTCTAAGAAGCTGAT

200

LTR-6B1

GTTCTCGCTCTCAAGATGCATTAAAGCTTT *** ***********************

SH 3'LTR

CATCTATCTCTCAAGATGCATTAAAGCTTT

Fig. 2. (A) Nucleotide sequence comparison of LTR fragments from two rat genomic clones isolated with an oligonucleotide probe derived from the 5' non-coding region of the oncomodulin cDNA (Fig. 1, probe 1). Only the sequence of the LTRs upstream from the region where the primer was derived is presented; - (B) Nucleotide sequence comparison of LTR-6B 1 with part ot~a Syrian Hamster IAP LTR (Ono & Ohishi, 1983).

(Ono & Ohishi, 1983). Over this region of 150 bp, the two sequences share 66% identity, inferring their evolutionary relationship. Comparison of these sequences also illustrates the enormous diversity of sequence between different IAP LTRs in the rat genome. In fact, individual comparisons of these

two sequences, 6B1 and 7B1, with the oncomodulin LTR show only a small degree of similarity (data not shown). To increase the stringency of the search for the oncomodulin LTR complete progenitor IAP particle, we used a restriction fragment of 209 bp con-

89 subcloned from the five clones and parts of their sequences were determined. Three new LTR sequences were thus identified and their nucleotide sequences are compared with the oncomodulin LTR sequence in Figure 4. The DNA sequences upstream and downstream from the LTRs were determined and no other IAP sequence was found flanking the LTRs. Rather, all three were shown to contain a six base pair repeat (different in each case) as was found in the oncomodulin gene, suggesting the new sequences were also solo LTRs. The three new sequences are slightly more similar to one another than to the oncomodulin LTR, but their overall homology with the oncomodulin sequence is striking. The major difference between the three new LTRs and the oncomodulin LTR is the absence of a stretch of 19 bp immediately upstream from the CCAAT box in the latter. The rat oncomodulin LTR is a strong promoter and functions efficiently in reverse orientation Fig. 3. Southern transfer analysis of rat genomic DNA. Ten Ixg of total genomic rat DNA was digested with BamHI (B) or with Pvull (P), electrophoresed on a 1% agarose gel and transfered to a Hybond nylon membrane (Amersham). Panel 1 was hybridised to the oligonucleotide probe 1 (Fig. 1). Panel 2 was hybridised to the oncomodulin LTR probe (Fig. 1, probe 2). Panel 3 was hybridised to a probe derived from the region immediately flanking the oncomodulin LTR (Fig. 1, probe 3).

raining most of the oncomodulin LTR (Fig. 1, probe 2). By Southern analysis of rat genomic DNA digested with BamHI or Pvull (neither of which cut the oncomodulin LTR sequence) four definite bands were identified with this probe (Fig. 3, panel 2) as opposed to the smear obtained with the oligonucleotide probe (Fig. 3, panel 1). Hybridisation of the genomic blot to a probe derived from the 30 base pair repeats (Fig. 1, probe 3), in which the oncomodulin LTR is integrated, identified which of the bands in lane B corresponds to the oncomodulin LTR and also demonstrated that the repeated units of 30 bases are not reiterated elsewhere in the rat genome (Fig. 3, panel 3). Screening our genomic library with the longer probe derived from the oncomodulin LTR genomic fragment (Fig. 1, probe 2) yielded five new clones containing LTR sequences. Genomic fragments containing the region hybridising to the probe were

To further characterise the promoter region of the rat oncomodulin gene, we made several constructions in which various fragments from the genomic clone containing the oncomodulin LTR were fused to the human growth hormone reporter gene in the plasmid p0GH (DeNoto, Moore & Goodman, 1981; Selden et al., 1986). A series of plasmids was made using available restriction sites upstream and within the rat oncomodulin LTR sequence (Fig. 5a). A second set of constructions was made which contained the entire sequence of the LTR as defined by the sequence comprised between the flanking six base pair repeat identified in the oncomodulin gene. This LTR 'cassette', obtained by a polymerase chain reaction (PCR, Saiki et al., 1985; Mullis & Faloona, 1987), was fused to the first exon of the GH reporter gene in both orientations. These plasmids were used to transfect Hela cells and 293 cells, a human cell line which expresses the E1A gene of adenovirus type 5 (Ad-5), constitutively. Control plasmids containing the GH reporter gene with either no promoter (p0GH), the thymidine kinase promoter (pTKGH), or the mouse metallothionein-I promotor (pXGH5), were also transfected in these cells. Transcription from the transfected gene was analyzed 24 h post-transfection by primer extension using a primer derived from the second exon of the GH gene. Primer extension was

90

• Oncomodulin

LTR LTR LTR

2 3 4

PstI

oo.ATAACACGGAGGTAGGTGTTGGCAGCCGCTATTGCTGCAGAGCCGCGCC o..TCATGGCAAGTGGCTG AT G ...GATGCAGGTACCTGTG A C C o..TCACTAAGAAAAGATC A

..... TTA TCGTC T A

.....

Oneomodulin LTR 2 LTR 3 LTR 4

AA-GATGGCGCTGCCTGT--GTGAGTCAGCAAAACCTGAAGAGCAGCAACACGCATGTGC

Oncomodulin

CTACTTGTCATGGCCTACGCCCGAGGCATG A C A C A A

LTR LTR LTR

2 3 4

Oncomodulin

LTR LTR LTR

2 3 4

Oncomodulin LTR 2 LTR 3 LTR 4

Oncomodulin

LTR LTR LTR

2 3 4

A -

-

GC GC GCA

C C C

CG CG CG

C C C

....... TGCACCAATCA CTAATTGAGTATAGCACTG CTAATTGAGTATAGCACTG CTAATTGAGTATAGCACTG

GGTGGAGACACGAGTCTTCCAAGCGTACATAAGCCACACTCTTTTCTCAGTCGGGGTTCC T G T T G A

T

G

PstI CCTTCTCACAAGAGCTGAACAATAAAGGCGTGACTGCAGAAGAATCCTGGTGTTCCAAGT T T TA T

CT

T

GC

T

TA

G

T T

TA

G

CGTTCTTGCCGGCGAGACCACCGTGCGGGACAGGTAGGGTTATCACAT... G C TGGCTGGACTTGAATT... G A C CCTGTGGAGTCCAGGA... A C AAGATCCGTTGACCTG...

Fig. 4. Nucleotidesequencecomparisonof three LTR sequencesclosely related to the oncomodulinLTR. The 6 bp direct repeats of rat

DNA flanking the LTRsare underlined. The arrow heads above the 3 bp inverted repeat in the oncomodulinsequenceindicate the limits of the LTRs. Blank spaces under the oncomodulinLTR indicate sequenceidentity with the three new LTRs. The sequence complementary to the 21mer oligonucleotideused as probe 1 (see Fig. 1) is also underlined.

used rather than measurement of the growth hormone in the medium because, in addition to the information on the amount of transcripts present in the cells, this procedure gives information on the location of the start of transcription of the transfected gene. The results of this analysis, presented in Figure 5b, indicate that the LTR, alone or with up to 1.3 kb of upstream sequences, functions in both Hela cells and 293 cells but that the level of transcription is much higher in the latter. In addition it

shows that in human cells, transcription of the gene starts within the LTR at the same position as that observed previously in rat placenta and hepatoma cells. In Hela cells, the presence of a full LTR or a truncated LTR containing only 14 nucleotides upstream from the CCAAT box did not appreciably influence the level of transcription from the transfected gene. This low level of transcription, only slightly higher than a control plasmid (pXGH5) in which the mouse metallothionein-I promotor is

91 driving the growth hormone gene, was also observed in 293 cells with the truncated LTR promotor (construction 1). However, the full LTR, alone or with up to 1.3 kb upstream sequence, was found to promote very strongly transcription of the transfected growth hormone gene in these cells (constructions A, 2 and 3). The extension product obtained with construction A is slightly longer than

the products obtained with constructions 1, 2 and 3, due to the presence of an additional 22 base pairs at the junction of the full LTR and the growth hormone gene. Finally, even when inserted in opposite orientation relative to the GH gene (Fig. 5b, construction B), the LTR 'cassette' was observed to function efficiently as a promoter but transcription was found to start at several positions within the

i!iiii~iii~!iiiii!!i~iiiii~i~ iiiiiiiiiiiii!!!iiiiiiiiiii!~ iliiiiiiiiii!!!iiiiiii!iiiiii iiiiiiiiii!iiiiiiiiiiiiiiiii! iiiiiiiiii!iiiiiiiiiiii!!!!!i! iiiiiiii!iiiiiiiiiiiiiiiiii~i: :::::::::::::::::::::::::::::: !iiiiiiiiiiiiiiiiiiiiiiiiiiii iiiiii!iiiiiiiiiiiiiiiiiiiiii iiiiiiiiiiiiiiiiiiiiiiiiiiiii iiiiiiiiiiiiiiiiiiiiiiiiiiiii iiiiiiiiiiiiiii!iiiiiiiiiiiii iiiiiiiiiiiiiiiiiiiiiiiiiiiii !iiiiiiiiiiiiiii!iiiiiiiiiiii iiiiiiii!iiiiiiiiiiiiiiiiiiii i:i:i:i:i:i:i:i:i:i:i:i:i:!:! iiiiii!iiiiiiiiiiiiiiiiiiiiii iiiiiiiiiiiiiiiiiiiiiiiiiiiii iiiiiiiiiiiiiiiiiiiiiiiiiiiii iiiiiiiiiiiiiiiiiiiiiiiiiiiii iiii!iiiiiiiiiiiii!ii;ii!iiii iiiiiiiiiiiiiiiiiiiiiiiiiiiii i:i:i:i:i:i:i:i:i:i:i:i:i:!:! iiiiiiiiiiiiiiiiiiiiiiiiiiiii iiiiiiiiiiiiiiiiiiiiiiiiiiiii iiiiiiiiiiiiiiiiiiiiiiiiiiiii iiiiiiiiiiiiiiiiiiiiiiiiiiiii

iiiiiiiiiiiiiiii;iiiiii;iiiii iiiiiiiiiiiiiiiiiiiiiiiiiiiii )iiiiiii)iiiiiiiiiiiiiiiiiiii ii!iiiiiiiiiiiiiiiiiiiiiiiiii iiiiiiii)ii)iiiiiiiiiiiii)iii iiiiiiiiiiiiiiiiiiiiiiiii)iii iiiiiiiiiiiiiiiiiiiiiiiiiiiii: iiiiiiiiiiiiiiiiiiiiiiiiiiiii iiiiii)iiiiiiiiiiiiiiiiiiiiii iiiiiiiiiiiiiii)iiiiiiiiiiiii ii;iiiiiiii)i)iiiiiiiiiiiiiii !iiiiiiiiiiiiiiiii)iiiiiiiiii :::::::::::::::::::::::::::::

Fig. 5. Transcriptional activity of the rat oncomodulin LTR. (A) Schematic representation of the 5' region of the rat oncomodulin gene showing the fragments used in the construction of the various plasmids containing the human growth hormone gene which were used for the transfection experiments. The arrowhead under the second exon of the human growth hormone gene shows the position of the oligonucleotide sequence used in the primer extension analyses; - 03) Primer extension analyses of RNA from transfected Hela and 293 cells. The plasmids used in the transfections analysed in lanes 1, 2, 3, A and B are those depicted in Figure 5A. The letters X, T and O refer respectively to the following plasmids: pXGH5, pTKGH and pOGH described in the text. The marker (M) is a Hinfl digest of pAT153.

92 LTR, presumably due to the lack of TATA and CCAAT boxes in proper positions relative to the transcription starts. Under our assay conditions, the control plasmid pTKGH in which the HSV thymidine kinase promoter is driving the growth hormone gene did not produce a detectable amount of transcripts in either Hela cells or 293 cells.

only slightly between the rat and the mouse genes and the nucleotide sequences of the coding regions of the two genes are highly conserved such that the two encoded proteins are 96% identical. A segment of high homology between the two genes is found in the region where the IAP LTR is located in the rat gene. Indeed, the DNA sequence of this region, composed of 30 base pair segments repeated 37 times in the rat gene, is highly conserved in the mouse genome with 26 nucleotide residues out of 30 being almost invariant. However, the number of repeated units is different in the mouse gene, where the 30 bases are directly repeated 28 times without interruption. A search within more than 10 kb of DNA upstream from the coding sequence of the mouse gene did not reveal the presence of IAP sequence.

The mouse oncomodulin gene does not contain an LTR promoter

In order to determine whether the transposition of the IAP LTR upstream from the oncomodulin gene occurred before the mouse and the rat became distinct species, the gene was isolated from a mouse genomic DNA library using the rat cDNA probe (Gillen et aL, 1987). Five overlapping clones coveting approximately 25 kb at the oncomodulin locus were obtained. The structure of the mouse gene as deduced from these clones is presented schematically in Figure 6a. The nucleotide sequence of the coding region of the mouse oncomodulin gene was determined and was shown to be interrupted by three introns located in the same positions as in the rat gene (Fig. 6b). The size of the introns differs

Discussion Analysis of the structural and functional organisation of the gene encoding the tumour associated calcium binding protein, oncomodulin, has shown that a solo LTR of IAP origin is the promoter of the

A ATG

TAA

I,

mum

k Hind III

I

I

I

I II

I

I

I

I

I

I I 5

I

BamHI

I I

I I I

I

I

I

I

EcoRI

I

I kb

10

Fig. 6. (A) Schematicrepresentationof the mouseoncomodulingene.The blackboxesrepresentthe fourcodingexons of mouse gene.

The arrowheadsindicatethe positionof a region of the mouseDNA homologousto the regionof the rat gene in whichthe IAP LTRis inserted; - (B) Nucleotidesequenceof parts of the mouseoncomodulinlocus.The sequenceof the firstof the 30 bp repeatsis underlined. The entiresequenceof the codingregionof the mousegeneis presentedin capitalletters.The deducedproteinsequenceis shownbelow. The ag and gt dinucleotidesflankingthe exons and the polyadenylationsignal,AATAAA,are underlined.

93

B qcaqqqttagtacatqcaqataccatqqaqgcaggcttagtacatgcagataccatggaggca gggttagtacatgcagacaccatggaggcagggttagtgcatgcagataccatggaggcaggg ttagtacatgcagataccatggaggcagggttagtgcatgcagataccatggaggcagggtta g t a c a t g c a g a t a c c a t g g a g g c a g g g t t a g t a c a t g c a g a t a c c a t g . . . (5.0 kb)... gtcaccgtggctcacatcttgtttcctctgttcggccaggtagAAAA/ATG/AGC/ATC/ACG Met Ser Ile Thr

GAC/ATT/CTG/AGC/GCT/GAT/GAC/ATT/GCA/GCG/GCC/CTG/CAG/GAA/TGC/CAA Asp Ile Leu Ser Ala Asp Asp Ile Ala Ala Ala Leu Gln GIu Cys Gln G q t g a c t g g g g a c t g g a g g a g c a g g c c a t g g t g g c a c t g g g g c a g a a g a . . . ( 1 . 1 kb)... A aatgtgacccactgacctcggcataacctagtctctgttcttta_~qAC/CCA/GAC/ACC/TTT sp Pro Asp Thr Phe

GAAICCAICAAIAAGITTCITTCICAGIACAITCGIGGC/CTC/TCC/AAG/ATG/TCT/GCC GIu Pro Gln Lys Phe Phe Gln Thr Ser Gly Leu Ser Lys Met Ser Ala

AGC/CAA/TTG/AAG/GAT/ATC/TTC/CAG/TTT/ATA/GAC/AAC/GAC/CAG/AGT/GGA Set Gln Leu Lys Asp Ile Phe Gln Phe Ile Asp Asn Asp Gln Ser Gly

TAC/CTG/GAT/GAA/GAT/GAG/CTC/AAqtaagctgtgtattgagcaacaaaacgtggatg Tyr Leu Asp Glu Asp Glu Leu Ly ggtgggggtagggg...(400 bp}...agagagcacaaggtctttcaggagcttgccaccag

ctttttgtggtgctgta__gG/TAT/TTC/CTA/CAG/AGG/TTC/CAG/AGC/GAC/GCT/AGA s Tyr Phe Leu Gln Arg Phe Gln Ser Asp Ala Arg

GAA/CTG/ACC/GAG/TCA/GAG/ACC/AAG/TCC/TTG/ATG/GAT/GCA/GCG/GAC/AAC GIu Leu Thr Glu Set Glu Thr Lys Ser Leu Met Asp Ala Ala Asp ASh

GAT/GGA/GAT/GGG/AAG/ATT/GGG/GCT/GAT/Gqtaggtctggtccgccaccgtgctgt Asp Gly Asp Gly Lys Ile Gly Ala Asp G ctaagacacacagacatagggg...(3.5 kb)...ccctgagccacctgcactgagtctgtc

ctctcatcttctattcta__gAA/TTC/CAG/GAA/ATG/GTG/CAT/TCT/TAAagcccaagtc lu Phe Gln Glu Met Val His Ser ttcagaagaaagagaggaaggggcattctgccagaaggattcaaaagcectgggactgggatg ctccccaccctaccccgaactaatttaccaagtccccctgaagctcttctgcaacgtgctcct tgcttgagggaatgcaatggtttgtggctcttccttctttggtggtggtggataggtcctgat gacttctgtaagcccccatctggcagacaaggcctttaaaaatcacccaataaaataatttct catcattggctgatgtatgggtgttttagttacttgtctccttgctgtaacaaaatgtacaac aaaagcaacttaaggaggctgg Fig. 6. Continued.

rat gene and that most of the 5' non-coding sequence of the rat oncomodulin messenger RNA is derived from the 3' sequence of this LTR (Banville & Boie, 1989). In an attempt to characterise a full length IAP particle from which the oncomodulin LTR was derived, we screened a rat genomic li-

brary with various probes from the oncomodulin gene. The first probe used was an oligonucleotide (21 mer) whose sequence was derived from the 5' non-coding region of the rat oncomodulin cDNA (Gillen et al., 1987). Even at high stringency, this probe hybridised to hundreds of genomic clones,

94 indicating that related sequences are present in high numbers in the rat genome, presumably within the many IAP LTRs. The cloning and the nucleotide sequence determination of two random clones detected with this probe illustrate the large variation in the sequence of the different IAP LTRs in the rat, as was suggested by the hybridisation studies of Lueders and Kuff (1983). A second probe consisting of a restriction fragment of 209 bp derived from the U3 and R region of the oncomodulin LTR allowed a more stringent hybridisation to rat DNA and detected a much smaller subset of sequences. Indeed, genomic Southern analysis of rat DNA using this probe detected four major fragments, one of which was shown to correspond to the oncomodulin gene. From five genomic clones, three new sequences were identified suggesting that we may have cloned all the related sequences from the rat genome. Nucleotide sequence determination of the region hybridising to the probe revealed that all three sequences were closely similar to one another and that in addition all three were solitary LTRs. The sequence of one of these LTRs was identical (except for one nucleotide difference) to the H122 LTR isolated from a rat genomic clone by Further, Heizmann and Berchtold (1989). At present, it is not known whether the three new solo LTRs identified here are transcriptionally active in the rat. However, our findings suggest that a copy of the complete IAP genome of the type which has transposed within the oncomodulin gene is no longer present in the rat genome. Intracisternal A particle LTRs from the mouse have been shown to function as promoters when introduced into eukaryotic cells by transfection (Lueders et al., 1984; Christy & Huang, 1988). To test the ability of the oncomodulin LTR to function as a promoter in human cells, we prepared a series of constructions placing the LTR sequence, alone or with upstream sequence from the oncomodulin locus, upstream from the coding sequence of the human growth hormone gene as a reporter. These plasmids were transfected into Hela cells and 293 cells, a human embryonal kidney cell line which expresses constitutively the E 1A gene from Adenovirus type 5 (Ad-5) (Graham et al., 1977). These studies showed that (1) the rat oncomodulin LTR can function as a promoter in transformed human cells and (2) that, in the case of the 293 cells, it is a strong promoter indeed, capable of bidirectional

transcription. Previous experiments have indicated that IAP LTRs may be the target for transactivation by oncogene products such as the myc gene product and the adenovirus early 1A gene product (E1A) (Luria & Horowitz, 1986). The involvement of the E 1A gene product in the activation of transcription from the oncomodulin LTR promoter in 293 cells has not been established in our experiments, but our transfection studies have shown conclusively that the oncomodulin LTR alone contains all the required regulatory signals for promotion and initiation of transcription in mammalian cells. The structure of the mouse oncomodulin gene, as determined from several overlapping clones isolated from a mouse genomic DNA library, is very similar to that of the rat gene. The protein encoded by the mouse gene differs from the rat protein at four positions only, thus the two proteins are more than 96% identical. The coding region of the mouse gene is interrupted by three introns located in positions identical to those in the rat gene. Nucleotide sequence analysis of the region of the mouse gene upstream from the ATG initiator codon revealed the presence of numerous highly repeated Alu-like sequences (our unpublished observation). A region located approximately 4 kb upstream from the ATG initiation codon in the mouse was found to be highly similar to the region of the rat gene in which the IAP LTR is inserted. In the rat gene, this region is composed of a 30 base pair segment repeated several times (20 times upstream from the LTR and 17 times downstream). In the mouse, not only is the sequence of this 30 base segment very similar to the rat sequence (90% similarity), but it is similarly repeated (28 times). However, unlike the rat oncomodulin locus, the mouse repeated sequences are not interrupted. It is intriguing that, as demonstrated by our genomic Southern analysis, these sequences are present at a single position in the rat genome. The significance (if any) of this series of repeated segments in the regulation of the mouse and rat oncomodulin g~nes is unknown. Analysis of the human oncomodulin gene locus revealed that no such repeated sequences are present in the human genome (our unpublished observation), suggesting that they may not be involved in the regulation of the oncomodulin gene. A search within more than 8 kb of DNA upstream from the start of the coding region of the mouse gene failed to identify IAP related sequences. We concluded that the

95 integration of the IAP element within the rat oncomodulin gene occurred after the mouse and the rat became distinct species. The nature of the mouse oncomodulin gene promoter as well as the sequence of the 5' non-coding region of the oncomodulin message have not been defined yet. Transposition of a strong promoter such as an lAP LTR near a functional gene is expected to be deleterious to the organism if it allows inappropriate expression of a gene in the 'wrong' tissue and/or at the 'wrong' time, or if it prevents its normal expression by interfering with the regulatory elements of the gene. Indeed most cases of transposition of IAP particles which have been reported were detected precisely because of the drastic changes in the normal pattern of expression of the affected gene. However, analysis of the rat oncomodulin gene organisation demonstrated for the first time that sequences derived from intracisternal-A type endogenous transposable elements can be used for the 'normal' regulation of a mammalian gene. Indeed, although quantitatively different, the pattern of expression of the oncomodulin gene is not qualitatively different in the rat, the mouse, and in human where the major site of expression in normal cells is the placenta (MacManus et al., 1982; MacManus, Whitfield & Stewart, 1984; Brewer & MacManus, 1985, 1987; MacManus, Brewer & Banville, 1990). We postulate that the insertion of the IAP particle within the rat gene and the subsequent utilisation of the LTR element as the promoter of the oncomodulin gene was 'allowed' to happen only because the rat IAP LTR is a poor promoter in normal cells except for the placenta. This conclusion is in agreement with the results of Djaffer et al. (1990) who reported that rat lAP related transcripts are poorly expressed in normal rat tissues with the exception of the placenta. Whether the presence of a strong promoter in the oncomodulin gene confers any evolutionary advantage to the rat species is not clear at this point. The presence of large amounts of the oncomodulin protein in cells in culture, however, does not results in any obvious phenotypic change (Mes-Masson et al., 1990). Though the presence of an LTR derived from an IAP particle within the rat oncomodulin gene may have been considered as a curious accident of 'nature', the recent identification of a second mammalian gene, the MIPP (mouse IAP promoted placenta

expressed gene) (Chang-Yeh, Mold & Huang, 1991) similarly controlled by an IAP LTR, suggests that this phenomenon may be more frequent than initially suspected. The ability of transposable elements to alter gene regulation without destroying gene function is not restricted to IAPs. Indeed, numerous cases have now been reported where the expression of cellular genes was affected by the insertion of a retroviral sequence other than lAP elements. Thus, a transposed element related to the mouse VL30s has conferred androgen sensitivity on the adjacent mouse sex-limited protein gene, a duplicated fourth component of complement C4 gene (Stavenhagen & Robins, 1988). A second example was provided by the work of Emi et al. (1988) and Samuelson et al. (1988, 1990), who showed that the insertion of human endogenous retroviruses belonging to the 4-1 family into the various members of the amylase gene family may be responsible for the differential tissue specific expression of the human salivary and pancreatic amylase genes. The identification of these transposition events was made possible by the fact that the transposed sequences still share a high degree of similarity to known retroviral sequences. This is most likely due to the relatively recent occurrence of the transpositions as suggested, for example, by the finding that the insertion of an IAP LTR in the oncomodulin gene occurred after the mouse and the rat became distinct species. More ancient transpositions may now be difficult to detect as the sequences may have slowly been altered by mutations until only the regulatory elements were left intact. However, the ancient widespread transposition of retroviral elements such as lAP particles, followed by recombination of the LTRs, leaving promoter 'cassettes' in the genome of mammalian cells is a reasonable hypothesis which could account for the relative homogeneity in the promoter regions of many very different eukaryotic genes.

References Banville, D. & Y. Boie, 1989. Retroviral long terminal repeat is the promoter of the gene encoding the tumor-associated calcium-binding protein oncomodulin in the rat. J. Mol. Biol. 207:481-490. Brewer, L. M. & J. P. MacManus, 1985. Localisation and synthesis of the tumor protein oncomodulin in extraembryonic

96 tissues of the fetal rat. Devl. Biol. 112: 49-58. Brewer, L. M. & J. P. MacManus, 1987. Detection of oncomodulin, an oncodevelopmental protein in human placenta and choriocarcinoma cell lines. Placenta 8:351-363. Ben-David, L. D. Aberdam, L. Sachs & C. Blatt, 1991. A deletion and a rearrangement distinguish between the intracisternal A-particle of Hox 2.4 and that of interleukin-3 in the same leukemia cells. Virology 182: 382-387. Blankenstein, T., Z. Qin, W. Li & T. Diamantstein, 1990. DNA rearrangement and constitutive expression of the interleukin6 gene in a mouse plasmacytoma. J. Exp. Med. 171: 965970. Canaani, E., O. Dreazen, A. Klar, G. Rechavi, D. Ram, J. B. Cohen & D. Givol, 1983. Activation of the c - m o s oncogene in a mouse plasmacytoma by insertion of an endogenous intracisternal A-particle genome. Proc. Natl. Acad. Sci. USA 80:7118-7122. Chang-Yeh, A., D. E. Mold & R. C. C. Huang, 1991. Identification of a novel murine IAP-promoted placenta-expressed gene. Nucleic Acids Res. 19: 3667-3672. Chert, E. Y. & P. H. Seeburg, 1985. Supercoiling sequencing: a fast and simple method for sequencing plasmid DNA. DNA 4: 165-170. Chirgwin, J. M., A. E. Przybyla, R. J. MacDonald & W. J. Rutter, 1979. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 18: 5294-5299. Christy, R, J. & R. C. C. Huang, 1988. Functional analysis of the long terminal repeats of intracisternal A-particle genes: sequences within the U3 region determine both the efficiency and direction of promoter activity. Mol. Cell. Biol. 8: 10931102. DeNoto, F. M., D. D. Moore & H. M. Goodman, 1981. Human growth hormone DNA sequence and mRNA structure: possible alternative splicing. Nucleic Acids Res. 9: 3719-~730. Devine, J. M., A. S. Tsang & J. G. Williams, 1982. Differential expression of the members of the discoidin I multigene family during growth and development of Dictyostelium discoideum. Cell 28: 793-800. Djaffar, I., L. Dianoux, S. Leibovich, L. Kaplan, R. EmanoilRavier & J. Peries, 1990. Detection oflAP related transcripts in normal and transformed rat cells. Biochem. Biophys. Res. Commun. 169: 222-231. Emi, M., A. Horii, N. Tomita, T. Nishide, M. Ogawa, T. Mori & K. Matsubara, 1988. Overlapping two genes in human DNA: a salivary amylase gene overlaps with a gamma actin pseudogene that carries an integrated human endogenous retroviral DNA. Gene 62: 229-235. Feinberg, A, P. & B. Vogelstein, 1984. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 137: 266-267. Furter, C. S., C. W. Heizmann & M. W. Berchtold, 1989. Isolation and analysis of a rat genomic clone containing a long terminal repeat with high similarity to the oncomodulin mRNA leader sequence. J. Biol. Chem. 264: 18276-18279. Gillen, M., D. Banville, R. G. Rutledge, S. Narang, V. L. Seligy, J. E Whitfield & J. P. MacManus, 1987. A complete complementary DNA for the oncodevelopmental calcium-binding protein, oncomodulin. J. Biol. Chem. 262:5308-5312. Graham, E L. & A. J. Van tier Eb, 1973. A new technique for the

assay of infectivity of human adenovirus 5 DNA. Virol. 52: 456-467. Graham, E L., J. Smiley, W. C. Russell & R. Nairn, 1977. Characteristics of a human cell line transformed by DNA from human adenovirus type 5. J. Gen. Virol. 36: 59-74. Hawley, R. G., M. J. Shulman & N. Hozumi, 1984. Transposition of two different intracisternal A-particle elements into an immunoglobulin kappa-chain gene. Mol. Cell. Biol. 4: 2565-2572. Holmes D. S. & M. Quigley, 1981. A rapid boiling method for the preparation of bacterial plasmids. Anal. Biochem. 114: 1934-197. Horowitz, M., S. Luria, G. Rechavi & D. Givol, 1984. Mechanism of activation of the mouse c - m o s oncogene by the LTR of an intracistemal A-particle gene. EMBO J, 3: 2937-2943. Kongsuwan, K., J. Allen & J. M. Adams, 1989. Expression of Hox-2.4 homeobox gene directed by proviral insertion in a myeloid leukemia. Nucleic Acids Res. 17: 1881-1892. Kuff, E. L., A. Feenstra, K. K. Lueders, L. Smith, R. Haroley, N. Hozumi & M. Shulman, 1983a. Intracistemal A-particle genes as movable elements in the mouse genome. Proc. Natl. Acad. Sci. USA 80: 1992-1996, Kuff, E. L., A. Feenstra, K. K. Lueders, G. Rechavi, D. Givol & E. Canaani, 1983b. Homology between an endogenous viral LTR and sequences inserted in an activated cellular oncogene. Nature (London) 302: 547-548. Kuff, E. L. & K. K. Lueders, 1988. The intracisternal A-particle gene family: structure and functional aspects. Adv. Cancer Res. 51: 183-276. Leslie, K. B., E Lee & J. W. Schrader, 1991. Intracistemal A-type particle mediated activations of cytokine genes in a murine myelomonocytic leukemia: generation of functional cytokine mRNAs by retroviral splicing events. Mol. Cell. Biol. 11: 5562-5570. Lueders, K. K. & E. L. Kuff, 1983. Comparison of the sequence organisation of related retrovirus-like multigene families in three evolutionary distant rodent genomes. Nucleic Acids Res. 11: 4391-4408. Lueders, K. K., J. W. Fewell, E. L. Kuff & T. Koch, 1984. The long terminal repeat of an endogenous intracisternal A-particle gene functions as a promoter when introduced into eucaryotic cells by transfection. Mol. Cell. Biol. 4: 2128-2135. Luria, S. & M. Horowitz, 1986. The long terminal repeat of the intracisternal A-particle as a target for transposition by oncogene products. J. Virol. 57: 998-1003. MacManus, J. P., J. E Whitfield, A. L. Boyton, J. P. Durkin & S. H. H. Swieranga, 1982. Oncomodulin - A widely distributed, tumour-specific calcium-binding protein. Oncodevl. Biol. Med. 3: 79-90. MacManus, J. P., J. F. Whitfield & D. J. Stewart, 1984. The presence in human tumours of a M, 11,700 calcium-binding protein similar to rodent oncomodulin. Cancer Lett. 21: 309315. MacManus, J. P., L. M. Brewer & D. Banville, 1990. Oncomodulin in normal and transformed cells, pp. 107-110 in Calcium Binding Protein in Normal and Transformed Cells, edited by R. Pochet, D. E. M. Lawson and C. W. Heizmann. Plenum Press. Mes-Masson, A. M., S. Masson, D. Banville & L. Chalifour, 1989. Expression of oncomodulin does not lead to transfor-

97 marion or immortalisation of mammalian cells in vitro. J. Cell. Sci. 94: 517-525. Mietz, J. A., Z. Grossman, K. K. Lueders & E. L. Kuff, 1987. Nucleotide sequence of a complete mouse intracisternal Aparticle genome: relationship to known aspects of particle assembly and function. J. Virol. 61: 3020-3029. Mullis, K. B. & E A, Faloona, 1987. Specific synthesis of cDNA in vitro via a polymerase-catalysed chain reaction. Methods Enzymol. 155: 335-350. Ono. M. & H. Ohishi, 1983. Long terminal repeat sequences of intracistemal A-particle genes in the Syrian hamster genome: identification of tRNA Phe as a putative primer tRNA Nucleic Acids Res. 11: 7169-7179. Saiki, R. K., S. Scharf, E A. Faloona, K. B. Mullis, G. T. Horn, H. A. Erlich & N. Amheim, 1985. Enzymatic amplification of [3-globin genomic sequences and restriction site analysis for diagnostic of sickle cell anemia. Science 230:1350-1354. Sambrook, J., E. E Fritsch & T. Maniatis, 1982. Molecular cloning - A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.

Samuelson, L. C,, K. Wiebauer, C. M. Snow & M. H. Meisler, 1990. Retroviral and pseudogene insertion sites reveal the lineage of human salivary and pancreatic amylase genes from a single during primate evolution. Mol. Cell. Biol. 10: 2513-2520, Selden, R. E, K. Burke Howie, M. E. Rowe, H. M. Goodman & D. D. Moore, 1986. Human growth hormone as a reporter gene in regulation studies employing transient gene expression. Mol. Cell Biol. 6: 3173-3179. Stavenhagen, J. B. & D. M. Robins, 1988. An ancient provirus has imposed androgen regulation on the adjacent mouse sex-limited protein gene. Cell 55: 247-254. Ymer, S., W. Q. Tucker, C. J. Sanderson, A. J. Hapel, H. D. Campbell & I. J. Young, 1985. Constitutive synthesis of interleukin-3 by leukemia cell line WEHI-3B is due to retroviral insertion near the gene. Nature (London) 317: 255-258. Ymer, S., W. Q. Tucker, H. D. Campbell & I. G. Young, 1986. Nucleotide sequence of the intracisternal A-particle genome inserted 5' to the interleukin-3 gene of the leukemia cell line WEHI-3B. Nucleic Acids Res. 14: 5901-5918.