Int Arch Allergy Appl Immunol 1991;94:202-209
The Molecular Biology of Eosinophil Granule Proteins1 Kimm J. Hamann. Robert L. Barker. Rosa M. Ten. Gerald J. Gleich Departments of Immunology and Medicine, Mayo Clinic and Foundation, Rochester, Minn., USA
Abstract. Here, we briefly review the molecular biology of the human eosinophil granule proteins, major ba sic protein (MBP), eosinophil peroxidase (EPO), eosinophil cationic protein (ECP) and eosinophil-derived neurotoxin (EDN). The nucleotide sequence of MBP cDNA indicates that MBP is translated as a 25.2-kilodalton preproprotein; the mpb gene consists of 6 exons and 5 introns spanning 3.3 kilobases (kb). The ~ 2 .1-kb nu cleotide sequence of EPO cDNA corresponds to a prosequence, light chain and heavy chain in that order; simi larities to other peroxidases suggest the existence of a multigene family. EDN and ECP cDNAs and genes are remarkably similar throughout, suggesting a relatively recent divergence. Promoter regions of the 4 genes show interesting differences and similarities which may be related to differential gene regulation.
major basic protein (MBP), eosinophil peroxidase (EPO), eosinophil cationic protein (ECP) and eosino phil-derived neurotoxin (EDN), and speculate con cerning aspects of regulation of their genes.
For many years following Paul Ehrlich’s 1897 dis covery and naming of the eosinophil, this granulocyte remained in relative obscurity. However, during the past two decades or so, there has been a rebirth of interest in the eosinophil [1], especially since its impli cation as an effector cell in the immune response to helminths and the accumulation of evidence for its in imical role in bronchial asthma [see ref. 2 and 3 for recent reviews]. Most of the recent advances in our understanding of the eosinophil have come from in vitro studies of functional characteristics and features of eosinophil activation and in vivo studies of the pathological association of eosinophils with various disease states. In the past few years we have begun attempts to understand the molecular biology of the eosinophil in order to dissect the mechanisms involved in its role as an effector cell in more detail. Here, we briefly review our present knowledge of the molecular biology of the major human eosinophil granule proteins, namely,
When Paul Ehrlich stained smears of human peripheral-blood cells with aniline dyes, he observed that certain leukocytes stained intensely with acid dyes such as eosin. it was this avidity of eosin for the leukocyte granules, of course, which led him to name these cells eosinophils. It is the distinctive specific or secondary granules in mammalian eosinophils which stain avidly with acid dyes; electron microscopy re veals them to be composed of an electron-dense core and a more electron-lucent matrix. Many properties of the four principal basic proteins of the granules are well characterized (table I), but our understanding of the molecular biology of these proteins is in its in fancy.
This work was supported in part by grants from the National Institutes of Health (AI09728 and AI07047) and from the Mayo Foundation.
Major Basic Protein The electron-dense crystalloid core of the eosino phil specific granule is composed almost entirely of
Eosinophil Granule Proteins
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/30/2018 11:27:41 PM
Introduction
The Molecular Biology of Eosinophil Granule Proteins
203
Table I. Some properties of human eosinophil granule proteins and their cDN As and genes Protein Site
Molecular weight X 10'5
Pi“
Molecular biology
Activities
cDNA
gene
chromosome
MBP
core
14
10.9
( 1) potent helminthotoxin and cytotoxin; (2) causes histamine release from basophils and rat mast cells: (3) neutralizes heparin; (4) bactericidal, and (5) causes bronchial constriction and hyperreactivity
-900 NT (preproMBP)
3.3 kb 5 introns
11
ECP
matrix 21
10.8
(1) potent helminthotoxin; (2) potent neurotoxin; (3) inhibits cultures of peripheral-blood lymphocytes; (4) causes histamine release from rat mast cells; (5) weak RNase activity, and (6) bactericidal
-725 NT (pre-ECP)
-1.2 kb 1 intron in UTR
14
EDN
matrix
18-19
8.9
( 1) potent neurotoxin; (2) inhibits cultures of pe ripheral-blood lymphocytes; (3) potent RNase activity, and (4) weak helminthotoxin
-725 NT (pre-EDN)
-1.2 kb 1 intron in UTR
14
EPO
matrix 71-77
10.8
in the presence of H;0 2 + halide: (1) kills micro organisms and tumor cells; (2) causes histamine release from rat mast cells; (3) inactivates leukotrienes; (4) can kill Brugia microfilariae and damage re spiratory epithelium even in absence of H;0 2, and (5) may contribute to bronchial hyperreactivity
-2.500 NT (2,!06-NT ORF)
12 kb 17 11 introns (preliminary observation)
MBP. The mature protein consists of a single poly peptide chain of 117 amino acids, rich in arginine, and having a molecular weight of 13.8 kilodaltons (kDa) and a calculated isoelectric point (pi) of 10.9 [4-6]. MBP is a potent toxin for helminths and mam malian cells in vitro and has been localized on dam aged helminths and tissues in hypersensitivity dis eases including bronchial asthma [1-3]. Surface charge interactions of MBP with cell membranes may result in damage from increased permeability without the concurrent formation of transmembrane channels such as those formed by polymerized C9 [7], The cat ionic charge of MBP causes it to bind avidly to the an ionic surface of target cells whereupon the apolar resi dues may insert into and perturb the lipid milieu [4], Analysis of cDNA representing human MBP mRNA from the promyelocytic cell line HL-60 indicates that MBP is translated as a preproprotein with an acidic pro-portion [5], The longest open reading frame of nucleotide sequence codes for a protein of 222 amino acids including a 15-amino-acid putative signal pep tide typical of secreted proteins. Following the signal
peptide is the ‘pro-sequence’ of 90 amino acids domi nated by glutamic and aspartic acids. The terminal deduced sequence of 117 amino acids is identical to the sequence of mature, toxic, MBP determined by Wasmoen et al. [4], The calculated pi of pro-MBP (207 amino acids) is 6.2, suggesting that pro-MBP is translated as a nontoxic precursor to mask the toxic effects of the strongly cationic mature MBP and to protect the eosinophil from damage while the mole cule is processed through the endoplasmic reticulum to its sequestered site in the granule core [5]. There are several possible mechanisms for the processing of pro-MBP. Based on several experimental observa tions, such as those suggesting decreasing granule ba sophilia (i.e. increasing cationicity) as eosinophils de velop from bone marrow myelocytes to mature granu locytes [8] and the lack of evidence for the existence of an intact pro-form of M BP in mature granules [9, 10], it is likely that, after transport through the endoplas mic reticulum, pro-MBP is temporarily sequestered in the granule. It may be then processed to toxic MBP which finally crystallizes to form the granule core [5].
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/30/2018 11:27:41 PM
NT = Nucleotides: ORE = open reading frame; UTR = untranslated region. See text for references concerning the molecular biology of these proteins and their genes. Modified from Hamann and Gleich [2]. “ Calculated from amino acid sequences deduced from the cDN As.
204
Hamann/Barker/Ten/Gleich
more potent helminthotoxicity in the presence of H;02 [13]. Purified EPO, like myeloperoxidase (MPO), in the presence of H:0 2, is able to oxidize ha lides to form highly reactive hypohalous acids. EPO prefers B r over CL in these reactions [15, 16] generat ing toxic hypobromous acid, but the molecular mech anisms underlying this preference are unknown. EPO is a heme-containing protein [1], composed of ap proximately 14- to 15-kDa and 50- to 58-kDa subunits that presumably are translated from the same mRNA into a larger precursor that is subsequently cleaved [17, 18]. Ten et al. [18] have recently constructed an eo sinophil cDNA library from human umbilical-cord blood mononuclear cells (MNC) induced to eosino phil differentiation by T-cell-conditioned media. Se quence analysis of a cDNA clone from this library re vealed an open reading frame of 2,106 base pairs corresponding to a pro-sequence, light chain and heavy chain in that order [18]. Curiously, attempts to identify EPO cDNA clones in an uninduced HL-60 cDNA library were unsuccessful. The molecular mass of the predicted precursor protein was about 79.6 kDa with a pi of 10.2; the light and heavy chains corre spond to 12.7- and 53.0-kDa proteins, with pi of 10.8 and 10.7, respectively [18], Thus, the sequence of the EPO clone confirmed the existence of a unique mRNA that encodes a large precursor containing both the light and heavy chains. Furthermore, this mRNA contains a 5' pro-sequence that codes for a peptide similar to the pro-sequence of neutrophil MPO [19]. Indeed, comparison of the entire EPO nucleotide sequence with other peroxidases shows striking similarities and suggests the existence of a peroxidase multigene family that evolved by gene duplication [18]. Murine EL-4 (thymoma) cell-conditioned medium was recently used to induce umbilical-cord MNC and HL-60 cells in order to analyze mRNA and protein synthesis in these eosinophil precursors [11]. While HL-60 clones selected for eosinophil differentiation were positive for EPO, they lost their ability to pro duce EPO after long-term culture. In contrast, cord blood MNC were regularly induced to produce EPO, MBP, EDN and ECP. Northern blot analysis revealed the presence of 2.8-, 1.2- and 1.0-kb bands Eosinophil Peroxidase corresponding to the full-length message for EPO, EPO is an abundant protein in the matrix of the eo MBP and EDN, respectively (fig. 1,2) [11], The inten sinophil granule [1] and is a potent toxin for parasites sity of the bands suggested that the amount of stable [13] and mammalian cells [14] with or without H2O2, mRNA peaked at around day 8, but that delectable although, on a molar basis, EPO mediates a much message was still present after 34 days of induction, in
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/30/2018 11:27:41 PM
A recent finding which may be relevant to this discus sion is the observation that a 200-300 base decrease in the size of MBP mRNA from eosinophil precursor cells induced for 5 days compared to that from cells induced for 8 days, suggesting some processing of the M BPmRNAduringthattime[l 1]. The expression of MBP mRNA in a variety of cell lines was recently analyzed by Northern blot hybridi zation to a 850-basepair cDNA clone [6]. MBP mRNA was detected [as ~ 1.0-kilobase (kb) species] only in HL-60 cells; comparable quantities of RNA from SK-Hep (human adenocarcinoma) cells and from KG-la (acute myelogenous leukemia) cells did not show detectable levels of MBP mRNA. Interest ingly, uninduced HL-60 cells contained higher levels of this mRNA than 40-hour or 72-hour dimethyl sulf oxide (DMSO)-induced (i.e. neutrophil induction) HL-60 cultures [6], Genomic DNA samples from hu man foreskin fibroblast (HFF) cells and from HL-60 were analyzed by restriction analysis and Southern blot hybridization. Restriction patterns of both HFF and HL-60 DNA were identical and suggested that the mbp gene was a single copy gene with at least one intron [6]. Recently, the mbp gene was cloned and its nucleo tide sequence determined [12]. The 3.3-kb gene con sists of 6 exons and 5 introns, 1 of which (intron 4) contains an Alu family repeat. The first and second exons generally comprise the 5'-untranslated region and the putative signal peptide, while the third exon codes the pro-portion and the beginning of mature MBP. The rest of MBP and the 3'-untranslated region are coded in the 3 remaining exons [12], The 5'-flanking region contains elements of a typical eukaryote promoter including a putative TATA box and an ele ment similar to the CCAAT box consensus sequence. Genomic Southern blots yielded results similar to those of McGrogan et al. [6]; furthermore, blots of DNA from 4 different individuals of different ethnic backgrounds showed identical restriction patterns, suggesting that mbp exhibits limited polymorphism [12] . Southern blot analysis of somatic cell hybrid DNAs and in situ hybridization localize the human mbp gene to chromosome 11 [unpubl. results].
205
The Molecular Biology of Eosinophil Granule Proteins
1
2
3
4
5
6
7
8
9 .4 9 -
0 .2 4 -
Kb
1
2
3
4
9 . 49 7 .4 6 4 . 40 -
Fig. 2. Northern blot analysis of the kinetics of MBP and EDN mRNA expression/stabilization during eosinophil differentiation of cord blood MNC. Lanes l-4 were hybridized with a radiola beled MBP cDNA insert and lanes 5-8 with a radiolabeled EDN genomic insert. Lanes I and 5 = uninduced cells; lanes 2 and 6 = 5-day induction with 10% EL-4-conditioned medium; lanes 3 and 7 = 8-day induction; lanes 4 and 8 = 34-day induction.
2 .3 7 -
0 .2 4 Fig. 1. Northern blot analysis of cord MNC total cellular RNA. a Gel electrophoresis shows the presence of comparable amounts of total cellular RNA in sample lanes 2-5: lane 2 = uninduced cord MNC; lane 3 = 5-day induction with 10% EL-4-conditioned medium: lane 4 = 8-day induction; lane 5 = 34-day induction; lane I = RNA ladder. The gel shows comparable amounts of total cellular RNA in each sample, b Kinetics of EPO mRNA expression/stabllization during eosinophil differentiation. Lanes 1-4 correspond to lanes 2-5 in a after hybridization with radiolabeled EPO cDNA insert. Maximal signal is seen in the 8-day induced cellular RNA (lane 3).
cells that resembled mature eosinophils. The activity of the EL-4-conditioned medium may be due to the presence of interleukin-5 (I L-5) [11]. Shortly after the publication of the EPO cDNA se quence [18], Sakamaki et al. [20] reported the isolation and characterization of the chromosomal gene for hu man EPO. They isolated this gene from a human pla cental genomic library using human MPO cDNA as a
probe and found that, like the MPO gene, the EPO gene consists of 12 exons and ll introns spanning about 12 kb. The similarities of EPO and MPO at both the nucleotide and amino acid levels confirmed the observations of Ten et al. [18], but, interestingly, little identity in the 5 '-flanking region was found. These differences between the putative promoter regions are interesting in light of the tissue-specific expression of the EPO and MPO genes [20], A pre liminary analysis suggests that the EPO gene is on chromosome 17 near that for MPO, lending further support for the concept of a peroxidase multigene family [l l, 20], whose members may be clustered on this chromosome. Eosinophil-Derived Neurotoxin and Eosinophil Cationic Protein In this review, we shall consider the granule pro teins EDN and ECP together because, as will be evi dent from the discussion below, there are fascinating similarities and differences between these two pro teins and their genes. EDN and ECP are both local ized in the granule matrix in the human eosinophil and both possess neurotoxic, helminthotoxic and ribonucleolytic activities [l], EDN and ECP have similar
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/30/2018 11:27:41 PM
1. 3 4 -
neurotoxic potencies as measured by their abilities to provoke the Gordon phenomenon in rabbits [21]. However, ECP is a more potent cyto- and helminthotoxin, while EDN is much less so [22, 23], and EDN possesses 50-100 times more ribonucleolytic activ ity than ECP [24], The mechanism of ECP-mediated cytotoxicity may involve the formation of trans membrane channels similar to those formed during membrane-complement interactions [7]. When the Nterminal amino acid sequences of ECP and EDN were determined, it was immediately apparent that EDN and ECP are markedly similar; furthermore, both are similar to pancreatic ribonuclease (RNase) [21]. The amino acid sequence deduced from the EDN cDNA [25, 26] is identical to the amino acid sequence of urinary nonsecretory RNase [27] and to the Nterminal sequence of human liver RNase [28]. Com parison of the nucleotide sequences of EDN and ECP cDNAs shows an 88% similarity index [29, 30], The nucleotide identity occurs in the 27-amino-acid signal peptides as well, and the deduced amino acid se quences of pre-ECP and pre-EDN demonstrate a 70% identity over 160 and 161 amino acids, respectively [29], These results also support previous biosynthetic labeling studies which suggested that ECP was syn thesized as a preprotein which was then processed to become the ‘storage form' of the protein in the gra nule [31]. Co- and posttranslational modifications of the preproteins, i.e. cleavage of the signal peptides and glycosylation, would yield proteins near the mo lecular weights reported for the mature proteins [21]. Rosenberg et al. [26] detected EDN mRNA in un induced HL-60 cells which was up-regulated with IL-5 induction toward eosinophilic differentiation as well as with DMSO induction toward neutrophilic differentiation. However, Northern blot analyses failed to demonstrate the presence of ECP mRNA in DMSO-induced HL-60 cells; ECP mRNA was seen only in an eosinophil-committed subline of HL-60 cells induced with IL-5 [30]. mRNA for both ECP and EDN was detected in total RNA from hypodense, eo sinophil-rich granulocytes from a patient with hypereosinophilic syndrome [26]. In studies of EL-4-induced precursor MNC, transcription of the EDN gene (or processing and/or stabilization of the RNA transcripts) seemed to occur slightly later than that for the EPO or MBP genes because no EDN mRNA was detectable from cells induced for 5 days (fig. 2) [11], Wc have recently reported the structure and chromosome localization of the EDN gene (RNS2)
H am ann/Barker/Ten/Gleich
and the ECP gene (RNS3) isolated from human leu kocyte and human fetal liver genomic libraries, re spectively [32]. The nucleotide sequences exhibited re markable similarity throughout the genes including the 5'-untranslated regions, the exons, the introns and about 75 bases into the 3'-untranslated regions. The relationships between EDN and ECP and other RNases illustrated by their amino acid and cDNA se quences and identities at active sites have been previ ously discussed [25, 26, 29, 30]. These relationships suggest that the ECP gene was derived from the EDN gene via gene duplication. A single intron separates each gene into 2 exons such that the entire coding re gions and 3'-untranslated regions of the genes are intronless; a single intron and an intronless coding re gion may be features common to members of the RNase gene superfamily [32]. Chromosome localiza tions utilizing Southern blots of hamster x human so matic cell hybrid DNA panels and in situ hybridiza tions demonstrated that both genes are located on the human chromosome I4q-arm at region q24-q31. Lo calization of these two genes to the same chromosome region strengthens the argument for their divergence via gene duplication. Furthermore, the recent locali zation [33] of the human gene for angiogenin, a more distantly related member of RNase family, to a nearby region (q 11-q 13) on chromosome 14 supports the hypothesis of the origin of the RNase gene family from an ‘ancestral RNase’ gene [27]. Determination of the gene sequences for EDN and ECP have enabled us to examine their evolutionary relationships in greater detail than previously possi ble. For example, comparison of the entire sequences showed that the divergence of ‘replacement sites" (sites at which mutations alter the amino acid that is coded) is nearly twice that of the ‘silent sites’ (at which no amino acid change occurs) [32], This is the reverse of what is true for most functional genes [34], and leads us to hypothesize that, after the gene duplica tion event, the ECP gene was (and is) under strong se lective pressure to code for a more basic and thus more toxic protein [29, 30, 32]. Divergence values also enable us to hypothesize concerning the time of di vergence of these genes for EDN and ECP and, con sequently, the phylogenetic distribution of these pro teins. We have suggested that the divergence of the EDN and ECP genes may have occurred as early as 25-40 million years ago within the Anthropoidea af ter the separation of the New World monkeys but be fore the separation of the Old World monkeys and
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/30/2018 11:27:41 PM
206
207
The Molecular Biology of Eosinophil Granule Proteins
+++ + ++ + +++
+**+* ++++ *+++*
ECP EDN EPO MBP
-278 CTG-CCAGCAGCGTATAGTTTTCACCCAGAGTCCAGATCCCACCGGCAAAA-CTCTGTCTAACA..... -312 CTG-CAGGCAGCATATAGTTTTCATCCAGAGTTTGGATCTAACCAGCAAAA-CTCTGTCTTACA...... -297 CTGTCAGCCAACAAATATC-- CATTGAGCGACACCTGTGTCCCAGGTGCTGCTCTGGGCCCTGGGAGAA -292 TTCA-- A-A......A-C--ACCAGTAAAA-CAGGGGAG-ATA......
ECP EDN EPO MBP
- 2 1 6 ..... CAGGATGACTTGGAATT--AG— AGTCC-GT............ A ----TAG--CA-GA-AAGA -250 ..... CAGGATGACTTGGAATT--AG AGTCC-TT............ A ----TAG--CA-GA-AAGA -230 GTGCATCAGTGGG-CTTGGTAGT--AG-- AGG-G--TAGGGATGGAGTGAAGGGTAGG-CAGG--AAGA -263 ......TGT-ATT--TTGGAAAAGCACCCAAGGCGATTC......... TGAAGTGTAGCCCAGGATAAGA
ECP EDN EPO MBP
-178 GC-A--G--CAGGGCTGT-CC--- T..................... TGGGTATCCG.......... TT--212 GC-A--G- -CAGGGCTGT-CC---T..................... TGGGTATCCG.......... TT-- 1 7 2 ........................ ATGTCCCCAGGCTGGTAGGAGGTGGGG-T-GGGGG-G T-TT--211 ACCATTGCCCAGAGCTGTTCCA-GATGGCCCCTGGGTTCCTGAAG-TGGGTATCGGGAGAGAAATCTTCA
ECP EDN EPO MBP
- 1 5 0 ................ GCT -- -CAGCCAAGTCATCAAAT..... A- -AAAAGGATGATTGCACAAGTGGA - 1 8 4 ................ GCT -- -CAGCCAAGTCATCAAAT..... A--AAAAGGATGATTGCACAAGTGGA - 1 3 5 .......................CAG.... TC- TCAAAACTCCCATGAAAACCAGAGAGAAGTTTCAGAA -143 CTGAATGAATGAGTGGGCTCCCCAGGGAAGTGATGAAAT............GG-TCCTTATCAGCCTTG-
+++ +**★ *+*
**★ ** ★ +
+++ +++++ ++
****++*+ *
***
*+++ + +++ +++++++++++++
+++*+ +++
++++++++
+♦
+♦++
+ +++ +
*
ECP -106 CCATGTGTCAATCTGTGGGTTTCTGCATGGCCAG................................... AC EDN -140 CTATGTACCAATCTGTGGGTTTCTGCATGGCCAAGAGCCAGACCCTCCCTCTGGGCTCTGCTGGCCCAAC EPO -93 CTCCACCCAAGAGGCTGGGTTTCT- -AGGGCCCAGAGCT-G-CCCTCCC................CCACC MBP -87 CTATCTCCC--TCTG...........A ----CA-GAGGCAAACTCTCTCTC----C-CTGGGGGAAGTTC * +++*+**+
ECP EDN EPO MBP
-70 -70 -43 -40
* * *
+**
+ * * ++
+ + •»++
*+++++ +
+++++
CCACCAAGGGAAGCTTTATTTAAACAGTTCCAAGTAGGGGAGACCAGCTGCCCCTGAACCCCAGAACAAC CCACCAAGGGATGCTTTATTTAAACAGTTCCAAGTAGGGGAGACCAGCTGCCCCTGAACCCCAGAACAAC CTAGAATGGG-- C--TATAAAA---GTCCC---T......TCCCAGCTACG--T.....CCAGAG-A CT-CCAAGGCCT-C--TATATAAGAAGTCTTTGTGAGAGGAAGC
hominoids [32], We have begun to examine this hypo thesis utilizing polymerase chain reaction technology and preliminary results are supportive of this estimate of divergence time.
Putative Promoter Regions of MBP, EPO, EDN and ECP Genes Control of gene expression in eukaryotes occurs on several levels. Transcriptional control is influenced by various regulatory sequence elements such as promoters which constitute binding sites for se quence-specific RNA polymerases and regulatory DNA-binding proteins termed transcription factors. Detailed examinations of the 5' noncoding regions of the eosinophil granule protein genes have yielded putative TATA and CAAT boxes, as well as similari ties to promoter motifs from unrelated genes. Typical TATA boxes are found in the 5'-flanking regions of the MBPand EPO genes [12, 20] and identical TATT-
TAA variants of the TATA box are located in com parable regions of the EDN and ECP genes [32] (fig. 3). Alignments of the EDN and ECP 5'-untranslated regions with those of the MBP and EPO genes yield similarity indices of about 54 and 51%, respec tively, and show intriguing similarities at and around several nucleotide blocks (fig. 3). These include re gions resembling the CAAT box consensus sequence and similar heptamers which more closely resemble the ‘octamer’ motif, ATGCAAAT, found in immu noglobulin promoters [35]. Among other conserved hexamer to octamer nucleotide blocks is the sequence TGGGTTTCT (ECP bases -91 to -83), which is 100% identical among the genes for the granule matrix pro teins EDN, ECP and EPO [32]. No corresponding nu cleotide block was seen in the gene encoding MBP, the protein comprising the granule core (fig. 3). The functional significance of these conservations and differences is presently unknown. Functional differ ences and tissue-specific expression of these proteins suggest that their genes may be subject to different reg-
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/30/2018 11:27:41 PM
Fig. 3. Alignment of nucleotide sequences of 5'-flanking regions of the human genes for ECP, EDN, EPO and MBP. Regions of grea test identity among all 4 genes are indicated above comparisons by asterisks and regions of identity among 3 of the 4 genes are indi cated by plus signs. Putative CAAT and TATA boxes are double underlined for each of the genes. A single line underscores the heptamers similar to the 'octamer' motif dis cussed in the text. Gaps were introduced to achieve maximum sequence identity. From Hamann et al. [32] with permission.
♦+♦*++*+***+
ulatory mechanisms. On the other hand, we may hy pothesize that gene products packaged and stored in the same subcelluiar location (here, the eosinophil crystalloid granules) may share certain mechanisms of transcription control [32].
7
8
9
Conclusion 10
At present, our knowledge of the molecular biol ogy of eosinophils is limited primarily to their wellcharacterized granule proteins. Yet, we are only now beginning to understand the intricacies of eosinophil differentiation, maturation and activation and what these processes mean to the granule proteins. Clearly, some of the most promising and anticipated lines of research concern the processing of eosinophil pro teins during cell development, features of RNA and protein synthesis concomitant with or consequent to eosinophil activation and new or uncharacterized en zymes, receptors and other proteins which may be in volved in these processes.
II 12
13
14
15 16
Acknowledgements 17 The authors wish to express their sincere gratitude to Mary Col lins, Nancy Trojan and Linda Arneson for their expert secretarial assistance and to Dr. Alan Leff, Section Head, Pulmonary and Crit ical Care Medicine, University of Chicago, whose patience and cooperation enabled me (K.J.H.) to prepare for and attend the 1990 CIA Meeting in Madeira.
References 1 Gleich GJ, Adolphson CR: The eosinophilic leukocyte: Struc ture and function. Adv Immunol 1986;39:177-253. 2 Hamann KJ, Gleich GJ: Eosinophil structure and function: Roles in host defense and pathogenesis of disease; in Sorg C (ed): Local Immunity, vol 6: Natural Resistance to Infection. Stuttgart, Fischer, in press. 3 Hamann KJ, White SR, Gundel RH, Gleich GJ: Interactions between respiratory epithelium and eosinophil granule proteins in asthma: The eosinophil hypothesis; in Farmer SG, Hay DWP (eds): The Airway Epithelium; Structure and Function in Health and Disease. New York, Dekker, in press. 4 Wasmoen TL, Bell MP, Loegering DA, et al: Biochemical and amino acid sequence analysis of human eosinophil granule ma jor basic protein. J Biol Chem 1988;263:12559-12563. 5 Barker RL, Gleich GJ, Pease LR: Acidic precursor revealed in human eosinophil granule major basic protein cDNA. J Exp Med 1988;168:1493-1498. 6 McGrogan M, Simonsen C, Scott R, et al: Isolation of a com-
18
19
20
21
22
23
24
25
plementary DNA clone encoding a precursor to human eosino phil major basic protein. J Exp Med 1988;168:2295-2308. Young JD, Peterson CGB, Venge P, Cohn ZA: Mechanism of membrane damage mediated by human eosinophil cationic protein. Nature 1986;321:613-616. Ackermann GA: Eosinophilic leukemia: A morphologic and histochemical study. Blood 1964:24:372-388. Gleich GJ, Loegering DA, Maldonado JE: Identification of a major basic protein in guinea pig eosinophil granules. J Exp Med 1973;137:1459-1471. Lewis DM, Lewis JC, Loegering DA, Gleich GJ: Localization of the guinea pig eosinophil major basic protein to the core of the granule. J Cell Biol 1978;77:701-713. Ten RM, Butterfield JA. Weiler DA, et al: Eosinophil differen tiation of human umbilical cord mononuclear cells by murine EL-4 thymoma cell conditioned media. Submitted. Barker RL, Loegering DA, Arakawa KC, et al: Cloning and se quence analysis of the human gene encoding eosinophil major basic protein. Gene 1990;86:285-289. Hamann KJ, Gleich GJ, Checkel JL, et al: In vitro killing of microfilariae of Brugia pahangi and Brugia malayi by eosino phil granule proteins. J Immunol 1990;144:3166-3173. Motojima S, Frigas E, Loegering DA, Gleich GJ: Toxicity of eosinophil cationic proteins for guinea pig trachea epithelium in vitro. Am Rev Respir Dis 1989;139:801-805. Weiss SJ, Test ST, Eckmann CM, et al: Brominating oxidants generated by human eosinophils. Science 1986;234:200-203. Mayeno AN, Curran AJ, Roberts RL, Foote CS: Eosinophils preferentially use bromide to generate halogenating agents. J Biol Chem 1989;264:5660-5668. OIsson I, Persson AM, Stromberg K, et al: Purification of eosin ophil peroxidase and studies of biosynthesis and processing in human marrow cells. Blood 1985:66:1143-1148. Ten RM, Pease LR, McKean DJ, et al: Molecular cloning of the human eosinophil peroxidase: Evidence for the existence of a peroxidase multigene family. J Exp Med 1989; 169:1757-1769. Johnson KR, Naussef WM, Care A, et al: Characterization of cDNA clones for human myeloperoxidase: Predicted amino acid sequence and evidence for multiple mRNA species. Nu cleic Acids Res 1987;15:2013-2028. Sakamaki K, Tomonaga M, Tusukui K, Nagata S: Molecular cloning and characterization of a chromosomal gene for human eosinophil peroxidase. J Biol Chem 1989;264:16828-16836. Gleich GJ, Loegering DA, Bell MP, et al: Biochemical and functional similarities between human eosinophil-derived neu rotoxin and eosinophil cationic protein: Homology with ribo nucléase. Proc Natl Acad Sei USA 1986;83:3146-3150. Ackerman SJ, Gleich GJ, Loegering DA, et al: Comparative toxicity of purified human eosinophil granule cationic proteins for schistosomula of Schistosoma mansoni. Am J Trop Med Hyg 1985;34:735-745. Hamann KJ. Barker RL, Loegering DA, Gleich GJ: Compara tive toxicity of purified human eosinophil granule proteins for newborn larvae of Trichinella spiralis. J Parasitol 1987;73: 523-529. Slifman NR, Loegering DA, McKean DJ, Gleich GJ: Ribonu cléase activity associated with human eosinophil-derived neu rotoxin and eosinophil cationic protein. J Immunol 1986; 137: 2913-2917. Hamann KJ, Barker RL, Loegering DA, et al: Sequence of hu-
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/30/2018 11:27:41 PM
H am ann/Barker/Ten/G leich
208
209
The Molecular Biology of Eosinophil Granule Proteins
27
28
29
30
31
32 Hamann KJ, Ten RM, Loegering DA, et al: Structure and chromosome localization of the human eosinophil-derived neu rotoxin and eosinophil cationic protein genes: Evidence for intronless coding sequences in the ribonucléase gene superfamily. Genomics 1990;7:535-546. 33 Weremowicz S, Fox EA, Morton CC: Assignment of human angiogenin gene to chromosome I4ql I-q13 (abstract). Cytogenet Cell Genet 1989:51:1107. 34 Lewin B: Genes, ed 3. New York, Wiley, 1987. 35 Parslow TG, Blair DL, Murphy WJ, Granner DK: Structure of the 5' ends of immunoglobulin genes: A novel conserved se quence. Proc Natl Acad Sci USA 1984;81:2650-2654.
Correspondence to: Dr. K.J. Hamann Section of Pulmonary and Critical Care Medicine Box 98 University of Chicago 5841 S. Maryland Avenue Chicago, IL 60637 (USA)
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/30/2018 11:27:41 PM
26
man eosinophil-derived neurotoxin cDNA: Identity of deduced amino acid sequence with human unsecretory ribonucleases. Gene 1989;83:161-167. Rosenberg HF, Tenen DG, Ackerman SJ: Molecular cloning of the human eosinophil-derived neurotoxin: A member of the ribonucléase gene family. Proc Natl Acad Sci USA 1989:86: 4460-4464. Beintema JJ, Hofsteenge J, Iwama M. et al: Amino acid se quence of the nonsecretory ribonucléase of human urine. Bio chemistry 1988:27:4530-4538. Sorrentino S, Turner GK, Glitz DG: Purification and character ization of a ribonucléase from human liver. J Biol Chem 1988: 263:16125-16131. Barker RL, Loegering DA, Ten RM, et al: Eosinophil cationic protein cDNA: Comparison with other toxic cationic proteins and ribonucleases. J Immunol 1989:143:952-955. Rosenberg FIF, Ackerman SJ, Tenen DG: Human eosino phil cationic protein: Molecular cloning of a cytotoxin and helminthotoxin with ribonucléase activity. J Exp Med 1989:170: 163-176. Olsson I, Persson AM, Wingvist I: Biochemical properties of the eosinophil cationic protein and demonstration of its biosyn thesis in vitro in marrow cells from patients with an eosinophilia. Blood 1986:67:498-503.
The Molecular Biology of Eosinophil Granule Proteins1 Kimm J. Hamann. Robert L. Barker. Rosa M. Ten. Gerald J. Gleich Departments of Immunology and Medicine, Mayo Clinic and Foundation, Rochester, Minn., USA
Abstract. Here, we briefly review the molecular biology of the human eosinophil granule proteins, major ba sic protein (MBP), eosinophil peroxidase (EPO), eosinophil cationic protein (ECP) and eosinophil-derived neurotoxin (EDN). The nucleotide sequence of MBP cDNA indicates that MBP is translated as a 25.2-kilodalton preproprotein; the mpb gene consists of 6 exons and 5 introns spanning 3.3 kilobases (kb). The ~ 2 .1-kb nu cleotide sequence of EPO cDNA corresponds to a prosequence, light chain and heavy chain in that order; simi larities to other peroxidases suggest the existence of a multigene family. EDN and ECP cDNAs and genes are remarkably similar throughout, suggesting a relatively recent divergence. Promoter regions of the 4 genes show interesting differences and similarities which may be related to differential gene regulation.
major basic protein (MBP), eosinophil peroxidase (EPO), eosinophil cationic protein (ECP) and eosino phil-derived neurotoxin (EDN), and speculate con cerning aspects of regulation of their genes.
For many years following Paul Ehrlich’s 1897 dis covery and naming of the eosinophil, this granulocyte remained in relative obscurity. However, during the past two decades or so, there has been a rebirth of interest in the eosinophil [1], especially since its impli cation as an effector cell in the immune response to helminths and the accumulation of evidence for its in imical role in bronchial asthma [see ref. 2 and 3 for recent reviews]. Most of the recent advances in our understanding of the eosinophil have come from in vitro studies of functional characteristics and features of eosinophil activation and in vivo studies of the pathological association of eosinophils with various disease states. In the past few years we have begun attempts to understand the molecular biology of the eosinophil in order to dissect the mechanisms involved in its role as an effector cell in more detail. Here, we briefly review our present knowledge of the molecular biology of the major human eosinophil granule proteins, namely,
When Paul Ehrlich stained smears of human peripheral-blood cells with aniline dyes, he observed that certain leukocytes stained intensely with acid dyes such as eosin. it was this avidity of eosin for the leukocyte granules, of course, which led him to name these cells eosinophils. It is the distinctive specific or secondary granules in mammalian eosinophils which stain avidly with acid dyes; electron microscopy re veals them to be composed of an electron-dense core and a more electron-lucent matrix. Many properties of the four principal basic proteins of the granules are well characterized (table I), but our understanding of the molecular biology of these proteins is in its in fancy.
This work was supported in part by grants from the National Institutes of Health (AI09728 and AI07047) and from the Mayo Foundation.
Major Basic Protein The electron-dense crystalloid core of the eosino phil specific granule is composed almost entirely of
Eosinophil Granule Proteins
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/30/2018 11:27:41 PM
Introduction
The Molecular Biology of Eosinophil Granule Proteins
203
Table I. Some properties of human eosinophil granule proteins and their cDN As and genes Protein Site
Molecular weight X 10'5
Pi“
Molecular biology
Activities
cDNA
gene
chromosome
MBP
core
14
10.9
( 1) potent helminthotoxin and cytotoxin; (2) causes histamine release from basophils and rat mast cells: (3) neutralizes heparin; (4) bactericidal, and (5) causes bronchial constriction and hyperreactivity
-900 NT (preproMBP)
3.3 kb 5 introns
11
ECP
matrix 21
10.8
(1) potent helminthotoxin; (2) potent neurotoxin; (3) inhibits cultures of peripheral-blood lymphocytes; (4) causes histamine release from rat mast cells; (5) weak RNase activity, and (6) bactericidal
-725 NT (pre-ECP)
-1.2 kb 1 intron in UTR
14
EDN
matrix
18-19
8.9
( 1) potent neurotoxin; (2) inhibits cultures of pe ripheral-blood lymphocytes; (3) potent RNase activity, and (4) weak helminthotoxin
-725 NT (pre-EDN)
-1.2 kb 1 intron in UTR
14
EPO
matrix 71-77
10.8
in the presence of H;0 2 + halide: (1) kills micro organisms and tumor cells; (2) causes histamine release from rat mast cells; (3) inactivates leukotrienes; (4) can kill Brugia microfilariae and damage re spiratory epithelium even in absence of H;0 2, and (5) may contribute to bronchial hyperreactivity
-2.500 NT (2,!06-NT ORF)
12 kb 17 11 introns (preliminary observation)
MBP. The mature protein consists of a single poly peptide chain of 117 amino acids, rich in arginine, and having a molecular weight of 13.8 kilodaltons (kDa) and a calculated isoelectric point (pi) of 10.9 [4-6]. MBP is a potent toxin for helminths and mam malian cells in vitro and has been localized on dam aged helminths and tissues in hypersensitivity dis eases including bronchial asthma [1-3]. Surface charge interactions of MBP with cell membranes may result in damage from increased permeability without the concurrent formation of transmembrane channels such as those formed by polymerized C9 [7], The cat ionic charge of MBP causes it to bind avidly to the an ionic surface of target cells whereupon the apolar resi dues may insert into and perturb the lipid milieu [4], Analysis of cDNA representing human MBP mRNA from the promyelocytic cell line HL-60 indicates that MBP is translated as a preproprotein with an acidic pro-portion [5], The longest open reading frame of nucleotide sequence codes for a protein of 222 amino acids including a 15-amino-acid putative signal pep tide typical of secreted proteins. Following the signal
peptide is the ‘pro-sequence’ of 90 amino acids domi nated by glutamic and aspartic acids. The terminal deduced sequence of 117 amino acids is identical to the sequence of mature, toxic, MBP determined by Wasmoen et al. [4], The calculated pi of pro-MBP (207 amino acids) is 6.2, suggesting that pro-MBP is translated as a nontoxic precursor to mask the toxic effects of the strongly cationic mature MBP and to protect the eosinophil from damage while the mole cule is processed through the endoplasmic reticulum to its sequestered site in the granule core [5]. There are several possible mechanisms for the processing of pro-MBP. Based on several experimental observa tions, such as those suggesting decreasing granule ba sophilia (i.e. increasing cationicity) as eosinophils de velop from bone marrow myelocytes to mature granu locytes [8] and the lack of evidence for the existence of an intact pro-form of M BP in mature granules [9, 10], it is likely that, after transport through the endoplas mic reticulum, pro-MBP is temporarily sequestered in the granule. It may be then processed to toxic MBP which finally crystallizes to form the granule core [5].
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/30/2018 11:27:41 PM
NT = Nucleotides: ORE = open reading frame; UTR = untranslated region. See text for references concerning the molecular biology of these proteins and their genes. Modified from Hamann and Gleich [2]. “ Calculated from amino acid sequences deduced from the cDN As.
204
Hamann/Barker/Ten/Gleich
more potent helminthotoxicity in the presence of H;02 [13]. Purified EPO, like myeloperoxidase (MPO), in the presence of H:0 2, is able to oxidize ha lides to form highly reactive hypohalous acids. EPO prefers B r over CL in these reactions [15, 16] generat ing toxic hypobromous acid, but the molecular mech anisms underlying this preference are unknown. EPO is a heme-containing protein [1], composed of ap proximately 14- to 15-kDa and 50- to 58-kDa subunits that presumably are translated from the same mRNA into a larger precursor that is subsequently cleaved [17, 18]. Ten et al. [18] have recently constructed an eo sinophil cDNA library from human umbilical-cord blood mononuclear cells (MNC) induced to eosino phil differentiation by T-cell-conditioned media. Se quence analysis of a cDNA clone from this library re vealed an open reading frame of 2,106 base pairs corresponding to a pro-sequence, light chain and heavy chain in that order [18]. Curiously, attempts to identify EPO cDNA clones in an uninduced HL-60 cDNA library were unsuccessful. The molecular mass of the predicted precursor protein was about 79.6 kDa with a pi of 10.2; the light and heavy chains corre spond to 12.7- and 53.0-kDa proteins, with pi of 10.8 and 10.7, respectively [18], Thus, the sequence of the EPO clone confirmed the existence of a unique mRNA that encodes a large precursor containing both the light and heavy chains. Furthermore, this mRNA contains a 5' pro-sequence that codes for a peptide similar to the pro-sequence of neutrophil MPO [19]. Indeed, comparison of the entire EPO nucleotide sequence with other peroxidases shows striking similarities and suggests the existence of a peroxidase multigene family that evolved by gene duplication [18]. Murine EL-4 (thymoma) cell-conditioned medium was recently used to induce umbilical-cord MNC and HL-60 cells in order to analyze mRNA and protein synthesis in these eosinophil precursors [11]. While HL-60 clones selected for eosinophil differentiation were positive for EPO, they lost their ability to pro duce EPO after long-term culture. In contrast, cord blood MNC were regularly induced to produce EPO, MBP, EDN and ECP. Northern blot analysis revealed the presence of 2.8-, 1.2- and 1.0-kb bands Eosinophil Peroxidase corresponding to the full-length message for EPO, EPO is an abundant protein in the matrix of the eo MBP and EDN, respectively (fig. 1,2) [11], The inten sinophil granule [1] and is a potent toxin for parasites sity of the bands suggested that the amount of stable [13] and mammalian cells [14] with or without H2O2, mRNA peaked at around day 8, but that delectable although, on a molar basis, EPO mediates a much message was still present after 34 days of induction, in
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/30/2018 11:27:41 PM
A recent finding which may be relevant to this discus sion is the observation that a 200-300 base decrease in the size of MBP mRNA from eosinophil precursor cells induced for 5 days compared to that from cells induced for 8 days, suggesting some processing of the M BPmRNAduringthattime[l 1]. The expression of MBP mRNA in a variety of cell lines was recently analyzed by Northern blot hybridi zation to a 850-basepair cDNA clone [6]. MBP mRNA was detected [as ~ 1.0-kilobase (kb) species] only in HL-60 cells; comparable quantities of RNA from SK-Hep (human adenocarcinoma) cells and from KG-la (acute myelogenous leukemia) cells did not show detectable levels of MBP mRNA. Interest ingly, uninduced HL-60 cells contained higher levels of this mRNA than 40-hour or 72-hour dimethyl sulf oxide (DMSO)-induced (i.e. neutrophil induction) HL-60 cultures [6], Genomic DNA samples from hu man foreskin fibroblast (HFF) cells and from HL-60 were analyzed by restriction analysis and Southern blot hybridization. Restriction patterns of both HFF and HL-60 DNA were identical and suggested that the mbp gene was a single copy gene with at least one intron [6]. Recently, the mbp gene was cloned and its nucleo tide sequence determined [12]. The 3.3-kb gene con sists of 6 exons and 5 introns, 1 of which (intron 4) contains an Alu family repeat. The first and second exons generally comprise the 5'-untranslated region and the putative signal peptide, while the third exon codes the pro-portion and the beginning of mature MBP. The rest of MBP and the 3'-untranslated region are coded in the 3 remaining exons [12], The 5'-flanking region contains elements of a typical eukaryote promoter including a putative TATA box and an ele ment similar to the CCAAT box consensus sequence. Genomic Southern blots yielded results similar to those of McGrogan et al. [6]; furthermore, blots of DNA from 4 different individuals of different ethnic backgrounds showed identical restriction patterns, suggesting that mbp exhibits limited polymorphism [12] . Southern blot analysis of somatic cell hybrid DNAs and in situ hybridization localize the human mbp gene to chromosome 11 [unpubl. results].
205
The Molecular Biology of Eosinophil Granule Proteins
1
2
3
4
5
6
7
8
9 .4 9 -
0 .2 4 -
Kb
1
2
3
4
9 . 49 7 .4 6 4 . 40 -
Fig. 2. Northern blot analysis of the kinetics of MBP and EDN mRNA expression/stabilization during eosinophil differentiation of cord blood MNC. Lanes l-4 were hybridized with a radiola beled MBP cDNA insert and lanes 5-8 with a radiolabeled EDN genomic insert. Lanes I and 5 = uninduced cells; lanes 2 and 6 = 5-day induction with 10% EL-4-conditioned medium; lanes 3 and 7 = 8-day induction; lanes 4 and 8 = 34-day induction.
2 .3 7 -
0 .2 4 Fig. 1. Northern blot analysis of cord MNC total cellular RNA. a Gel electrophoresis shows the presence of comparable amounts of total cellular RNA in sample lanes 2-5: lane 2 = uninduced cord MNC; lane 3 = 5-day induction with 10% EL-4-conditioned medium: lane 4 = 8-day induction; lane 5 = 34-day induction; lane I = RNA ladder. The gel shows comparable amounts of total cellular RNA in each sample, b Kinetics of EPO mRNA expression/stabllization during eosinophil differentiation. Lanes 1-4 correspond to lanes 2-5 in a after hybridization with radiolabeled EPO cDNA insert. Maximal signal is seen in the 8-day induced cellular RNA (lane 3).
cells that resembled mature eosinophils. The activity of the EL-4-conditioned medium may be due to the presence of interleukin-5 (I L-5) [11]. Shortly after the publication of the EPO cDNA se quence [18], Sakamaki et al. [20] reported the isolation and characterization of the chromosomal gene for hu man EPO. They isolated this gene from a human pla cental genomic library using human MPO cDNA as a
probe and found that, like the MPO gene, the EPO gene consists of 12 exons and ll introns spanning about 12 kb. The similarities of EPO and MPO at both the nucleotide and amino acid levels confirmed the observations of Ten et al. [18], but, interestingly, little identity in the 5 '-flanking region was found. These differences between the putative promoter regions are interesting in light of the tissue-specific expression of the EPO and MPO genes [20], A pre liminary analysis suggests that the EPO gene is on chromosome 17 near that for MPO, lending further support for the concept of a peroxidase multigene family [l l, 20], whose members may be clustered on this chromosome. Eosinophil-Derived Neurotoxin and Eosinophil Cationic Protein In this review, we shall consider the granule pro teins EDN and ECP together because, as will be evi dent from the discussion below, there are fascinating similarities and differences between these two pro teins and their genes. EDN and ECP are both local ized in the granule matrix in the human eosinophil and both possess neurotoxic, helminthotoxic and ribonucleolytic activities [l], EDN and ECP have similar
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/30/2018 11:27:41 PM
1. 3 4 -
neurotoxic potencies as measured by their abilities to provoke the Gordon phenomenon in rabbits [21]. However, ECP is a more potent cyto- and helminthotoxin, while EDN is much less so [22, 23], and EDN possesses 50-100 times more ribonucleolytic activ ity than ECP [24], The mechanism of ECP-mediated cytotoxicity may involve the formation of trans membrane channels similar to those formed during membrane-complement interactions [7]. When the Nterminal amino acid sequences of ECP and EDN were determined, it was immediately apparent that EDN and ECP are markedly similar; furthermore, both are similar to pancreatic ribonuclease (RNase) [21]. The amino acid sequence deduced from the EDN cDNA [25, 26] is identical to the amino acid sequence of urinary nonsecretory RNase [27] and to the Nterminal sequence of human liver RNase [28]. Com parison of the nucleotide sequences of EDN and ECP cDNAs shows an 88% similarity index [29, 30], The nucleotide identity occurs in the 27-amino-acid signal peptides as well, and the deduced amino acid se quences of pre-ECP and pre-EDN demonstrate a 70% identity over 160 and 161 amino acids, respectively [29], These results also support previous biosynthetic labeling studies which suggested that ECP was syn thesized as a preprotein which was then processed to become the ‘storage form' of the protein in the gra nule [31]. Co- and posttranslational modifications of the preproteins, i.e. cleavage of the signal peptides and glycosylation, would yield proteins near the mo lecular weights reported for the mature proteins [21]. Rosenberg et al. [26] detected EDN mRNA in un induced HL-60 cells which was up-regulated with IL-5 induction toward eosinophilic differentiation as well as with DMSO induction toward neutrophilic differentiation. However, Northern blot analyses failed to demonstrate the presence of ECP mRNA in DMSO-induced HL-60 cells; ECP mRNA was seen only in an eosinophil-committed subline of HL-60 cells induced with IL-5 [30]. mRNA for both ECP and EDN was detected in total RNA from hypodense, eo sinophil-rich granulocytes from a patient with hypereosinophilic syndrome [26]. In studies of EL-4-induced precursor MNC, transcription of the EDN gene (or processing and/or stabilization of the RNA transcripts) seemed to occur slightly later than that for the EPO or MBP genes because no EDN mRNA was detectable from cells induced for 5 days (fig. 2) [11], Wc have recently reported the structure and chromosome localization of the EDN gene (RNS2)
H am ann/Barker/Ten/Gleich
and the ECP gene (RNS3) isolated from human leu kocyte and human fetal liver genomic libraries, re spectively [32]. The nucleotide sequences exhibited re markable similarity throughout the genes including the 5'-untranslated regions, the exons, the introns and about 75 bases into the 3'-untranslated regions. The relationships between EDN and ECP and other RNases illustrated by their amino acid and cDNA se quences and identities at active sites have been previ ously discussed [25, 26, 29, 30]. These relationships suggest that the ECP gene was derived from the EDN gene via gene duplication. A single intron separates each gene into 2 exons such that the entire coding re gions and 3'-untranslated regions of the genes are intronless; a single intron and an intronless coding re gion may be features common to members of the RNase gene superfamily [32]. Chromosome localiza tions utilizing Southern blots of hamster x human so matic cell hybrid DNA panels and in situ hybridiza tions demonstrated that both genes are located on the human chromosome I4q-arm at region q24-q31. Lo calization of these two genes to the same chromosome region strengthens the argument for their divergence via gene duplication. Furthermore, the recent locali zation [33] of the human gene for angiogenin, a more distantly related member of RNase family, to a nearby region (q 11-q 13) on chromosome 14 supports the hypothesis of the origin of the RNase gene family from an ‘ancestral RNase’ gene [27]. Determination of the gene sequences for EDN and ECP have enabled us to examine their evolutionary relationships in greater detail than previously possi ble. For example, comparison of the entire sequences showed that the divergence of ‘replacement sites" (sites at which mutations alter the amino acid that is coded) is nearly twice that of the ‘silent sites’ (at which no amino acid change occurs) [32], This is the reverse of what is true for most functional genes [34], and leads us to hypothesize that, after the gene duplica tion event, the ECP gene was (and is) under strong se lective pressure to code for a more basic and thus more toxic protein [29, 30, 32]. Divergence values also enable us to hypothesize concerning the time of di vergence of these genes for EDN and ECP and, con sequently, the phylogenetic distribution of these pro teins. We have suggested that the divergence of the EDN and ECP genes may have occurred as early as 25-40 million years ago within the Anthropoidea af ter the separation of the New World monkeys but be fore the separation of the Old World monkeys and
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/30/2018 11:27:41 PM
206
207
The Molecular Biology of Eosinophil Granule Proteins
+++ + ++ + +++
+**+* ++++ *+++*
ECP EDN EPO MBP
-278 CTG-CCAGCAGCGTATAGTTTTCACCCAGAGTCCAGATCCCACCGGCAAAA-CTCTGTCTAACA..... -312 CTG-CAGGCAGCATATAGTTTTCATCCAGAGTTTGGATCTAACCAGCAAAA-CTCTGTCTTACA...... -297 CTGTCAGCCAACAAATATC-- CATTGAGCGACACCTGTGTCCCAGGTGCTGCTCTGGGCCCTGGGAGAA -292 TTCA-- A-A......A-C--ACCAGTAAAA-CAGGGGAG-ATA......
ECP EDN EPO MBP
- 2 1 6 ..... CAGGATGACTTGGAATT--AG— AGTCC-GT............ A ----TAG--CA-GA-AAGA -250 ..... CAGGATGACTTGGAATT--AG AGTCC-TT............ A ----TAG--CA-GA-AAGA -230 GTGCATCAGTGGG-CTTGGTAGT--AG-- AGG-G--TAGGGATGGAGTGAAGGGTAGG-CAGG--AAGA -263 ......TGT-ATT--TTGGAAAAGCACCCAAGGCGATTC......... TGAAGTGTAGCCCAGGATAAGA
ECP EDN EPO MBP
-178 GC-A--G--CAGGGCTGT-CC--- T..................... TGGGTATCCG.......... TT--212 GC-A--G- -CAGGGCTGT-CC---T..................... TGGGTATCCG.......... TT-- 1 7 2 ........................ ATGTCCCCAGGCTGGTAGGAGGTGGGG-T-GGGGG-G T-TT--211 ACCATTGCCCAGAGCTGTTCCA-GATGGCCCCTGGGTTCCTGAAG-TGGGTATCGGGAGAGAAATCTTCA
ECP EDN EPO MBP
- 1 5 0 ................ GCT -- -CAGCCAAGTCATCAAAT..... A- -AAAAGGATGATTGCACAAGTGGA - 1 8 4 ................ GCT -- -CAGCCAAGTCATCAAAT..... A--AAAAGGATGATTGCACAAGTGGA - 1 3 5 .......................CAG.... TC- TCAAAACTCCCATGAAAACCAGAGAGAAGTTTCAGAA -143 CTGAATGAATGAGTGGGCTCCCCAGGGAAGTGATGAAAT............GG-TCCTTATCAGCCTTG-
+++ +**★ *+*
**★ ** ★ +
+++ +++++ ++
****++*+ *
***
*+++ + +++ +++++++++++++
+++*+ +++
++++++++
+♦
+♦++
+ +++ +
*
ECP -106 CCATGTGTCAATCTGTGGGTTTCTGCATGGCCAG................................... AC EDN -140 CTATGTACCAATCTGTGGGTTTCTGCATGGCCAAGAGCCAGACCCTCCCTCTGGGCTCTGCTGGCCCAAC EPO -93 CTCCACCCAAGAGGCTGGGTTTCT- -AGGGCCCAGAGCT-G-CCCTCCC................CCACC MBP -87 CTATCTCCC--TCTG...........A ----CA-GAGGCAAACTCTCTCTC----C-CTGGGGGAAGTTC * +++*+**+
ECP EDN EPO MBP
-70 -70 -43 -40
* * *
+**
+ * * ++
+ + •»++
*+++++ +
+++++
CCACCAAGGGAAGCTTTATTTAAACAGTTCCAAGTAGGGGAGACCAGCTGCCCCTGAACCCCAGAACAAC CCACCAAGGGATGCTTTATTTAAACAGTTCCAAGTAGGGGAGACCAGCTGCCCCTGAACCCCAGAACAAC CTAGAATGGG-- C--TATAAAA---GTCCC---T......TCCCAGCTACG--T.....CCAGAG-A CT-CCAAGGCCT-C--TATATAAGAAGTCTTTGTGAGAGGAAGC
hominoids [32], We have begun to examine this hypo thesis utilizing polymerase chain reaction technology and preliminary results are supportive of this estimate of divergence time.
Putative Promoter Regions of MBP, EPO, EDN and ECP Genes Control of gene expression in eukaryotes occurs on several levels. Transcriptional control is influenced by various regulatory sequence elements such as promoters which constitute binding sites for se quence-specific RNA polymerases and regulatory DNA-binding proteins termed transcription factors. Detailed examinations of the 5' noncoding regions of the eosinophil granule protein genes have yielded putative TATA and CAAT boxes, as well as similari ties to promoter motifs from unrelated genes. Typical TATA boxes are found in the 5'-flanking regions of the MBPand EPO genes [12, 20] and identical TATT-
TAA variants of the TATA box are located in com parable regions of the EDN and ECP genes [32] (fig. 3). Alignments of the EDN and ECP 5'-untranslated regions with those of the MBP and EPO genes yield similarity indices of about 54 and 51%, respec tively, and show intriguing similarities at and around several nucleotide blocks (fig. 3). These include re gions resembling the CAAT box consensus sequence and similar heptamers which more closely resemble the ‘octamer’ motif, ATGCAAAT, found in immu noglobulin promoters [35]. Among other conserved hexamer to octamer nucleotide blocks is the sequence TGGGTTTCT (ECP bases -91 to -83), which is 100% identical among the genes for the granule matrix pro teins EDN, ECP and EPO [32]. No corresponding nu cleotide block was seen in the gene encoding MBP, the protein comprising the granule core (fig. 3). The functional significance of these conservations and differences is presently unknown. Functional differ ences and tissue-specific expression of these proteins suggest that their genes may be subject to different reg-
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/30/2018 11:27:41 PM
Fig. 3. Alignment of nucleotide sequences of 5'-flanking regions of the human genes for ECP, EDN, EPO and MBP. Regions of grea test identity among all 4 genes are indicated above comparisons by asterisks and regions of identity among 3 of the 4 genes are indi cated by plus signs. Putative CAAT and TATA boxes are double underlined for each of the genes. A single line underscores the heptamers similar to the 'octamer' motif dis cussed in the text. Gaps were introduced to achieve maximum sequence identity. From Hamann et al. [32] with permission.
♦+♦*++*+***+
ulatory mechanisms. On the other hand, we may hy pothesize that gene products packaged and stored in the same subcelluiar location (here, the eosinophil crystalloid granules) may share certain mechanisms of transcription control [32].
7
8
9
Conclusion 10
At present, our knowledge of the molecular biol ogy of eosinophils is limited primarily to their wellcharacterized granule proteins. Yet, we are only now beginning to understand the intricacies of eosinophil differentiation, maturation and activation and what these processes mean to the granule proteins. Clearly, some of the most promising and anticipated lines of research concern the processing of eosinophil pro teins during cell development, features of RNA and protein synthesis concomitant with or consequent to eosinophil activation and new or uncharacterized en zymes, receptors and other proteins which may be in volved in these processes.
II 12
13
14
15 16
Acknowledgements 17 The authors wish to express their sincere gratitude to Mary Col lins, Nancy Trojan and Linda Arneson for their expert secretarial assistance and to Dr. Alan Leff, Section Head, Pulmonary and Crit ical Care Medicine, University of Chicago, whose patience and cooperation enabled me (K.J.H.) to prepare for and attend the 1990 CIA Meeting in Madeira.
References 1 Gleich GJ, Adolphson CR: The eosinophilic leukocyte: Struc ture and function. Adv Immunol 1986;39:177-253. 2 Hamann KJ, Gleich GJ: Eosinophil structure and function: Roles in host defense and pathogenesis of disease; in Sorg C (ed): Local Immunity, vol 6: Natural Resistance to Infection. Stuttgart, Fischer, in press. 3 Hamann KJ, White SR, Gundel RH, Gleich GJ: Interactions between respiratory epithelium and eosinophil granule proteins in asthma: The eosinophil hypothesis; in Farmer SG, Hay DWP (eds): The Airway Epithelium; Structure and Function in Health and Disease. New York, Dekker, in press. 4 Wasmoen TL, Bell MP, Loegering DA, et al: Biochemical and amino acid sequence analysis of human eosinophil granule ma jor basic protein. J Biol Chem 1988;263:12559-12563. 5 Barker RL, Gleich GJ, Pease LR: Acidic precursor revealed in human eosinophil granule major basic protein cDNA. J Exp Med 1988;168:1493-1498. 6 McGrogan M, Simonsen C, Scott R, et al: Isolation of a com-
18
19
20
21
22
23
24
25
plementary DNA clone encoding a precursor to human eosino phil major basic protein. J Exp Med 1988;168:2295-2308. Young JD, Peterson CGB, Venge P, Cohn ZA: Mechanism of membrane damage mediated by human eosinophil cationic protein. Nature 1986;321:613-616. Ackermann GA: Eosinophilic leukemia: A morphologic and histochemical study. Blood 1964:24:372-388. Gleich GJ, Loegering DA, Maldonado JE: Identification of a major basic protein in guinea pig eosinophil granules. J Exp Med 1973;137:1459-1471. Lewis DM, Lewis JC, Loegering DA, Gleich GJ: Localization of the guinea pig eosinophil major basic protein to the core of the granule. J Cell Biol 1978;77:701-713. Ten RM, Butterfield JA. Weiler DA, et al: Eosinophil differen tiation of human umbilical cord mononuclear cells by murine EL-4 thymoma cell conditioned media. Submitted. Barker RL, Loegering DA, Arakawa KC, et al: Cloning and se quence analysis of the human gene encoding eosinophil major basic protein. Gene 1990;86:285-289. Hamann KJ, Gleich GJ, Checkel JL, et al: In vitro killing of microfilariae of Brugia pahangi and Brugia malayi by eosino phil granule proteins. J Immunol 1990;144:3166-3173. Motojima S, Frigas E, Loegering DA, Gleich GJ: Toxicity of eosinophil cationic proteins for guinea pig trachea epithelium in vitro. Am Rev Respir Dis 1989;139:801-805. Weiss SJ, Test ST, Eckmann CM, et al: Brominating oxidants generated by human eosinophils. Science 1986;234:200-203. Mayeno AN, Curran AJ, Roberts RL, Foote CS: Eosinophils preferentially use bromide to generate halogenating agents. J Biol Chem 1989;264:5660-5668. OIsson I, Persson AM, Stromberg K, et al: Purification of eosin ophil peroxidase and studies of biosynthesis and processing in human marrow cells. Blood 1985:66:1143-1148. Ten RM, Pease LR, McKean DJ, et al: Molecular cloning of the human eosinophil peroxidase: Evidence for the existence of a peroxidase multigene family. J Exp Med 1989; 169:1757-1769. Johnson KR, Naussef WM, Care A, et al: Characterization of cDNA clones for human myeloperoxidase: Predicted amino acid sequence and evidence for multiple mRNA species. Nu cleic Acids Res 1987;15:2013-2028. Sakamaki K, Tomonaga M, Tusukui K, Nagata S: Molecular cloning and characterization of a chromosomal gene for human eosinophil peroxidase. J Biol Chem 1989;264:16828-16836. Gleich GJ, Loegering DA, Bell MP, et al: Biochemical and functional similarities between human eosinophil-derived neu rotoxin and eosinophil cationic protein: Homology with ribo nucléase. Proc Natl Acad Sei USA 1986;83:3146-3150. Ackerman SJ, Gleich GJ, Loegering DA, et al: Comparative toxicity of purified human eosinophil granule cationic proteins for schistosomula of Schistosoma mansoni. Am J Trop Med Hyg 1985;34:735-745. Hamann KJ. Barker RL, Loegering DA, Gleich GJ: Compara tive toxicity of purified human eosinophil granule proteins for newborn larvae of Trichinella spiralis. J Parasitol 1987;73: 523-529. Slifman NR, Loegering DA, McKean DJ, Gleich GJ: Ribonu cléase activity associated with human eosinophil-derived neu rotoxin and eosinophil cationic protein. J Immunol 1986; 137: 2913-2917. Hamann KJ, Barker RL, Loegering DA, et al: Sequence of hu-
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/30/2018 11:27:41 PM
H am ann/Barker/Ten/G leich
208
209
The Molecular Biology of Eosinophil Granule Proteins
27
28
29
30
31
32 Hamann KJ, Ten RM, Loegering DA, et al: Structure and chromosome localization of the human eosinophil-derived neu rotoxin and eosinophil cationic protein genes: Evidence for intronless coding sequences in the ribonucléase gene superfamily. Genomics 1990;7:535-546. 33 Weremowicz S, Fox EA, Morton CC: Assignment of human angiogenin gene to chromosome I4ql I-q13 (abstract). Cytogenet Cell Genet 1989:51:1107. 34 Lewin B: Genes, ed 3. New York, Wiley, 1987. 35 Parslow TG, Blair DL, Murphy WJ, Granner DK: Structure of the 5' ends of immunoglobulin genes: A novel conserved se quence. Proc Natl Acad Sci USA 1984;81:2650-2654.
Correspondence to: Dr. K.J. Hamann Section of Pulmonary and Critical Care Medicine Box 98 University of Chicago 5841 S. Maryland Avenue Chicago, IL 60637 (USA)
Downloaded by: Univ. of California Santa Barbara 128.111.121.42 - 3/30/2018 11:27:41 PM
26
man eosinophil-derived neurotoxin cDNA: Identity of deduced amino acid sequence with human unsecretory ribonucleases. Gene 1989;83:161-167. Rosenberg HF, Tenen DG, Ackerman SJ: Molecular cloning of the human eosinophil-derived neurotoxin: A member of the ribonucléase gene family. Proc Natl Acad Sci USA 1989:86: 4460-4464. Beintema JJ, Hofsteenge J, Iwama M. et al: Amino acid se quence of the nonsecretory ribonucléase of human urine. Bio chemistry 1988:27:4530-4538. Sorrentino S, Turner GK, Glitz DG: Purification and character ization of a ribonucléase from human liver. J Biol Chem 1988: 263:16125-16131. Barker RL, Loegering DA, Ten RM, et al: Eosinophil cationic protein cDNA: Comparison with other toxic cationic proteins and ribonucleases. J Immunol 1989:143:952-955. Rosenberg FIF, Ackerman SJ, Tenen DG: Human eosino phil cationic protein: Molecular cloning of a cytotoxin and helminthotoxin with ribonucléase activity. J Exp Med 1989:170: 163-176. Olsson I, Persson AM, Wingvist I: Biochemical properties of the eosinophil cationic protein and demonstration of its biosyn thesis in vitro in marrow cells from patients with an eosinophilia. Blood 1986:67:498-503.
