Cell, Vol. 60, 733-746,

March 9, 1990, Copyright

0 1990 by Cell Press

The MyoD DNA Binding Domain Contains a Recognition Code for Muscle-Specific Gene Activation Robert L. Davis,‘* Pei-Feng Cheng, Andrew B. Lassar: and Harold Weintraub’ Department of Genetics Hutchinson Cancer Research Center 1’124 Columbia Street Seattle, Washington 98104 t IDepartment of Pathology University of Washington Seattle, Washington 98195 l

Summary A 60 amino acid domain of the myogenic determination gene MyoD is necessary and sufficient for sequence-specific DNA binding in vitro and myogenic conversion of transfected C3HlOT112 cells. We show that a highly basic region, immediately upstream of the helix-loop-helix (HLH) oligomerization motif, is required for MyoD DNA binding in vitro. Replacing helixl, helix2, or the loop of MyoD with the analogous sequence of the Drosophila T4 achaete-scute protein (required for peripheral neurogenesis) has no substantial effect on DNA binding in vitro or muscle-specific gene activation in transfected C3HlOT1/2 cells. However, replacing the basic region of MyoD with the analogous sequence of other HLH proteins (the immunoglobulin enhancer binding El2 protein or T4 achaetes’cute protein) allows DNA binding in vitro, yet abolishes muscle-specific gene activation. These findings suggest that a recognition code that determines muscle-specific gene activation lies within the MyoD basic region and that the capacity for specific DNA binding is insufficient to activate the muscle program. Introduction The myogenic determination gene MyoD is one member of a family of genes regulating mammalian skeletal musclle development (Davis et al., 1987; Wright et al., 1989; Braun et al., 1989; Edmondson and Olson, 1989). Experimental expression of a MyoD cDNA in a variety of mesodermal and nonmesodermal cell types activates muscle-specific gene expression under conditions that promote differentiation (Weintraub et al., 1989). This observation suggests that MyoD can activate the myogenic program either alone or in combination with non-tissuesipecific factors present in many cell types. Deletion mutagenesis of MyoD has revealed that a segment of about 60 amino acids in total length, a highly basic region followed by a region of similarity to the Myc protein family, is necessary and sufficient for myogenesis in stably transfected C3HlOT1/2 mouse embryo fibroblasts (lOTV2 c’ells) (Tapscott et al., 1988). Together, these regions constitute a conserved segment of 50 to 70 amino acids present in gene products implicated in transcriptional regulation, such as those of the Drosophila achaete-scufe

complex (AS-C, which is required for peripheral neurogenesis; Cabrera et al., 1987, and references therein), twist (Thisse et al., 1988), daughterless (Caudy et al., 1988; Cronmiller et al., 1988), hairy (Rushlow et al., 1989), and the non-tissue-specific K immunoglobulin enhancer binding proteins El2 and E47 (Murre et al., 1989a). Two other cloned myogenic regulatory genes, myogenin (Wright et al., 1989; Edmondson and Olson, 1989) and myfd (Braun et al., 1989), encode distinct proteins with substantial homology over the basic region and Myc similarity region, suggesting that they function similarly to MyoD. Expression of a MyoD cDNA in some fibroblast cell lines activates expression of the endogenous MyoD gene and myogenin, and expression of a myogenin or myf-5 cDNA can activate MyoD expression (Thayer et al., 1989; Braun et al., 1989); thus, a complex interplay among these factors may regulate myogenic determination and differentiation. MyoD is a sequence-specific DNA binding protein (Lassar et al., 1989; see also Buskin and Hauschka, 1989). It can bind in vitro to sequences in the enhancer of the muscle creatine kinase (MCK) gene. These sequences are required for maximal muscle-specific expression of MCKchloramphenicol acetyltransferase (CAT) reporter genes (Jaynes et al., 1988; Lassar et al., 1989). MyoD can also bind to other similar sequences implicated in the regulation of muscle-specific genes, such as myosin light chain and desmin (Lassar et al., 1989). The same domains of MyoD required for myogenesis in transfection assays are necessary and sufficient for DNA binding to the MCK enhancer (Lassar et al., 1989). From analysis of the primary amino acid sequence of the Myc similarity region in E12, E47, MyoD, AS-C proteins, and daughterless, it has been proposed that there is a motif of 40 to 50 amino acids that has the potential to form two amphipathic a helices, separated by a linker of variable sequence and length referred to as a loop (Murre et al., 1989a). The adjacent region amino-terminal to the helix-loop-helix (HLH) motif usually contains clusters of basic residues (Tapscott et al., 1988). The HLH motif has been shown to mediate oligomerization by HLH-containing proteins. For instance, MyoD can form a hetero-oligomer with E12, and this oligomer can form in the absence of DNA binding (Murre et al., 1989b). Combined as an oligomer, these two proteins bind with greater affinity than either alone to the K immunoglobulin E2 enhancer, which contains a core CANNTG sequence found in heavy and light chain immunoglobulin enhancer elements (Ephrussi et al., 1985; Lenardo et al., 1987), the insulin enhancer (Moss et al., 1988), and the MCK enhancer (Buskin and Hauschka, 1989). The results of these studies suggest the possibility that the specificity and modulation of transcriptional control by HLH proteins is a function of combinatorial interactions among them. We have used site-directed mutagenesis to test the idea that MyoD DNA binding and oligomerization are Separable functions mediated by subdomains within the basic

Cell 734

A

helix-loop-helix (B-HLH) region. The ability of MyoD to form hetero-oligomers with the El2 gene product requires a functional HLH motif. This region in MyoD is essential for, but can function independent of, DNA binding. MyoD can also form DNA binding homo-oligomers. The adjacent highly basic region is required for DNA binding, and appears to be the principal mediator of binding. Disruption of the basic region results in MyoD mutants that can inhibit wild-type MyoD trans-activation in vivo. Substituting either helix segment or the loop of MyoD with the analogous sequence from the Drosophila T4 AS-C protein generates MyoD mutants that bind DNA in vitro and can activate myogenesis in transfected lOT1/2 cells. In contrast, substituting the basic region of MyoD with the analogous regions of El2 or T4 AS-C proteins generates mutants that bind specifically to DNA in vitro, but do not activate myogenesis significantly in transfection assays. The critical part of the MyoD basic region contains 13 amino acids, of which only 6 are different between MyoD and E12. Our data suggest that the MyoD basic region encodes a “specificity function,” separable from DNA binding per se, which is required for activation of muscle-specific genes. Results

Free - MCK OIlgo 1

2

3

4

5

6

7

8

9

10

B ElZWTDM63-99DM3-56-

-TM270

-DM3-56; TM167

Figure 1. DNA Binding of MyoD and El2 to the MCK Enhancer (A) Electrophoretic mobility shift assays were performed using 5 ul (lanes l-4) or 7.5 91 (lanes 5-10, 30 ul reactions) of nonradioactively labeled in vitro translated wild-type (WT) MyoD or mutant MyoD, and E12. Added mixed reticulocyte lysates contained the following specific proteins: none (no RNA translation control, lane l), WT (lane 2). WT+DM63-99 (lane 3) DM63-99 (lane 4) W (lane 5) El2 (lane 6) WT+EiP (lane 7), DM3-56+E12 (lane 8) TM270+E12 (lane 9) and DM3-56;TMW+E12 (lane 10). Note that lanes l-4 are from a separate gel in which the oligonucleotide probe was run off the gel to resolve the complexes. DM, deletion mutant with amino acids depleted, inclusive; TM, truncation mutant with termination codon at amino acid listed; i.e., DM366TM167 MyoD mutant is missing amino acids 3 through 56 and 167 through 318 (normal termination), inclusive. Protein mixing prior to DNA binding reactions enhances, but is not required for, formation of these complexes (data not shown). (6) SDS-PAGE analysis was performed on parallel s%-labeled in vitro translation products, RNA primed reticulocyte lysates were mixed as in (A) prior to gel analysis. Lane order is the same as in (A). No obvious alteration in MyoD or El2 is observed with mixing. In addition, we have not observed any mobility-altering, posttranslational modification of s%-labeled MyoD or El2 from DNA binding reactions (data not shown).

MyoD Forms Homo-Oligomeric and Hetero-Oligomeric DNA Binding Complexes on the MCK Enhancer We investigated the binding of in vitro translated wild-type mouse MyoD and human El2 to the MCK enhancer sequence, since independent evidence indicates a role for El2 in both MyoD DNA binding in vivo and muscle-specific gene activation. Most, if not all, MyoD DNA binding activity obtained from myocyte nuclear extracts represents MyoD complexed with a protein or proteins sharing epitopes with El2 (unpublished data). Moreover, we have generated lOT112 fibroblast cell lines that express antisense El2 RNA. These lines grow normally but have substantially reduced El2 protein levels. When challenged to activate myogenesis by 5-azacytidine treatment or by infection with a MyoD-expressing retrovirus, these antisense El2 lines fail to convert to muscle (unpublished data). The probe used for an electrophoretic mobility shift assay is a 25 bp oligonucleotide representing the high affinity MyoD binding site from the MCK enhancer. Wildtype MyoD alone produces one major DNA binding complex (Figure lA, lane 2). An internal deletion of MyoD (DM63-99, which contains the HLH domain and adjacent basic region), generates a slightly faster mobility complex (lane 4). Mixing the two translation products prior to DNA binding generates a new intermediate mobility complex (lane 3) as well as the two original complexes in approximately a 1:2:1 ratio, demonstrating that MyoD binds to this sequence as a homo-oligomer. The El2 gene product alone (a partial human cDNA clone; Murre et al., 1989a) generates two complexes (Figure lA, lane 6). However, when MyoD and El2 are combined prior to DNA binding, a lo- to 20-fold increase in shifted oligonucleotide probe is observed, and three complexes are formed (lane 7). Since all three complexes

MyoD Mutants That Bind DNA but Do Not Activate 7:35

Myogenesis

are qualitatively or quantitatively enhanced by combining MyoD and E12, and since the complex mobilities are altered with various deletion mutants of MyoD (Figure lA, lanes 8-10) we believe these complexes are dependent on both MyoD and E12. We are currently testing whether this heterogeneity is the result of different stable conformations of MyoD-El2 heterodimers, stoichiometries other than dimers, or association with other proteins in the reticulocyte @ate. Since we cannot rule out higher order structures, we refer to these complexes as oligomers. Neither wild-type MyoD alone, El2 alone, nor any of the MyoD mutants described in this study in combination with El2 blind to a mutant oligonucleotide containing a 6 bp substitution affecting the core sequence of the MCK enhancer (CAACACCTGCTGCCT to CAACACGGTAACCCT, core sequence underlined; data not shown). The HLH Motif Is Required for Oligomerization and Functions Independently of the Basic Region and DNA Binding Previous work has shown that sequences in the B-HLH region of El2 are required for specific DNA binding, but this work did not distinguish between DNA binding and the associated oligomerization activity (Murre et al., 1989a). One goal of this study was to test the hypothesis that the basic region of the B-HLH motif is essential for DNA binding, while the HLH domain is essential for oligomerization. Figure 2A shows a schematic of the MyoD B-HLH region, divided roughly according to the proposed designation in Murre et al. (1989a). The function of each mutant MyoD protein has been analyzed in several ways. We tested oligomerization with El2 in the absence of DNA binding by a coimmunoprecipitation assay employing a MyoD-specific polyclonal antiserum. DNA binding in vitro to the MCK enhancer sequence, either alone (data not shown, but tabulated in Figures 2-5) or in combination with E12, has been examined in a mobility shift assay similar to that in Figure 1. Finally, each mutant has been tested fior muscle-specific gene activation by transfection into lOT112 fibroblasts to examine transient expression of either a cotransfected MCK enhancer-controlled CAT reporter gene (p3300MCK-CAT see Experimental Procedures), or the endogenous myosin heavy chain gene. The El2 gene product is not significantly immunoprecipitated by the anti-MyoD serum (Figure 28, lane 2) but i’s coprecipitated in association with wild-type MyoD (lane 3) or mutants deleting part (D102-114, lane 4) or all (D1021121,lane 5) of the basic region. However, deletions across the HLH domain result in only trace association in this assay (lanes 6-9). A complete MyoD HLH domain is therefore essential for oligomerization of MyoD with E12. Each of these MyoD B-HLH deletions fails to demonstrate DNA binding in combination with El2 (Figure 2C, lanes 3-8) or alone. Residual El2 DNA binding activity is present using the four mutants that fail to oligomerize with El2 (compare lanes 5-8 with lane 9) while the two basic region deletions show no residual El2 binding activity (lanes 3 and 4). This probably reflects the formation of oligomers with El2 that are defective for DNA binding, such that either basic region deletion mutant can titrate

most of the active El2 molecules added to the DNA binding reactions. None of the deletion mutants was able to function in vivo in either of the transfection assays (Figure 2A). Thus, the entire B-HLH region is required for both DNA binding and muscle-specific gene activation by MyoD. The expression of each mutant in vivo was monitored by indirect immunofluorescence using a polyclonal antiserum to wild-type MyoD. Each mutant was readily detectable after transfection, under both proliferation and differentiation conditions (data not shown).

A Functional Basic Region in MyoD Is Essential for DNA Binding The basic region contains three clusters of basic residues, designated Bl, 82, and 83, which are highly conserved among various species’ MyoD genes (Hopwood et al., 1989; see also Discussion), as well as myogenin and myf-5 (Figure 3A). Our site-directed mutants of the MyoD basic region oligomerize with El2 to the same extent as wildtype MyoD does, consistent with the idea that the basic region plays no essential role in this function (Figure 38, compare lanes 3-11 with lane 2). A two glutamine substitution in Bl, BlQQ, or a two alanine insertion between Bl and 82, Bl(A2)B2, binds to DNA in combination with El2 as well as wild-type MyoD mixed with El2 (Figure 3C, compare lanes 2 and 3 with lane 1). However, a two glutamine substitution in 82 results in substantial attenuation of DNA binding when mixed with El2 (lane 4). All of the remaining mutants, affecting the spacing and sequence between 82 and 83 as well as 83 itself, abolish DNA binding in the presence of El2 (Figure 3C, lanes 5-10). Basic region mutants that do not bind DNA in combination with El2 also attenuate residual El2 binding (compare lanes 5-10 with lane 11). Similar to the MyoD basic region deletions, mutations across the MyoD basic region 82 and 83 clusters result in nonfunctional DNA binding domains, even though oligomers with El2 can be formed. The BlQQ and Bl(A2)B2 mutants activate myogenesis in both transfection assays (Figure 3A). The remaining mutants of this series have only trace or no significant myogenic activation in either transfection assay. The immunofluorescence staining pattern of MyoD is similar for these mutants compared with wild type under proliferation conditions; however, under differentiation conditions, all of the defective mutants of the MyoD basic region (except the deletion mutants) show a lower percentage of MyoDpositive cells and a lower average MyoD nuclear staining intensity (data not shown). We conclude from this mutant series that MyoD DNA binding activity is highly sensitive to mutations of the 82 and 83 clusters in the basic region as well as the sequence between them, suggesting that some or all of these residues play a critical role in this binding. Lack of muscle-specific gene activation by these basic region mutants parallels the loss of DNA binding activity. We cannot rule out the direct participation of HLH residues in DNA binding at this time, although it is likely that the HLH motif is indirectly required for DNA binding, probably to juxta-

Cell 736

102

Transient Transfectlon I I #Mvosinl+) MCK-CAT MyoDtE12 CO30 Fields Activity Immunoppt. (%Wild-type)

316

162

MY00

1

Wild-type

kRKTTNADRRKAATMRERRRlLSK”NEAFETLKRCT

D102.114

(KFiKlTNADRRKAA}

0

3.6

+

D102.121

(KRKTTNADRRKAATMRERRR)

0

2.5

+

0102.135

(KRKnNADRRKAATMRERRRhKVNEAFETLKRC)

0

2.7

-

0

2.9

-

0

2.0

-

0

2.3

-

D122-136

D137-145

D143-162

1 SSNPNQRLPI KVEILRNAIRYIEGLOA

(LSKVNEAFETLKRCT)

(SSNPNQRLP)

(RLP~VEILRNAIRYIEGLQA]

1

100

100.0

+

A MyoD+EIP DNA Binding

MyoD DNA Binding

+

+

Figure 2. Deletion Analysis of the MyoD B-HLH Region (A) A schematic is shown of the MyoD wild-type sequence and the amino acids deleted in this series of mutants (in brackets). Vertical dotted lines indicate where the borders of domains in the mutants occur relative to wild type. The number of myosin heavy chain-positive cells obtained with wild-type MyoD in the transient transfections in this series was 870; the number of positive cells with the expression vector lacking a cDNA insert was 0. The percentage of CAT activity with cotransfection of the expression vector lacking a cDNA insert was 2.3% of wild type. 1 2 3 4 5 6 7 6 9 3456769 1 2 (B) Coimmunoprecipitation of El2 with MyoD D deletion mutants was performed after mixing %-labeled in vitro translation products by addition of an anti-MyoD polyclonal antiserum -MyoD (directed against MyoD amino acids 60-219; Tapscott et al., 1988). Samples were processed for SDS-PAGE, followed by fluorography. Immunoprecipitated proteins were the following: wild-type (WT) MyoD alone (lane l), El2 alone (lane 2) WT+ElP (lane 3) D102-114+E12 (lane 4) D102121+E12 (lane 5) D102-135+E12 (lane 6) D122-136+E12 (lane 7) DW-145+E12 (lane 8) and 0145162+E12 (lane 9). The lower molecular weight species represent premature termination products of MyoD translation. (C) DNA binding analysis of the MyoD deletion mutants combined with El2 was performed as described in Experimental Procedures using 5 ul of nonradioactively labeled in vitro translation products. Sample order is as follows: no RNA translation control (lane l), wild-type @VT) MyoD+ElP (lane 2) D102-114+E12 (lane 3) D102-121+E12 (lane 4) Dl02-135+E12 (lane 5), D122-136+E12 (lane 6) D137-145+E12 (lane 7) D143-162+E12 (lane 8) El2 alone (lane 9). (D) SDS-PAGE analysis was performed on parallel 35S-labeled in vitro translation products. RNA-primed reticulocyte lysates were mixed as in (C) prior to gel analysis. Lane order is the same as in (C).

pose the two basic regions of MyoD and El2 such that a functional chimeric DNA binding domain can be formed. The Loop May Be Required to Keep the Helix Segments Structurally Distinct The next series of mutants were generated to probe more finely the function of the HLH motif in oligomerization and subsequent DNA binding (Figure 4A). A two alanine inser-

tion was made at the junction between the basic region and helixl, 63(A2)Hl. The B3(A2)Hl mutant oligomerized well with El2 (Figure 48, lane 3) suggesting that the junction is probably not crucial to the oligomerization function of helixl. We cannot rule out that the basic region and helix1 are structurally coupled, such as in a continuous a helix. However, the B3(A2)Hl “junction” mutant did not bind DNA when combined with El2 and attenuated resid-

MyoD Mutants That Bind DNA but Do Not Activate 737

MYOD

1

102

Myogenesis

162

318

HELIX 1 tillId-type

Bl 82 83 K~TTNADRRW\ATMRERRR

SKVNEAFETLKRCT

SSNPNQRLP KVEILRNAIRYIEGLOA

#Mvosin(+l MCK-CA1 30 Fields Act~vify (%Wild-type)

MyoD+ElZ COlmmunoppt

MyoD+ElP C)NA BIndIng

100

+

+

87

+

+

+

+

62

El (A2)BZ

-TTN(A2JADR

BZcn

-NADQQ+U,

0

W(A7)83

pRRK(A7JAAT

0

0.8

+

BZ(A2)83

RKAMATM

0

1.0

BZProB3

RKAETMR

0

3.0

0

2.2

0

1.2

0

0.5

01 13-l 14 pRRK(AA)TMR

E/D118

-

TMRDRRR

MyoD DNA BIndIng

+

+

+

+

+

+

Figure 3. Site-Directed Basic Region

Mutants of the MyoD

(A) A schematic is shown of the MyoD wild-type sequence. Amino acid changes in the basic region mutants are underlined. The Bl. 82, and C 83 clusters are marked above the wild-type sequence. Alanine insertions (AX, where X = number of alanines) are in parentheses, and the one deletion, D113-114, is bracketed. Three amino acids of authentic MyoD sequence flank the indicated changes. Vertical dotted lines indicate where the borders of domains in the mutants occur relative to wild type. The number of 12 34 5 6 7 891011_ 1 2 3 4 5 6 7 8 9 10 11 u myosin heavy chain-positive cells obtained with wild-type MyoD in the transient transfec-El2 tions in this series was 590; the number of posi-MyoD tive ceils with the expression vector lacking a cDNA insert was 0. The percentage of CAT activity with cotransfection of the expression vector lacking a cDNA insert was 0.5% of wild type (except for B2ProB3, which was 2.3% of wild type). (13) Coimmunoprecipitation of El2 with MyoD basic region mutants was performed after mixing 35S-labeled in vitro translation products by addition of an anti-MyoD polyclonal antiserum (directed against MyoD amino acids 160-307; Tapscott et al., 1988). Samples were processed for SDS-PAGE, followed by fluorography. lmmunoprecipitated proteins were the following: El2 alone (lane l), wild-type (WT) MyoD+ElP (lane 2). BlOQ+ElP (lane 3) Bl(A2)B2+E12 (lane 4) B20Q+E12 (lane 5) B2(A7)B3+E12 (lane 6) B2(A2)83+E12 (lane 7) B2ProB3+E12 (lane 8) D113-114+E12 (lane 9) Ei/D118+E12 (lane lo), and B3QQ+E12 (lane 11). The lower molecular weight products represent premature termination products of MyoD translation. (13) DNA binding analysis of the MyoD basic region mutants combined with El2 was performed as described in Experimental Procedures using 5 ul of nonradioactively labeled in vitro translation products. Sample order was as follows: wild-type (WT) MyoD+ElP (lane 1) BlQQ+ElP (lane 2) Etl(A2)B2+E12 (lane 3) B2QQ+E12 (lane 4) B2(A7)B3+E12 (lane 5) B2(A2)B3+E12 (lane 6) B2ProB3+E12 (lane 7) D113-114+E12 (lane 8) E/D118+E12 (lane 9), B3QQ+E12 (lane lo), El2 alone (lane 11). (13) SDS-PAGE analysis was performed on parallel s5S-labeled in vitro translation products. RNA primed reticulocyte lysates were mixed as in (C) prior to gel analysis. Lane order is the same as in (C).

ual El2 binding (Figure 4C, lane 2; compare with lane 11). We believe that this reflects the misalignment of the basic region with respect to the HLH motif and that this alignment is crucial for proper DNA contacts. Proline substitutions in helix1 or helix2, HlPro and H2Pro, abolished oligomerization, as expected if these sequences

are forming a-helical secondary structures (Figure 48, lanes 4 and 11). A proline substitution in the loop, LPro. had no effect on oligomerization, nor did a two or three alanine substitution, LSubAP and LSubA3, nor a six alanine insertion, L(A6), in the loop (Figure 48, lanes 5, 6, 9, and 10). A seven or nine alanine substitution in the loop,

Cell 730

*Mvosin(

+

MCK-CAT

30 Flelds

Actiwty

(%Wlld-type) MVoD Wild-type

B3(AZ)Hl

MyoD+El? CO-

MyoD+ElP DNA

DNA

Imm”noppf.

BIndIng

Bmdmg

+

+

> %TTNAD?ikATMFE~

LSKVNEAFETLKRCT

SSNPNQRLP

KYEILRNAIRYIEGL

100.0

0.3

RRR\AP)LSK

+

iHIP,0

0.6

EAFETLK

LSubA2

SSNANORL&E

48.3

LSubA3

SSNMRLP

40.8

LSubA7

CTSAAAAAAAPKV ~------I

LSubA9

RCiAAAAAAAAAkVE

+

+

+

+

44.0

+

0.3 I

LP,O

NpN!RLp

103.6

UAW

SNP(AG)NQR -

134.9

tIPPro

NAlEYlE -

+

+

+

+

0.4

Figure 4. Site-Directed HLH Motif

Mutants of the MyoD

(A) A schematic is shown of the MyoD wild-type sequence. The HLH subdomains are abbreviated Hl, L, and H2. Amino acid changes in C this series of mutants are underlined. Alanine *II ahlli-El2 insertions (AX, where X = number of alanines) are in parentheses. Three amino acids of authen-MyoD tic MyoD sequence flank the indicated changes. Vertical dotted lines indicate where the borders of domains occur in the mutants relative to wild type. The number of myosin heavy chain-posi. tive cells obtained with wild-type MyoD in the transient transfections in this series was 870; the number of positive cells with the expression vector lacking a cDNA insert was 0. The percentage of CAT activity with cotransfection of the expression vector lacking a cDNA insert was 0.7% of wild type (except for LSubA7, which was 2.3% of wild type). (B) Coimmunoprecipitation of El2 with MyoD HLH mutants was performed after mixing 35S-labeled in vitro translation products by addition of an anti-MyoD polyclonal antiserum (directed against MyoD amino acids 160-307). Samples were processed for SDS-PAGE, followed by fluorography. lmmunoprecipitated proteins were the following: El2 alone (lane l), wild-type (WT) MyoD+EiP (lane 2) B3(A2)Hl+E12 (lane 3) HlPro+El2 (lane 4) LSubA2+E12 (lane 5) LSubA3+E12 (lane 6), LSubA7+E12 (lane 7) LSubAS+ElP (lane E), LPro+ElP (lane 9) L(A6)+E12 (lane lo), and H2Pro+E12 (lane 11). Normalizing the amount of the LSubA7 and LSubA9 mutants to wild-type MyoD in later experiments still failed to reveal any significant association with E12. (C) DNA binding analysis of the MyoD HLH mutants combined with El2 was performed as described in Experimental Procedures using 5 ul of nonradioactively labeled in vitro translation products. Sample order is as follows: wild-type (WT) MyoD+ElP (lane 1). B3(A2)Hl+E12 (lane 2) HlPro+El2 (lane 3) LSubA2+E12 (lane 4) LSubA3+E12 (lane 5) LSubA7+E12 (lane 6) LSubAS+E12 (lane 7) LPro+E12 (lane 8) L(A6)+E12 (lane 9), H2Pro+E12 (lane IO), El2 alone (lane 11). (D) SDS-PAGE analysis was performed on parallel 35S-labeled in vitro translation products. RNA primed reticulocyte lysates were mixed as in (C) prior to gel analysis. Lane order is the same as in (C).

LSubA7 and LSubA9, resulted in little to no oligomerization by the coimmunoprecipitation assay (Figure 48, lanes 7 and 8). The loop mutants that oligomerize with El2 bind DNA well when mixed with El2 (Figure 4C, lanes 4, 5, 8, and 9). The LSubA7 mutant also binds DNA when combined with El2 (lane 6), but the LSubA9 mutant, in which the loop contains two more alanines and no proline, forms

only a very weak DNA binding oligomer (lane 7). We believe that this difference reflects the requirement of the loop to uncouple structurally the helix segments so that they form two separate subdomains within the HLH motif. Short alanine-based peptides are known to form stable a helices (Marqusee et al., 1989) so that it is possible that the LSubA7 and LSubA9 substitutions are imposing a structure on the loop, resulting in a weaker oligomeriza-

MyoD Mutants That Bind DNA but Do Not Activate 739

Myogenesis

tion that is disrupted by the salt and detergent concentrations used for the immunoprecipitation assay. However, under conditions of the DNA binding assay, the LSubA7 mutant can oligomerize with El2 to bind DNA, while the LSubA9 mutant interacts with El2 only very weakly (see Discussion). The MyoD HLH mutants that bind DNA significantly in combination with El2 also activate myogenesis in the transfection assays (Figure 4A). Domain Replacement Mutants of the MyoD B-HLH Region: Replacement Mutants of the MyoD Basic Region Can Bind DNA but Fail to Activate Myogenesis To investigate whether B-HLH subdomains from other proteins can substitute for those in MyoD, we constructed a set of MyoD mutants where these subdomains in MyoD are individually replaced with the analogous sequence from other B-HLH proteins (Figure 5A). We first replaced the basic region of MyoD with that of E12. This mutant, ElPBasic, oligomerized with the El2 protein to the same extent as wild-type MyoD did (Figure 58, lane 3; compare with lane 2). In addition, the E12Basic mutant bound DNA in combination with E12, with about one-half the apparent affinity of wild-type MyoD (Figure 5C, lane 2; compare with lane 1). In transfections, surprisingly, the El2Basic mutant di’d not activate myogenesis (Figure 5A). Like the previously described basic region mutants of MyoD, the E12Basic mutant also shows less MyoD immunoreactivity than wild type by indirect immunofluorescence under differentiation conditions, while immunoreactivity is comparable to wild type under proliferation conditions. However, MyoD-positive, myosin heavy chain-negative cells are still easily detectable. Thus, it is possible to generate a mutant of MyoD that oligomerizes with E12, binds DNA qualitatively in a similar fashion as wild-type MyoD, yet fails to activate myogenesis in vivo. This observation suggests that a myogenic activation function separable from intrinsic DNA binding is conferred by the sequence of the MyoD basic region. We next replaced each segment of the Et-HLH region of MyoD with the analogous sequence of a different positive cell type determination factor, the Drosophila T4 AS-C gene product, which is part of a complex locus required far peripheral neurogenesis. The results with the basic region substitution were similar to that of the ElPBasic mutant. The T4Basic mutant oligomerized with El2 (Figure 5B, lane 4), and bound DNA in combination with El2 about one-half as well as wild-type MyoD (Figure 5C, lane 3:). Like the E12Basic mutant, the T4Basic mutant did not activate myogenesis substantially in the transfection assays (Figure 5A). Changing the loop sequence to that of T4 AS-C had no effect on oligomerization with El2 (Figure 58, lane 6) even though this substitution dramatically alters the sequence and more than doubles its length. This mutant bound DNA when mixed with El2 to the same extent as wild-type MyoD (Figure 5C, lane 5). It also bound DNA by itself to the same extent as wild type, suggesting that this substitution had no effect on MyoD homo-oligomerization. This mutant activated myogenesis with nearly wild-type levels in the transfection assays (Figure 5A).

The T4 AS-C helix substitutions failed to oligomerize significantly with El2 in the coimmunoprecipitation assay (Figure 58, lanes 5 and 7), although both bound to DNA in combination with El2 (Figure 5C, lanes 4 and 6). The smaller amount of binding complexes with the T4Helixl mutant correlates with its lower in vitro translational efficiency compared with wild type (Figure 5D). The lack of oligomerization with El2 in the coimmunoprecipitation assay versus the DNA binding assay probably reflects a weaker association that can be disrupted by the salt and detergent conditions used for immunoprecipitation, since we have been able to detect some association of the T4Helixl and T4Helix2 mutants with El2 by coimmunoprecipitation when the salt and detergent concentrations are lowered (data not shown). That the T4Helixl and T4Helix2 mutants function in both transfection assays suggests that the helix subdomains are not the principal mediators of muscle-specific gene activation (Figure 5A). We next generated a similar set of domain replacement mutants with the mouse c-Myc sequence. The basic region substitution, MycBasic, oligomerized well with El2 (Figure 5B, lane 8), but failed to bind DNA when mixed with El2 (Figure 5C, lane 7) or by itself. It also attenuated residual El2 DNA binding activity, similar to previous MyoD basic region mutants (see Figure 3). The MycHelixl and MycHelix2 mutants failed to oligomerize with El2 (Figure 5B, lanes 9 and 11) and also failed to bind DNA significantly in combination with El2 (Figure 5C, lanes 8 and 10) or by themselves. The MycBasic, MycHelixl, and MycHelix 2 mutants all failed to activate myogenesis in the transfection assays (Figure 5A). Only the MycLoop substitution showed in vitro function (Figure 58, lane 10, and Figure 5C, lane 9) and in vivo function (Figure 5A), again pointing to the relatively large variation tolerated in the loop sequence. The MycBasic, MycHelixl, and MycHelix2 sequences do not substitute in vitro or in vivo for the analogous sequences in MyoD. The contrast with the T4 AS-C domain substitutions implies a different structure and function of the B-HLH region in c-Myc from that in determination factors like T4 AS-C and MyoD. Coimmunoprecipitation and DNA binding assays with authentic c-Myc failed to reveal any interaction with MyoD or El2 (data not shown). Basic Region Mutants of MyoD Can Act As Dominant-Negative Inhibitors of Wild-Type MyoD We have shown that a variety of mutants in the basic region of MyoD oligomerize well with E12, yet fail to bind DNA when mixed with El2 and attenuate residual El2 DNA binding activity. If MyoD is functioning in cells in the form of an oligomeric complex, then basic region mutants should act in adominant-negative fashion and inhibit wildtype MyoD activity by titrating the other species normally associating with MyoD. We tested this possibility by cotransfecting lOTl12 cells with an excess of several of these basic region mutants or HLH motif mutants (which should not act in a dominant-negative fashion since they do not oligomerize) with both wild-type MyoD and the MCK-CAT reporter gene, and we assayed wild-type MyoD-dependent trans-activation of this reporter. Figure 6 shows that the three basic region mutants B2(Pro)B3, B2(A7)83, and

Cell 740

Transient

I m MCK-CAT 30 Fields Activity C%Wild-type)

HELIX 1 Wild-type

KRKITNADRRKAATMRERRR

ElZBasic

WEREKERRVANNARERLR

0

0.8

T4Basic

P-QRFWAREFh

0

1.2

23

37.7

TlHellxl

LSKVNEAFETLKRCl

VKQVNNSFARLROHI

TdLoop

,

T4Helix2

MycBasic

MycHelixl

SSNPNORLP KVEILRNAIRVIEGLOA

HKKISk’DlLRIAVEYIRSLCJD I

100.0

77.9

MyoD+ElP COlmmunoppt +

h+yoD+ElZ DNA Bmding

MY-JD DNA Binding

+

+

+

+

+

+

+

+

+

0.7

SSDTEENDKFlRlHNVLERORk I

2.3

NDLKRSFFALRWI

91.5

MycLoop

MvcHeI1x2

too

130.4

I ,

A

Transfection

I

NEKAPi(VVILKKATAYILSlCIA

+

1.7

Figure 5. Domain Replacement MyoD B-HLH Region

Mutants of the

(A) A schematic is shown of the wild-type MyoD sequence. The amino acid sequences of the segments that replaced MyoD sequences are indicated. The human El2 sequence is from Murre et al. (1969a), the Drosophila T4 AS-C sequence is from Villares and Cabrera (1967) and the mouse c-Myc sequence is from Bernard et al. (1963). Vertical dotted lines indicate where the borders of domains in the mutants occur relative to wild type. The number of myo123 4 5 67 69tOll 1 2 3 4 5 6 7 6 9 10 11 sin heavy chain-positive cells obtained with D wild-type MyoD in the transient transfections in -El2 this series was 590 (except for MycHelix 1 and 44YOD MycLoop, which was 252); the number of positive cells with the expression vector lacking a cDNA insert was 0. The percentage of CAT activity with cotransfection of the expression vector lacking a cDNA insert was 0.6% of wild type (except for MycHelixl and MycLoop, which was 2.3% of wild type). (B) Coimmunoprecipitation of El2 with MyoD domain replacement mutants was performed after mixing %.-labeled in vitro translation products by addition of an anti-MyoD polyclonal antiserum (directed against MyoD amino acids 160-307). Samples were processed for SDS-PAGE, followed by fluorography. lmmunoprecipitated proteins were the following: El2 alone (lane l), wild-type (WT) MyoD+ElP (lane 2) ElPBasic+ElP (lane 3) T4Basic+E12 (lane 4), T4Helixl+E12 (lane 5) T4Loop+E12 (lane 6) T4Helix2+E12 (lane 7) MycBasic+ElZ (lane Et), MycHelixl+ElZ (lane 9) MycLoop+ElP (lane lo), and MycHelixP+El2 (lane 11). Normalizing the amount of the T4Helixl and MycHelixl mutants to wild type in later experiments failed to reveal any significant association with E12. (C) DNA binding analysis of the MyoD domain replacement mutants combined with El2 was performed as described in Experimental Procedures using 5 ul of nonradioactively labeled in vitro translation products. Sample order is as follows: wild-type (WT) MyoD+ElP (lane l), El2Basic+El2 (lane 2) T4Basic+ElP (lane 3) T4Helixl+E12 (lane 4) T4Loop+E12 (lane 5) T4Helix2+E12 (lane 6) MycBasic+E12 (lane 7) MycHelixl+ElZ (lane 6) MycLoop+ElP (lane 9) MycHelixZ+ElP (lane lo), El2 alone (lane 11). (D) SDS-PAGE analysis was performed on parallel 35S-labeled in vitro translation products. RNA primed reticulocyte lysates were mixed as rn (C) prior to gel analysis. Lane order is the same as in (C).

D113-114 all inhibit CAT reporter Vans-activation by wildtype MyoD compared with control expression vector cotransfection (Figure 6, lanes 3-8; compare with lanes 1 and 2; independent transfections done in duplicate). The two helix2 mutants, D143-162 and H2Pro, failed to have a

substantial effect (lanes 9-12). Although the H2Pro mutant showed some attenuation, it was not nearly as much as the basic region mutants. These results demonstrate that the HLH motif of MyoD is functional in the cell as in the in vitro assays, indepen-

MyoD Mutants That Bind DNA but Do Not Activate 741

Wild-type

MyoD

Myogenesis

+ MCK-CAT

Figure 6. Basic Region Mutants of MyoD Dominantly Inhibit Wild-Type MyoD Activation of MCK-CAT Five micrograms of pEMSVscribe-MyoD, expressing wild-type MyoD, 5 pg of p3300MCKCAT, and 30 pg of test vectors were cotransfected into lOTV2 cells. Cells were harvested to assay CAT activity after 2 days in differentiation medium. Duplicate, independent calciumphosphate precipitations were prepared for independent transfections. Test vectors expressed the following MyoD mutants: none (control expression vector lacking a cDNA insert, lanes 1 and 2), B2ProB3 (lanes 3 and 4), B2(A7)83 (lanes 5 and 6), 0113-114 (lanes 7 and 6), D143-162 (lanes 9 and lo), and H2Pro (lanes 11 and 12).

“?!

1

2

3

4

5

6

7

6

9

10

-Origin 11

dent of a functional basic region and, most likely, independent of DNA binding. In addition, these results suggest that HLH-mediated oligomerization can titrate an essential component (perhaps El2 itself) of an oligomeric complex in which wild-type MyoD normally functions. Generating mutants of the basic region, while leaving the HLH motif intact, may present a general method for creating dominant-negative mutants of B-HLH proteins. Interestingly, these mutants behave in a similar fashion to the Id gene product, both in vitro and in vivo (R. Benezra, R. L. II., D. Lockshon, and H. W., submitted). The Id gene encodes a non-tissue-specific HLH protein, and its expression is down-regulated during the terminal differentiation of myoblasts and erythroblasts. The Id protein contains an HLH motif, but no adjacent basic region. Discussion The MyoD HLH Domain Oligomerizes to Juxtapose Adjacent Basic Regions for DNA Binding IJsing site-directed mutagenesis, we have shown that the MyoD HLH motif is essential for both horn@ and heterooligomer formation. Oligomerization can occur in the absence of DNA binding (Murre et al., 1989b; this study). However, although oligomerization does not require the adjacent basic region, our results point to the basic region as a distinct functional domain required for, and the principal mediator of, DNA binding. The sequence of the two basic residue clusters (82 and 83) and the intervening sequence appear to be critical to DNA binding. Binding also requires an intact HLH motif, probably because of the requirement to form homo- or hetero-oligomers prior to or coincident with DNA binding. The exact relationship beI:ween the MyoD HLH domain and basic region is crucial, since an insertion of two alanines at the junction inhibits DNA binding but not oligomerization. Inspection of the primary amino acid sequence of the various members of the HLH protein family reveals that the loop region has the highest variability in length and se-

quence within the HLH motif. The only consistent feature is the presence of residues frequently associated with P-turns (Chou and Fasman, 1974) or loops (Lesczynski and Rose, 1986), which is why this region was originally so named (Murre et al., 1989a). Although our loop mutations represent a small nonrandom set, most loop changes that we introduced have little effect on MyoD function. The AS-C loop replacement, which alters the loop sequence dramatically and increases its length by 12 residues, especially illustrates this point. Myogenic specificity of MyoD does not seem to reside in the loop. Nevertheless, the loop probably has some specific function, as its length and sequence are highly conserved when comparing MyoD proteins from mouse, Caenorhabditis elegans (M. Krause, unpublished data), Drosophila (T Maniatis, A. Michelson, and S. Abmayr, personal communication), and frog (Hopwood et al., 1989). The loop sequence in human El2 is also highly similar to that of Drosophila cfaughterless (Murre et al., 1989a). Figure 7 shows two of several possible configurations of the HLH motif. The loop changes that we have generated support, but do not prove, the model shown in (B), since they suggest that the loop may be needed only to allow helix2 to bend back and interact freely with helixl. The LSubA7 mutant retains a proline at the end of the loop segment, while this proline is substituted by alanine in the LSubA9 mutant. The lack of this terminal proline in the loop may allow the putative a-helical structure of helix2 to propagate to helixl, or vice versa, via a “polyalanine helix” substitution, which would result in one larger a helix (Richardson and Richardson, 1988). Thus, acomplete deletion of the loop (D137-145) leads to a failure in oligomerization and a loop containing 7 alanines and 1 proline (LSubA7) allows oligomerization, but a loop of 9 alanines and no proline (LSubA9) does not allow oligomerization. The two T4 AS-C helix replacement mutants are notable for their myogenic activity in vivo, in addition to DNA binding in vitro. The ability of these mutants to induce myogenie conversion indicates a remarkable similarity of func-

Cell 742

El2 MyoD El2

Figure 7. Schematic of Alternative MyoD-El2 Hetero-Oligomer Structures and MyoD-Specific Basic Region Residues

(A) Single copies of MyoD and El2 are drawn for simplification. We have arbitrarily diagrammed the interaction between MyoD and (1) El2 here and in (B) as parallel. MyoD and El2 form a hetero-oligomer in which helix1 (Hi) of Hl BASIC MyoD interacts only with helix1 of E12, and ~~ZAATMRERRR LSK MyoD helix2 (H2) of MyoD interacts only with helix2 of E12, while the loop (L) has no well-defined (2) structure. This configuration is possible if an BASIC Hl imposed structure on the loop in the LSubA9 mutant, but not the LSubA7 mutant (see text), DFiRKAA;MRER~R 1 LSK ,. MyoD * alters the orientation of the loop and causes ERRVANNARERLRI VRD El2 misalignment of the helix subdomains between MyoD and E12. (B) MyoD and El2 form a parallel heteroC oligomer in which helix1 and helix2 of MyoD interact with each other; helix1 and helix2 of El2 interact with each other; and helix1 and helix2 of MyoD can interact with helix1 and helix2 of E12. (C)Those residues of the mouse MyoD basic region that are invariant among other species’ MyoD genes as well as myogenin and myf-5 are underlined in (1). Although not invariant, the methionine between the invariant threonine and arginine residues is also highly conserved among these myogenic regulatory genes, with the exception of rat and mouse myogenin, where this residue is a leucine. Of the invariant residues among the MyoD-like genes, the four that vary between mouse MyoD and human El2 are marked by asterisks in (2). MyoD

tion, and presumably structure, between the HLH of T4 AS-C and that of MyoD. These two mutants, along with the T4 AS-C loop replacement, provide evidence that helixl, the loop, and helix2 actually are relatively separable structural subdomains within the HLH motif. The two helix replacement mutants also provide evidence that the helix subdomains are not the principal mediators of the myogenie specificity of MyoD, since T4 AS-C is required in Drosophila for peripheral neurogenesis (see review by Ghysen and Dambly-Chaudiere, 1988, and references therein). Some specificity of function of the HLH motif seems evident, though, for two reasons. First, the Myc helix replacement mutants fail to oligomerize or bind DNA in combination with E12. That the superficially similar sequences of Myc helix1 or helix2 fail to function in the context of MyoD is consistent with the previous proposal that the Myc protein family represents a distinctly different class of HLH proteins (Murre et al., 1989b). Second, in more recent “domain replacement”experiments, DNA binding is inhibited, although oligomerization is not (unpublished data). Thus, only a subset of domain replacements among HLH proteins results in mutants with activities comparable to their wild-type counterparts. It is striking that these results seem to parallel other studies using site-directed mutagenesis to probe the structure and function of the leucine zipper-containing DNA binding proteins, such as C-EBP (Landschulz et al., 1989) as well as Fos and Jun (Gentz et al., 1989; Turner and Tjian, 1989; Neuberg et al., 1989; Ransone et al., 1989). Here, a dimerization motif, the leucine zipper (Landschulz et al., 1988) is on the carboxy-terminal side of an adjacent DNA binding domain rich in basic residues. The proximal 20 or so amino acids of this basic region appear to be crucial to DNA binding, while the leucine zipper-mediated di-

merization is relatively independent of a functional basic region and DNA binding. Combinatorial Interactions among HLH Proteins The MyoD basic region mutants that fail to bind to DNA can also function as dominant-negative inhibitors of wildtype MyoD in transfection assays. It seems likely that these mutants are forming oligomers in the cell and that they can titrate either wild-type MyoD, or another essential protein that must interact with wild-type MyoD, through the HLH motif before the myogenic program can be initiated. Other independent data support the possibility that El2 is the target of this inhibition, since El2 is apparently required for myogenesis in lOT112 fibroblast cells (see Results). Our view of MyoD structure is that oligomerization through the HLH motif allows juxtaposition of basic regions for the formation of chimeric DNA binding domains. Given the high positive charge of the basic region, it may be relatively unstructured in solution; but, when neutralized by the DNA phosphate backbone, it may adopt a more defined structure in the context of specific functional groups in the DNA major groove. A chimeric DNA binding domain provides an opportunity to regulate MyoD function through variation in the oligomerization partner and can effectively create an on-off switch for DNA binding. For example, an extreme case of modulated DNA binding activity would be oligomerization of MyoD with Id. Id is an HLH protein that can associate with both MyoD and E12, but, because it lacks an adjacent basic region, inhibits MyoD-El2 hetero-oligomer DNA binding in vitro and MyoDdependent rrans-activation in vivo (R. Benezra, R. L. D., D. Lockshon, and H. W., submitted). Similarly, exrramacrochaetee, a negative regulator of the AS-C in Drosophila,

MyoD Mutants That Bind DNA but Do Not Activate 743

Myogenesls

encodes an HLH protein lacking an adjacent basic region (H. Ellis and J. Posakony, personal communication; J. Garrell and J. Modolell, personal communication). Control of MyoD function through the particular choice of an oligorner partner could also provide a molecular basis for the difference in MyoD function between proliferating myoblasts and differentiated myocytes. One of the dominant-negative mutants in the MyoD basic region is B2ProB3, which contains a proline between l:he 82 and 83 clusters in the basic region. The gene products of hairy and the Enhancer of split locus in Drosophila are also HLH proteins (Klambt et al., 1989; Rushlow et al., ‘1989). Each of these gene products appears to have an inhibitory role in controlling the genes (or gene products, which are B-HLH proteins) of the AS-C locus or daughferless (Moscoso del Prado and Garcia-Bellido, 1984; Knust et al., 1987; Brand and Campos-Ortega, 1988). We have noticed that haiv and Enhancer of split gene products contain typical basic regions, except for the presence of a proline residue between the 82 and 83 clusters. This proline corresponds to MyoD residue ThrI15, which is adjacent to MyoD Ala,,,, which was substituted with proline in the B2ProB3 mutant. By analogy to the B2Pro133 mutant of MyoD, we would expect that hairy and Enhancer of split gene products could function as negative regulators of B-HLH proteins by forming hetero-oligomers with them to prevent DNA binding. T4 AS-C may have another role in combinatorial interac1:ions among HLH proteins, since there is evidence that it functions as si.sferlessB, a proposed “numerator” element gene measuring the X:A ratio for sex determination and dosage compensation (Torres and Sanchez, 1989). A “denominator” element may be an autosomal gene or genes, encoding a “negative” HLH protein (like extramacmchaetae) that “titrates” the T4 AS-C protein expressed from a single X chromosome in males. However, at a higher X:A ratio in females, excess T4 AS-C is available to interact with daughferless and positively activate Sex-lethal expression, which controls both sex determination and dosage compensation (Cline, 1988; see also Cline, 1989). ‘The Specificity for Activating Myogenesis Resides in the Basic Region of MyoD IHowis the muscle specificity of MyoD function encoded? Our interpretation of the results with the ElPBasic and ‘T4Basic mutants, which bind DNA specifically yet fail to lOOO Cilmmol; New England Nuclear). Sequencing reactions were run on 6% acrylamide gradient gels and visualized by autoradiography. Selected clones were used for preparative plasmid isolation and then sequenced again to confirm the desired mutation. The DM3-56, DM63-99, TM270, and DM4-lOlTM167 mutants have already been described (Tapscott et al., 1988; Lassar et al., 1989). The DM3-565M167 mutant has not been described previously, but has wild-type levels of In vitro DNA binding activity and lo%-15% of wild-type levels of in vivo myogenic activity. This mutant was generated by placing a stop codon at residue 167 in the DM3-56 mutant. In Vitm Transcription and Translation In vitro transcription of MyoD mutants was done directly in pEMSVscribe. The LTR and SV-40 poly(A) addition slgnal of this plasmid are flanked by T3 and T7 promoters, respectively. Wild-type or mutant MyoD plasmids were linearized with BamHl and used in preparative

T3 RNA polymerase reactions for Bluescribe plasmids (Stratagene). The 1.3 kb cDNA clone of human El2 in PBS-AlG, pE12R. has been described (Murre et al., 1989a). Generally, 30-50 pg of RNA was synthesized in a 50 pl reaction using 100 U of T3 RNA polymerase. RNA was purified, ethanol precipitated, and stored at -7OOC in diethylpyrocarbonate-treated distilled water. For in vitro translation, l-2 vg of RNA was used per 50 11 reaction for 90 min at 30°C using a pretreated rabbit reticulocyte lysate (Promega). For translations to generate nonradioactively labeled protein, minus leucine and minus methionine amino acid mixtures were each added to the reaction. Parallel translations to generate radioactively labeled proteins were done using L-FSjmethionine (>800 Cilmmol; New England Nuclear). Translation reactions were stored at -70°C. lmmunoprecipitation Five microliters of in vitro translated 35S-labeled proteins was mixed and incubated at 37°C for 20 min. After incubation, 150 pl of buffer (10 m M Tris [pH 7.41, 250 m M NaCI, 5 m M EDTA, 0.25% NP-40) containing 10 VI of anti-MyoD serum was added, followed by 20 ~1 of packed volume protein A-agarose (Repligen). The samples were shaken for 1 hr at 4OC, followed by three washes in the same buffer. Samples were then heated lo 95OC for 5 min in SDS gel sample buffer, spun, and loaded onto 10% or 12% discontinuous SDS-PAGE gels. Gels were fixed, treated with 1 M sodium salicylate for 30 min (Chamberlain, 1979), dried, and fluorographed. DNA Binding Assays For DNA binding, a 25 bp oligonucleotide containing the high affinity MyoD binding site from the MCK enhancer was used (Buskin and Hauschka, 1989; Lassar et al., 1989). The sequence of this oligonucleotide is GATCCCCCCAACACCTGCTGCCTGA, read 5’ to 3’ toward the MCK promoter. The core CANNTG sequence is underlined. The opposite strand oligonucleotide is designed such that there is a 4 base 5’overhang, which was not altered for the binding reactions. Although the data are not shown, a mutant oligonucleotide was used in parallel binding assays to test the specificity of binding. The sequence of this oligonucleotide is GATCCCCCCAACACGGTCTGCCTGA, read in the same orientation. These oligonucleotides were labeled by kinase reactions using [v-~~P]ATP (3000 Cilmmol; New England Nuclear) and T4 polynucleotide kinase (New England BioLabs), followed by removal of unincorporated label over NAP-5 columns (Pharmacia). The oligonucleotides were then denatured and annealed to a lo-fold molar excess of the opposite strand to drive most of the labeled strand into the double-stranded form. Generally, for DNA binding, nonradioactively labeled in vitro translated proteins (MyoD wild type, mutants, and E12) were mixed to give a 10 PI volume. For binding reactions using a single translation product, the volume of reticulocyte lysate was equalized with a no-RNA-added control translation. After proteins were incubated for 20 min at 3PC, 10 VI of (2x concentrated) DNA binding cocktail was added such that the final concentrations of binding cocktail components were the following: 20 m M HEPES (pH 7.6). 50 m M KCI. 1 m M dithiothreitol, 1 m M EDTA, 5% glycerol, 1 wg double-stranded poly(dldC) nonspecific competitor (Pharmacia), 0.2 ng double-stranded oligonucleotide probe (assuming 100% annealing). Quantitation of the amount of MyoD added based on parallel 35S-labeled translations yielded a concentration of about 2.3 x lo-lo M, giving about 5.8 x 10-l’ M MyoD per reaction, or a molar ratioof MyoD protein to doublestranded DNA probe of about 0.1. El2 was in about 2- to 3-fold molar excess of MyoD. Binding reactions were performed at room temperature for 15 min and then immediately loaded on to 5% PAGE gels (30X acrylamide:bisacrylamide) and run in lx TBE buffer (50 m M Tris, 50 m M boric acid, 1 m M EDTA) for 2.5 to 3.5 hr at 8 V/cm. Gels were dried directly and autoradiographed. Acknowledgments We thank our colleagues in the Department of Genetics for their thoughtful comments during the course of this work and on the manuscript. We also thank V. Akins for performing numerous CAT assays, C. Murre and D. Baltimore for human El2 and E47 clones, and I? Kim and E. O’Shea for thoughts about MyoD-El2 oligomer configurations. R. L. D. was supported by the Medical Scientist Training Program and the Cardiovascular Pathology Training Grant in the Department of

MyoD Mutants That Bind DNA but Do Not Activate 745

Myogenesis

Pathology at the University of Washington. A. B. L. is a Lucille P. Markey Scholar, and this work was supported in part by a grant from the Lucille P Markey Charitable Trust. R. L. D. would like to dedicate this paper to P D. This work was supported by a grant from the National Institutes of Health (to H. W.). Hal Weintraub dedicates this paper to Abe Worcel, a dear friend and colleague. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Fleceived November

3, 1989; revised January

Elernard, O., Cory, S., Gerondakis, S., Webb, E., and Adams, J. M. (‘1983). Sequence of the murine and human cellular myc oncogenes and two modes of myc transcription resulting from chromosome translocation in B lymphoid turnours. EMBO J. 2. 2375-2383. Elrand, M., and Campos-Ortega, J. A. (1988). Two groups of interrlelated genes regulate early neurogenesis in Drosophila melanogaste~ Floux’s Arch. Dev. Biol. 797, 457-470. Elraun, T., Buschhausen-Denker, G., Bober, E., Tannich, E., and Arnlold, H. H. (1989). A novel human muscle factor related to but distinct from MyoDl induces myogenic conversion in lOT1/2fibroblasts. EMBO J. 8, 701-709. Eluskin, J. N., and Hauschka, S. D. (1989). Identification of a myocyte nuclear factor which binds to the muscle-specific enhancer of the muscle creatine kinase gene. Mol. Cell. Biol. 9, 2627-2640. Cabrera, C. V., Martinez-Arias, A., and Bate, M. (1987). The expression of three members of the achaete-scute gene complex correlates with neuroblast segregation in Drosophila. Cell 50. 425-433. Gaudy, M., Vassin, H., Brand, M.. Tuma, R., Jan, L. Y., and Jan, Y. N. (‘1988). daughter/ess, a Drosophila gene essential for both neurogenesis and sex determination, has sequence similarities to rnyc and the achaete-scute complex. Cell 55, 1061-1067. Chamberlain, J. P. (lQ79). Fluorographic detection of radioactivity in polyacrylamide gels with the water-soluble fluor, sodium salicylate. I\nal. Biochem. 98, 132-135. Chou, P Y., and Fasman, G. D. (1974). Prediction of protein conformation. Biochemistry 13, 222-244. Cline. T. W. (1988). Evidence that sisterless-a and sisterless-b are two of several discrete “numerator elements” of the X/A sex determination signal in Drosophila that switch Sxl between two alternative stable expression states. Genetics 719, 829-862. and the promiscuity

Hopwood. N. D., Pluck, A., and Gurdon, J. 8. (1989). MyoD expression in the forming somites is an early response to mesoderm induction in Xenopus embryos. EMBO J. 8, 3409-3417. Jaynes, J. B., Johnson, J. E., Buskin, J. N., Gartside, C. L., and Hauschka, S. D. (1988). The muscle creatine kinasegene is regulated by multiple upstream elements, including a muscle-specific enhancer. Mol. Cell. Biol. 8, 62-70. Kim, K. S., and Guarente, L. (1989). Mutations that alter transcriptional activation but not DNA binding in the zinc finger of yeast activator HAPl. Nature 342, 200-203.

9, 1990.

References

Cline, T. W. (1989). The affairs of daughterless clevelopmental regulators. Cell 59, 231-234.

Gorman, C. M., Moffat, L. F., and Howard, B. H. (1982). Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2, 1044-1051.

of

Cronmiller, C., Schedl, P., and Cline, T. W. (1988). Molecular characterization of daughterless, a Drosophila sex determination gene with multiple roles in development. Genes Dev. 2, 1686-1676. Davis, R. L., Weintraub, H.. and Lassar, A. 8. (1987). Expression of a single transfected cDNA converts fibroblasts to myoblasts. Cell 57, 087-1000. Edmondson, D. G., and Olson, E. N. (1989). A gene with homology to the rnyc similarity region of MyoDl is expressed during myogenesis and is sufficient to activate the muscle differentiation program. Genes Dev. 3, 628-640. Ephrussi. A., Church, G. M., Tonegawa, S., and Gilbert, W. (1985). l3-lineage-specific interactions of an immunoglobulin enhancer with cellular factors in viva. Science 227, 134-140. (Gentz, R., Rauscher, F. J., Ill, Abate, C., and Curran, T. (1989). Parallel association of fos and jun leucine zippers juxtaposes DNA binding domains. Science 243, 1695-1699. (Ghysen. A., and Dambly-Chaudiere, C. (1988). From DNA to form: the ,achaete-scute complex. Genes Dev. 2, 495-501. (Glass, C. K., Holloway, J. M., Devary, 0. V., and Rosenfeld, M. G. 1:1988). The thyroid hormone receptor binds with opposite transcrip‘Ilonal effects to a common sequence motif in thyroid hormone and estrogen response elements. Cell 54, 313-323.

Klambt, C., Knust, E., Tietze, K., and Campos-Ortega, J. A. (1989). Closely related transcripts encoded by the neurogenic gene complex Enhancer of split of Drosophila melanogaster. EMBO J. 8, 203-210. Knust, E., Bremer, K. A., Vassin, H., Ziemer, A.. Tepass, U., and Campos-Ortega, J. A. (1987). The Enhancer of split locus and neurogenesis in Drosophila melanogaster. Dev. Biol. 122, 262-273. Landschulz, W. H., Johnson, I? F., and McKnight, S. L. (1988). The leutine zipper: a hypothetical structure common to a new class of DNA binding proteins. Science 240, 1759-1764. Landschulz, W. H., Johnson, I? F., and McKnight, S. L. (1989). The DNA binding domain of the rat liver nuclear protein C-EBP is bipartite. Science 243, 1681-1688. Lassar, A. B., Buskin, J. M., Lockshon, D., Davis, R. L., Apone, S., Hauschka, S. D., and Weintraub, H. (1989). MyoD is a sequencespecific DNA binding protein requiring a region of myc homology to bind to the muscle creatine kinase enhancer. Cell 58, 823-831. Lenardo, M., Pierce, J. W., and Baltimore, D. (1987). Protein-binding sites in lg enhancers determine transcriptional activity and inducibility. Science 236, 1573-1577. Lesczynski, J. F., and Rose, G. D. (1986). Loops in globular proteins: a novel category of secondary structure. Science 234, 849-855. Lin, Z., Dechesne, C. A., Eldridge, J., and Paterson, B. M. (1989). An avian muscle factor related to MyoDl activates muscle-specific promoters in nonmuscle cells of different germ-layer origin and in BrdUtreated myoblasts. Genes Dev. 3, 986-996. Marqusee, S., Robbins, V. H., and Baldwin, R. L. (1989). Unusually stable helix formation in short alanine-based peptides. Proc. Natl. Acad. Sci. USA 86, 4286-5290. Moscoso del Prado, J., and Garcia-Bellido. A. (1984). Genetic regulation of the Achaete-scute complex of Drosophila melanogaster. Roux’s Arch. Dev. Biol. 793, 242-245. Moss, L. G., Moss, J. B., and Rutter, W. J. (1988) Systematic binding analysis of the insulin gene transcription control region: insulin and immunoglobulin enhancers utilize similar transactivators. Mol. Cell. Biol. 8, 2620-2627. Murre, C., McCaw, P S., and Baltimore, D. (1989a). A new DNA binding and dimerization motif in immunoglobulin enhancer binding, daughterless, MyoD, and myc proteins. Cell 56, 777-783. Murre, C., McCaw, P S., Vaessin, H., Gaudy, M.. Jan, L. Y., Jan, Y. N., Cabrera, C. V., Buskin, J. N., Hauschka, S. D., Lassar, A. B., Weintraub, H., and Baltimore, D. (1989b). Interactions between heterologous helix-loop-helix proteins generate complexes that bind specifically to a common DNA sequence. Cell 58. 537-544. Neuberg, M., Schuermann, M., Hunter, J. B., and Muller, R. (1989). Two functionally different regions in Fos are required for the sequencespecific DNA interaction of the FosNun protein complex. Nature 338, 589-590. Pfeifer, K., Prezant, T., and Guarente, L. (1987). Yeast HAP1 activator binds to two upstream activation sites of different sequences. Cell 49, 19-27. Ptashne, M. (1988). How eukaryotic transcriptional ture 335, 683-689.

activators work. Na-

Ransone, L. J., Visvader, J., Sassone-Corsi, P., and Verma, I. M. (1989). Fos and Jun interaction: mutational analysis of the leucine zipper domain of both proteins. Genes Dev. 3. 770-781.

Cell 746

Richardson, J. S., and Richardson, D. C. (1988). Amino acid preferences for specific locations at the ends of a helices. Science 240, 1648-1852. Rushlow, C. A., Hogan, A., Pinchin, S. M., Howe, K. M., Lardelli, M., and Ish-Horowitz, D. (1989). The Drosophila hairy protein acts in both segmentation and bristle patterning and shows homology to N-myc. EMBO J. 8, 3095-3103. Sakai, D. D., Helms, S., Carlstedt-Duke, J., Gustafsson, J.-A., Rottman, F. M.. and Yamamoto, K. R. (1988). Hormone-mediated repression of transcription: a negative glucocorticoid response element from the bovine prolactin gene. Genes Dev. 2, 1144-1154. Schena, M., Freedman, L. l?, and Yamamoto, K. R. (1989). Mutations in the glucocorticoid receptor zinc finger region that distinguish interdigitated DNA binding and transcriptional enhancement activities. Genes Dev. 3, 1590-1601. Stern, S., Tanaka, M., and Herr, W. (1989). The Ott-1 homeodomain directs formation of a multiprotein-DNA complex with the HSV transactivator VP-16. Nature 341, 624-630. Tapscott, S. J., Davis, R. L., Thayer, M. J., Cheng, P-F., Weintraub, H., and Lassar, A. B. (1988). MyoD: a nuclear phosphoprotein required a fnyc homology region to convert fibroblasts to myoblasts. Science 242, 405-411. Thayer, M. J., Tapscott, S. J., Davis, R. L., Wright, W. E., Lassar, A. B., and Weintraub. H. (1989). Positive autoregulation of the myogenic determination gene MyoDl. Cell 58, 241-248. Thisse, B., Stoetzel, C., Gorostiza-Thisse, C., and Perrin-Schmitt, F. (1988) Sequence of the hvist gene and nuclear localization of its protein in endomesodermal cells of early Drosophila embryos. EMBO J. 7, 2175-2183. Torres, M., and Sanchez, L. (1989). The scute (T4) gene acts as a numerator element of the X:A signal that determines the state of activity of sex-lethal in Drosophila. EMBO J. 8, 3079-3086. Turner, R., and Tjian, R. (1989). Leucine repeats and an adjacent DNA binding domain mediate the formation of functional cFos-cJun heterodimers. Science 243, 1689-1894. Villares, R., and Cabrera, C. V. (1987). The achaete-scutegene complex of D. melanogaster: conserved domains in a subset of genes required for neurogenesis and their homology to myc. Cell 50, 415-424. Weintraub, H., Tapscott, S. J., Davis, R. Lassar, A. B., and Miller, A. D. (1989). genes in pigment, nerve, fat, liver, and expression of MyoD. Proc. Natl. Acad.

L., Thayer, Activation fibroblast Sci. USA

M. J., Adam, M. A., of muscle specific cell lines by forced 86, 5434-5438.

Wigler, M.. Pellicer, A., Silverstein, S., Axel, R., Urlaub, G., and Chasin, L. (1979). DNA-mediated transfer of the adenine phosphoribosyltransferase locus into mammalian cells, Proc. Natl. Acad. Sci. USA 76, 1373-1376. Wright, W. E., Sassoon, D. A., and Lin, V. K. (1989). Myogenin, a factor regulating myogenesis, has a domain homologous to MyoD. Cell 56, 607-617.