http://informahealthcare.com/bij ISSN: 0269-9052 (print), 1362-301X (electronic) Brain Inj, 2014; 28(2): 244–251 ! 2014 Informa UK Ltd. DOI: 10.3109/02699052.2013.859735
ORIGINAL ARTICLE
The negative impact of traumatic brain injury (TBI) on bone in a mouse model Hongrun Yu1,2, Heather Watt1 & Subburaman Mohan1,2 1
Musculoskeletal Disease Center, Jerry L. Pettis Memorial VA Medical Center, Loma Linda, CA, USA and 2Department of Medicine, Loma Linda University, Loma Linda, CA, USA Abstract
Keywords
Introduction: While it is well established that the brain produces hypothalamic hormones and neuropeptides that influence skeletal metabolism, the impact of traumatic brain injury (TBI) on bone is unknown. Based on the recognition from clinical studies that there is an association between TBI and long-term hypothalamic pituitary dysfunction, it was hypothesized that TBI exerts a negative impact on skeletal growth and maintenance. Methods: To test the hypothesis, this study employed a repetitive weight drop model for TBI. Four impacts were applied for four consecutive days on 5-week old female C57BL/6 J mice. Bone measurements were taken 2 weeks after the first impact. Results: Bone mineral content (BMC), bone area (B area) and bone mineral density (BMD) in the total body were reduced by 14.5%, 9.8% and 5.2%, respectively, in the impacted vs. control mice. There was a 17.1% reduction in total volumetric BMD (vBMD) and a 4.0% reduction in material vBMD in cortical bone. In trabecular bone, there was a 44.0% reduction in BV/TV. Although there was no change in the cross-sectional bone size, the tibial growth plate and the tibia itself were shortened. Conclusion: The repetitive animal TBI model produced an immediate, strong negative impact on bone mass acquisition in young mice.
Bone density, bone formation, mice, traumatic brain injury, weight drop model
Traumatic brain injury (TBI) involves damage to the brain from an external force [1]. The causes of TBI include falls, motor vehicle accidents, sports injuries and violence. The severity can be classified into mild, moderate and severe based on the length of time of lost consciousness [1]. Mild TBI accounts for almost 85% of all TBI cases [2]. TBI including mild TBI can have a host of physical, cognitive, social, emotional and behavioural effects. It is a major cause of disability and death worldwide, especially in children and young adults. More than 1.7 million people experience one TBI each year in the US [3]. The US military establishment has estimated that 22% of all combat wounds in the Iraq and Afghanistan conflicts were brain injuries, which were mainly due to blasts and gunshot wounds. Economically, authoritative data cited by the CDC showed that direct medical costs resulting from TBI and indirect costs such as lost productivity totalled an estimated $76.5 billion in the US in the year 2000 alone [4]. In addition, TBI frequently occurs in polytrauma in combination with other disabling conditions, such as spinal cord injury (SCI) and post-traumatic stress disorder (PTSD)
Correspondence: Subburaman Mohan, PhD, Musculoskeletal Disease Center, Jerry L. Pettis Memorial VA Medical Center, 11201 Benton Street (151), Loma Linda, CA 92357, USA. Tel: 1-909-825-7084, Ext 2932. Fax: 1-909-796-1680. Email: [email protected]
Received 16 May 2013 Revised 20 September 2013 Accepted 23 October 2013 Published online 26 November 2013
[5]. ‘Polytrauma’ was termed to describe injuries to multiple body parts and organs, for example, occurring as a result of blast-related wounds in combat situations. Recent data show that TBI and PTSD can and frequently co-exist with overlapping symptoms [1, 6, 7]. Mild TBI appears to increase the risk for PTSD [1]. The current study is focused on the impact of TBI on skeletal tissues based on the following rationale. First and foremost, TBI is a common cause of pituitary dysfunction, which is recognized as a sequela [8, 9]. Thirty-to-fifty per cent of TBI patients suffer from hypopituitarism [10–12]. Broadly, hypothalamic-pituitary dysfunction was identified in nearly 70% of patients following TBI [13]. The most common manifestations of hypopituitarism are growth hormone (GH), gonadotrophin and thyroid-stimulating hormone (TSH) deficiencies [14, 15]. Many pituitary hormones are involved in bone metabolism. For example, GH is an important regulator of insulin-like growth factor-1 (IGF-1), which in turn contributes to peak bone mass [16, 17]. Second, bone formation markers such as osteocalcin in serum was significantly lower in TBI patients, while collagen fragments generated by bone resorption such as pyridinoline crosslinked telopeptide domain of type 1 collagen (ICTP) were significantly higher, suggesting an imbalance between bone formation and bone resorption towards the latter [18]. Third, stroke, another condition of brain injury, tends to induce osteoporosis due to immobility [19, 20]. Animal experimental
20 14
Introduction
History
DOI: 10.3109/02699052.2013.859735
data also showed reduced bone formation after TBI [21]. Finally, rat studies showed that TBI could lead to progressive behavioural deficits including anxiety-like behaviour [22]. Animal studies using mouse PTSD models showed that anxiety behaviours were associated with reduced bone mass acquisition in young mice and deterioration of trabecular architecture in later development [23, 24]. Clinically, patients with depression have a 6–15% lower bone mineral density (BMD) and an increased risk of osteoporotic fractures [25, 26]. Based on the above evidence, the authors proposed the hypothesis that TBI exerts a negative impact on skeletal growth and maintenance. To test this hypothesis, a repetitive weight drop method was chosen to create closed-head injury in mice as a TBI model [3]. There are a number of rodent models available for TBI and three of the most commonly used are the cortical contusion injury (CCI), fluid percussion injury (FPI) and weight drop injury [27] models. However, only the weight drop injury model can achieve high velocity impact and rapid head acceleration, two of the most critical factors in producing mild, concussive brain injuries [3]. Among the weight drop models, only Marmarous et al.’s [28] rat model can create a diffuse, closed-head brain injury, which has recently been adapted for mice and can be applied repeatedly, making it possible to study the most common form of TBI, repetitive and mild TBI [3]. This study found that this model produced an immediate, statistically significant negative impact on bone mass acquisition as well as on cortical structure and trabecular architecture in young mice.
Materials and methods Animals Four-week old female C57BL/6 J mice were purchased from the Jackson Laboratory (Bar Harbor, ME). The mice were allowed 1 week to acclimate to the local environment before the experiment began at 5 weeks of age. All animals were housed in the Veterinary Medical Unit of the VA Loma Linda HealthCare System under the standard conditions of 14 hours of light, 10 hours of darkness, with an ambient temperature of 20 C and a relative humidity of 30–60%. All experimental protocols were in compliance with pertinent animal welfare regulations and were approved by the Institutional Animal Care and Use Committee of the Medical Centre. TBI protocol The apparatus used in this study was similar to the one described previously [3] and consisted of an ‘H’ shaped Plexiglas frame and a piece of aluminum foil taped on the top of it. Slits were cut in the aluminium foil in such a way that the foil barely supported the weight of a mouse placed on top of it. The top half of the frame was empty. Thus, the aluminium foil and the top half of the frame offered no resistance to a falling mouse upon impact from a dropped weight. The bottom half of the frame was filled with a sponge cushion to protect the animal from secondary injuries. This study used a 72 gram brass weight milled to a cylinder shape (8 cm long and 1 cm in diameter). This weight was
The negative impact of TBI on bone in a mouse model
245
based on the 95 gram weight for the adult mice [3] and the body weight ratio of young vs. adult mice. Since the end of the weight that touched the animal was smooth, no steel cap was used. The weight was placed inside a PVC guide tube with an inside diameter of 1.5 cm. The PVC tube was positioned on a stand just above the mouse, anterior to the ears, between bregma and lambda of the skull. To prevent movement of the animal during the impact, the mouse was anaesthetized by isoflurane inhalation (1 minute 50 seconds) before the procedure. To begin the procedure, the anaesthetized mouse was placed on the aluminium foil. The starting position of the weight was just above the head of the resting animal. The weight was pulled up 1.5 metres before being dropped. The control mice did not go through the impact, but underwent the isolfurane anaesthesia. The righting reflex response was assessed immediately, as previously described [3]. This study used a total of 14 mice with nine as experimental and five as control. The impact for the experimental mice or isoflurane exposure alone for the control mice was carried out for 4 consecutive days, with one treatment per day. Pain medicine and hydrating saline solution were administered by intraperitoneal injection, when necessary. Animal end-point and sample collection At the end of 2 weeks after the first impact, both impacted and control mice were euthanized at 7 weeks of age. A day before euthanasia, in vivo bone parameters were measured on anaesthetized mice using a PIXImus densitometer (LUNAR Corp., Madison, WI). Euthanasia was carried out with 70% carbon dioxide inhalation, followed by decapitation. Trunk blood was collected, and centrifuged at 10 000x g for 15 minutes at 4 C. The serum was stored at 70 C for later IGF-1 and ALP assays. The calvaria and right femur bones were collected and stored in liquid nitrogen for RNA isolation for real time RT-PCR. Both left and right tibias were collected, fixed in 4% formaldehyde for 48 hours and preserved in 1 phosphate buffered saline for in vitro bone parameter measurements using micro-CT. After micro-CT analysis, the left tibia was subjected to three-point bending to determine bone strength parameters. Bone parameter measurements, expression analyses and serum assays Detailed procedures have been described previously for in vivo PIXImus measurements [23, 29], for in vitro microCT analysis [24, 30], for three-point bending [30–32], for real time RT-PCR [24], for serum IGF-1 assay [24, 33] and for serum ALP assay [34, 35]. mRNA levels in the tissue samples were measured by real time RT-PCR. Primers were developed (Table I) to analyse the bone formation markers alkaline phosphatase (ALP), insulin-like growth factor 1 (IGF-1: transcript variant 1, 2 and 3) and one of the two osteocalcin isoforms, osteocalcin-2 (OC), and to analyse bone resorption markers cathepsin K (CTSK) and tartrate-resistant acid phosphatase (TRAP: transcript variant 1, 2 and 3). Peptidylprolyl isomerase A (PPIA) was used as an internal reference to normalize transcript levels. The differences in delta CT between mRNA levels in the stressed and control
246
H. Yu et al.
Brain Inj, 2014; 28(2): 244–251
mice were calculated as a fold change and were then converted to a percentage of the control mice. Growth plate determination Based on the metaphyseal trabecular data from micro-CT analyses, this study also determined the length of the proximal tibial growth plate. The distal end of the growth plate was Table I. Primers used in real time RT-PCR. Gene
Primer direction
Primer sequence
PPIA
Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
50 -CCATGGCAAATGCTGGACCA 50 -TCCTGGACCCAAAACGCTCC 50 -ATGGTAACGGGCCTGGCTACA 50 -AGTTCTGCTCATGGACGCCGT 50 -CAGGCATTGTGGATGAGTGTTG 50 -TCTTGTTTGTCGATAGGGACGG 50 -CTCTCTCTGCTCACTCTGCT 50 -TTTGTAGGCGGTCTTCAAGC 50 - GAACGAGAAAGCCCTGAAGAGA 50 - TATCCAGTGCTTGCTTCCCTTC 50 - CACTCAGCTGTCCTGGCTCAA 50 - CTGCAGGTTGTGGTCATGTCC
ALP IGF-1 OC CTSK TRAP
defined by a cross-section that contained an obvious bridgeshaped thickening of cartilage tissue in the X-ray image. The proximal end was marked by the disappearance of the thickening cartilage tissue identified by examining the X-ray images of successive slices (Figure 1). The length of the growth plate was obtained by multiplying the thickness of each slide, which was 10.5 mm, with the number of slices between the two end cross-sections.
Results In the weight drop regimen with four impacts at a 1.5 metre drop height, two out of a total of nine impacted mice died soon after the impacts. This mortality rate (22.2%) was higher than the previously reported 10% in mice [3], which could have been due to the small animal number used in this study. However, no bleeding was observed after the impacts. The remaining seven mice survived to the end of the experiment. No evidence of skull fracture was found during dissection of the head at the end of the experiment. No visible damages were observed except for some redness, likely due to blood accumulation, in the brain of the impacted mice (Figure 2). The average time of the righting reflex was 2.7 minutes for
Figure 1. Cross-sections of the proximal metaphyseal region of the tibia used to determine the length of the growth plate. Green lines delineate the actual growth plate area in cross-sections based on micro-CT analysis. f, fibula; lc, lateral condyle; mc, medial condyle; hf, head of fibula. The distal end of the growth plate (A) is characterized by an obvious bridge-shaped thickening of cartilage tissue in the X-ray image of the cross-section forming two compartments of the metaphysis. The proximal end (D) is characterized by the complete disappearance of the two compartments and the growth plate itself within the fused tissues of the lateral condyle, medial condyle and head of the fibula and was identified by examining the X-ray images of successive slices (B, C) of the tibial cross-sections.
DOI: 10.3109/02699052.2013.859735
Figure 2. Representative brain images of the impacted and control mice. The mice were immediately euthanized after undergoing four impacts or four isoflurance exposures on 4 consecutive days.
The negative impact of TBI on bone in a mouse model
247
Figure 4. Bone mass parameters measured in total body, femur and tibia. Bone mineral content (BMC), bone area (B area) and bone mineral content (BMD) were determined from PIXImus analysis in total body, femurs and tibias. Values are means and SEM of nine impacted mice and five control mice. *, ** Significant at p50.05 and 0.01, respectively, between the impacted and control mice based on t-test.
Figure 3. Time recorded for the righting reflex after the impact. Values are means and SEM of nine impacted mice and five control mice. In two-way ANOVA, the main effect of impact treatment was significant at p50.01. The within-group effect of successive impacts at different time points was not significant. ** Significant at p50.01 between the impacted and control mice based on LSD test.
the first impact and was only 0.4 minutes for the corresponding anaesthesia only treatment of the control mice (Figure 3). These numbers were significantly different and did not change in later impacts. Data obtained from the PIXImus measurements showed that the repetitive weight drop impacts caused significant bone mass reductions as bone mineral content (BMC), bone area (B area) and bone mineral density (BMD) in total body scans were reduced by 14.5% (p50.01), 9.8% (p50.01), 5.2% (p50.05), respectively in the impacted vs. control mice (Figure 4). Similar reductions were also observed in the femur and tibia. In addition, the average body weight was also reduced by 10.4% (p50.01). Micro-CT analysis of the mid-diaphyseal region of the tibia showed that there was no significant difference in total volume between the impacted and control mice, suggesting that the cross-sectional size of cortical bone was not affected (Figure 5A). However, the weight drop did significantly impact bone mass and density since bone volume and total volumetric bone mineral density (vBMD) were reduced by 12.4% (p50.01) and 17.1% (p50.01), respectively, indicating a greater marrow space and a thinner cortical bone.
Figure 5. Cortical bone parameters (A) and cortical strength parameters (B) measured at the mid-diaphyseal region of the tibia. Cortical bone parameters total volume, bone volume, total volumetric BMD (vBMD) and material vBMD were obtained from TV, BV, Mean1 and Mean2 in micro-CT analysis, respectively. Cortical bone strength parameters maximum load (Pmax), yield load (Pyield) and stiffness (S) were obtained from the three-point bending test. Values are means and SEM of nine impacted and five control mice. *, ** Significant at p50.01 between the impacted and control mice based on t-test.
In addition, material vBMD was also reduced by 4.0% in the impact mice. Changes in cortical bone structure led to reductions in cortical bone strength. Three-point bending showed that, among three strength parameters measured
248
H. Yu et al.
Brain Inj, 2014; 28(2): 244–251
Figure 6. Trabecular bone parameter measured at the metaphyseal region of the tibia. Total volume (TV), bone volume (BV), BV/TV, connectivity density (Conn-Den), structure model index (SMI), trabecular number (Tb.N), trabecular thickness (Tb.Th) and trabecular separation (Tb.S) were obtained from micro-CT analysis. The length of the growth plate was determined by examining X-ray images of tibial crosssections of the metaphyseal region based on micro-CT analysis, as shown in Figure 1. Values are means and SEM of nine impacted and five control mice. *, ** Significant at p50.01 between the impacted and control mice based on t-test.
at the mid-diaphyseal region of the tibia, maximum load or breaking strength was significantly lower in the impacted mice vs. the control mice, with a reduction of 33.2% (p50.01) (Figure 5B). Micro-CT analysis of the metaphyseal region of the tibia indicated that trabecular bone was reduced and trabecular architecture damaged in the impacted mice compared to the controls. Trabecular number (Tb.N) and trabecular thickness (Tb.Th) was reduced by 19.7% (p50.01) and 8.1% (p50.01), respectively, and trabecular separation (Tb.Sp) was increased by 26.3% (p50.01) (Figure 6). As a result, although the measured total volume (TV) was almost the same, bone volume (BV), BV/TV and connectivity density (Conn-Dens) were reduced by 44.5%, 44.0% and 62.9% (all p50.01), respectively. At the same time, the structure model index (SMI) was increased by 26.5% (p50.01). Examination of the proximal growth plate showed that its length was reduced and was 14.9% (p50.05) shorter in the impacted mice vs. the controls. This was associated with a 2.9% (p50.05) reduction in tibia length for the impacted mice. Real time RT-PCR analysis showed that there were no changes in the expression of bone formation markers IGF-1 and ALP (Figure 7A). However, the expression of another bone formation marker, OC, was significantly lower in the impacted compared to control mice, 27.9% (p50.01) lower in the calvaria and 36.7% (p50.05) lower in the femur. The expression of bone resorption markers CTSK and TRAP were not different between impacted and control mice in both calvaria and femur samples (Figure 7B). The IGF-1 concentration and ALP activity were also examined in serum samples. There was no significant difference, probably due to small sample sizes, in serum IGF-1 levels or serum ALP activity, although they were 9.4% and 9.7%, respectively, lower in the impact compared to control mice.
Figure 7. Expression of bone formation related marker mRNAs (A) and bone resorption related marker mRNAs (B) in the calvaria and femur determined by real time RT-PCR. Fold changes were converted to the percentages of control mice. Values are means and SEM of nine impacted and five control mice. *, **Significant at p50.05 and 0.01, respectively, between the impacted and control mice based on t-test.
Discussion PIXImus analysis in this study showed that impacted mice had reductions of bone mass parameters such as BMC, B area and BMD in total body scans as well as reductions specifically in the femur and tibia. It is well known that PIXImus measurements are sensitive to differences in body weight. The body weight of impacted mice was also significantly reduced, suggesting that part of the bone mass reduction in the impacted mice could be attributed to their reduced body weight. However, micro-CT analyses of the tibia indicated that there were also a significant reduction of cortical bone volume and density at the mid-diaphysis. Although cross-sectional bone size was not affected, the reduced cortical bone volume and density was confirmed by a significant reduction in cortical bone strength. Similar results were observed in the trabecular bone, where there was reduced bone volume characterized by decreased trabecular number and trabecular thickness, increased trabecular spacing and reduced density characterized by decreased BV/TV and connectivity density. In addition, the weight drop TBI model also caused a significant shortening of the tibial growth plate and the tibia itself. Since young mice were used, which were still undergoing active skeletal growth, the resting chondrocytes in the growth plate were the source of proliferative chondrocytes that would form the trabecular bone through endochrondral ossification or pre-osteoblasts that would cause the elongation of cortical bone through intramembranous ossification [36]. These findings demonstrate that TBI caused
DOI: 10.3109/02699052.2013.859735
an acute reduction in peak bone mass acquisition in skeletal tissues and these data are supported by another animal study that showed a reduction in BMD and reduced bone strength following TBI in rats [21]. In terms of an endocrine effect, TBI causes hypothalamicpituitary dysfunction, mainly hypopituitarism. Growth hormone deficiency (GHD) is one of the most common endocrine abnormalities following TBI [3]. In children, 3–19% of patients exhibit GHD 12 months after being diagnosed with TBI [15, 37]. Similarly, the incidence of GHD is 2–33% in adults at 1 year or more after TBI [3]. IGF-1 is a primary mediator of the effects of growth hormone. Therefore, IGF-1 and insulin-like growth factor-binding protein 3 (IGFBP3) can be used for screening to identify GHD [3, 38]. This study found that the impacted mice showed a decrease in serum levels of IGF-1 2 weeks after the first impact, although this reduction was not significant. Four of the nine impacted mice showed visible signs of paralysis with one side of the body being tilted. When these mice were used to compare to the control mice, there was a 17.5% decrease of serum IGF-1, which was significant at p50.05. These results indicate that IGF-1 can be a systemic indicator of TBI severity. However, significant changes were not found in IGF-1 mRNA expression in local bone tissues. This was probably due to the timing of the sample collection. Previous expression analyses of bone-related markers following TBI in animals and humans have been confined to serum samples. There was no significant change in the serum levels of either bone formation-related marker, ALP or osteocalcin, in diagnosed TBI patients [39], as well as in a rat TBI model [21]. Likewise, in this study serum ALP activity did not change significantly in the impacted mice, supporting these observations. However, in one study, Trentz et al. [18] did observe lower serum levels of osteocalcin during the early post-traumatic period of TBI. This group also showed elevated serum levels of the resorption-related marker, ICTP. The impact of TBI on gene expression of bone-related markers in skeletal tissues has not been reported since most studies emphasize the observation that osteogenic factors are centrally released during TBI and enter the systemic circulation [40]. In this study, while there were no significant changes in the expression of the bone formation marker, ALP in calvaria and femur bone samples, there was a significant reduction in the expression of another bone formation-related marker, osteocalcin, in both bone tissues. On the other hand, there was no significant change in the expression of the bone resorption-related markers, CTSK and TRAP. These results suggest that bone formation pathways involving osteocalcin might have been inhibited while bone resorption pathways were not affected following TBI. Furthermore, they suggest the above phenotype analyses showing that the TBIinduced loss of bone mass might have been due to decreased bone formation, rather than to increased bone resorption. The effect of TBI on bone has been mainly studied in the context of heterotopic ossification, a condition of abnormal bone formation in non-skeletal soft tissues such as muscles and neurons [41, 42]. This condition has been observed in 20% of patients with severe brain injury [43]. The symptoms of heterotopic ossification include vascular calcification, joint stiffness, swelling and pain [44]. TBI frequently has
The negative impact of TBI on bone in a mouse model
249
been associated with an increased osteogenic potential and enhanced fracture healing [40, 45–48]. However, the callus formed at a fracture site following TBI is not histologically consistent with typical callus and may represent an extension of heterotopic ossification [40]. Whether this heterotopic ossification goes on to form fracture callus and lead to bony union is debatable [49]. In light of the controversy surrounding the questionable positive impact on bone in the form of heterotopic ossification, the current study was focused on the potential negative impact on skeletal growth and maintenance, which is supported by overwhelming clinical evidence, as discussed in the Introduction. However, it is speculated that TBI may first cause bone mass loss in skeletal tissues, only to be followed by a systemic over-correction that results in heterotopic ossification of non-skeletal tissues. In summary, the repetitive weight drop model for TBI produced a significant negative impact on bone in 5-week old mice, inducing significant bone mass loss 2 weeks after the impacts began. These results, coupled with decreased expression of the bone formation-related marker osteocalcin and unchanged expression of bone resorption related markers in skeletal tissues, suggest that the negative impact of TBI on bone was likely due to decreased bone formation rather than increased bone resorption.
Acknowledgements This work was funded through the Rehabilitation Research and Development Merit Review Program of the Department of Veterans Affairs, and was performed at research facilities provided by the VA Loma Linda HealthCare System. The authors thank Catrina Alarcon, Sheila Pourteymoor and Joe Rung-Aroon for their technical assistance. They also thank James DeKeyser for making the apparatus used in the study, and Charles Rundle for assistance in taking photographs of the mouse brains.
Declaration of interest The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper.
References 1. Bryant R. Post-traumatic stress disorder vs traumatic brain injury. Dialogues in Clinical Neuroscience 2011;13:251–262. 2. Chamelian L, Reis M, Feinstein A. Six-month recovery from mild to moderate Traumatic Brain Injury: the role of APOE-epsilon4 allele. Brain 2004;127:2621–2628. 3. Kane MJ, Angoa-Perez M, Briggs DI, Viano DC, Kreipke CW, Kuhn DM. A mouse model of human repetitive mild traumatic brain injury. Journal of Neuroscience Methods 2011;203:41–49. 4. Center of Disease Control and Prevention. Injury prevention & control: traumatic brain injury. Available online at: http:// www.cdc.gov/TraumaticBrainInjury/index.html, accessed 2012. 5. Affairs DoV. Understanding traumatic brain injury: definition and background. Available online at: http://www.polytrauma.va.gov/ understanding-tbi/definition-and-background.asp, accessed 2011. 6. Brenner LA. Neuropsychological and neuroimaging findings in traumatic brain injury and post-traumatic stress disorder. Dialogues in Clinical Neuroscience 2011;13:311–323. 7. Ryan PB, Lee-Wilk T, Kok BC, Wilk JE. Interdisciplinary rehabilitation of mild TBI and PTSD: a case report. Brain Injury 2011;25:1019–1025.
250
H. Yu et al.
8. Moon RJ, Sutton T, Wilson PM, Kirkham FJ, Davies JH. Pituitary function at long-term follow-up of childhood traumatic brain injury. Journal of Neurotrauma 2010;27:1827–1835. 9. Tanriverdi F, De Bellis A, Ulutabanca H, Bizzarro A, Sinisi AA, Bellastella G, Paglionico VA, Mora LD, Selcuklu A, Unluhizarci K, et al. Five years prospective investigation of anterior pituitary function after traumatic brain injury: is hypopituitarism long-term after head trauma associated with autoimmunity? Journal of Neurotrauma 2013;30:1426–1433. 10. Park KD, Kim DY, Lee JK, Nam HS, Park YG. Anterior pituitary dysfunction in moderate-to-severe chronic traumatic brain injury patients and the influence on functional outcome. Brain Injury 2010;24:1330–1335. 11. Rose SR, Auble BA. Endocrine changes after pediatric traumatic brain injury. Pituitary 2012;15:267–275. 12. Zaben M, El Ghoul W, Belli A. Post-traumatic head injury pituitary dysfunction. Disability & Rehabilitation 2013;35:522–525. 13. Rosario ER, Aqeel R, Brown MA, Sanchez G, Moore C, Patterson D. Hypothalamic-pituitary dysfunction following traumatic brain injury affects functional improvement during acute inpatient rehabilitation. Journal of Head Trauma Rehabilitation 2013;28: 390–396. 14. Acerini CL, Tasker RC. Traumatic brain injury induced hypothalamic-pituitary dysfunction: a paediatric perspective. Pituitary 2007; 10:373–380. 15. Norwood KW, Deboer MD, Gurka MJ, Kuperminc MN, Rogol AD, Blackman JA, Wamstad JB, Buck ML, Patrick PD. Traumatic brain injury in children and adolescents: surveillance for pituitary dysfunction. Clinical Pediatrics (Philadelphia) 2010;49:1044–1049. 16. Mohan S, Baylink DJ. Impaired skeletal growth in mice with haploin sufficiency of IGF-I: genetic evidence that differences in IGF-I expression could contribute to peak bone mineral density differences. Journal of Endocrinology 2005;185:415–420. 17. Mohan S, Richman C, Guo R, Amaar Y, Donahue LR, Wergedal J, Baylink DJ. Insulin-like growth factor regulates peak bone mineral density in mice by both growth hormone-dependent and -independent mechanisms. Endocrinology 2003;144:929–936. 18. Trentz OA, Handschin AE, Bestmann L, Hoerstrup SP, Trentz OL, Platz A. Influence of brain injury on early posttraumatic bone metabolism. Critical Care Medicine 2005;33:399–406. 19. Sato Y. Abnormal bone and calcium metabolism in patients after stroke. Archives of Physical Medicine & Rehabilitation 2000;81: 117–121. 20. Sato Y, Kuno H, Kaji M, Etoh K, Oizumi K. Influence of immobilization upon calcium metabolism in the week following hemiplegic stroke. Journal of Neurological Sciences 2000;175: 135–139. 21. Lee JI, Kim JH, Kim HW, Choi ES, Lim SH, Ko YJ, Han YM. Changes in bone metabolism in a rat model of traumatic brain injury. Brain Injury 2005;19:1207–1211. 22. Ajao DO, Pop V, Kamper JE, Adami A, Rudobeck E, Huang L, Vlkolinsky R, Hartman RE, Ashwal S, Obenaus A, et al. Traumatic brain injury in young rats leads to progressive behavioral deficits coincident with altered tissue properties in adulthood. Journal of Neurotrauma 2012;29:2060–2074. 23. Yu H, Watt H, Kesavan C, Johnson PJ, Wergedal JE, Mohan S. Lasting consequences of traumatic events on behavioral and skeletal parameters in a mouse model for post-traumatic stress disorder (PTSD). PLoS One 2012;7:e42684. 24. Yu H, Watt H, Kesavan C, Mohan S. The negative impact of single prolonged stress on bone development in mice. Stress 2013;16: 564–570. 25. Cizza G, Ravn P, Chrousos GP, Gold PW. Depression: a major, unrecognized risk factor for osteoporosis? Trends in Endocrinology & Metabolism 2001;12:198–203. 26. Yirmiya R, Goshen I, Bajayo A, Kreisel T, Feldman S, Tam J, Trembovler V, Csernus V, Shohami E, Bab I. Depression induces bone loss through stimulation of the sympathetic nervous system. Proceedings of the National Academy of Sciences USA 2006;103: 16876–16881. 27. Albert-Weissenberger C, Siren AL. Experimental traumatic brain injury. Experimental & Translational Stroke Medicine 2010; 2:16. 28. Marmarou A, Foda MA, van den Brink W, Campbell J, Kita H, Demetriadou K. A new model of diffuse brain injury in rats.
Brain Inj, 2014; 28(2): 244–251
29.
30.
31.
32.
33.
34.
35.
36. 37.
38.
39.
40.
41.
42.
43. 44.
45.
Part I: pathophysiology and biomechanics. Journal of Neurosurgery 1994;80:291–300. Masinde GL, Li X, Gu W, Wergedal J, Mohan S, Baylink DJ. Quantitative trait loci for bone density in mice: the genes determining total skeletal density and femur density show little overlap in F2 mice. Calcified Tissue International 2002;71: 421–428. Yu H, Wergedal JE, Zhao Y, Mohan S. Targeted disruption of TGFBI in mice reveals its role in regulating bone mass and bone size through periosteal bone formation. Calcified Tissue International 2012;91:81–87. Kesavan C, Mohan S. Bone mass gained in response to external loading is preserved for several weeks following cessation of loading in 10 week C57BL/6J mice. Journal of Musculoskeletal & Neuronal Interactions 2010;10:274–280. Wergedal JE, Sheng MH, Ackert-Bicknell CL, Beamer WG, Baylink DJ. Mouse genetic model for bone strength and size phenotypes: NZB/B1NJ and RF/J inbred strains. Bone 2002;31: 670–674. Mohan S, Baylink DJ. Development of a simple valid method for the complete removal of insulin-like growth factor (IGF)-binding proteins from IGFs in human serum and other biological fluids: comparison with acid-ethanol treatment and C18 Sep-Pak separation. Journal of Clinical Endocrinology & Metabolism 1995;80: 637–647. Govoni KE, Linares GR, Chen ST, Pourteymoor S, Mohan S. T-box 3 negatively regulates osteoblast differentiation by inhibiting expression of osterix and runx2. Journal of Cellular Biochemistry 2009;106:482–490. Linares GR, Xing W, Burghardt H, Baumgartner B, Chen ST, Ricart W, Fernandez-Real JM, Zorzano A, Mohan S. Role of diabetes- and obesity-related protein in the regulation of osteoblast differentiation. American Journal of Physiology – Endocrinology & Metabolism 2011;301:E40–48. Day TF, Yang Y. Wnt and hedgehog signaling pathways in bone development. Journal of Bone & Joint Surgery American Volume 2008;90:19–24. Einaudi S, Matarazzo P, Peretta P, Grossetti R, Giordano F, Altare F, Bondone C, Andreo M, Ivani G, Genitori L, et al. Hypothalamo-hypophysial dysfunction after traumatic brain injury in children and adolescents: a preliminary retrospective and prospective study. Journal of Pediatric Endocrinology & Metabolism 2006;19:691–703. Kaulfers AM, Backeljauw PF, Reifschneider K, Blum S, Michaud L, Weiss M, Rose SR. Endocrine dysfunction following traumatic brain injury in children. Journal of Pediatrics 2010;157: 894–899. Mysiw WJ, Tan J, Jackson RD. Heterotopic ossification. The utility of osteocalcin in diagnosis and management. American Journal of Physical Medicine & Rehabilitation 1993;72: 184–187. Toffoli AM, Gautschi OP, Frey SP, Filgueira L, Zellweger R. From brain to bone: evidence for the release of osteogenic humoral factors after traumatic brain injury. Brain Injury 2008; 22:511–518. Kesikburun S, Omac OK, Yasar E, Hazneci B, Alaca R. Severe heterotopic ossification in the non-affected limbs of a hemiplegic patient with traumatic brain injury. Brain Injury 2011; 25:127–129. van Kampen PJ, Martina JD, Vos PE, Hoedemaekers CW, Hendricks HT. Potential risk factors for developing heterotopic ossification in patients with severe traumatic brain injury. Journal of Head Trauma Rehabilitation 2011;26:384–391. Bruno-Petrina A. Posttraumatic heterotopic ossification. Available online at: http://emedicine.medscape.com/article/326242-overview, accessed 2011. Leblanc E, Trensz F, Haroun S, Drouin G, Bergeron E, Penton CM, Montanaro F, Roux S, Faucheux N, Grenier G. BMP-9-induced muscle heterotopic ossification requires changes to the skeletal muscle microenvironment. Journal of Bone & Mineral Research 2011;26:1166–1177. Boes M, Kain M, Kakar S, Nicholls F, Cullinane D, Gerstenfeld L, Einhorn TA, Tornetta P 3rd. Osteogenic effects of traumatic brain injury on experimental fracture-healing. Journal of Bone & Joint Surgery America 2006;88:738–743.
DOI: 10.3109/02699052.2013.859735
46. Gautschi OP, Cadosch D, Frey SP, Skirving AP, Filgueira L, Zellweger R. Serum-mediated osteogenic effect in traumatic braininjured patients. ANZ Journal of Surgery 2009;79:449–455. 47. Klein BY, Shohami E, Reikhinshtein Y, Ben-Bassat H, Liebergall M. Serum-mediated osteogenic effects of head injury on cultured rat marrow stromal cells. Calcified Tissue International 1999;65: 217–222.
The negative impact of TBI on bone in a mouse model
251
48. Song Y, Bi L, Zhang Z, Huang Z, Hou W, Lu X, Sun P, Han Y. Increased levels of calcitonin gene-related peptide in serum accelerate fracture healing following traumatic brain injury. Molecular Medicine Reports 2011;5:432–438. 49. Morley J, Marsh S, Drakoulakis E, Pape HC, Giannoudis PV. Does traumatic brain injury result in accelerated fracture healing? Injury 2005;36:363–368.
Copyright of Brain Injury is the property of Taylor & Francis Ltd and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
ORIGINAL ARTICLE
The negative impact of traumatic brain injury (TBI) on bone in a mouse model Hongrun Yu1,2, Heather Watt1 & Subburaman Mohan1,2 1
Musculoskeletal Disease Center, Jerry L. Pettis Memorial VA Medical Center, Loma Linda, CA, USA and 2Department of Medicine, Loma Linda University, Loma Linda, CA, USA Abstract
Keywords
Introduction: While it is well established that the brain produces hypothalamic hormones and neuropeptides that influence skeletal metabolism, the impact of traumatic brain injury (TBI) on bone is unknown. Based on the recognition from clinical studies that there is an association between TBI and long-term hypothalamic pituitary dysfunction, it was hypothesized that TBI exerts a negative impact on skeletal growth and maintenance. Methods: To test the hypothesis, this study employed a repetitive weight drop model for TBI. Four impacts were applied for four consecutive days on 5-week old female C57BL/6 J mice. Bone measurements were taken 2 weeks after the first impact. Results: Bone mineral content (BMC), bone area (B area) and bone mineral density (BMD) in the total body were reduced by 14.5%, 9.8% and 5.2%, respectively, in the impacted vs. control mice. There was a 17.1% reduction in total volumetric BMD (vBMD) and a 4.0% reduction in material vBMD in cortical bone. In trabecular bone, there was a 44.0% reduction in BV/TV. Although there was no change in the cross-sectional bone size, the tibial growth plate and the tibia itself were shortened. Conclusion: The repetitive animal TBI model produced an immediate, strong negative impact on bone mass acquisition in young mice.
Bone density, bone formation, mice, traumatic brain injury, weight drop model
Traumatic brain injury (TBI) involves damage to the brain from an external force [1]. The causes of TBI include falls, motor vehicle accidents, sports injuries and violence. The severity can be classified into mild, moderate and severe based on the length of time of lost consciousness [1]. Mild TBI accounts for almost 85% of all TBI cases [2]. TBI including mild TBI can have a host of physical, cognitive, social, emotional and behavioural effects. It is a major cause of disability and death worldwide, especially in children and young adults. More than 1.7 million people experience one TBI each year in the US [3]. The US military establishment has estimated that 22% of all combat wounds in the Iraq and Afghanistan conflicts were brain injuries, which were mainly due to blasts and gunshot wounds. Economically, authoritative data cited by the CDC showed that direct medical costs resulting from TBI and indirect costs such as lost productivity totalled an estimated $76.5 billion in the US in the year 2000 alone [4]. In addition, TBI frequently occurs in polytrauma in combination with other disabling conditions, such as spinal cord injury (SCI) and post-traumatic stress disorder (PTSD)
Correspondence: Subburaman Mohan, PhD, Musculoskeletal Disease Center, Jerry L. Pettis Memorial VA Medical Center, 11201 Benton Street (151), Loma Linda, CA 92357, USA. Tel: 1-909-825-7084, Ext 2932. Fax: 1-909-796-1680. Email: [email protected]
Received 16 May 2013 Revised 20 September 2013 Accepted 23 October 2013 Published online 26 November 2013
[5]. ‘Polytrauma’ was termed to describe injuries to multiple body parts and organs, for example, occurring as a result of blast-related wounds in combat situations. Recent data show that TBI and PTSD can and frequently co-exist with overlapping symptoms [1, 6, 7]. Mild TBI appears to increase the risk for PTSD [1]. The current study is focused on the impact of TBI on skeletal tissues based on the following rationale. First and foremost, TBI is a common cause of pituitary dysfunction, which is recognized as a sequela [8, 9]. Thirty-to-fifty per cent of TBI patients suffer from hypopituitarism [10–12]. Broadly, hypothalamic-pituitary dysfunction was identified in nearly 70% of patients following TBI [13]. The most common manifestations of hypopituitarism are growth hormone (GH), gonadotrophin and thyroid-stimulating hormone (TSH) deficiencies [14, 15]. Many pituitary hormones are involved in bone metabolism. For example, GH is an important regulator of insulin-like growth factor-1 (IGF-1), which in turn contributes to peak bone mass [16, 17]. Second, bone formation markers such as osteocalcin in serum was significantly lower in TBI patients, while collagen fragments generated by bone resorption such as pyridinoline crosslinked telopeptide domain of type 1 collagen (ICTP) were significantly higher, suggesting an imbalance between bone formation and bone resorption towards the latter [18]. Third, stroke, another condition of brain injury, tends to induce osteoporosis due to immobility [19, 20]. Animal experimental
20 14
Introduction
History
DOI: 10.3109/02699052.2013.859735
data also showed reduced bone formation after TBI [21]. Finally, rat studies showed that TBI could lead to progressive behavioural deficits including anxiety-like behaviour [22]. Animal studies using mouse PTSD models showed that anxiety behaviours were associated with reduced bone mass acquisition in young mice and deterioration of trabecular architecture in later development [23, 24]. Clinically, patients with depression have a 6–15% lower bone mineral density (BMD) and an increased risk of osteoporotic fractures [25, 26]. Based on the above evidence, the authors proposed the hypothesis that TBI exerts a negative impact on skeletal growth and maintenance. To test this hypothesis, a repetitive weight drop method was chosen to create closed-head injury in mice as a TBI model [3]. There are a number of rodent models available for TBI and three of the most commonly used are the cortical contusion injury (CCI), fluid percussion injury (FPI) and weight drop injury [27] models. However, only the weight drop injury model can achieve high velocity impact and rapid head acceleration, two of the most critical factors in producing mild, concussive brain injuries [3]. Among the weight drop models, only Marmarous et al.’s [28] rat model can create a diffuse, closed-head brain injury, which has recently been adapted for mice and can be applied repeatedly, making it possible to study the most common form of TBI, repetitive and mild TBI [3]. This study found that this model produced an immediate, statistically significant negative impact on bone mass acquisition as well as on cortical structure and trabecular architecture in young mice.
Materials and methods Animals Four-week old female C57BL/6 J mice were purchased from the Jackson Laboratory (Bar Harbor, ME). The mice were allowed 1 week to acclimate to the local environment before the experiment began at 5 weeks of age. All animals were housed in the Veterinary Medical Unit of the VA Loma Linda HealthCare System under the standard conditions of 14 hours of light, 10 hours of darkness, with an ambient temperature of 20 C and a relative humidity of 30–60%. All experimental protocols were in compliance with pertinent animal welfare regulations and were approved by the Institutional Animal Care and Use Committee of the Medical Centre. TBI protocol The apparatus used in this study was similar to the one described previously [3] and consisted of an ‘H’ shaped Plexiglas frame and a piece of aluminum foil taped on the top of it. Slits were cut in the aluminium foil in such a way that the foil barely supported the weight of a mouse placed on top of it. The top half of the frame was empty. Thus, the aluminium foil and the top half of the frame offered no resistance to a falling mouse upon impact from a dropped weight. The bottom half of the frame was filled with a sponge cushion to protect the animal from secondary injuries. This study used a 72 gram brass weight milled to a cylinder shape (8 cm long and 1 cm in diameter). This weight was
The negative impact of TBI on bone in a mouse model
245
based on the 95 gram weight for the adult mice [3] and the body weight ratio of young vs. adult mice. Since the end of the weight that touched the animal was smooth, no steel cap was used. The weight was placed inside a PVC guide tube with an inside diameter of 1.5 cm. The PVC tube was positioned on a stand just above the mouse, anterior to the ears, between bregma and lambda of the skull. To prevent movement of the animal during the impact, the mouse was anaesthetized by isoflurane inhalation (1 minute 50 seconds) before the procedure. To begin the procedure, the anaesthetized mouse was placed on the aluminium foil. The starting position of the weight was just above the head of the resting animal. The weight was pulled up 1.5 metres before being dropped. The control mice did not go through the impact, but underwent the isolfurane anaesthesia. The righting reflex response was assessed immediately, as previously described [3]. This study used a total of 14 mice with nine as experimental and five as control. The impact for the experimental mice or isoflurane exposure alone for the control mice was carried out for 4 consecutive days, with one treatment per day. Pain medicine and hydrating saline solution were administered by intraperitoneal injection, when necessary. Animal end-point and sample collection At the end of 2 weeks after the first impact, both impacted and control mice were euthanized at 7 weeks of age. A day before euthanasia, in vivo bone parameters were measured on anaesthetized mice using a PIXImus densitometer (LUNAR Corp., Madison, WI). Euthanasia was carried out with 70% carbon dioxide inhalation, followed by decapitation. Trunk blood was collected, and centrifuged at 10 000x g for 15 minutes at 4 C. The serum was stored at 70 C for later IGF-1 and ALP assays. The calvaria and right femur bones were collected and stored in liquid nitrogen for RNA isolation for real time RT-PCR. Both left and right tibias were collected, fixed in 4% formaldehyde for 48 hours and preserved in 1 phosphate buffered saline for in vitro bone parameter measurements using micro-CT. After micro-CT analysis, the left tibia was subjected to three-point bending to determine bone strength parameters. Bone parameter measurements, expression analyses and serum assays Detailed procedures have been described previously for in vivo PIXImus measurements [23, 29], for in vitro microCT analysis [24, 30], for three-point bending [30–32], for real time RT-PCR [24], for serum IGF-1 assay [24, 33] and for serum ALP assay [34, 35]. mRNA levels in the tissue samples were measured by real time RT-PCR. Primers were developed (Table I) to analyse the bone formation markers alkaline phosphatase (ALP), insulin-like growth factor 1 (IGF-1: transcript variant 1, 2 and 3) and one of the two osteocalcin isoforms, osteocalcin-2 (OC), and to analyse bone resorption markers cathepsin K (CTSK) and tartrate-resistant acid phosphatase (TRAP: transcript variant 1, 2 and 3). Peptidylprolyl isomerase A (PPIA) was used as an internal reference to normalize transcript levels. The differences in delta CT between mRNA levels in the stressed and control
246
H. Yu et al.
Brain Inj, 2014; 28(2): 244–251
mice were calculated as a fold change and were then converted to a percentage of the control mice. Growth plate determination Based on the metaphyseal trabecular data from micro-CT analyses, this study also determined the length of the proximal tibial growth plate. The distal end of the growth plate was Table I. Primers used in real time RT-PCR. Gene
Primer direction
Primer sequence
PPIA
Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse
50 -CCATGGCAAATGCTGGACCA 50 -TCCTGGACCCAAAACGCTCC 50 -ATGGTAACGGGCCTGGCTACA 50 -AGTTCTGCTCATGGACGCCGT 50 -CAGGCATTGTGGATGAGTGTTG 50 -TCTTGTTTGTCGATAGGGACGG 50 -CTCTCTCTGCTCACTCTGCT 50 -TTTGTAGGCGGTCTTCAAGC 50 - GAACGAGAAAGCCCTGAAGAGA 50 - TATCCAGTGCTTGCTTCCCTTC 50 - CACTCAGCTGTCCTGGCTCAA 50 - CTGCAGGTTGTGGTCATGTCC
ALP IGF-1 OC CTSK TRAP
defined by a cross-section that contained an obvious bridgeshaped thickening of cartilage tissue in the X-ray image. The proximal end was marked by the disappearance of the thickening cartilage tissue identified by examining the X-ray images of successive slices (Figure 1). The length of the growth plate was obtained by multiplying the thickness of each slide, which was 10.5 mm, with the number of slices between the two end cross-sections.
Results In the weight drop regimen with four impacts at a 1.5 metre drop height, two out of a total of nine impacted mice died soon after the impacts. This mortality rate (22.2%) was higher than the previously reported 10% in mice [3], which could have been due to the small animal number used in this study. However, no bleeding was observed after the impacts. The remaining seven mice survived to the end of the experiment. No evidence of skull fracture was found during dissection of the head at the end of the experiment. No visible damages were observed except for some redness, likely due to blood accumulation, in the brain of the impacted mice (Figure 2). The average time of the righting reflex was 2.7 minutes for
Figure 1. Cross-sections of the proximal metaphyseal region of the tibia used to determine the length of the growth plate. Green lines delineate the actual growth plate area in cross-sections based on micro-CT analysis. f, fibula; lc, lateral condyle; mc, medial condyle; hf, head of fibula. The distal end of the growth plate (A) is characterized by an obvious bridge-shaped thickening of cartilage tissue in the X-ray image of the cross-section forming two compartments of the metaphysis. The proximal end (D) is characterized by the complete disappearance of the two compartments and the growth plate itself within the fused tissues of the lateral condyle, medial condyle and head of the fibula and was identified by examining the X-ray images of successive slices (B, C) of the tibial cross-sections.
DOI: 10.3109/02699052.2013.859735
Figure 2. Representative brain images of the impacted and control mice. The mice were immediately euthanized after undergoing four impacts or four isoflurance exposures on 4 consecutive days.
The negative impact of TBI on bone in a mouse model
247
Figure 4. Bone mass parameters measured in total body, femur and tibia. Bone mineral content (BMC), bone area (B area) and bone mineral content (BMD) were determined from PIXImus analysis in total body, femurs and tibias. Values are means and SEM of nine impacted mice and five control mice. *, ** Significant at p50.05 and 0.01, respectively, between the impacted and control mice based on t-test.
Figure 3. Time recorded for the righting reflex after the impact. Values are means and SEM of nine impacted mice and five control mice. In two-way ANOVA, the main effect of impact treatment was significant at p50.01. The within-group effect of successive impacts at different time points was not significant. ** Significant at p50.01 between the impacted and control mice based on LSD test.
the first impact and was only 0.4 minutes for the corresponding anaesthesia only treatment of the control mice (Figure 3). These numbers were significantly different and did not change in later impacts. Data obtained from the PIXImus measurements showed that the repetitive weight drop impacts caused significant bone mass reductions as bone mineral content (BMC), bone area (B area) and bone mineral density (BMD) in total body scans were reduced by 14.5% (p50.01), 9.8% (p50.01), 5.2% (p50.05), respectively in the impacted vs. control mice (Figure 4). Similar reductions were also observed in the femur and tibia. In addition, the average body weight was also reduced by 10.4% (p50.01). Micro-CT analysis of the mid-diaphyseal region of the tibia showed that there was no significant difference in total volume between the impacted and control mice, suggesting that the cross-sectional size of cortical bone was not affected (Figure 5A). However, the weight drop did significantly impact bone mass and density since bone volume and total volumetric bone mineral density (vBMD) were reduced by 12.4% (p50.01) and 17.1% (p50.01), respectively, indicating a greater marrow space and a thinner cortical bone.
Figure 5. Cortical bone parameters (A) and cortical strength parameters (B) measured at the mid-diaphyseal region of the tibia. Cortical bone parameters total volume, bone volume, total volumetric BMD (vBMD) and material vBMD were obtained from TV, BV, Mean1 and Mean2 in micro-CT analysis, respectively. Cortical bone strength parameters maximum load (Pmax), yield load (Pyield) and stiffness (S) were obtained from the three-point bending test. Values are means and SEM of nine impacted and five control mice. *, ** Significant at p50.01 between the impacted and control mice based on t-test.
In addition, material vBMD was also reduced by 4.0% in the impact mice. Changes in cortical bone structure led to reductions in cortical bone strength. Three-point bending showed that, among three strength parameters measured
248
H. Yu et al.
Brain Inj, 2014; 28(2): 244–251
Figure 6. Trabecular bone parameter measured at the metaphyseal region of the tibia. Total volume (TV), bone volume (BV), BV/TV, connectivity density (Conn-Den), structure model index (SMI), trabecular number (Tb.N), trabecular thickness (Tb.Th) and trabecular separation (Tb.S) were obtained from micro-CT analysis. The length of the growth plate was determined by examining X-ray images of tibial crosssections of the metaphyseal region based on micro-CT analysis, as shown in Figure 1. Values are means and SEM of nine impacted and five control mice. *, ** Significant at p50.01 between the impacted and control mice based on t-test.
at the mid-diaphyseal region of the tibia, maximum load or breaking strength was significantly lower in the impacted mice vs. the control mice, with a reduction of 33.2% (p50.01) (Figure 5B). Micro-CT analysis of the metaphyseal region of the tibia indicated that trabecular bone was reduced and trabecular architecture damaged in the impacted mice compared to the controls. Trabecular number (Tb.N) and trabecular thickness (Tb.Th) was reduced by 19.7% (p50.01) and 8.1% (p50.01), respectively, and trabecular separation (Tb.Sp) was increased by 26.3% (p50.01) (Figure 6). As a result, although the measured total volume (TV) was almost the same, bone volume (BV), BV/TV and connectivity density (Conn-Dens) were reduced by 44.5%, 44.0% and 62.9% (all p50.01), respectively. At the same time, the structure model index (SMI) was increased by 26.5% (p50.01). Examination of the proximal growth plate showed that its length was reduced and was 14.9% (p50.05) shorter in the impacted mice vs. the controls. This was associated with a 2.9% (p50.05) reduction in tibia length for the impacted mice. Real time RT-PCR analysis showed that there were no changes in the expression of bone formation markers IGF-1 and ALP (Figure 7A). However, the expression of another bone formation marker, OC, was significantly lower in the impacted compared to control mice, 27.9% (p50.01) lower in the calvaria and 36.7% (p50.05) lower in the femur. The expression of bone resorption markers CTSK and TRAP were not different between impacted and control mice in both calvaria and femur samples (Figure 7B). The IGF-1 concentration and ALP activity were also examined in serum samples. There was no significant difference, probably due to small sample sizes, in serum IGF-1 levels or serum ALP activity, although they were 9.4% and 9.7%, respectively, lower in the impact compared to control mice.
Figure 7. Expression of bone formation related marker mRNAs (A) and bone resorption related marker mRNAs (B) in the calvaria and femur determined by real time RT-PCR. Fold changes were converted to the percentages of control mice. Values are means and SEM of nine impacted and five control mice. *, **Significant at p50.05 and 0.01, respectively, between the impacted and control mice based on t-test.
Discussion PIXImus analysis in this study showed that impacted mice had reductions of bone mass parameters such as BMC, B area and BMD in total body scans as well as reductions specifically in the femur and tibia. It is well known that PIXImus measurements are sensitive to differences in body weight. The body weight of impacted mice was also significantly reduced, suggesting that part of the bone mass reduction in the impacted mice could be attributed to their reduced body weight. However, micro-CT analyses of the tibia indicated that there were also a significant reduction of cortical bone volume and density at the mid-diaphysis. Although cross-sectional bone size was not affected, the reduced cortical bone volume and density was confirmed by a significant reduction in cortical bone strength. Similar results were observed in the trabecular bone, where there was reduced bone volume characterized by decreased trabecular number and trabecular thickness, increased trabecular spacing and reduced density characterized by decreased BV/TV and connectivity density. In addition, the weight drop TBI model also caused a significant shortening of the tibial growth plate and the tibia itself. Since young mice were used, which were still undergoing active skeletal growth, the resting chondrocytes in the growth plate were the source of proliferative chondrocytes that would form the trabecular bone through endochrondral ossification or pre-osteoblasts that would cause the elongation of cortical bone through intramembranous ossification [36]. These findings demonstrate that TBI caused
DOI: 10.3109/02699052.2013.859735
an acute reduction in peak bone mass acquisition in skeletal tissues and these data are supported by another animal study that showed a reduction in BMD and reduced bone strength following TBI in rats [21]. In terms of an endocrine effect, TBI causes hypothalamicpituitary dysfunction, mainly hypopituitarism. Growth hormone deficiency (GHD) is one of the most common endocrine abnormalities following TBI [3]. In children, 3–19% of patients exhibit GHD 12 months after being diagnosed with TBI [15, 37]. Similarly, the incidence of GHD is 2–33% in adults at 1 year or more after TBI [3]. IGF-1 is a primary mediator of the effects of growth hormone. Therefore, IGF-1 and insulin-like growth factor-binding protein 3 (IGFBP3) can be used for screening to identify GHD [3, 38]. This study found that the impacted mice showed a decrease in serum levels of IGF-1 2 weeks after the first impact, although this reduction was not significant. Four of the nine impacted mice showed visible signs of paralysis with one side of the body being tilted. When these mice were used to compare to the control mice, there was a 17.5% decrease of serum IGF-1, which was significant at p50.05. These results indicate that IGF-1 can be a systemic indicator of TBI severity. However, significant changes were not found in IGF-1 mRNA expression in local bone tissues. This was probably due to the timing of the sample collection. Previous expression analyses of bone-related markers following TBI in animals and humans have been confined to serum samples. There was no significant change in the serum levels of either bone formation-related marker, ALP or osteocalcin, in diagnosed TBI patients [39], as well as in a rat TBI model [21]. Likewise, in this study serum ALP activity did not change significantly in the impacted mice, supporting these observations. However, in one study, Trentz et al. [18] did observe lower serum levels of osteocalcin during the early post-traumatic period of TBI. This group also showed elevated serum levels of the resorption-related marker, ICTP. The impact of TBI on gene expression of bone-related markers in skeletal tissues has not been reported since most studies emphasize the observation that osteogenic factors are centrally released during TBI and enter the systemic circulation [40]. In this study, while there were no significant changes in the expression of the bone formation marker, ALP in calvaria and femur bone samples, there was a significant reduction in the expression of another bone formation-related marker, osteocalcin, in both bone tissues. On the other hand, there was no significant change in the expression of the bone resorption-related markers, CTSK and TRAP. These results suggest that bone formation pathways involving osteocalcin might have been inhibited while bone resorption pathways were not affected following TBI. Furthermore, they suggest the above phenotype analyses showing that the TBIinduced loss of bone mass might have been due to decreased bone formation, rather than to increased bone resorption. The effect of TBI on bone has been mainly studied in the context of heterotopic ossification, a condition of abnormal bone formation in non-skeletal soft tissues such as muscles and neurons [41, 42]. This condition has been observed in 20% of patients with severe brain injury [43]. The symptoms of heterotopic ossification include vascular calcification, joint stiffness, swelling and pain [44]. TBI frequently has
The negative impact of TBI on bone in a mouse model
249
been associated with an increased osteogenic potential and enhanced fracture healing [40, 45–48]. However, the callus formed at a fracture site following TBI is not histologically consistent with typical callus and may represent an extension of heterotopic ossification [40]. Whether this heterotopic ossification goes on to form fracture callus and lead to bony union is debatable [49]. In light of the controversy surrounding the questionable positive impact on bone in the form of heterotopic ossification, the current study was focused on the potential negative impact on skeletal growth and maintenance, which is supported by overwhelming clinical evidence, as discussed in the Introduction. However, it is speculated that TBI may first cause bone mass loss in skeletal tissues, only to be followed by a systemic over-correction that results in heterotopic ossification of non-skeletal tissues. In summary, the repetitive weight drop model for TBI produced a significant negative impact on bone in 5-week old mice, inducing significant bone mass loss 2 weeks after the impacts began. These results, coupled with decreased expression of the bone formation-related marker osteocalcin and unchanged expression of bone resorption related markers in skeletal tissues, suggest that the negative impact of TBI on bone was likely due to decreased bone formation rather than increased bone resorption.
Acknowledgements This work was funded through the Rehabilitation Research and Development Merit Review Program of the Department of Veterans Affairs, and was performed at research facilities provided by the VA Loma Linda HealthCare System. The authors thank Catrina Alarcon, Sheila Pourteymoor and Joe Rung-Aroon for their technical assistance. They also thank James DeKeyser for making the apparatus used in the study, and Charles Rundle for assistance in taking photographs of the mouse brains.
Declaration of interest The authors report no conflicts of interest. The authors alone are responsible for the content and writing of the paper.
References 1. Bryant R. Post-traumatic stress disorder vs traumatic brain injury. Dialogues in Clinical Neuroscience 2011;13:251–262. 2. Chamelian L, Reis M, Feinstein A. Six-month recovery from mild to moderate Traumatic Brain Injury: the role of APOE-epsilon4 allele. Brain 2004;127:2621–2628. 3. Kane MJ, Angoa-Perez M, Briggs DI, Viano DC, Kreipke CW, Kuhn DM. A mouse model of human repetitive mild traumatic brain injury. Journal of Neuroscience Methods 2011;203:41–49. 4. Center of Disease Control and Prevention. Injury prevention & control: traumatic brain injury. Available online at: http:// www.cdc.gov/TraumaticBrainInjury/index.html, accessed 2012. 5. Affairs DoV. Understanding traumatic brain injury: definition and background. Available online at: http://www.polytrauma.va.gov/ understanding-tbi/definition-and-background.asp, accessed 2011. 6. Brenner LA. Neuropsychological and neuroimaging findings in traumatic brain injury and post-traumatic stress disorder. Dialogues in Clinical Neuroscience 2011;13:311–323. 7. Ryan PB, Lee-Wilk T, Kok BC, Wilk JE. Interdisciplinary rehabilitation of mild TBI and PTSD: a case report. Brain Injury 2011;25:1019–1025.
250
H. Yu et al.
8. Moon RJ, Sutton T, Wilson PM, Kirkham FJ, Davies JH. Pituitary function at long-term follow-up of childhood traumatic brain injury. Journal of Neurotrauma 2010;27:1827–1835. 9. Tanriverdi F, De Bellis A, Ulutabanca H, Bizzarro A, Sinisi AA, Bellastella G, Paglionico VA, Mora LD, Selcuklu A, Unluhizarci K, et al. Five years prospective investigation of anterior pituitary function after traumatic brain injury: is hypopituitarism long-term after head trauma associated with autoimmunity? Journal of Neurotrauma 2013;30:1426–1433. 10. Park KD, Kim DY, Lee JK, Nam HS, Park YG. Anterior pituitary dysfunction in moderate-to-severe chronic traumatic brain injury patients and the influence on functional outcome. Brain Injury 2010;24:1330–1335. 11. Rose SR, Auble BA. Endocrine changes after pediatric traumatic brain injury. Pituitary 2012;15:267–275. 12. Zaben M, El Ghoul W, Belli A. Post-traumatic head injury pituitary dysfunction. Disability & Rehabilitation 2013;35:522–525. 13. Rosario ER, Aqeel R, Brown MA, Sanchez G, Moore C, Patterson D. Hypothalamic-pituitary dysfunction following traumatic brain injury affects functional improvement during acute inpatient rehabilitation. Journal of Head Trauma Rehabilitation 2013;28: 390–396. 14. Acerini CL, Tasker RC. Traumatic brain injury induced hypothalamic-pituitary dysfunction: a paediatric perspective. Pituitary 2007; 10:373–380. 15. Norwood KW, Deboer MD, Gurka MJ, Kuperminc MN, Rogol AD, Blackman JA, Wamstad JB, Buck ML, Patrick PD. Traumatic brain injury in children and adolescents: surveillance for pituitary dysfunction. Clinical Pediatrics (Philadelphia) 2010;49:1044–1049. 16. Mohan S, Baylink DJ. Impaired skeletal growth in mice with haploin sufficiency of IGF-I: genetic evidence that differences in IGF-I expression could contribute to peak bone mineral density differences. Journal of Endocrinology 2005;185:415–420. 17. Mohan S, Richman C, Guo R, Amaar Y, Donahue LR, Wergedal J, Baylink DJ. Insulin-like growth factor regulates peak bone mineral density in mice by both growth hormone-dependent and -independent mechanisms. Endocrinology 2003;144:929–936. 18. Trentz OA, Handschin AE, Bestmann L, Hoerstrup SP, Trentz OL, Platz A. Influence of brain injury on early posttraumatic bone metabolism. Critical Care Medicine 2005;33:399–406. 19. Sato Y. Abnormal bone and calcium metabolism in patients after stroke. Archives of Physical Medicine & Rehabilitation 2000;81: 117–121. 20. Sato Y, Kuno H, Kaji M, Etoh K, Oizumi K. Influence of immobilization upon calcium metabolism in the week following hemiplegic stroke. Journal of Neurological Sciences 2000;175: 135–139. 21. Lee JI, Kim JH, Kim HW, Choi ES, Lim SH, Ko YJ, Han YM. Changes in bone metabolism in a rat model of traumatic brain injury. Brain Injury 2005;19:1207–1211. 22. Ajao DO, Pop V, Kamper JE, Adami A, Rudobeck E, Huang L, Vlkolinsky R, Hartman RE, Ashwal S, Obenaus A, et al. Traumatic brain injury in young rats leads to progressive behavioral deficits coincident with altered tissue properties in adulthood. Journal of Neurotrauma 2012;29:2060–2074. 23. Yu H, Watt H, Kesavan C, Johnson PJ, Wergedal JE, Mohan S. Lasting consequences of traumatic events on behavioral and skeletal parameters in a mouse model for post-traumatic stress disorder (PTSD). PLoS One 2012;7:e42684. 24. Yu H, Watt H, Kesavan C, Mohan S. The negative impact of single prolonged stress on bone development in mice. Stress 2013;16: 564–570. 25. Cizza G, Ravn P, Chrousos GP, Gold PW. Depression: a major, unrecognized risk factor for osteoporosis? Trends in Endocrinology & Metabolism 2001;12:198–203. 26. Yirmiya R, Goshen I, Bajayo A, Kreisel T, Feldman S, Tam J, Trembovler V, Csernus V, Shohami E, Bab I. Depression induces bone loss through stimulation of the sympathetic nervous system. Proceedings of the National Academy of Sciences USA 2006;103: 16876–16881. 27. Albert-Weissenberger C, Siren AL. Experimental traumatic brain injury. Experimental & Translational Stroke Medicine 2010; 2:16. 28. Marmarou A, Foda MA, van den Brink W, Campbell J, Kita H, Demetriadou K. A new model of diffuse brain injury in rats.
Brain Inj, 2014; 28(2): 244–251
29.
30.
31.
32.
33.
34.
35.
36. 37.
38.
39.
40.
41.
42.
43. 44.
45.
Part I: pathophysiology and biomechanics. Journal of Neurosurgery 1994;80:291–300. Masinde GL, Li X, Gu W, Wergedal J, Mohan S, Baylink DJ. Quantitative trait loci for bone density in mice: the genes determining total skeletal density and femur density show little overlap in F2 mice. Calcified Tissue International 2002;71: 421–428. Yu H, Wergedal JE, Zhao Y, Mohan S. Targeted disruption of TGFBI in mice reveals its role in regulating bone mass and bone size through periosteal bone formation. Calcified Tissue International 2012;91:81–87. Kesavan C, Mohan S. Bone mass gained in response to external loading is preserved for several weeks following cessation of loading in 10 week C57BL/6J mice. Journal of Musculoskeletal & Neuronal Interactions 2010;10:274–280. Wergedal JE, Sheng MH, Ackert-Bicknell CL, Beamer WG, Baylink DJ. Mouse genetic model for bone strength and size phenotypes: NZB/B1NJ and RF/J inbred strains. Bone 2002;31: 670–674. Mohan S, Baylink DJ. Development of a simple valid method for the complete removal of insulin-like growth factor (IGF)-binding proteins from IGFs in human serum and other biological fluids: comparison with acid-ethanol treatment and C18 Sep-Pak separation. Journal of Clinical Endocrinology & Metabolism 1995;80: 637–647. Govoni KE, Linares GR, Chen ST, Pourteymoor S, Mohan S. T-box 3 negatively regulates osteoblast differentiation by inhibiting expression of osterix and runx2. Journal of Cellular Biochemistry 2009;106:482–490. Linares GR, Xing W, Burghardt H, Baumgartner B, Chen ST, Ricart W, Fernandez-Real JM, Zorzano A, Mohan S. Role of diabetes- and obesity-related protein in the regulation of osteoblast differentiation. American Journal of Physiology – Endocrinology & Metabolism 2011;301:E40–48. Day TF, Yang Y. Wnt and hedgehog signaling pathways in bone development. Journal of Bone & Joint Surgery American Volume 2008;90:19–24. Einaudi S, Matarazzo P, Peretta P, Grossetti R, Giordano F, Altare F, Bondone C, Andreo M, Ivani G, Genitori L, et al. Hypothalamo-hypophysial dysfunction after traumatic brain injury in children and adolescents: a preliminary retrospective and prospective study. Journal of Pediatric Endocrinology & Metabolism 2006;19:691–703. Kaulfers AM, Backeljauw PF, Reifschneider K, Blum S, Michaud L, Weiss M, Rose SR. Endocrine dysfunction following traumatic brain injury in children. Journal of Pediatrics 2010;157: 894–899. Mysiw WJ, Tan J, Jackson RD. Heterotopic ossification. The utility of osteocalcin in diagnosis and management. American Journal of Physical Medicine & Rehabilitation 1993;72: 184–187. Toffoli AM, Gautschi OP, Frey SP, Filgueira L, Zellweger R. From brain to bone: evidence for the release of osteogenic humoral factors after traumatic brain injury. Brain Injury 2008; 22:511–518. Kesikburun S, Omac OK, Yasar E, Hazneci B, Alaca R. Severe heterotopic ossification in the non-affected limbs of a hemiplegic patient with traumatic brain injury. Brain Injury 2011; 25:127–129. van Kampen PJ, Martina JD, Vos PE, Hoedemaekers CW, Hendricks HT. Potential risk factors for developing heterotopic ossification in patients with severe traumatic brain injury. Journal of Head Trauma Rehabilitation 2011;26:384–391. Bruno-Petrina A. Posttraumatic heterotopic ossification. Available online at: http://emedicine.medscape.com/article/326242-overview, accessed 2011. Leblanc E, Trensz F, Haroun S, Drouin G, Bergeron E, Penton CM, Montanaro F, Roux S, Faucheux N, Grenier G. BMP-9-induced muscle heterotopic ossification requires changes to the skeletal muscle microenvironment. Journal of Bone & Mineral Research 2011;26:1166–1177. Boes M, Kain M, Kakar S, Nicholls F, Cullinane D, Gerstenfeld L, Einhorn TA, Tornetta P 3rd. Osteogenic effects of traumatic brain injury on experimental fracture-healing. Journal of Bone & Joint Surgery America 2006;88:738–743.
DOI: 10.3109/02699052.2013.859735
46. Gautschi OP, Cadosch D, Frey SP, Skirving AP, Filgueira L, Zellweger R. Serum-mediated osteogenic effect in traumatic braininjured patients. ANZ Journal of Surgery 2009;79:449–455. 47. Klein BY, Shohami E, Reikhinshtein Y, Ben-Bassat H, Liebergall M. Serum-mediated osteogenic effects of head injury on cultured rat marrow stromal cells. Calcified Tissue International 1999;65: 217–222.
The negative impact of TBI on bone in a mouse model
251
48. Song Y, Bi L, Zhang Z, Huang Z, Hou W, Lu X, Sun P, Han Y. Increased levels of calcitonin gene-related peptide in serum accelerate fracture healing following traumatic brain injury. Molecular Medicine Reports 2011;5:432–438. 49. Morley J, Marsh S, Drakoulakis E, Pape HC, Giannoudis PV. Does traumatic brain injury result in accelerated fracture healing? Injury 2005;36:363–368.
Copyright of Brain Injury is the property of Taylor & Francis Ltd and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.
