The EMBO Journal vol.10 no.10 pp.2997-3005, 1991

The oct3 gene, a gene for an embryonic transcription factor, is controlled by a retinoic acid repressible enhancer H.Okazawa, K.Okamoto, F.lshino1, T.Ishino-Kanekol, S.Takeda2, Y.Toyoda2, M.Muramatsu and H.Hamada Department of Biochemistry, Faculty of Medicine, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113, 'The Institute for Applied Microbiology, University of Tokyo, 1-1-1 Yayoi, Bunkyo-ku, Tokyo 113 and 2Institute for Medical Sciences, University of Tokyo, Shiroganedai, Minato-ku, Tokyo 108, Japan Communicated by W.Schaffner

Oct3 is an embryonic octamer-binding transcription factor, whose expression is rapidly repressed by retinoic acid (RA). In this report, we have determined the transcriptional control region of the oct3 gene and studied the mechanism of the RA-mediated repression. The chromosomal oct3 gene consists of five exons. Three subdomains of the POU region and transactivating domain are located in separate exons. Transcription initiates at multiple sites in the GC-rich region lacking a typical TATA box. The upstream 2 kb region can confer the cell type-specific expression and RA-mediated repression. Analysis of the upstream region by deletion mutagenesis locates a cis element (RARE1) which functions as a stem cell-specific, yet RA-repressible, enhancer. Footprint and gel-retardation assays show that RARE1 is composed of two domains, each of which is recognized by distinct factors. Microinjection of oct3 - lacZ constructs into fertilized eggs indicates that RARE1 can function in early embryos. We suggest that RARE1 is a critical cis element for oct3 gene expression in embryonic stem cells and for the RA-mediated repression. Key words: embryogenesis/POU gene/retinoic acid/ transcription factor

embryonic stem cells and some germ cells, therefore it probably acts at the very top of the genetic cascade that operates during mammalian embryogenesis. The in situ hybridization studies (Rosner et al., 1990; Scholer et al., 1990a) indicated that the zygotic oct3 expression starts some time before 3.5 days post coitum (dpc). The gene is repressed afterward, although exactly when the gene becomes inactive depends on cell lineage; the repression takes place first in trophectoderm lineage at 4.5 dpc, in primitive endoderm lineage at 5.5 dpc, in mesoderm lineage at 7 dpc and finally in ectoderm lineage at 10 dpc. Oct3 protein presumably regulates expression of its target genes in positive as well as negative fashions. In fact, we have recently identified a few genes that are negatively controlled by Oct3 (our unpublished data). The presence or absence of Oct3 in developing embryonic cells probably determines or influences their fates. In this regard, it is important to study the regulation of oct3 gene itself. One particularly interesting feature of the oct3 gene is that its expression in P19 stem cells was dramatically repressed by retinoic acid (RA). The RA-mediated repression was rapid and was observed regardless of the direction of the cell differentiation, suggesting that it was not due to secondary effects of cell differentiation but specific to RA. Therefore, this system not only serves as a model system for studying the mechanism of oct3 gene repression during development, but also provides an opportunity to define the RA response pathway. In this report, we have isolated the chromosomal oct3 gene, examined its transcriptional control region and searched for cis elements that contribute to the RA-mediated repression. One such cis element, which functions as a RArepressible enhancer, has been found and characterized. The same repression pathway may be utilized for the oct3 gene repression during mammalian development.

Results Introduction Development of multicellular organisms is controlled by the genetic cascades consisting of a group of 'regulatory genes'. Recent advances have identified many of such regulatory genes in the fruit fly, Drosophila. However, the regulatory genes controlling mammalian development are less well understood. We have been interested in identifying regulatory genes which are involved in early embryogenesis, and have recently obtained one such candidate, oct3 gene (Okamoto et al., 1990). The gene encodes an embryonic octamer-binding transcription factor (Oct3). Like other octamer transcription factors such as Octl (Sturm et al., 1988) and Oct2 (Muller et al., 1988; Scheidereit et al., 1988), Oct3 has the POU domain as the DNA-binding domain. The apparently same gene was subsequently reported by two other groups (Rosner et al., 1990; Scholer et al., 1990b). Oct3 is expressed exclusively in early Oxford University Press

Organization of the chromosomal oct3 gene We have previously isolated cDNA for Oct3 (Okamoto et al., 1990). In Southern blot analysis, the oct3 cDNA detected several hybridized bands in the mouse genome (Figure 1A). A mouse genomic library was screened with the cDNA clone under the stringent condition, and we obtained three overlapping genomic clones that strongly hydridized the probe. These clones should contain the chromosomal oct3 gene, according to the following criteria. First, the restriction maps of these genomic clones (Figure 1B) matched the most strongly hybridized band in Figure IA. Secondly, the nucleotide sequences of the exons (Figure 2) were perfectly compatible with that of oct3 cDNA (there was an error in the sequence of the oct3 cDNA that we previously reported; Okamoto et al., 1990. Two Gs at nucleotide number 932 and 933 in Figure 5 of that paper, should have been three Gs. This has now been confirmed 2997

H.Okazawa et al.

..

*W0.

iI

7.

-

..

-.-

.§m

I-=e

1_

_._t

...

Fig. 1. Structure of the chromosomal oct3 gene. A. Southern blot analysis of oct3 gene in mouse genome. P19 DNA digested with the indicated restriction enzymes was hybridized to the oct3 probe. The probe used here was derived from an oct3 partial cDNA clone and contained only its POU domain-coding sequence. The filter was washed at 60°C in 0.1 xSSC. The band corresponding to the oct3 gene are indicated by the arrows. Other bands represent oct3 related genes. B. The restriction map of the mouse oct3 gene. The map was constructed from three overlapping genomic clones (2G22, 2G3 and 2G19), which are indicated above. The HindllI-BamHI 8 kb region containing all the exons is shown in an expanded fashion. The five boxes represent five exons. The exons are numbered 1-5 accordingly from the 5' site. The closed boxes and open boxes are protein-coding and non-coding regions, respectively. The 5' end of oct3 mRNA and the direction of transcription are shown by the small arrows below the map. The 5' end of three nearly full-length cDNA clones (BH12, Cl and C24) are shown at the bottom. B, BamHI; E, EcoRI; H, HindIII; S, SacI; X, XbaI.

with the cDNA and genomic clones). Finally, the isolated chromosomal gene appeared to be a functional one in all aspects. Transcriptional initiation sites were determined by analyzing the 5' end of oct3 mRNA. Primer extension analysis and SI nuclease analysis (Figure 3) both indicated that the initiation takes place at multiple sites clustering in the GC-rich region (indicated by the arrow heads in Figure 2). After we reported the oct3 cDNA clone XC1, we have obtained two more nearly full-length cDNA clones (XBH12 and XC24). The 5' ends of these cDNA clones are compatible with the initiation sites determined by the primer extension and SI nuclease analyses. No TATA box-like sequences were found near the initiation sites. Instead, the nucleotide sequence encompassing the initiation sites are very GC-rich.

Transcriptional control region We have previously shown (Okamoto et al., 1990) that the expression of the oct3 gene in P19 EC cells is rapidly repressed by RA. The repression was observed regardless of the direction of cell differentiation, suggesting that it is specific to RA, and not due to secondary effects of cell differentiation. In order to know the mechanism of the RA-mediated repression, we first determined the transcriptional control region of the oct3 gene. The 2 kb DNA region upstream of the initiation sites (nucleotide + 14 to - 1879) was tested for cell-type specific expression and responsiveness to RA (Figure 4). pHAvcat, in which the 2 kb upstream region was linked to a promoterless cat gene, could confer the cell-

2998

type specificity and the RA-responsiveness; it was active in undifferentiated P19 cells, was repressed by RA and was not expressed in L cells (Figure 4, lane 3). pHAvcat also failed to be expressed in other differentiated cells such as NIH3T3 and HeLa cells (data not shown). On the other hand, pHAvRcat, in which the 2 kb upstream region is linked to the cat gene in an opposite orientation, was inactive in all cell types (lane 2). pSV2 cat, another control was active in P19 cells regardless of the presence or absence of RA (lane 4). These results indicated that the 2 kb upstream region contains the cis element(s) which confers the celltype specificity and RA-responsiveness. P19 cells are known to differentiate into different directions, depending on how the differentiation is induced (Rudnicki and McBumey, 1988). In the above transfection experiments involving RA, P19 cells were plated on tissue culture dishes. When cells are treated by this procedure, they eventually differentiate into smooth muscle-like cells Rudnicki et al., 1990). We have examined several markers at various days after the addition of RA; SSEA-1 which is a specific marker for 'undifferentiated' EC stem cells (Solter and Knowels, 1978), smooth muscle actin and GFAP (Figure 5). As expected, smooth muscle actin is induced, but it is only apparent after day 3. SSEA-1, on the other hand, is present until day 5. In our transfection assay, the cells had been exposed to RA for 48 h before they were harvested for the CAT assay. Therefore, the transfected cells at harvest would correspond to the day 2 cells. In fact, P19 cells transfected in the presence of RA were still positive for SSEA-1 but negative for smooth muscle actin and GFAP, when they were

Regulation of oct3 gene

-

Altottt;ATo.ACCA(GAOI~Ao-ltoCA(AI IATGTAYI(F.T GoAGC1G06t AI AGGATAt tC~i ACCt kAtI6 FAX AI-A Io \757MuI CAtAG.1(RA0oAG1GAACfl1AA9TT uoAA1101i1ltATA'I

-1799 169 109

oAo

T

1

A

lTIATfl~ATI kk(JI~Rt

bOA

I

At

IA`TAITII6iIAGA(l

01tAtl9t969TACAGGOO-

'A(AtIGA

0(

it

II66tTIFAITIOTAAC9911(AtAI1ITIAA.AIA TAAd

1339 01249

90131IGA1AO19T9GOA0G1GAWt

IAAUtUA6AAI

GAl

1W ~A

l M'1It CC

IT itACO

oA

10609

-WTAOAo693.'GAAGIIAlkCMCIAI

-0929

(AiT-,TFoot tIOG1.A~T4TCTAG-AGCA9T1-t IAIT0C-TCFCCG TTIFI~ACTTCkA0T GT(19-Ttt-( TTTCAIITA iA

-A(-oUT('GGO I0AAAGC10IIG(,TiCA(kTU-IAT , 11 ,IT( lGI'(T9At6, 1%IG66(T

t439 ATVot 66601t1 %CC0ATATAGC.A10390(1UTAX.AI 0TCAGTAI6A(iC

IAAWCAWA GGTItlAt'' AAootTlIA

-0349

I,AT(A,A,Tt1'TTIA~GGI'TCCCAGAGGAII(iUl-GAG GGGC1(TI9IA0.AAGOCCI1AGAG(GOT(IoAAol t(CkAAtAI0tTITt

-0169

66TT ti61 CTt'AAIbOoTGFICITGTI0C9CA0AGT0CCCCA9JCOTCCITCAC~AOAIAGAG('A(AAAA~A('

Cl

BH112

1)

20 030 tOt I.kTCGA(1CA0GCCIkC91G1-0T1AflGTGOO9GTCICCCIIA-IA(TI-TI01CTtAIACGAGTTtt 11111 F 1 lOtlE %LCISPCPPAIPIf

IGItLAtTIP UI

FAFAt1OAA

FTT

At~LillAtotI

IA

tIP FA It)PlPNA

I

iTA-oT

9

nTtt tAI

tITttTF I(At -OiCCA V+

H

91 A

C124

iT'

AIATAIT

tTt

~'

~ Tt

l6ATtt~"A.F"(A IA

RAI

TAItt-(~A( &DX-.

EA.tO Ot ~ ~ ~ ~.1V'k~AfV ~~4 ItI [

At I

AA

PT

l

'0 IWIITA(6.AIAII A% ITA AW

tol

AACIAtIk A6IAt(-TCi ACAGIACTFI07GTAGlTGliliAIT0TGTAlt6T1At6'!.~It `Jtt6l,At.t1-li iA

ITtF-rAt.AAA~TI-TlCF-FI-rCACTACAGIATlAIAOOACATO.AkA(At 111AAAA0'AA lA

Exon2

TITIA AGAtt6A`ItIIAGtA 01o0IA 'F P, IF A )0A % F ~ 1

100

(1lt 1-1TITItI 60i

A6t

AlTtA

Af1 Al AT

1

A

10, -191

A tnt ATFtGCFITI A19AAAt6TAflt AltIV it AV At 111

AlIt

6OT --I A 11'it

F

ii I 1

A t

I9 21101

Fig. 3. Mapping of the 5' ends of oct3 mRNA. The 5' ends of oct3 mRNA were determained by primer extension assay and SI1-nuclease

2 10

91K S P 1 L V 0 A 90 91

P K P 1 1 220_M

N

It

0

AG111TF6o'1AGCATGTIITPI'I0AAGTI(OCCtIIGAACCCTPCCU-ACAGCAG&9TCA9OCACAI1CG('('AA ltCAtI'lCT('166 I AGAtIAAt6~-AlIlt 9l 1-

.9

91 C1 Pl

241t

P 1 L 0 01

T II

250

A

9.

0

It

2111(

to AI GlttGltltAlt GAGIlCtAAGAllAllFGCC(t(('('lGTAC'611CGA10.01T[0MC11-GTlC(1CATrCC(CkCAC(1'C01ITII 9CC((11C(911((C

11191....... tAAAOI' AMillTIl0AIiO11IT97TACCG'CAG0T0909010AtGP9A3009TC'9ACTA11I-'At-Al 'tC'tAA('A(AA1Ak'.At9lAl 010 P1 P019F99N99091091G RI Fl itFY 011 F

nA

1701

assay (lanes 1 and 2). as described in Materials and methods. The lanes marked A,C,G and T show the dideoxy sequencing ladders of the upstream region, which served as sequence markers. The nucleotide sequence near the 5' ends of oct3 niRNA is shown on the left. Two major capping sites are indicated by the horizontal bars.

2911

2311( Al iAAG9CC0tT 0 300 310 3211 AMTCACCIAl9111AUTO 'A0101F1CCTM10CFGAGGGCGAGG1CCTCCO7F(-T0CC1-1T(01010-1-1T-01901Cttt-66TUAt190P"A01TA P 1 1 S 0' P P P P G1 P A P P 5 0 P 0 9M S 1191 ,( 340 10C191 90090 T(lOO901PAC196CA01111PI191919i1AITi6ti 9lkAA]Il(71TI1

AGG(11AC'A COOAI'A9('ITIF 'ITCA(011GG(iO1'G.9T1fATCC1'0CTGCCCFC0AO(OP0C'CCCl1AM6 GWA CCCCA( 1' A 1T II PF F II P G G0 A S FSP P L1 P P

tilA11AGWiAI6O FPA.A,(AACACI C01101916 11 CC600 AT CCGC.9116100G1A(90X-9A1-T0191ATCOt'FTA-llIG ATC A ttTI103-R',C(1I lF FC1A'IC CACAI11'I'lIll'I'I'A9.9TA9AGA(lO900aACACACAGTrAG9TAG11-F09ATM110l11l-T '10' A,1`TCC1'9ttAli 'IllCC tO Itl 1AGAA(19AGF191AA1TO0AI1P1(9FCA10CCCA01.1IGAlI'CTC.99AACA(6101G(01AITPGA.9'.9 FICAI'.G11C1IAtA~A.AAIt19('CA11 1010 AF10111 0116100119(CA('l-TAGAGAA(OiCCAIA(PC

Fig. 2. Nucleotide sequence of the oct3 gene. Nucleotide sequences of the 5' upstream region, f-ive exons and introns are shown. Nucleotide residues are numbered for the upstream region. Exon sequences are underlined. Two major capping sites are indicated by arrow heads. The 5' ends of three oct3 cDNA clones (Cl1, BH12 and C24)) are also shown.

harvested (data not shown). These results suggest that the RA-mediated repression should take place early during the cell differentiation process, at least before a number of differentiation markers are induced. RARE 1, an RA-repressible enhancer In order to map the RA-responsive element(s), a series of deletion mutants were constructed from pHAvcat and their transcription activities were assayed in P19 cells, in the presence or absence of RA. The results with the 3' deletion mutants (Figure 6A), and the 5' deletion mutants (Figure 6B) indicate that there is an RA-responsive element (designated as RAREI1) between nucleotides - 1132 and -889 (the

nucleotide sequence is shown in Figure 6C) which functions as an enhancer in the absence of RA but loses its

activity

in the presence of RA. The enhancer activity and RA responsiveness were inseparable in our deletion analysis; i.e. there were no deletion mutants that lost the RA-responsiveness and yet retained the enhancer activity. Therefore, RAREI1 is an RA-repressible enhancer, which represents a novel type of cis element. RARE 1 can function as an RA-repressible enhancer even when linked to a heterologous promoter (Figure 7). The BamHl -Xbal 0.8 kb fragment or the 243 bp fragment (from - 1132 to 1889), both containing RARE 1, was placed upstream of a fl-interferon gene promoter. The resulting CAT constructs (pIFNcatBXO.8, pIFNcatBXO.8R and pIFNcatO.2) behaved much like pHAvcat; all of these constructs were active in P19 cells in the absence of RA, inactive in the presence of RA (Figure 7, lanes 2-4) and inactive in all the differentiated cell lines tested including L cells, NIH3T3 cells and HeLa cells (data not shown). These results obtained with the heterologous system now establish that RARElI (- 1 132 to - 889) is a cell-type specific yet RA-repressible enhancer. RARE 1 is composed of two elements The 243 bp RAREI1 region has been dissected in detail. When the 243 bp fragment was divided into two halves at the internal AluI site (located at - 10 13), neither fragment

2999

H.Okazawa et al.

possessed the enhancer activity (data not shown). The 243 bp region was next surveyed by footprint assay. When nuclear extracts prepared from P19 stem cells were used, two protected regions were detected: RAREIA and RARElB (Figure 8A). Oligonucleotides corresponding to the two protected regions were synthesized (shown in Figure 6C), and were used as probes for gel shift assay. Both probes detected binding factors in P19 nuclear extracts (Figure 8B). The mobilities of retarded bands observed with RAREIA and RAREIB were slightly but apparently different, suggesting that RAREIA and RARElB were recognized by different factors. Interestingly, the same retarded bands were also

-A, li.

ii

Fig. 4. Transcriptional control region of the oct3 gene. Each of the four CAT plasmids was transfected into P19 cells in the presence or absence of RA, or into L cells. The structure of four plasmids are shown on the top. Lanes 1, pOcat; lanes 2, pHAvRcat; lanes 3, pHAvcat; lanes 4, pSV2cat. See text for detail.

observed with nuclear extracts from RA-treated P19 cells (Figure 8B). In the competition experiments (Figure 8B), formation of the RAREIA complex was abolished by the unlabeled RARE1A oligonucleotide but not by the RAREIB oligonucleotide. On the other hand, the RARE1B complex was competed out by unlabeled RARE1B but not by RARElA. These results establish that RARE1A and RAREIB are recognized by specific yet different factors. Nuclear extracts from P19 stem cells and from RA-treated P19 cells behaved indistinguishably throughout these binding assays, suggesting that the same factors exist before and after the RA-treatment. In order to know whether RARElA and RAREIB are essential to the RAREI enhancer activity, internal deletion mutants lacking RARElA or RARElB were constructed and tested for the enhancer activity (Figure 9). The mutant lacking RARE1A (Figure 9, lane 2) and the mutant lacking RAREIB (Figure 9, lane 3) both lost the enhancer activity. On the other hand, the mutant lacking another part of RAREl (Figure 9, lane 4) still retained full-activity and responsiveness to RA. These results indicate that RARE1 is composed of at least two cis elements, RAREIA and RAREIB. RARE1 activity is not influenced by retinoic acid receptors RA-induced signal pathway is believed to be mediated by retinoic acid receptors (RARs). Several types of RARs have been identified, including RARce, RAR,3 and RAR-y. RARca and RARy exist in P19 stem cells and persist during the RAinduced differentiation. On the other hand, RAR3 is not expressed at an appreciable level in the stem cells but is greatly induced by RA (de Groot et al., 1990). We next we tested the possibility that RAR may be directly involved in the repression of RAREl activity by RA. pIFNcatO.2 (containing RAREl) was transfected to P19 cells

.-

y

:C

1iM

RA. At various days Fig. 5. RA-induced phenotypic changes of P19 cells. P19 cells were plated on tissue culture dishes in the presence of 1 after the addition of RA, the cells were fixed and stained with the SSEA1-antibody (Solter and Knowels, 1978) or anti-smooth muscle actin antibody. For each set, phase contrast photographs (PC) and immunological staining patterns (IF) are shown.

3000

Regulation of oct3 gene

in the absence of RA, along with RARa, RARf or RARy expression vector (Figure 10). However, none of the RAR expression vectors influenced the RARE1 activity, suggesting that RAR is not directly responsible for the RA-mediated repression of RARE1 enhancer (it is possible that a ligandbound RAR may repress the RAREl activity. However, such experiments are not feasible in our case since RARE1 is only active in EC stem cells).

A

Activity of the oct3 upstream region in mouse early embryo In our results so far described, the transcriptional control region of the oct3 gene has been assayed in the pluripotent EC cell line (P19), which are believed to be equivalent to inner mass cells. Next, we examined whether the 2 kb upstream region of the oct3 gene is active in mouse embryos. The 2 kb upstream fragment was linked to the bacterial lacZ

=

I,I SI,I SI,I

a

I T4

...

0 0 I

B

t *:

4 4.

* i d

.

F3 *.

t.

sI

.;

it.

e11 4.

i

41 aS

C

Fig. 6. Mapping of RAREI, an RA-repressible enhancer. In one series of deletion mutants, the oct3 upstream region was progressively deleted from the 3' site to the 5' site (A). In the other set of deletion mutants, the DNA region was deleted from the 5' site toward the 3'-site (B). Each deletion mutant was transfected to P19 cells in the presence or absence of RA, and CAT activity produced was measured. The arrows indicate two forms of acetylated chloramphenicol. Approximate location of RAREI, determined by these deletion analyses, is indicated on the top-left. (C). The nucleotide sequence of the 243 bp RAREI

region. 3001

H.Okazawa et at.

composed of three subdomains; POU-specific A, POUspecific B and homeobox-like H. In this regard, it is interesting to note that each of three subdomains of the Oct3

up~~~~~~~~~~~~~~1

4

Fig. 7. RARE1

can

function with

a

heterologous promoter. The

structure of the CAT-constructs used in this figure are shown on the top. pIFNcat (lanes 1) contains ,B interferon gene promoter (from -55 to + 19; Hata et al., 1989). The RARE1-containing fragment, either the BamHI-XbaI 0.8 kb fragment or the 243 bp fragment (-1132 to -889) was placed just upstream of the interferon promoter, to create

pIFNcatBX1.0 (lanes 2), pIFNcatO.2 (lanes 4). Each plasmid transfected to P19 cells in the presence or absence of RA.

was

The resulting construct (oct3-lacZ; Figure 1 1A) was injected into mouse fertilized eggs, and the embryos were stained for fl-galactosidase activity 96 h after the injection (blastocyst stage). 16% of the blastocysts (8/50) were positive for the staining (a representative embryo is shown in Figure 1 IB). The staining was observed both in inner cell mass and trophectoderm, which is consistent with the oct3 expression pattern examined by in situ hybridization (Rosner et al., 1990; Scholer et al., 1990a). However, the frequency of the positively stained embryos was lower than that of pCH110, a lacZ construct driven by the SV40 promoter/enhancer (20/50 of the embryos were positive with pCH1 10). The intensity of the staining with oct3 -lacZ was also weaker than that with pCH1 10, although it is difficult to compare the expression levels quantitatively. Therefore, the 2 kb upstream region of the oct3 gene may not be sufficient for its expression in early embryo. Nonetheless, the positive staining was never detected (0/50) when RARE1 was deleted (Aoct3 lacZ, in Figure 1llA), indicating that RARE1 is a critical cis element for the oct3 gene expression in early embryo as well as in P19 stem cells. gene.

-

Discussion In this report, we have determined the structure of the chromosomal oct3 gene, and have studied the mechanisms of RA-mediated repression in EC cells as a model system for its regulation during development. The chromosomal oct3 gene consists of five exons. The exon/intron organization seems to reflect functional domains of Oct3 protein. The transactivating domain located in the amino-terminal region of Oct3 (Okamoto et al., 1990) is contained in a single exon. Herr et al. (1988) have proposed, based on the amino acid sequence homology between several POU-containing proteins, that a POU domain is 3002

POU is located in separate exons. The oct3 probe has detected, in the mouse genome, multiple bands in addition to the oct3 gene (Figure lA). The probe used in the experiment corresponds to Oct3 POU (B and H) region, whose amino acid sequence is diversed from those of other POU proteins (Okamoto et al., 1990). Therefore, the observed multiple bands most probably indicate the existence of oct3 related genes in the mouse genome. It remains to be seen whether the oct3 related genes are functional or pseudogenes. Our results indicate that expression of the oct3 gene in P19 cells is controlled by the cell-type specific yet RArepressible enhancer (RAREI), which can contribute to the RA-mediated repression. RARE1 is composed of at least two cis elements (RAREIA and RAREIB), each of which are recognized by distinct factors (Figure 8). Since the enhancer activity and the responsiveness to RA were not separable in our mutagenesis analysis, RAREIA and RARElB probably act in a co-operative manner to make up this enhancer. However, the RARElA-binding factor and RAREIB-binding factor were present in RA-treated P19 cells as well as in P19 stem cells (Figure 8B). Therefore, it is not clear in this study how RAREI loses its enhancer activity in response to RA. One obvious possibility is that RA-treatment results in the modification of the existing RAREl-binding factors. As the simplest model, RA may induce a certain enzyme that modifies the factors (such as protein kinase, for example). Alternatively, RAREI enhancer activity may require the interaction of the RAREl-binding factors with another factor yet to be detected. RA may abolish this interaction, by reducing the amount of the third factor. In any case, the RAREl-binding factors must be identified by molecular cloning, in order to understand how RARE1 activity is repressed by RA. It is generally believed that most, if not all, of the action of RA is mediated by the retinoic acid receptors (RARs; Brand et al., 1988; Giguere et al., 1988; Zelent et al., 1989). We initially expected that RARs might be directly involved in the repression of RAREI activity. However, our data suggest that this is not the case. First, the 243 bp RAREI region does not contain typical recognition sequence of RARs. Secondly, RARca, RAR3 and RAR-y failed to influence the RAREI activity when co-transfected into P19 cells (Figure 10). Finally, the DNA-binding domains of RARs (that were produced in bacteria) failed to bind to the RAREI 243 bp fragment, RAREIA oligonucleotide and RAREIB oligonucleotide (unpublished data). Another important question to be addressed is whether RA is actually involved in the repression of the oct3 gene during normal development. The in situ hybridization studies (Rosner et al., 1990; Scholer et al., 1990a) indicated that the zygotic oct3 gene expression starts before 3.5 dpc. The repression of the genes takes place at various stages (4-10 dpc) depending on the cell lineage. Do early embryos have chances to be exposed to RA? Do they synthesize RA? Although endogenous RA was initially detected in chick limb buds, the presence of RA is not restricted to this tissue. Wagner et al. (1990) have shown that the floor plate of the developing neural tube contains not only polarizing activity but also RA-synthesis activity. Furthermore, endogenous RA has been detected in frog early embryos (stage 10-15) at

Regulation of oct3 gene

A 234 I&

56 I

i

1.

*E_

40-- -"'

i:

I1 a _

w

c:

.

as .

I

m LLJ

cr:

c: v * *

.i;

lla) B RARF

DrcrCe

FE

pz

P1 9 -

RARE 1-A M

p

x8

X8

.'* -

RiARE -: -

R

P.9 F~~~'

P19

_

--

a

XI."0I

B

-

RARE '-B Xi

x.1-

-

t'

.

HA 1 RMRE

--

-

B

RAA

RARE '-B X8 A",-

-:

-

RARE !-A x

x

iAA A

Fig. 8. Detection of RAREl-binding factors. A. Footprint assay. The probe DNA is the 243 bp fragment (-1132 to -1889). The 5' end of the lower strand is labeled for lanes 1-4, while the 3' end of the upper strand is labeled for lanes 5-6. The probe was incubated with (+) or without (-) P19 nuclear extract. Two protected regions (RARElA and RAREIB) are indicated. For lanes 5-6, the gel was run much longer in order to expand the RAREIA region. The protection was also detected at the RAREIB region of the upper strand (data not shown). B. Gel shift assay. The RARE1A probe and RAREIB probe are the 27 bp oligonucleotide (-1120 to -1094) and the 35 bp oligonucleotide (-943 to -909), respectively. They were incubated with nuclear extracts from P19 stem cells (indicated as P19) or RA-treated P19 cells (indicated as P19+RA). The binding was challenged by unlabeled RAREIA or RAREIB oligonucleotide. 3003

~~

H.Okazawa et al.

A P E .I

A_t/

'i

_... _/ .. __-...- ._N__,-

:._

...

1,

..

Fig. 11. Activity of oct3lacZ in mouse early embryo. A. Structure of two lacZ constructs (one containing the 2 kb upstream region, the other lacking RAREI) are shown. B. A representative embryo is shown that gave rise to the positive staining with oct3-lacZ.

Fig. 9. RAREI is composed of at least two elements. The structures of the CAT constructs used in these figures are shown on the upper part. The 243 RAREI region is shown on the top. Two proteinbinding sites (RAREIA and RAREIB) determined by footprint assay and gel shift assay (Figure 8) are indicated by two ovals. pIFNcat (lanes 1) and pIFNcatO.2 (lanes 5) have been described in Figure 7. Three internal deletion mutants, AA (lanes 2), AM (lanes 4) and AB (lanes 3) lack -1120 to -1094, -980 to -941, and -941 to -911, respectively. Each plasmid was transfected to P19 cells in the presence or absence of RA.

1. b4. e -cL

'!F]

_

N

Fig. 10. RAREl activity is not directly influenced by retinoic acid receptor. pIFNcatO.2 (10 jig) was transfected to P19 cells in the absence of RA, along with 5 jig of an effector plasmid. a mean concentration of 0.15 AM. This concentration is within the range encountered in other tissues including chick limb bud. In this view, it would not be surprising to see that mouse early embryos contains endogenous RA. Even if RA is not actually involved in the repression of the oct3 gene during normal development, early embryos may utilize the common pathway. In this case, it would not be RA but some other signal that triggers the repression

3004

pathway. Whether RA plays any part in embryogenesis or not, the genetic cascade similar to the one that is induced by RA in EC cells may operate during vertebrate embryogenesis.

Materials and methods Materials Murine embryonal carcinoma cells, P19 (McBumey and Rogers, 1978) were maintained in cs-MEM medium. Anti-SSEAl antibody (Solter and Knowels, 1978) was kindly provided by T.Muramatsu. Anti-smooth muscle actin antibody was purchased from Sigma Co.

Isolation and characterization of chromosomal oct3 gene A mouse genomic library constructed from P19 stem cell DNA was screened with the oct3 cDNA clone (Okamoto et al., 1990). More than ten positive clones were obtained. Among them, three overlapping clones that strongly hybridized to the probe were chosen for this study. The exon/intron organization was determined by restriction mapping followed by hybridization to the cDNA, and by sequencing. The nucleotide sequence was determined by the dideoxy method, by using the Sequenase kit (United States Biochemical Corporation). The primer extension and SI -nuclease assays were carried out with 10 itg of poly(A)+ RNA from P19 stem cells, as described by Ausbel et al. (1987). A 30mer oligonucleotide (AAGCTTAGCCAGGTTCGAGAATCCACCCAG), which is complementary to oct3 mRNA (from + 154 to + 183) was used for both assays. For the primer extension assay, the 30mer was 5' end labeled and used as a primer. For S l-nuclease assay, the anti-sense single-stranded DNA (from - 1879 to + 183) was synthesized with the 5' end labeled 30mer, and was annealed to the RNA.

Mapping of RARE1 To construct pHAvcat, the AvrII site (+ 15) was converted into a HindIII site. The resulting HinduI 2 kb fragment from + 14 to -1879 was placed at the Hindm site of pOcat (Okamoto et al., 1990). In pHAvRcat, the same Hindm-2 kb fragment was inserted in an opposite orientation. In a series of 5' deletion mutants (A5'), the deletion extends from the upstream Hindlll site to the 3' site. In another set of deletion mutants (A3'), the deletion starts at the StuI site located at -181, and proceeds to the 5' site. Each deletion mutant was verified by restriction mapping and sequencing. DNA transfection was performed as described previously (Okamoto et al., 1990). In brief, 10 ytg of test plasmid was mixed with 10 /kg of pUC 12 DNA, and transfected to the cells. For transfection into RA-treated PIG cells, 1 jiM of RA was added when the cells were plated. RA was present

Regulation of oct3 gene

until the cells were harvested for CAT assay (therefore the cells were exposed to RA for 48 h). For RA-treated and untreated P19 cells, cell extract containing the same amount of protein were used to measure CAT activity. In some cases, 5 Ag of pCH110 was included as an internal standard. In such cases, cell extract showing the same level of 1-galactosidase activity was used for CAT assay. In co-transfection experiments (Figure 10), 5 of effector plasmid, 10 of reporter plasmid and 5 1tg of pUC 12 were mixed and transfected. The expression vectors for human RARcs,3,-y were kindly provided by P.Chambon (Brand et al., 1988; Krust et al., 1989).

ytg

ytg

Wagner,M., Thallaer,C., Jessell,T. and Eichele,G. (1990) Nature, 345, 819-822. Zelent,A.A., Krust,M., Petrovich,M. and Chambon,P. (1989) Nature, 339, 714-717. Received on April 29, 1991; revised on June 17, 1991

Microinjection of lacZ constructs

For constructing oct3 - lacZ, the HindIII -BamHI lacZ fragment derived from pCHI10 was first subcloned in Bluescript (pBSlacZ). The HindIII-2 kb fragment from pHAvcat was inserted into pBSlacZ in an appropriate orientation. Aoct3 - lacZ was constructed in a similar way, with the 5' deletion mutant (A5'-9 shown in Figure 6B). In both cases, the vector sequence was removed by SacII -XhoI digestion, followed by gel electrophoresis. The recovered lacZ fragment was used for the microinjection into fertilized mouse eggs. All the procedures to obtain the microinjected blastocysts are essentially as described by Hogan et al. (1986). The eggs were cultured in vitro for 96 h, and morphologically normal blastocysts were selected, and were stained for LacZ activity as described by Scholer et al. (1989).

Acknowledgements We are most grateful to Prof. P.Chambon for kindly providing us with the retinoic acid receptor expression clones. We also thank N.Sakurai for his assistance in the immunological work, T.Muramatsu and D.Solter for the SSEA1 antibody, and P.Hirom for improving the manuscript. This work was supported by grants from the Ministry of Education, Science and Culture of Japan.

References Ausbel,F.M., Brent,R., Kingston,R.E., Moore,D.D., Seidman,J.G., Smith,J.A. and Struhl,K. (1987) Current Protocols in Molecular Biology. Wiley-Interscience, New York. Brand,N., Petkovich,M., Krust,A., Chambon,P. de The,H., Marchio,A., Tiollas,P. and Dejean,A. (1988) Nature, 332, 850-853. de Groot,R.P., Kruyt,F.A.E., van der Saag,P. and Dejean,A. (1990) EMBO J., 9, 1831-1837. Giguere,V., Ong,E.S., Segui,P. and Evans,R.M. (1987) Nature, 330, 624-629. Hata,A., Ohno,S., Akita,Y. and Suzuki,K. (1989) J. Biol. Chem., 264,

6404-6411. Herr,W., Sturm,R.A., Clerc,R.G., Corcoran,L.M., Baltimore,D., Sharp,P.A., Ingraham,H.A., Rosenfeld,M.G., Finney,M., Ruvkun,G. and Horvitz,H.R. (1988) Genes Dev., 2, 1513-1516. Hogan,B., Constantini,F. and Lacy,E. (1986) Manipulating the Mouse Embryo. Cold Spring Harbor Laboratory Press, Cold Sring Harbor, NY. Krust,A., Kastner,P., Petkovich,M., Zelent,A. and Chambon,P. (1989)

Proc. Natl. Acad. Sci. USA, 86, 5310-5314. McBurney,M.W. and Rogers,B.J. (1978) Dev. Biol.,

89, 503-508. Muller,M.M., Ruppert,S., Schaffner,W. and Matthias,P. (1988) Nature,

336, 551-555. Okamoto,K., Okazawa,H., Okuda,A., Sakai,M., Muramatsu,M. and Hamada,H. (1990) Cell, 60, 461-472. Rosner,M.H., Vigano,M.A., Ozato,K., Timmons,P.M., Poirier,F., Rigby,P.W. and Staudt,L.M. (1990) Nature, 345, 686-692. Rudnicki,M.A., Sawtell,N.M., Reuhl,K.R., Berg,R., Craig,J.C., Jardine,K., Lessard,J.L. and McBurney,M.W. (1990) J. Cell Physiol., 142, 89-98.

Rudnicki,M.A. and McBurney,M.W. (1987) In Robertson,E.J. (ed.) Teratocarcinoma and Embryonic Stem Cells -A Practical Approach. IRL Press, Oxford. Scheidereit,C., Cromnlish,J.A., Gerster,T., Kawakami,K., Balmaceda,C.G., Currie,R.A. and Roeder,R.G. (1988) Nature, 336, 551-557. Scholer,H.R., Dressler,G.R., Balling,R., Rohdewohld,H. and Gruss,P.

(1990a) EMBO J., 9, 2185-2 195. Scholer,H.R., Ruppert,S., Suzuki,N., Chowdhury,K. and Gruss,P. (1990b) Nature, 344, 435-439. SolterD. and Knowels,B.B. (1978). Proc. Natl. Acad. Sci. USA, 75, 5 S6 -s69.

Sturm,R.A., Das,G. and Herr.W. (1988) Genes Dev'., 2, 1582-1599.

3005