Oral Diseases (2015) 21, 320–327 doi:10.1111/odi.12272 © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd All rights reserved www.wiley.com
ORIGINAL ARTICLE
The oncogenic role of androgen receptors in promoting the growth of oral squamous cell carcinoma cells T-F Wu1,*, F-J Luo2,*, Y-L Chang1, C-M Huang1,2, W-J Chiu1, C-F Weng1, Y-K Hsu3, T-C Yuan1 1
Department of Life Science and Institute of Biotechnology, National Dong Hwa University, Hualien; 2Department of Pathology, Mennonite Christian Hospital, Hualien; 3Department of Dentistry, Mennonite Christian Hospital, Hualien, Taiwan
OBJECTIVES: The aims of this study were to examine the expression of androgen receptors (AR) in oral squamous cell carcinoma (OSCC) cells and tumors and to determine the role of AR in regulating OSCC cell growth. MATERIALS AND METHODS: Four OSCC cell lines were used for analyzing AR expression and transcriptional activity. The effects of AR knockdown on the growth and tumorigenicity of OSCC cells were examined. A series of 11 benign, 22 premalignant, and 21 malignant lesions of the oral cavity were used for analyzing AR expression. RESULTS: OSCC cells expressed AR proteins with differential activities. Stimulation of AR by dihydrotestosterone in OSCC cells caused an increase in cyclin D1 expression and promoted cell growth, whereas treatment with bicalutamide led to decreased cyclin D1 expression and inhibited cell growth. Knockdown of AR expression in OSCC cells resulted in decreased proliferation, increased apoptosis, and inhibited tumorigenicity. Results from immunohistochemical studies showed that AR immunoreactivity was found in 27% (3/11) of benign lesions, while 68% (15/22) of premalignant and 67% (14/21) of malignant lesions showed positive AR staining. CONCLUSION: Our data suggest that OSCC cells express functional AR proteins which are critical for promoting cell growth and causing malignant disease. Oral Diseases (2015) 21, 320–327 Keywords: oral squamous cell carcinoma; androgen receptor; cell growth; dihydrotestosterone; bicalutamide
Correspondence: Ta-Chun Yuan, PhD, Department of Life Science and Institute of Biotechnology, National Dong Hwa University, No. 1, Sec. 2, Da Hsueh Rd., Shoufeng, Hualien 97401, Taiwan. Tel: 886 3 863 3668, Fax: 886 3 863 3630, E-mail: [email protected] *These authors contributed equally. Received 12 February 2014; revised 13 May 2014; accepted 27 June 2014
Introduction Oral squamous cell carcinoma (OSCC) is the most frequently diagnosed malignancy worldwide and accounts for over 90% of neoplasms in the oral cavity. The risk factors for causing OSCC include tobacco use, alcohol consumption, and betel quid chewing (Warnakulasuriya, 2009). For patients with early-stage (stage I/II) OSCC, surgery and radiotherapy improve patient survival rates to 70–90% (Argiris et al, 2008). Unfortunately, due to the delay in diagnosis, 65% of patients with OSCC are initially diagnosed with advanced stages (stage III/IV) of the disease. The current management of advanced OSCC consists of multiple treatment modalities, including surgery, radiotherapy, and chemotherapy. Despite recent advances in disease management, more than 50% of patients with OSCC eventually develop local relapses or distant metastases, resulting in a poor prognosis (Silverman, 2001). Thus, further elucidation of the molecular events that promote the malignancy of OSCC is urgently needed to develop promising strategies for treating patients with advanced OSCC. The androgen receptor (AR) is a ligand-dependent transcription factor that belongs to the nuclear receptor superfamily. In humans, the AR is ubiquitously expressed throughout the entire body (Kimura et al, 1993). Upon activation by androgens, the AR dimerizes as a homodimer and subsequently binds to androgen-responsive elements (AREs) on the promoter regions of target genes. This binding in turn activates the expression of genes that regulate the growth, differentiation, and survival of AR-expressing cells, such as prostate epithelia (Devlin and Mudryj, 2009). Deregulated AR expression or activity is a key factor that causes the malignant transformation of prostate cancer cells, and thus, inhibition of AR activity is a therapeutic strategy to treat prostate cancer. Compared with the intensive studies regarding the oncogenic functions of AR in prostate cancer, there is limited evidence regarding the expression and function of AR in OSCC tumors (Kushlinskii et al, 1993; Nehse and Tunn, 1994). In a study of archival specimens of head and neck squamous cell carcinoma, 60% of examined samples were positive for AR staining, with only 20% positive staining observed in normal mucosa samples (Budai et al, 1997).
The role of AR in regulating OSCC cell growth
T-F Wu et al
In salivary gland cancer, the expression of AR is well defined; thus, the AR can serve as a potential target for clinical management (Fan et al, 2000; Jaspers et al, 2011). In this study, we examined the expression of AR in OSCC cell lines and tumors. We further characterized the function of AR in promoting the growth and tumorigenesis of OSCC cells.
Materials and methods Cell culture Human OSCC cell lines, SCC4 and SCC25, and prostate cancer LNCaP cells were obtained from the Biosource Collection and Research Center (BCRC, Taipei, Taiwan). OECM-1 (Meng et al, 1998) and SAS cells, two OSCC cell lines, were obtained from Dr. K.W. Chang (National Yang-Ming University, Taipei, Taiwan). OECM-1 and LNCaP cells were cultured in RPMI 1640 medium, SCC4 and SCC25 cells were maintained in DMEM/F12 medium, and SAS cells were cultured in DMEM medium. Each medium was supplemented with 5% FBS, 2 mM glutamine, and 0.05 mg ml1 of gentamicin. Cell culture medium and supplements were purchased from Invitrogen (Carlsbad, CA, USA). Reverse transcription PCR Total RNA content was isolated using an RNA purification kit (Geneaid, Taipei, Taiwan), and cDNA was synthesized using a GoScript reverse transcription system (Promega, Madison, WI, USA) according to the manufacturer’s instructions. PCR amplification was performed for 30 cycles (94°C for 1 min, 60°C for 1 min, and 72°C for 2 min). The paired primers used for AR and GAPDH were AR (forward): CCTGGCTTCCGCAACTTACA C-30 ); AR (reverse): GGACTTGTGCATGCGGTACTC; GAPDH (forward): TGGTATCGTGGAAGGACTCATGA C; and GAPDH (reverse): TGCCAGTGAGCTTCCCGT TCAGC. These primers were designed according to a public database from RTPrimerDB (Pattyn et al, 2003). Following agarose gel electrophoresis, the amplicons were visualized using ethidium bromide staining. Luciferase reporter assay Cells were plated in complete medium in 24-well plates at 1 9 104 cells well1. After a 48-h incubation, cells were cotransfected with 1 lg of pGL2-ARE-luc plasmids and 0.2 lg of Renilla luciferase-expressing vectors using a TransLT1-transfection reagent (Mirus, Madison, WI, USA). After an additional 48-h incubation, the cells were lysed, and the ratio of the two luciferase activities was analyzed using a dual-luciferase reporter assay kit (Promega) and a 2020n luminometer (Turner BioSystems, Sunnyvale, CA, USA). Lentiviral infection Lentiviral vectors carrying shRNA against the AR gene were obtained from the RNAi Core at Academic Sicina (Taipei, Taiwan). For the preparation of the shRNA-containing lentiviruses, 293FT cells (Invitrogen) were cotransfected with a lentiviral expression vector containing an AR-targeted
shRNA and with packaging plasmids using a PolyJet Transfection Reagent (SignaGen Lab., Ijamsville, MD, USA). Cells expressing shRNA against the firefly luciferase gene (shLuc) served as controls. After a 72-h incubation, the culture medium containing lentiviruses was harvested. For infection, cells grown in 6-well plates were incubated with viruses in the presence of 8 lg ml1 of polybrene for 24 h at 37°C. The expression level of AR in these infected cells was detected by Western blot analysis.
321
Cell growth assay To compare the growth of the different types of OSCC cells and to determine the effects of bicalutamide (Sigma, St. Louis, MO, USA) and knocking down AR expression on cell growth, cells were seeded in 24-well plates. After a 48-h incubation, one set of attached cells was harvested and counted as day 0. The remaining cells were fed with fresh medium and harvested on day 3 or day 4 for counting. To examine the effect of dihydrotestosterone (DHT; Sigma) on cell growth, SCC4 cells were cultured for 48 h in a steroid-reduced (SR) medium, that is, phenol red-free DMEM/F12 medium supplemented with 5% charcoal-/ dextran-treated FBS. The cells were then fed with fresh SR medium containing 10 nM DHT. After 4 days of culture, the cells were harvested, and the cell number was counted. Cell cycle analysis For cell cycle distribution analysis, cells were harvested and fixed in ice-cold 70% ethanol for storage at 20°C. After washing with PBS, the cell pellets were stained with 1 ml of propidium iodide (PI) staining solution containing 0.1% Triton X-100, 20 lg ml1 PI, and 200 lg ml1 RNase for 30 min. Acquisition and analysis were performed by Cytomics FC500 flow cytometry (Beckman Coulter, Brea, CA, USA) with excitation at 488 nm. Soft agar assay Each well of a 6-well culture dish was coated with a bottom layer of 1.5 ml of an agar–medium mixture consisting of DMEM with 5% FBS and 0.6% agar. After the bottom layer was solidified, 1.5 ml of an agar–medium mixture consisting of DMEM with 5% FBS, 0.5% agar, and 1 9 104 cells was added, and the dishes were incubated at 37°C for 2 weeks. Plates were stained with 0.005% crystal violet, and colonies larger than 25 lm in diameter were counted in four randomly selected fields using an optical microscope at 40-fold magnification. Tumorigenic study Animal protocols have been approved by the Institutional Animal Care and Use Committee at the National Dong Hwa University. Twenty-four hours after lentiviral infection, AR-knockdown and shLuc control SAS cells were harvested, and an aliquot of 5 9 105 cells suspended in 0.2 ml of PBS was injected subcutaneously into the back of 8- to 10-week-old BALB/cA-nu nude mice. Tumor growth was measured weekly until 35 days after inoculation, and tumor volumes were determined using the formula (larger diameter) 9 (smaller diameter)2 9 0.5.
Oral Diseases
The role of AR in regulating OSCC cell growth
T-F Wu et al
322
Western blot analysis Cells were harvested, and the cell lysates were prepared as previously described (Yuan et al, 2007). For immunoblotting, an aliquot of total cell lysates in an SDS-PAGE sample buffer was separated by electrophoresis and then transferred to a nitrocellulose membrane. After blocking with 5% nonfat milk or BSA in Tris-buffered saline containing 0.1% Tween 20 for 1 h at room temperature (RT), the membrane was incubated with antibodies against AR (PG-21) (Millipore, Billerica, MA, USA), cyclin D1, Bcl-2, or Bax (Epitomics, Burlingame, CA, USA). After incubation for overnight at 4°C, the membrane was washed and then incubated with appropriate secondary antibodies for 1 h at RT. The specific protein was then detected by an ECL reagent kit (Amersham, Piscataway, NJ, USA). The relative level of cyclin D1 protein was semi-quantified by densitometric analysis using ImageJ (NIH image, Bethesda, MA, USA). Tissue microarray and immunohistochemistry Specimens analyzed included 11 benign, 22 premalignant, and 21 malignant lesions of the oral cavity that were collected from patients who underwent surgical resection at Mennonite Christian Hospital (Hualien, Taiwan). This procedure was approved by the institutional review board of the Buddhist Tzu Chi General Hospital (#IRB101-115), and written informed consents were obtained from all participants. Tissue specimens were incorporated into a tissue microarray. The sections were deparaffinized in xylene, rehydrated with graded ethanol, and then boiled in 1 mM EDTA (pH 8.0) for 5 min in an autoclave. After three washes with 3% H2O2, the sections were blocked with a protein block serum (Dako, Glostrup, Denmark) for 5 min. Subsequently, the sections were incubated with an AR mouse monoclonal antibody (clone AR441; Dako) at a 1:50 dilution for 30 min, and the signal was then amplified using an Envision kit (Dako) according to manufacturer’s protocol. All sections were counterstained with hematoxylin for 2.5 min. The expression of AR was evaluated using a light microscope, and the scores were (a)
(c)
Oral Diseases
divided into three grades: negative (0), low (+1), and high (+2/+3). Tumor cores with >10% of cells staining +1 or greater were defined as positive. Statistical analysis The significance for all group comparisons was assessed by Student’s two-tailed t-test or a one-way ANOVA followed by Tukey’s or Dunnett’s post hoc comparison. The chi-square test was used for comparison between categorical variables. A P-value
ORIGINAL ARTICLE
The oncogenic role of androgen receptors in promoting the growth of oral squamous cell carcinoma cells T-F Wu1,*, F-J Luo2,*, Y-L Chang1, C-M Huang1,2, W-J Chiu1, C-F Weng1, Y-K Hsu3, T-C Yuan1 1
Department of Life Science and Institute of Biotechnology, National Dong Hwa University, Hualien; 2Department of Pathology, Mennonite Christian Hospital, Hualien; 3Department of Dentistry, Mennonite Christian Hospital, Hualien, Taiwan
OBJECTIVES: The aims of this study were to examine the expression of androgen receptors (AR) in oral squamous cell carcinoma (OSCC) cells and tumors and to determine the role of AR in regulating OSCC cell growth. MATERIALS AND METHODS: Four OSCC cell lines were used for analyzing AR expression and transcriptional activity. The effects of AR knockdown on the growth and tumorigenicity of OSCC cells were examined. A series of 11 benign, 22 premalignant, and 21 malignant lesions of the oral cavity were used for analyzing AR expression. RESULTS: OSCC cells expressed AR proteins with differential activities. Stimulation of AR by dihydrotestosterone in OSCC cells caused an increase in cyclin D1 expression and promoted cell growth, whereas treatment with bicalutamide led to decreased cyclin D1 expression and inhibited cell growth. Knockdown of AR expression in OSCC cells resulted in decreased proliferation, increased apoptosis, and inhibited tumorigenicity. Results from immunohistochemical studies showed that AR immunoreactivity was found in 27% (3/11) of benign lesions, while 68% (15/22) of premalignant and 67% (14/21) of malignant lesions showed positive AR staining. CONCLUSION: Our data suggest that OSCC cells express functional AR proteins which are critical for promoting cell growth and causing malignant disease. Oral Diseases (2015) 21, 320–327 Keywords: oral squamous cell carcinoma; androgen receptor; cell growth; dihydrotestosterone; bicalutamide
Correspondence: Ta-Chun Yuan, PhD, Department of Life Science and Institute of Biotechnology, National Dong Hwa University, No. 1, Sec. 2, Da Hsueh Rd., Shoufeng, Hualien 97401, Taiwan. Tel: 886 3 863 3668, Fax: 886 3 863 3630, E-mail: [email protected] *These authors contributed equally. Received 12 February 2014; revised 13 May 2014; accepted 27 June 2014
Introduction Oral squamous cell carcinoma (OSCC) is the most frequently diagnosed malignancy worldwide and accounts for over 90% of neoplasms in the oral cavity. The risk factors for causing OSCC include tobacco use, alcohol consumption, and betel quid chewing (Warnakulasuriya, 2009). For patients with early-stage (stage I/II) OSCC, surgery and radiotherapy improve patient survival rates to 70–90% (Argiris et al, 2008). Unfortunately, due to the delay in diagnosis, 65% of patients with OSCC are initially diagnosed with advanced stages (stage III/IV) of the disease. The current management of advanced OSCC consists of multiple treatment modalities, including surgery, radiotherapy, and chemotherapy. Despite recent advances in disease management, more than 50% of patients with OSCC eventually develop local relapses or distant metastases, resulting in a poor prognosis (Silverman, 2001). Thus, further elucidation of the molecular events that promote the malignancy of OSCC is urgently needed to develop promising strategies for treating patients with advanced OSCC. The androgen receptor (AR) is a ligand-dependent transcription factor that belongs to the nuclear receptor superfamily. In humans, the AR is ubiquitously expressed throughout the entire body (Kimura et al, 1993). Upon activation by androgens, the AR dimerizes as a homodimer and subsequently binds to androgen-responsive elements (AREs) on the promoter regions of target genes. This binding in turn activates the expression of genes that regulate the growth, differentiation, and survival of AR-expressing cells, such as prostate epithelia (Devlin and Mudryj, 2009). Deregulated AR expression or activity is a key factor that causes the malignant transformation of prostate cancer cells, and thus, inhibition of AR activity is a therapeutic strategy to treat prostate cancer. Compared with the intensive studies regarding the oncogenic functions of AR in prostate cancer, there is limited evidence regarding the expression and function of AR in OSCC tumors (Kushlinskii et al, 1993; Nehse and Tunn, 1994). In a study of archival specimens of head and neck squamous cell carcinoma, 60% of examined samples were positive for AR staining, with only 20% positive staining observed in normal mucosa samples (Budai et al, 1997).
The role of AR in regulating OSCC cell growth
T-F Wu et al
In salivary gland cancer, the expression of AR is well defined; thus, the AR can serve as a potential target for clinical management (Fan et al, 2000; Jaspers et al, 2011). In this study, we examined the expression of AR in OSCC cell lines and tumors. We further characterized the function of AR in promoting the growth and tumorigenesis of OSCC cells.
Materials and methods Cell culture Human OSCC cell lines, SCC4 and SCC25, and prostate cancer LNCaP cells were obtained from the Biosource Collection and Research Center (BCRC, Taipei, Taiwan). OECM-1 (Meng et al, 1998) and SAS cells, two OSCC cell lines, were obtained from Dr. K.W. Chang (National Yang-Ming University, Taipei, Taiwan). OECM-1 and LNCaP cells were cultured in RPMI 1640 medium, SCC4 and SCC25 cells were maintained in DMEM/F12 medium, and SAS cells were cultured in DMEM medium. Each medium was supplemented with 5% FBS, 2 mM glutamine, and 0.05 mg ml1 of gentamicin. Cell culture medium and supplements were purchased from Invitrogen (Carlsbad, CA, USA). Reverse transcription PCR Total RNA content was isolated using an RNA purification kit (Geneaid, Taipei, Taiwan), and cDNA was synthesized using a GoScript reverse transcription system (Promega, Madison, WI, USA) according to the manufacturer’s instructions. PCR amplification was performed for 30 cycles (94°C for 1 min, 60°C for 1 min, and 72°C for 2 min). The paired primers used for AR and GAPDH were AR (forward): CCTGGCTTCCGCAACTTACA C-30 ); AR (reverse): GGACTTGTGCATGCGGTACTC; GAPDH (forward): TGGTATCGTGGAAGGACTCATGA C; and GAPDH (reverse): TGCCAGTGAGCTTCCCGT TCAGC. These primers were designed according to a public database from RTPrimerDB (Pattyn et al, 2003). Following agarose gel electrophoresis, the amplicons were visualized using ethidium bromide staining. Luciferase reporter assay Cells were plated in complete medium in 24-well plates at 1 9 104 cells well1. After a 48-h incubation, cells were cotransfected with 1 lg of pGL2-ARE-luc plasmids and 0.2 lg of Renilla luciferase-expressing vectors using a TransLT1-transfection reagent (Mirus, Madison, WI, USA). After an additional 48-h incubation, the cells were lysed, and the ratio of the two luciferase activities was analyzed using a dual-luciferase reporter assay kit (Promega) and a 2020n luminometer (Turner BioSystems, Sunnyvale, CA, USA). Lentiviral infection Lentiviral vectors carrying shRNA against the AR gene were obtained from the RNAi Core at Academic Sicina (Taipei, Taiwan). For the preparation of the shRNA-containing lentiviruses, 293FT cells (Invitrogen) were cotransfected with a lentiviral expression vector containing an AR-targeted
shRNA and with packaging plasmids using a PolyJet Transfection Reagent (SignaGen Lab., Ijamsville, MD, USA). Cells expressing shRNA against the firefly luciferase gene (shLuc) served as controls. After a 72-h incubation, the culture medium containing lentiviruses was harvested. For infection, cells grown in 6-well plates were incubated with viruses in the presence of 8 lg ml1 of polybrene for 24 h at 37°C. The expression level of AR in these infected cells was detected by Western blot analysis.
321
Cell growth assay To compare the growth of the different types of OSCC cells and to determine the effects of bicalutamide (Sigma, St. Louis, MO, USA) and knocking down AR expression on cell growth, cells were seeded in 24-well plates. After a 48-h incubation, one set of attached cells was harvested and counted as day 0. The remaining cells were fed with fresh medium and harvested on day 3 or day 4 for counting. To examine the effect of dihydrotestosterone (DHT; Sigma) on cell growth, SCC4 cells were cultured for 48 h in a steroid-reduced (SR) medium, that is, phenol red-free DMEM/F12 medium supplemented with 5% charcoal-/ dextran-treated FBS. The cells were then fed with fresh SR medium containing 10 nM DHT. After 4 days of culture, the cells were harvested, and the cell number was counted. Cell cycle analysis For cell cycle distribution analysis, cells were harvested and fixed in ice-cold 70% ethanol for storage at 20°C. After washing with PBS, the cell pellets were stained with 1 ml of propidium iodide (PI) staining solution containing 0.1% Triton X-100, 20 lg ml1 PI, and 200 lg ml1 RNase for 30 min. Acquisition and analysis were performed by Cytomics FC500 flow cytometry (Beckman Coulter, Brea, CA, USA) with excitation at 488 nm. Soft agar assay Each well of a 6-well culture dish was coated with a bottom layer of 1.5 ml of an agar–medium mixture consisting of DMEM with 5% FBS and 0.6% agar. After the bottom layer was solidified, 1.5 ml of an agar–medium mixture consisting of DMEM with 5% FBS, 0.5% agar, and 1 9 104 cells was added, and the dishes were incubated at 37°C for 2 weeks. Plates were stained with 0.005% crystal violet, and colonies larger than 25 lm in diameter were counted in four randomly selected fields using an optical microscope at 40-fold magnification. Tumorigenic study Animal protocols have been approved by the Institutional Animal Care and Use Committee at the National Dong Hwa University. Twenty-four hours after lentiviral infection, AR-knockdown and shLuc control SAS cells were harvested, and an aliquot of 5 9 105 cells suspended in 0.2 ml of PBS was injected subcutaneously into the back of 8- to 10-week-old BALB/cA-nu nude mice. Tumor growth was measured weekly until 35 days after inoculation, and tumor volumes were determined using the formula (larger diameter) 9 (smaller diameter)2 9 0.5.
Oral Diseases
The role of AR in regulating OSCC cell growth
T-F Wu et al
322
Western blot analysis Cells were harvested, and the cell lysates were prepared as previously described (Yuan et al, 2007). For immunoblotting, an aliquot of total cell lysates in an SDS-PAGE sample buffer was separated by electrophoresis and then transferred to a nitrocellulose membrane. After blocking with 5% nonfat milk or BSA in Tris-buffered saline containing 0.1% Tween 20 for 1 h at room temperature (RT), the membrane was incubated with antibodies against AR (PG-21) (Millipore, Billerica, MA, USA), cyclin D1, Bcl-2, or Bax (Epitomics, Burlingame, CA, USA). After incubation for overnight at 4°C, the membrane was washed and then incubated with appropriate secondary antibodies for 1 h at RT. The specific protein was then detected by an ECL reagent kit (Amersham, Piscataway, NJ, USA). The relative level of cyclin D1 protein was semi-quantified by densitometric analysis using ImageJ (NIH image, Bethesda, MA, USA). Tissue microarray and immunohistochemistry Specimens analyzed included 11 benign, 22 premalignant, and 21 malignant lesions of the oral cavity that were collected from patients who underwent surgical resection at Mennonite Christian Hospital (Hualien, Taiwan). This procedure was approved by the institutional review board of the Buddhist Tzu Chi General Hospital (#IRB101-115), and written informed consents were obtained from all participants. Tissue specimens were incorporated into a tissue microarray. The sections were deparaffinized in xylene, rehydrated with graded ethanol, and then boiled in 1 mM EDTA (pH 8.0) for 5 min in an autoclave. After three washes with 3% H2O2, the sections were blocked with a protein block serum (Dako, Glostrup, Denmark) for 5 min. Subsequently, the sections were incubated with an AR mouse monoclonal antibody (clone AR441; Dako) at a 1:50 dilution for 30 min, and the signal was then amplified using an Envision kit (Dako) according to manufacturer’s protocol. All sections were counterstained with hematoxylin for 2.5 min. The expression of AR was evaluated using a light microscope, and the scores were (a)
(c)
Oral Diseases
divided into three grades: negative (0), low (+1), and high (+2/+3). Tumor cores with >10% of cells staining +1 or greater were defined as positive. Statistical analysis The significance for all group comparisons was assessed by Student’s two-tailed t-test or a one-way ANOVA followed by Tukey’s or Dunnett’s post hoc comparison. The chi-square test was used for comparison between categorical variables. A P-value
