Molecular Microbiology (1991) 5(1), 11-18
0950382X9100003T
MicroReview The regulation of genetic competence in Baciiius subtiiis D. Dubnau Department of Microbioiogy, Public Heaith Research Institute. 455 First Avenue, New York, New York 10016, USA.
Summary Genetic competence develops as a global response of Baciiius subtiiis to the onset of stationary phase, in glucose-minima I salts-based media. The onset of competence is accompanied by the expression of several late gene products that are required for the binding, processing and uptake of transforming DNA. A number of regulatory genes have been identified that are needed for the appropriate synthesis of the late gene products. The regulatory gene products include a number of known transcription factors, as well as several members of the bacterial two-component regulatory system. Genetic analysis has suggested a scheme for the flow of regulatory information signalling the onset of competence. Most of these regulatory products appear to be involved in the response to nutritional status, while the components responsible for growth stage and cell-type-specific control remain unknown. The general implications of this scheme for post-exponential expression are discussed.
Introduction Bacteria are usually capable of existing in widely disparate environments and possess the capacity to alter their metabolism globaWy in response to environmental change. Baciiius subtiiis is no exception, and among its global adaptations are a variety of post-exponential responses. These Include the synthesis and secretion of several extracellular degradative enzymes, sporulation, motility, the production of surfactin and antibiotic substances, and genetic competence. Competence refers to the ability to be genetically transformed by exogenous DNA, and the regulation of competence is the subject of this review.
Received 17 July, 1990; revised 24 August, 1990. Tel. {212)578 0842; Fax (212J 578 0804.
Tbe expression of competence Competence develops post-exponentially in B. subtilis in amino-acid-supp(emented, glucose-minimal salts-based media (Anagnostopoulos and Spizizen, 1961; Spizizen, 1958), but does not develop in meat-broth-based complex media. In addition to the growth stage and mediumspecific modes of regulation, competence is cell-typespecific (Cahn and Fox, 1968; Hadden and Nester, 1968). Resolution of a competent culture on a Renografin density gradient yields two populations: (i) a light buoyant density competent fraction comprising about 10% of the total cell number, and (ii) a heavy non-competent fraction. Although the physical basis for the density difference is obscure, these populations are metabolically distinct (Dooley et ai, 1971; Dubnau and Cirigliano, 1973) and also appear to differ in cell size (Singh and Pitale, 1967). The appearance of the light and heavy buoyant density cell fractions represents a non-terminal developmental event.
Regulatory and late competence genes The use of chemicai mutagens, as well as transposon and plasmid insertion mutagenesis, has allowed the isolation of a variety of mutants deficient in competence (Albano et ai, 1987; Fani etai, 1984; Hahn efa/., 1987; Matromei e( ai, 1988; Mulder and Venema, 1982; Nakano and Zuber, 1989; Weinrauch efa/., 1990). These mutants cannot bind, process and transport transforming DNA. They are distinct from rec mutations, which permit the transport of exogenous DNA, but do not allow subsequent recombination with a resident replicon. Competence mutants fall info two broad categories. Many carry mutations in one or another gene specifying a component of the binding-transport machinery or required for the assembly of this machinery: these are referred to as late competence mutations. The late competence genes so far characterized specify hydrophobic proteins, which in several cases have been shown to be membrane-associated (Albano et ai, 1989; Albano and Dubnau, 1989; Breitling and Dubnau, 1990; Mohan ef ai, 1989). These proteins are expressed postexponentially, only in media that support competence, and only in the light (competent) Renografin fraction (Albano ef a/., 1987). These characteristics provide an
12 a Dubnau initial description of competence-specific regulation and permit the conclusion that the expression of the late genes represents the output of the competence regulatory apparatus. Competence mutations have also been described in regulatory genes, most of which are expressed during exponential growth and irrespective of growth medium. Using transcriptionai fusions of the late genes to IacZ, the products of most of the regulatory genes have been shown to be required for the expression of the late genes. These expression patterns and epistatic effects characterize most members of the class of regulatory genes (Table 1).
The regulatory genes Several of the regulatory genes listed in Table 1 can be classified as members of the bacterial two-component signal transduction systems (reviewed by Stock et ai, 1989). These systems consist of a protein (often a transmembrane protein) that can be autophosphorylated at a conserved histidine residue (histidine kinase (HK)) and a so-called response regulator (RR) to whioh the HK protein transfers a phosphate group. The phosphorylation state of the RR determines its activity, most often as a transcriptionai activator. These proteins are usually first identified
by the presence of conserved amino acid sequences in a C-terminal domain of the HK and in an N-terminal domain of the RR. By these criteria, ComP and ComA are predicted to be HK and RR proteins, respectively (Nakano and Zuber, 1989; Weinrauoh et al., 1989, 1990). ComP possesses an /V-terminal hydrophobic domain and is predicted to be a transmembrane protein. DegS and DegU are similarly predicted to be HK and RR proteins, respectively, but the former does not appear to have a hydrophobic domain (Henner et ai, 1988; Kunst et ai, 1988; Tanaka and Kawata, 1988). Both ComA and DegU contain sequences in their C-terminal regions that may represent DNA-binding heiix-turn-helix motifs, although neither protein has been demonstrated to act transcriptionally (Msadek et ai, 1990; Weinrauch et ai, 1989). Finally, SpoOA is a member of the RR class {Ferrari et ai, 1985). The only HK known to act in concert with SpoOA is SpoliJ(Antoniewskiefa/., 1990; Peregoefa/., 1989).Anuil mutation of spoilJ exhibited normal competence (Y. Weinrauch and D. Dubnau, unpublished). comP and comA mutants are equally competence deficient, and a double comP, comA mutant is no more competence deficient than is either single mutant (Weinrauch etai, 1989, 1990). If the phosphorylation paradigm is assumed to hold for the products of these genes, it is simplest to assume that a phosphate group is transferred
Table 1. Competence regulatory mutations. Gene
Mutational type
Competence phenotype
abrB comA
Null Null
Deficient Deficient
comB csh293 comP aagU
(Nulir
degS
Null point (degS")
nwcA
(Point?)^
mecB
(Point?)=
sin SpoOA
Null Null
Deficient Deficient Deficient Deficient Deficient (Wild-type)" Deficient Nutritionally constitutive Nutritionally constitutive Deficient Deficient
spoOH
Null
Deficient
spoOK
Null Null NufI point idegU')
Deficient
Reference Albano 0( a/. (1987) Guillen et ai (1989); Nakanc and Zuber (1989); Weinrauch etal. (1989) Guillen etai (1989); Weinrauch et al. (1989) Jaacks et al. (1989) Weinrauch et ai (1990) Tanaka and Kawata (1988) Msadek etal. (1990); Roggiani etal. (1990) Msadek etal. (1990); Roggtani etai (1990) Msadek ef al. (1990); Roggiani ef ai (1990) Dubnau etai (1990); Roggiani etal. (1990) Dubnau eta'. (1990); Roggiani e/a/. (1990) Gauref 3/. (1986) Albano efa/. (1987); Sadaie and Kada(1983); Spizizen (1965) Albano e( a/. (1987); Sadaie and Kada(1983); Spizizen (1965) Roggiani etai (1990)
a. ThecomS;35mutation(saTn977/acZinsertioninthe +1 position of the comS transcript (Weinrauch etai, 1989). It is not certain that this represents a null (loss of function) mutation. b. Mutations in degS can be polar on the downstream degU gene (Henner ef ai. 1988). However, degU has Its own promoter, and the extent of competence deficiency noted in degS nuil mutants suggests that DegS is not required for competence. c. The mec mutations were induced by ethyl methane sulphonate, and have not been further characterized (Dubnau ef al.. 1990). d. The spoOK141 mutation has not been characterized.
Regulation of genetic competence from ComP to ComA in response to some environmental signal which acts on the membrane-associated A/-termlnal portion of ComP, activating the RR as a positive transcription factor. When comA is present in multicopy, null mutations in comA and comP are bypassed (Weinrauch et al., 1990). This suggests that ComP acts prior to ComA in the regulatory cascade. Provision of an excess of ComA is presumed to compensate for the absence of phosphorylation in the mutant strains. Similar effects of overexpressed RR proteins have been noted in other systems (Slauch etai, 1988; Weston and Kadner, 1987). Mutations In another regulatory gene, comB, also severely depress the frequency of transformation. When comA is present in multicopy, a comB mutation is bypassed, suggesting that the oomB product, like ComP, acts prior to ComA, As noted above, DegS and DegU are HK and RR proteins, respectively. Inactivation of degS has only a minor effect on competence, and this can be explained by a polar effect on cfegft/expression (Msadek et ai, 1990; Roggiani et ai, 1990). Mutations in degS and degU that appear to result in constitutive activation of DegU (socalled degS'^ and degU'^ mutations) also confer a competence-deficient phenotype (Msadek ef ai, 1990; Roggiani ef ai, 1990; Steinmetz ef ai, 1976). This effect in a degil'^ mutant is suppressed by introduction of a degS null mutation (Msadek e? a/., 1990). In addition, degUnull mutants are competence deficient (Msadek et ai, 1990; Roggiani ef ai, 1990; Tanaka and Kawata, 1988). When interpreted according to the phosphorylation paradigm, these results strongly suggest that it is the unphosphorylated form of DegU that is required for the development of competence. SpoOA, a member of the RR class of proteins, is known to be a negative regulator of abrB expression and AbrB, in turn, plays a role as a negative regulator for expression of several post-exponentially expressed gene products (Marahiei etai, 1987; Perego etai, 1988; Strauch etai, 1989; Zuber and Losick, 1987). In thecase of competence, AbrB plays a complex role (Albano etai, 1987). In a spoOA null mutant, competence is severely depressed, while an abrB spoOA double mutant exhibits a partial restoration of competence, to the same level as is exhibited by a strain carrying only an abrB null mutation. This suggests that AbrB plays a positive as well as a negative role in competence, and that SpoOA is needed only to downregulate abrB. The role of SpoOA in this system may be to maintain the AbrB concentration at a level sufficient to satisfy its positive role, but too low to inhibit competence. Like AbrB. the Sin protein is known to be both a DNA-binding protein, and a negative transcription factor (Gaur ef ai, 1988, 1986). Although Sin appears to act in competence as a positive regulator, this may be an indirect consequence of downregulation of a repressor.
13
Some comments on the roles of spoOH and spoOK are timely. spoOi-l encodes a", a secondary sigma factor required for sporulation and expression of certain other post-exponentially expressed as well as vegetative functions (Dubnau et ai, 1988). The dependence of competence on spoOH Implies that at least one criiical competence gene is directly transcribed by the a*^ form of RNA polymerase. The identity of this gene(s) is unknown. Only one spoOK aliele has been described (Coote, 1972; Piggot and Coote, 1976). Sadajeand Kada (1983)and A.D. Grossman (personal communication) have noted that this mutation (spoOKM?) confers competence deficiency. We have shown that spoOK141 strains are deficient in the expression of late competence genes, but not in the expression of several competence regulatory genes (Roggiani ef ai, 1990), with the exception of csh293 (see below). The cs/i293mutation was detected as an insertion of the transposon Tn917tacZ in a gene that appeared to be partially dependent on the minor sigma factor d^ for full expression, and which confers a competence-deficient phenotype (Jaacks etai, 1989). csh293is also epistatio on the late competence genes (Roggiani etai, 1990). Since the expression of the csh293 fusion increases dramatically at the time of transition from exponential- to stationary phase, it was possible to look for epistatic effects of other regulatory competence genes on expression of this fusion (J. Hahn and D. Dubnau, unpublished). The csh293 fusion was found to be strongly dependent for expression on SpoOK, comA and comB, and partially dependent on comP. No effects of null mutations in sin, abrB or degU were observed. The degU'' and degS'' mutations aiso had little or no effect on csh293 expression. Interpreted as a pathway, these results imply the existence of two branches (Fig. 1). One branch depends on SpoOK, ComB, ComA and possibly on ComP, and includes the point of action of the csh293 product. A second branch would involve DegU, and would merge with the first branch at a point downstream from csh293. Interactions among regulatory genes As noted above, when ComA is overexpressed from a multicopy plasmid, null mutations in comB and comP are bypassed. This observation has been extended to null mutations in sin and arbB, and applies regardless of whether one measures competence or the expression of p-galactosidase from a late competence-gena-/acZ fusion (Y. Weinrauch and D. Dubnau, unpublished). On the other hand, multicopy cotnA cannot bypass a degU null mutation, although it can bypass degU^ and degS'' mutations. These observations imply that Sin and AbrB act prior to ComA in the competence pathway. They also imply that DegU acts either later than ComA, together with ComA, or on a separate branch of the pathway.
14
0. Dubnau Regulation of Competence: Flow of intomiation
SpoOA i I ,
SpoOK ComA
(SrfA) Csh293
AbrB
ComB?
Late Competence
Genes 'AssiiiTes nonnal role in competence lor mec genes.
Fig. 1. The competence reguiatory pathway. This scheme is a provisional and formal representation that accommodates many cf the known regulatory interactions. The arrows represent the flow of regulatory intcs^mation wrth positive effects. Lines ending in perpendiculars represent information flow with negative etfecls. The points at which the spoOH product acts are not known. AbrB acts both positively and negatively during the development of competence, and in the latter capacity exerts its effects at several points: before ComA and after mecA and mecB (see text). The negative action of SpoOA on AbrB. and several possible points of AbrB negative action are indicated. (Lines extending from AbrB to these points ot action are eliminated tor clarity.) The broken box indicates that ComA and DegU are both required in the second (lower) branch of the competence pathway and may even work in concert, possib/y in a heterodimer. It is not certain whether ComP is required for the upper or lower branches of the competence pathway, of for both, and whether ComB or SpoOK are required for the lower branch.
As just stated, since elimination of Sin and AbrB by mutation can be bypassed by ComA expression in multicopy, it would be logical to infer that these two products act prior to ComA on the first branch. But if so, why are they not required for csh293 expression? One way out of this dilemma is to assume that ComA is required not only for the first branch of the competence pathway, as noted above, but also for the second branch of the pathway, in addition to unphosphorylated DegU (Fig. 1). This supposition would explain the bypass of sin and abrB null mutations by ComA overproduction, if the AbrB and Sin products normally act on the second pathway, prior to ComA. As noted above, the expression of csh293 is only partially dependent (about five-fold) on ComP. Perhaps ComP is not needed for the first pathway, and the partial dependence may be due to the observed two- to threefold polar effect of comP disruption on the downstream comA determinant (Weinrauch e( a/., 1990). The degS'' and degU'^ mutations have little or no effect on csh293 expression, but seem to act prior to ComA, since overexpression of oomA oan bypass the effects of degS'^ and degU^ mutations on competence. How can this be reconciled? The inhibitory effect of phosphorylated DegU protein may be exerted independently of the DegU requirement, and on the second pathway, upstream from the point of action of ComA. Alternatively, the degl/' and
mutations may be inhibitory because they result in depletion of the required pool of unphosphorylated DegU. A high concentration of ComA, produced when comA is present in multicopy, may drain phosphate from DegS by cross-talk, thus restoring an appropriate concentration of unphosphorylated DegU. This wouid explain the bypassing of degS^ and degU^ by multicopy comA. The interactions among the regulatory gene products described above were interpreted in terms of pathways of information flow. However, some of the data are also interpretable according to the notion that regulatory proteins form heteromultimers, and that these exert their effects via further protein-protein or protein-DNA interactions. If two regulatory components lorm a heteromultimer, then together they would constitute a single node rather than two separate nodes in a diagram of information flow. An illustration of this general point is provided by the bypass of degS^ and degU^ by multicopy comA. This bypass may be rationalized in terms of a pathway, as noted above. Alternatively, it is possible that phosphorylated ComA forms an essential complex with unphosphorylated DegU, and that this complex acts via the second pathway (Fig. 1). Overproduction of ComA then, could bypass the degS^ and degU'^ mutations by sequestering DegU and preventing its phosphorylation. Sinoe the pathway concept is simpler to consider, and invokes fewer assumptions about specific protein-protein interactions, we have chosen to interpret the data in this way. It would be best, however, to keep the alternative possibility in mind.
mec mutations As desoribed above, competence and (ate competence genes are expressed in glucose-minimal salts-based media, but not in complex, meat broth-based media. Using /acZ fusions to late competence genes, mutations were characterized that allowed expression in complex media (Dubnau et ai, 1990). These were called mec mutations (for rriedium independent expression of competence), mec mutants express all known late competence genes in connplex media, and express competence itself under these conditions. The expression of competence and of late competence genes in mec mutants appear to be subject to the usual growthstage-specific control, indicating that the apparent post-exponential and nutritional forms of regulation are genetically separable. The meo mutations chosen for further study mapped at two loci on the B. subtiiis chromosome. mecA is quite close to the spoOK141 marker and may be an allele of SpoOK. The mecB mutations were very closely linked to several rifampicin- and lipiarmycin resistance mutations that are probably alleles of rpoB. the structural gene for the
Regulation ofger^etic competence Ac
AG
AF
comC
GGCTCCGGCAGAATCAAAXAAAGATTCTGCCGTTTTTTT
comG
TTTCTTGCCAGAAAGAATTGGTTTTTCAGCATATAACAT
I mil
11 i
III II
I
I
-81 Fig. 2. Possible CTF-binding sites. DNA sequences upstream from the comC and comG promoters are shown. These contain dyads centred at - 8 4 and -81 relative to the transcriptional start sites {Albano et ai.. 1989; Mohan and Dubnau, 1990). The vertical bars represent sites of identity. Deletion C results in wild-type competence. Deletions G and F result in severe competence deficiencies {Mohan and Dubnau, 1990).
p-subunit of RNA polymerase. mecB mutations may be rpoB atleles or they may be located in other genes that are closely linked to rpoB. To place the point of mec action in the hypothetical competence pathway, mec mutations were combined with early gene null mutations, and the effects of IacZ fusions to late competence genes were determined (Roggiani e( ai, 1990). Both mecA and mecB mutations effected complete bypass of null mutations in comA. comB, comP, sin. abrB, csh293, and degU, and of the degU" and degS'' mutations. These results imply that these regulatory genes exert their effects prior to the actions of the MecA and MecB gene products (Fig. 1). The interactions with spoOK, spoOA and spoOH are more complex. mecA42 bypasses the spoOK requirement for late competence gene expression. Using an Indirect genetic approach, we have reported that mecB mutations do not bypass spoOK141 (Roggiani et ai, 1990). This would be the sole example of different responses to the two classes of mec mutations. However, since the expression of csh293 was shown to be dependent on spoOK, as mentioned above, we have tentatively placed the point of action of spoOK prior to that of csh293 in Fig. 1. Only a very slight bypass of a spoOA null mutation was noted for the mec mutations. Sinoe the role of SpoOA in competence seems to be restricted to the downregulation of AbrB (see above), this implies that the negative effect of AbrB on competence is exerted, at least ir] part, downstream from the points of action of the MecA and MecB gene products. However, overexpression of ComA part/ally reverses the effect on competence of a spoOA null mutation (Y. Weinrauch and D. Dubnau, unpublished). Since this bypass results in a level of competence about 20-fo!d lower than that of the wild type, it is not surprising that only a very slight bypass effeot was noted when the p-galactosidase level of a late competence-gene-/acZ fusion was measured. Taken together, these results suggest that the negative effects of AbrB overproduction are exerted at multiple points, both upstream from the point{s) of ComA action and downstream from MecA and
15
MecB (Fig. 1). Finally, mecA42 bypasses a spoOH null mutation, implying that the essential spoOH-dependent competence gene(s) act prior to mecA. For technical reasons it was not possible to measure bypass of the spoOH null mutation by mecB. In this discussion of the mec mutations, we have assumed that the mec genes are normal components of the competence regulatory machinery, as seems likely. It is also possible, however, that they are not, and that the altered mec gene products serve to permit bypass of the normal regulatory machinery. The validity of our assumption must await the characterization of the mec genes and their products.
What turns on late competence genes? The promoters of two late competence genes have been characterized by high-resolution S1 mapping, and by primer extension (Albano eM/., 1989; Mohan etai, 1989). Upstream from the start sites of both genes are properly spaced hexamers with a strong resemblance to the - 1 0 and - 35 consensus sequences of the vegetative ((f^) form of 6. subtilis RNA polymerase. Since these late competence genes are not constitutively expressed it is likely that auxiliary transcription factors are responsible for their regulation. Although Sin, AbrB, and SpoOH are known to be transcriptional regulators, and although DegU and ComA are probably transcriptional activators as well (Henner etai, 1988; Weinrauch etai, 1989) it is unlikely that any of these proteins interact directly with the promoters of late competence genes to turn them on. This conclusion is based on the abilities of mec mutations to bypass the requirements for these early regulatory genes, suggesting that the products of the latter act early in the pathway. What gene products then, are directly involved in activating the (ate genes? An approach to identifying competence-specific transcription factors was based on determining the effects of comG and comC promoter-bearing fragments when present in multicopy (Albano et ai, 1989; Mohan and Dubnau, 1990). These fragments were shown to depress the expression of all late competence-gene-/acZ fusions present on the chromosome, and to inhibit the expression of competence. It was proposed that a positive transcriptional effector was being titrated. This effector was named CTF (competence transcription factor). Deletion analysis of the comC promoter region revealed that removal of sequences upstream from - 9 7 had no effect on the expression of competence. However, further deletion to - 7 9 markedly reduced the level of competence (Mohan and Dubnau, 1990) (Fig. 2). When the deleted fragments were placed in multicopy, the - 9 7 deletion was found to reduce the expression of a late competence gene fusion to the same extent as the undeleted fragment. The - 7 9
16
D. Dubnau
deletion reduced expression to a much lower extent. These results suggested that the binding site for the factor titrated by the multicopy promoter fragments overlapped or was identical to the binding site required for comC expression. Gel shift experiments revealed the presence of an activity specific for the comC promoter fragment (Mohan and Dubnau, 1990). This activity, which is considered to represent CTF, was obtained only in extracts prepared from stationary-phase cultures, and further study suggested that CTF expression is under competence-specific control. Examination of the comC and comG promoters reveals dyad sequence elements with axes of symmetry located at - 8 4 and - 8 1 , respectively. These dyads exhibit considerable base-sequence identity (Fig. 2), and may represent part or all of the CTF-recognition sequences for these two genes. It is likely that a key late event in the regulation of the competence pathway is the expression and/or activation of CTF (Fig. 1).
Competence and other post-exponential expression events As described above, competence is one of several possible forms of expression that occur after the termination of exponential growth. Only sketchy information exists as to the conditions that trigger each of these forms of expression. It is not clear to what extent they are alternative events, whether each type of response constitutes an endpoint, or whether at least some of them represent sequential steps on a pathway, tn a sense, sporulation would appear to be an ultimate event in the life of a celt. Other responses, such as competence, degradative enzyme production, motitity, and antibiotic production may represent initial solutions to the stress of post-exponential existence, before the cell is irreversibly committed to sporulation. In a sense, then, some of these modes of expression may constitute stages preceding sporulation. Whatever the relationships among the various responses, it is striking that virtually none of the regulatory genes listed and described in Table 1 are restricted in their phenotypic effects to a single form of expression. A few examptes may suffice to itiustrate this point. When comA is overproduced, an oligosporogenic phenotype is observed (Weinrauch et ai, 1989). GomA is required both for competence and surfactin synthesis (Nakano and Zuber, 1989). A comP null mutation confers oligosporogeny, especially when the strain is also mutant for spolij (Weinrauch ef ai, 1990). The csh293 mutant is not only competence deficient but exhibits oligosporogeny under certain conditions (Jaacks et al., 1989). Recently M. M. Nakano and P. Zuber (personal communication) have shown that the cs/j295Tn9) 7 insertion has occurred in a large (approximately 20 kb pair) operon, srfA, which is also required for the post-exponential production of surfactin.
The degS" and degU'' mutants are able to sporulate in the presence of glucose, whereas sporulation in witd-type strains is severety depressed by this metabotite (Kunst e( a/., 1974). These mutations atso confer competence deficiency, non-motitity, and overproduction of degradative enzymes (Kunst e( a/., 1974; Lepesant ef a/., 1972; Steinmetz et ai, 1976). Nult degU mutants are competence deficient and deficient in the degradative enzyme response (Tanaka and Kawata, 1988). Nult mutations in s/n confer non-motility, in addition to competence deficiency (Gaur et ai., 1986). The overproduction of Sin results in inhibition of sporutation and of protease synthesis. The SpoOA, SpoOH and SpoOK products are required for both sporulation and competence. aiorB is a regulatory gene for certain sporulation genes, and for antibiotic and protease production, as welt as for competence (Atbano et aL, 1987; Ferrari efa/., 1988; Marahiet efa/., 1987; Perego etai, 1988; Strauch etai, 1989; Trowsdate etaL, 1978, 1979; Zuber and Losick, 1987).
The signal transduction network This partiat tisting demonstrates the interrelationships of the various post-exponential responses. The genes and gene products discussed above may be part of a signaltransduction network that relays environmental information to severat response-specific effector pathways. In some cases these responses may be mutuatly exclusive. For instance, entry into the sporutation pathway may prectude the simuttaneous expression of competence. The tatter response appears to require the presence of glucose, whereas sporulation is glucose-re pressed. This physiotogicat reciprocity is reftected on the genetic tevet. As noted above, ComA is required for competence but its overexpression inhibits sporutation (Weinrauch ef ai, 1989). SpoOF is required for sporulation, but overexpression of SpoOF inhibits competence (M. Lewandowski and 1. Smith, personal communication). Sin is required for competence, but its overexpression inhibits sporulation (Gaur efa/., 1986). These considerations are compatibte with the notion of a signat-transduction network that receives environmentat and intraceltular information from a variety of sources. This input is tikety to be received, at teast in part, by HK-tike moiecuies such as OomP, DegS, and SpoltJ. It is possible that additionat protein components act prior to the HK proteins to interpret extraceltutar and intracetlutar information. Sin and AbrB, which can be bypassed by overexpression of ComA, are possibte candidates for this rote. Processing of the HK-encoded information most tikely ensues, probably via phosphate transfer to cognate RR motecutes and subsequent information ftow through other components of the signal-transduction network. Crosstalk between HK and RR proteins and between down-
Reguiation of genetic competence stream components woutd ensure that the information gathered by a given input channet is avaitable to other components of fhe network. Consequently, the signaltransduction network might permit the combinatorial processing of input information, in order to specify particular responses. For instance, signats 1 and 2 may trigger the degradative enzyme response and sporulation, whereas signals 1, 3 and 4 may, in combination, uniquely determine the onset of competence. Downstream from the signal-transduction network there may be responsespecific regulators, in the case of competence, CTF might be such a molecule, in the case of sporutation, att of the stage tl (and tater-acting) regulators woutd betong to this category, and there may be stage zero sporulation-specific regulators as well. However, it is possible that some responses may not be dependent on specific proximal regulations: for instance, in the case of the degradative enzyme response, it is possible that phosphory tated DegU protein may interact directty with degradative enzyme promoters and stimutate transcription. In most cases the signals involved are unclear. Starvation for carbon, nitrogen or phosphate can trigger the onset of sporuiation (Schaeffer ef ai., 1965). The deveiopment of competence requires the presence of glucose, in the sense that substitution of gtycerol markedly reduces the expression of competence and of late competence genes (Albano ef ai. 1987). When overexpression of ComA is used to bypass a comP nuti mutation, the expression of competence and of (ate competence genes occurs independently of the presence of gtuoose (Weinrauch et ai, 1990). This resutt impties that the ComAComP input channet may be invotved in sensing the carbon source. Clearty, the systematic investigation of the nutritional signals required for the various possibie postexponentiat responses, and the genetic components involved in this signatling, are vital subjects for future work.
Growth stage and cell-type-specific regulation Most of the genes and mutations discussed above are invotved in nutritional signalling. The bypassing of nearly atl the regulatory gene requirements for competence by mecA and mecB mutations suggests that this is so, since the primary mec phenotype is to render the development of competence independent of the medium. Nevertheless, mec mutants display the wild-type growth-stage-specific regulation of competence. Which genes are required for this type of control? Which signals are involved? tt is possibte that growth stage signatling depends on a diffusible factor, the concentration of which is celldensity-dependent. Development in Myxococcus (Kim and Kaiser, 1990), competence in Streptococcus pneumoniae (Tomasz and Mosser, 1966), and sporulation in S.
17
subtilis (Grossman and Losick, 1988) seem to be regulated, in part, by diffusible factors. It has been reported that growth in conditioned medium permits the accelerated development of competence in S. subtilis (Joenje ef ai, 1972) and further work is ctearly necessary for exploration of the significance of this finding. If a diffusible factor is used for competence signatling, is this pathway independent of nutritional environment or is the production or response to the factor coupted to exhaustion of some key nutrient(s)? Is the diffusible sporulation factor atso invoived in signalling for competence? Alternatively, it may be that the apparent growth-stage-specific regutation of competence invotves a response to the environment or the sensing of an intraceltutar parameter tinked to the end of exponentiat growth, and does not invotve the action of a diffusible factor at all. Equatly mysterious is the significance of the heterogeneity of competent 6. subtilis cuttures. The devetopment of competence in onty about 10% of the culture may be merety an accidentat consequence of the limited expression of some essential component. It may also reflect a more highly regutated process. It is intriguing to consider the possibitity that the non-competent cell type is specialized to extrude DNA, and that competence involves a primitive sexual dimorphsim. It has been reported that germinating spores of S, subtilis are able to extrude transforming DNA in sequentiat genetic order (Borenstein and Ephrati-Etizur, 1969). Atso, the spontaneous release of transforming DNA occurs during the growth of S. subtilis cuttures both earty in the logarithmic growth phase, and post-exponentially, and appears not to be a consequence of celt tysis (Ephrati-Etizur, 1968). We have observed the devetopment of competence to fotlow exactly this kinetic pattern during growth (Aibano ef ai., 1987). If the notion of sexual dimorphism is correct, it woutd imply that the development of competence in only 10% of the culture is not a trivial phenomenon, but represents a regulated developmentat event. Clearly, as B. subtilis adjusts to retirement from active growth, a variety of options are avaitabte. The selection of an appropriate response to the new life situation depends at least in part on environmental signals, mediated by a complex network of regulatory elements. Unravetling this complexity will continue to present a challenging and fascinating task.
Acknowledgements The work quoted from our laboratory was supported by NIH grants All 0311 and GM37137. The author thanks M. M. Nakano, P. Zuber, A. D. Grossman, M. Lewandowski and I. Smith for communicating unpublished data, and E. Dubnau, A. D. Grossman, J. Hahn, L. Kong, R. Losick, M. Roggiani, I. Smith and Y. Weinrauch, for stimulating discussions.
18
D. Dubnau
References Albano, M., and Dubnau, D. (1989) JSacfer/o/171: 5376-5385. Albano, M. etal. (1989) Jeacteno/171: 5386-5404. Albano, M. et aS. (1987) J Bacteriol 169; 3110-3117. Anagnostopoulos, C , and Spizizen, J. (1961) J Baeteriot a^: 741-746. Antoniewski, C. etai (1990) JSacfeno/172: 86-93. Borenstein, S. and Ephrati-Eilzur, E. (1969) J Mol Biol 45: 137-152. Breitling, R., and Dubnau, D. (1990) J Sacfer/o/172: 1499-1508. Cahn, F.H., and Fox, M.S. (1968) J Bacteriol 95: 867-875. Coote, J.G. (1972) JGen Microbioi7"i: 17-27. Dooley, D.C. etai (1971) JSacfeno/108: 668-679. Dubnau, D., and Cirigliano,C. (1973) J8acfer/o/113:1512-1514. Dubnau, D.ef a/. (1988) JSacteno/170: 1054-1062. Dubnau, D. etal. (1990) JSacferio/172: 4048-4055. Ephrati-Elizur, E. (1968) Genet Res 11: 83-96. Fani, R. ef a/. (1984) JSacfeno/157: 153-157. Ferrari, F.A. etai {1985) Proc NatiAead Sci USA 82: 2647-2651. Ferrari, E. etai. (1988) JSacferioM70: 289-295. Gaur, N.K. etaL (1986) JSacferio/168: 860-869. Gaur, N.K. etai (1988) JSacfeno/170: 1046-1053. Grossman, A.D., and Losick, R. (1988) Proc NatI Acad Sci USA
85: 4369-4373. Guillen, H. ei al. (1989) J Bacteriof 171: 5354-5361. Hadden, C , and Nester, E.W. (1968) JSacfeno/95: 876-885. Hahn, J. etai (1987) J Bacteriol 169: 3104-3109. Henner, D.J. etai (1988) JSacfenb/170: 5102-5109. Jaacks, K.J. etaL (^969} J Bacteriol 17A: 4121-4129. Joenje.H. efa/. (1972) Biocfi/m Siophys Acfa 262; 189-199. Kim, S.K., and Kaiser, D. (1990) Proc Nati Acad Sci USA 87:
3635-3639. Kunst, F. etal. (1974) Biochimie56: 1481-1489. Kunst, F. etai (1988) JSacferio/170: 5093-5101. Lepesant, J.A. et al. (1972) Mol Gen Genet 118: 135-160.
Marahiei, M.A. etaL (1987) J Bacteriol 169: 2215-2222. Mastromei, G. et ai (1988) In 9th European Meeting on Genetic Transformation. Butler, L.O., Moseiey, B.E.B., and Harwood, C.R. (eds). Canterbury, UK: University of Kent. Mohan, S. et a/. (1989) J Bacterioi 17V. 6043-6051. Mohan, S., and Dubnau, D. (1990) J Bacteriol 172: 4064-4071. Msadek, T. etai {^990) JBacterion72: 824-834. Mulder, J.A., and Venema, G. (1982) J Bacteriol 150: 260-268. Nakano, M.M., and Zuber, P. (1989) JSacfeno/171: 5347-5353. Perego, M. ef a/, (1988) Moi Mierobiot 2:689-699. Perego, M. etai (1989) J Bacteriol 17V. 6187-6196. Piggot, P., and Coote, J.G. (1976) Sacferio//?ev 40: 908-962. Roggiani, M. efa/. (1990) J Sacferio/172: 4056-4063. Sadaie, Y., and Kada,T. (1983) JSacferio/153: 813-821. Schaeffer, P. ef al. (1965) Proc NatI Acad Sei USA 54: 704-711. Singh, R.N., and Pitale, M.P. (1967) Nature2-\3: 1262-1263. Slauch, J.M. efa/. (1988) JSacferio/170: 439-441. Spizizen, J. (1958) Proc/Vaf/z^cadSc/L/S/l 44: 1072-1078. Spizizen, J. (1965) In Spores IH. Campbell, L.L, and Halvorsen, H.O. (eds). Washington, D.C; American Society for Microbiology, pp. 125-137. Steinmetz, M. (1976)/Wo/Gen Genef 148: 281-285. Stock, J.B. (1989) Mierobiot Rev 53: 450-490. Strauch, M.A. etai (1989) EMBOja: 1615-1621. Tanaka, T., and Kawata, M. (1988) J Baeterioi 170: 3593-3600. Tomasz, A., and Mosser, J.L. |1966) Proc NatiAead Sei USA 55: 58-66. Trowsdafe, J. etai (1978) In SporesW/. Chambliss, G.,and Vory, J.C. (eds). Washington, D.C: American Society for Microbiology, pp. 131-135. Trowsdale, J. et al. (1979) Mol Gen Genet 173: 61-70. Weinrauch, Y. ef ai (1989) J Baeteriot 171: 5362-5375. Weinrauch, Y. et at. (1990) Genes Devel 4: 860-872. Weston, L.A., and Kadner, R.J. (1987) J Baeteriot 169: 35463555. Zuber, P., and Losick, R. (1987) JSacferio/169: 2223-2230.
0950382X9100003T
MicroReview The regulation of genetic competence in Baciiius subtiiis D. Dubnau Department of Microbioiogy, Public Heaith Research Institute. 455 First Avenue, New York, New York 10016, USA.
Summary Genetic competence develops as a global response of Baciiius subtiiis to the onset of stationary phase, in glucose-minima I salts-based media. The onset of competence is accompanied by the expression of several late gene products that are required for the binding, processing and uptake of transforming DNA. A number of regulatory genes have been identified that are needed for the appropriate synthesis of the late gene products. The regulatory gene products include a number of known transcription factors, as well as several members of the bacterial two-component regulatory system. Genetic analysis has suggested a scheme for the flow of regulatory information signalling the onset of competence. Most of these regulatory products appear to be involved in the response to nutritional status, while the components responsible for growth stage and cell-type-specific control remain unknown. The general implications of this scheme for post-exponential expression are discussed.
Introduction Bacteria are usually capable of existing in widely disparate environments and possess the capacity to alter their metabolism globaWy in response to environmental change. Baciiius subtiiis is no exception, and among its global adaptations are a variety of post-exponential responses. These Include the synthesis and secretion of several extracellular degradative enzymes, sporulation, motility, the production of surfactin and antibiotic substances, and genetic competence. Competence refers to the ability to be genetically transformed by exogenous DNA, and the regulation of competence is the subject of this review.
Received 17 July, 1990; revised 24 August, 1990. Tel. {212)578 0842; Fax (212J 578 0804.
Tbe expression of competence Competence develops post-exponentially in B. subtilis in amino-acid-supp(emented, glucose-minimal salts-based media (Anagnostopoulos and Spizizen, 1961; Spizizen, 1958), but does not develop in meat-broth-based complex media. In addition to the growth stage and mediumspecific modes of regulation, competence is cell-typespecific (Cahn and Fox, 1968; Hadden and Nester, 1968). Resolution of a competent culture on a Renografin density gradient yields two populations: (i) a light buoyant density competent fraction comprising about 10% of the total cell number, and (ii) a heavy non-competent fraction. Although the physical basis for the density difference is obscure, these populations are metabolically distinct (Dooley et ai, 1971; Dubnau and Cirigliano, 1973) and also appear to differ in cell size (Singh and Pitale, 1967). The appearance of the light and heavy buoyant density cell fractions represents a non-terminal developmental event.
Regulatory and late competence genes The use of chemicai mutagens, as well as transposon and plasmid insertion mutagenesis, has allowed the isolation of a variety of mutants deficient in competence (Albano et ai, 1987; Fani etai, 1984; Hahn efa/., 1987; Matromei e( ai, 1988; Mulder and Venema, 1982; Nakano and Zuber, 1989; Weinrauch efa/., 1990). These mutants cannot bind, process and transport transforming DNA. They are distinct from rec mutations, which permit the transport of exogenous DNA, but do not allow subsequent recombination with a resident replicon. Competence mutants fall info two broad categories. Many carry mutations in one or another gene specifying a component of the binding-transport machinery or required for the assembly of this machinery: these are referred to as late competence mutations. The late competence genes so far characterized specify hydrophobic proteins, which in several cases have been shown to be membrane-associated (Albano et ai, 1989; Albano and Dubnau, 1989; Breitling and Dubnau, 1990; Mohan ef ai, 1989). These proteins are expressed postexponentially, only in media that support competence, and only in the light (competent) Renografin fraction (Albano ef a/., 1987). These characteristics provide an
12 a Dubnau initial description of competence-specific regulation and permit the conclusion that the expression of the late genes represents the output of the competence regulatory apparatus. Competence mutations have also been described in regulatory genes, most of which are expressed during exponential growth and irrespective of growth medium. Using transcriptionai fusions of the late genes to IacZ, the products of most of the regulatory genes have been shown to be required for the expression of the late genes. These expression patterns and epistatic effects characterize most members of the class of regulatory genes (Table 1).
The regulatory genes Several of the regulatory genes listed in Table 1 can be classified as members of the bacterial two-component signal transduction systems (reviewed by Stock et ai, 1989). These systems consist of a protein (often a transmembrane protein) that can be autophosphorylated at a conserved histidine residue (histidine kinase (HK)) and a so-called response regulator (RR) to whioh the HK protein transfers a phosphate group. The phosphorylation state of the RR determines its activity, most often as a transcriptionai activator. These proteins are usually first identified
by the presence of conserved amino acid sequences in a C-terminal domain of the HK and in an N-terminal domain of the RR. By these criteria, ComP and ComA are predicted to be HK and RR proteins, respectively (Nakano and Zuber, 1989; Weinrauoh et al., 1989, 1990). ComP possesses an /V-terminal hydrophobic domain and is predicted to be a transmembrane protein. DegS and DegU are similarly predicted to be HK and RR proteins, respectively, but the former does not appear to have a hydrophobic domain (Henner et ai, 1988; Kunst et ai, 1988; Tanaka and Kawata, 1988). Both ComA and DegU contain sequences in their C-terminal regions that may represent DNA-binding heiix-turn-helix motifs, although neither protein has been demonstrated to act transcriptionally (Msadek et ai, 1990; Weinrauch et ai, 1989). Finally, SpoOA is a member of the RR class {Ferrari et ai, 1985). The only HK known to act in concert with SpoOA is SpoliJ(Antoniewskiefa/., 1990; Peregoefa/., 1989).Anuil mutation of spoilJ exhibited normal competence (Y. Weinrauch and D. Dubnau, unpublished). comP and comA mutants are equally competence deficient, and a double comP, comA mutant is no more competence deficient than is either single mutant (Weinrauch etai, 1989, 1990). If the phosphorylation paradigm is assumed to hold for the products of these genes, it is simplest to assume that a phosphate group is transferred
Table 1. Competence regulatory mutations. Gene
Mutational type
Competence phenotype
abrB comA
Null Null
Deficient Deficient
comB csh293 comP aagU
(Nulir
degS
Null point (degS")
nwcA
(Point?)^
mecB
(Point?)=
sin SpoOA
Null Null
Deficient Deficient Deficient Deficient Deficient (Wild-type)" Deficient Nutritionally constitutive Nutritionally constitutive Deficient Deficient
spoOH
Null
Deficient
spoOK
Null Null NufI point idegU')
Deficient
Reference Albano 0( a/. (1987) Guillen et ai (1989); Nakanc and Zuber (1989); Weinrauch etal. (1989) Guillen etai (1989); Weinrauch et al. (1989) Jaacks et al. (1989) Weinrauch et ai (1990) Tanaka and Kawata (1988) Msadek etal. (1990); Roggiani etal. (1990) Msadek etal. (1990); Roggtani etai (1990) Msadek ef al. (1990); Roggiani ef ai (1990) Dubnau etai (1990); Roggiani etal. (1990) Dubnau eta'. (1990); Roggiani e/a/. (1990) Gauref 3/. (1986) Albano efa/. (1987); Sadaie and Kada(1983); Spizizen (1965) Albano e( a/. (1987); Sadaie and Kada(1983); Spizizen (1965) Roggiani etai (1990)
a. ThecomS;35mutation(saTn977/acZinsertioninthe +1 position of the comS transcript (Weinrauch etai, 1989). It is not certain that this represents a null (loss of function) mutation. b. Mutations in degS can be polar on the downstream degU gene (Henner ef ai. 1988). However, degU has Its own promoter, and the extent of competence deficiency noted in degS nuil mutants suggests that DegS is not required for competence. c. The mec mutations were induced by ethyl methane sulphonate, and have not been further characterized (Dubnau ef al.. 1990). d. The spoOK141 mutation has not been characterized.
Regulation of genetic competence from ComP to ComA in response to some environmental signal which acts on the membrane-associated A/-termlnal portion of ComP, activating the RR as a positive transcription factor. When comA is present in multicopy, null mutations in comA and comP are bypassed (Weinrauch et al., 1990). This suggests that ComP acts prior to ComA in the regulatory cascade. Provision of an excess of ComA is presumed to compensate for the absence of phosphorylation in the mutant strains. Similar effects of overexpressed RR proteins have been noted in other systems (Slauch etai, 1988; Weston and Kadner, 1987). Mutations In another regulatory gene, comB, also severely depress the frequency of transformation. When comA is present in multicopy, a comB mutation is bypassed, suggesting that the oomB product, like ComP, acts prior to ComA, As noted above, DegS and DegU are HK and RR proteins, respectively. Inactivation of degS has only a minor effect on competence, and this can be explained by a polar effect on cfegft/expression (Msadek et ai, 1990; Roggiani et ai, 1990). Mutations in degS and degU that appear to result in constitutive activation of DegU (socalled degS'^ and degU'^ mutations) also confer a competence-deficient phenotype (Msadek ef ai, 1990; Roggiani ef ai, 1990; Steinmetz ef ai, 1976). This effect in a degil'^ mutant is suppressed by introduction of a degS null mutation (Msadek e? a/., 1990). In addition, degUnull mutants are competence deficient (Msadek et ai, 1990; Roggiani ef ai, 1990; Tanaka and Kawata, 1988). When interpreted according to the phosphorylation paradigm, these results strongly suggest that it is the unphosphorylated form of DegU that is required for the development of competence. SpoOA, a member of the RR class of proteins, is known to be a negative regulator of abrB expression and AbrB, in turn, plays a role as a negative regulator for expression of several post-exponentially expressed gene products (Marahiei etai, 1987; Perego etai, 1988; Strauch etai, 1989; Zuber and Losick, 1987). In thecase of competence, AbrB plays a complex role (Albano etai, 1987). In a spoOA null mutant, competence is severely depressed, while an abrB spoOA double mutant exhibits a partial restoration of competence, to the same level as is exhibited by a strain carrying only an abrB null mutation. This suggests that AbrB plays a positive as well as a negative role in competence, and that SpoOA is needed only to downregulate abrB. The role of SpoOA in this system may be to maintain the AbrB concentration at a level sufficient to satisfy its positive role, but too low to inhibit competence. Like AbrB. the Sin protein is known to be both a DNA-binding protein, and a negative transcription factor (Gaur ef ai, 1988, 1986). Although Sin appears to act in competence as a positive regulator, this may be an indirect consequence of downregulation of a repressor.
13
Some comments on the roles of spoOH and spoOK are timely. spoOi-l encodes a", a secondary sigma factor required for sporulation and expression of certain other post-exponentially expressed as well as vegetative functions (Dubnau et ai, 1988). The dependence of competence on spoOH Implies that at least one criiical competence gene is directly transcribed by the a*^ form of RNA polymerase. The identity of this gene(s) is unknown. Only one spoOK aliele has been described (Coote, 1972; Piggot and Coote, 1976). Sadajeand Kada (1983)and A.D. Grossman (personal communication) have noted that this mutation (spoOKM?) confers competence deficiency. We have shown that spoOK141 strains are deficient in the expression of late competence genes, but not in the expression of several competence regulatory genes (Roggiani ef ai, 1990), with the exception of csh293 (see below). The cs/i293mutation was detected as an insertion of the transposon Tn917tacZ in a gene that appeared to be partially dependent on the minor sigma factor d^ for full expression, and which confers a competence-deficient phenotype (Jaacks etai, 1989). csh293is also epistatio on the late competence genes (Roggiani etai, 1990). Since the expression of the csh293 fusion increases dramatically at the time of transition from exponential- to stationary phase, it was possible to look for epistatic effects of other regulatory competence genes on expression of this fusion (J. Hahn and D. Dubnau, unpublished). The csh293 fusion was found to be strongly dependent for expression on SpoOK, comA and comB, and partially dependent on comP. No effects of null mutations in sin, abrB or degU were observed. The degU'' and degS'' mutations aiso had little or no effect on csh293 expression. Interpreted as a pathway, these results imply the existence of two branches (Fig. 1). One branch depends on SpoOK, ComB, ComA and possibly on ComP, and includes the point of action of the csh293 product. A second branch would involve DegU, and would merge with the first branch at a point downstream from csh293. Interactions among regulatory genes As noted above, when ComA is overexpressed from a multicopy plasmid, null mutations in comB and comP are bypassed. This observation has been extended to null mutations in sin and arbB, and applies regardless of whether one measures competence or the expression of p-galactosidase from a late competence-gena-/acZ fusion (Y. Weinrauch and D. Dubnau, unpublished). On the other hand, multicopy cotnA cannot bypass a degU null mutation, although it can bypass degU^ and degS'' mutations. These observations imply that Sin and AbrB act prior to ComA in the competence pathway. They also imply that DegU acts either later than ComA, together with ComA, or on a separate branch of the pathway.
14
0. Dubnau Regulation of Competence: Flow of intomiation
SpoOA i I ,
SpoOK ComA
(SrfA) Csh293
AbrB
ComB?
Late Competence
Genes 'AssiiiTes nonnal role in competence lor mec genes.
Fig. 1. The competence reguiatory pathway. This scheme is a provisional and formal representation that accommodates many cf the known regulatory interactions. The arrows represent the flow of regulatory intcs^mation wrth positive effects. Lines ending in perpendiculars represent information flow with negative etfecls. The points at which the spoOH product acts are not known. AbrB acts both positively and negatively during the development of competence, and in the latter capacity exerts its effects at several points: before ComA and after mecA and mecB (see text). The negative action of SpoOA on AbrB. and several possible points of AbrB negative action are indicated. (Lines extending from AbrB to these points ot action are eliminated tor clarity.) The broken box indicates that ComA and DegU are both required in the second (lower) branch of the competence pathway and may even work in concert, possib/y in a heterodimer. It is not certain whether ComP is required for the upper or lower branches of the competence pathway, of for both, and whether ComB or SpoOK are required for the lower branch.
As just stated, since elimination of Sin and AbrB by mutation can be bypassed by ComA expression in multicopy, it would be logical to infer that these two products act prior to ComA on the first branch. But if so, why are they not required for csh293 expression? One way out of this dilemma is to assume that ComA is required not only for the first branch of the competence pathway, as noted above, but also for the second branch of the pathway, in addition to unphosphorylated DegU (Fig. 1). This supposition would explain the bypass of sin and abrB null mutations by ComA overproduction, if the AbrB and Sin products normally act on the second pathway, prior to ComA. As noted above, the expression of csh293 is only partially dependent (about five-fold) on ComP. Perhaps ComP is not needed for the first pathway, and the partial dependence may be due to the observed two- to threefold polar effect of comP disruption on the downstream comA determinant (Weinrauch e( a/., 1990). The degS'' and degU'^ mutations have little or no effect on csh293 expression, but seem to act prior to ComA, since overexpression of oomA oan bypass the effects of degS'^ and degU^ mutations on competence. How can this be reconciled? The inhibitory effect of phosphorylated DegU protein may be exerted independently of the DegU requirement, and on the second pathway, upstream from the point of action of ComA. Alternatively, the degl/' and
mutations may be inhibitory because they result in depletion of the required pool of unphosphorylated DegU. A high concentration of ComA, produced when comA is present in multicopy, may drain phosphate from DegS by cross-talk, thus restoring an appropriate concentration of unphosphorylated DegU. This wouid explain the bypassing of degS^ and degU^ by multicopy comA. The interactions among the regulatory gene products described above were interpreted in terms of pathways of information flow. However, some of the data are also interpretable according to the notion that regulatory proteins form heteromultimers, and that these exert their effects via further protein-protein or protein-DNA interactions. If two regulatory components lorm a heteromultimer, then together they would constitute a single node rather than two separate nodes in a diagram of information flow. An illustration of this general point is provided by the bypass of degS^ and degU^ by multicopy comA. This bypass may be rationalized in terms of a pathway, as noted above. Alternatively, it is possible that phosphorylated ComA forms an essential complex with unphosphorylated DegU, and that this complex acts via the second pathway (Fig. 1). Overproduction of ComA then, could bypass the degS^ and degU'^ mutations by sequestering DegU and preventing its phosphorylation. Sinoe the pathway concept is simpler to consider, and invokes fewer assumptions about specific protein-protein interactions, we have chosen to interpret the data in this way. It would be best, however, to keep the alternative possibility in mind.
mec mutations As desoribed above, competence and (ate competence genes are expressed in glucose-minimal salts-based media, but not in complex, meat broth-based media. Using /acZ fusions to late competence genes, mutations were characterized that allowed expression in complex media (Dubnau et ai, 1990). These were called mec mutations (for rriedium independent expression of competence), mec mutants express all known late competence genes in connplex media, and express competence itself under these conditions. The expression of competence and of late competence genes in mec mutants appear to be subject to the usual growthstage-specific control, indicating that the apparent post-exponential and nutritional forms of regulation are genetically separable. The meo mutations chosen for further study mapped at two loci on the B. subtiiis chromosome. mecA is quite close to the spoOK141 marker and may be an allele of SpoOK. The mecB mutations were very closely linked to several rifampicin- and lipiarmycin resistance mutations that are probably alleles of rpoB. the structural gene for the
Regulation ofger^etic competence Ac
AG
AF
comC
GGCTCCGGCAGAATCAAAXAAAGATTCTGCCGTTTTTTT
comG
TTTCTTGCCAGAAAGAATTGGTTTTTCAGCATATAACAT
I mil
11 i
III II
I
I
-81 Fig. 2. Possible CTF-binding sites. DNA sequences upstream from the comC and comG promoters are shown. These contain dyads centred at - 8 4 and -81 relative to the transcriptional start sites {Albano et ai.. 1989; Mohan and Dubnau, 1990). The vertical bars represent sites of identity. Deletion C results in wild-type competence. Deletions G and F result in severe competence deficiencies {Mohan and Dubnau, 1990).
p-subunit of RNA polymerase. mecB mutations may be rpoB atleles or they may be located in other genes that are closely linked to rpoB. To place the point of mec action in the hypothetical competence pathway, mec mutations were combined with early gene null mutations, and the effects of IacZ fusions to late competence genes were determined (Roggiani e( ai, 1990). Both mecA and mecB mutations effected complete bypass of null mutations in comA. comB, comP, sin. abrB, csh293, and degU, and of the degU" and degS'' mutations. These results imply that these regulatory genes exert their effects prior to the actions of the MecA and MecB gene products (Fig. 1). The interactions with spoOK, spoOA and spoOH are more complex. mecA42 bypasses the spoOK requirement for late competence gene expression. Using an Indirect genetic approach, we have reported that mecB mutations do not bypass spoOK141 (Roggiani et ai, 1990). This would be the sole example of different responses to the two classes of mec mutations. However, since the expression of csh293 was shown to be dependent on spoOK, as mentioned above, we have tentatively placed the point of action of spoOK prior to that of csh293 in Fig. 1. Only a very slight bypass of a spoOA null mutation was noted for the mec mutations. Sinoe the role of SpoOA in competence seems to be restricted to the downregulation of AbrB (see above), this implies that the negative effect of AbrB on competence is exerted, at least ir] part, downstream from the points of action of the MecA and MecB gene products. However, overexpression of ComA part/ally reverses the effect on competence of a spoOA null mutation (Y. Weinrauch and D. Dubnau, unpublished). Since this bypass results in a level of competence about 20-fo!d lower than that of the wild type, it is not surprising that only a very slight bypass effeot was noted when the p-galactosidase level of a late competence-gene-/acZ fusion was measured. Taken together, these results suggest that the negative effects of AbrB overproduction are exerted at multiple points, both upstream from the point{s) of ComA action and downstream from MecA and
15
MecB (Fig. 1). Finally, mecA42 bypasses a spoOH null mutation, implying that the essential spoOH-dependent competence gene(s) act prior to mecA. For technical reasons it was not possible to measure bypass of the spoOH null mutation by mecB. In this discussion of the mec mutations, we have assumed that the mec genes are normal components of the competence regulatory machinery, as seems likely. It is also possible, however, that they are not, and that the altered mec gene products serve to permit bypass of the normal regulatory machinery. The validity of our assumption must await the characterization of the mec genes and their products.
What turns on late competence genes? The promoters of two late competence genes have been characterized by high-resolution S1 mapping, and by primer extension (Albano eM/., 1989; Mohan etai, 1989). Upstream from the start sites of both genes are properly spaced hexamers with a strong resemblance to the - 1 0 and - 35 consensus sequences of the vegetative ((f^) form of 6. subtilis RNA polymerase. Since these late competence genes are not constitutively expressed it is likely that auxiliary transcription factors are responsible for their regulation. Although Sin, AbrB, and SpoOH are known to be transcriptional regulators, and although DegU and ComA are probably transcriptional activators as well (Henner etai, 1988; Weinrauch etai, 1989) it is unlikely that any of these proteins interact directly with the promoters of late competence genes to turn them on. This conclusion is based on the abilities of mec mutations to bypass the requirements for these early regulatory genes, suggesting that the products of the latter act early in the pathway. What gene products then, are directly involved in activating the (ate genes? An approach to identifying competence-specific transcription factors was based on determining the effects of comG and comC promoter-bearing fragments when present in multicopy (Albano et ai, 1989; Mohan and Dubnau, 1990). These fragments were shown to depress the expression of all late competence-gene-/acZ fusions present on the chromosome, and to inhibit the expression of competence. It was proposed that a positive transcriptional effector was being titrated. This effector was named CTF (competence transcription factor). Deletion analysis of the comC promoter region revealed that removal of sequences upstream from - 9 7 had no effect on the expression of competence. However, further deletion to - 7 9 markedly reduced the level of competence (Mohan and Dubnau, 1990) (Fig. 2). When the deleted fragments were placed in multicopy, the - 9 7 deletion was found to reduce the expression of a late competence gene fusion to the same extent as the undeleted fragment. The - 7 9
16
D. Dubnau
deletion reduced expression to a much lower extent. These results suggested that the binding site for the factor titrated by the multicopy promoter fragments overlapped or was identical to the binding site required for comC expression. Gel shift experiments revealed the presence of an activity specific for the comC promoter fragment (Mohan and Dubnau, 1990). This activity, which is considered to represent CTF, was obtained only in extracts prepared from stationary-phase cultures, and further study suggested that CTF expression is under competence-specific control. Examination of the comC and comG promoters reveals dyad sequence elements with axes of symmetry located at - 8 4 and - 8 1 , respectively. These dyads exhibit considerable base-sequence identity (Fig. 2), and may represent part or all of the CTF-recognition sequences for these two genes. It is likely that a key late event in the regulation of the competence pathway is the expression and/or activation of CTF (Fig. 1).
Competence and other post-exponential expression events As described above, competence is one of several possible forms of expression that occur after the termination of exponential growth. Only sketchy information exists as to the conditions that trigger each of these forms of expression. It is not clear to what extent they are alternative events, whether each type of response constitutes an endpoint, or whether at least some of them represent sequential steps on a pathway, tn a sense, sporulation would appear to be an ultimate event in the life of a celt. Other responses, such as competence, degradative enzyme production, motitity, and antibiotic production may represent initial solutions to the stress of post-exponential existence, before the cell is irreversibly committed to sporulation. In a sense, then, some of these modes of expression may constitute stages preceding sporulation. Whatever the relationships among the various responses, it is striking that virtually none of the regulatory genes listed and described in Table 1 are restricted in their phenotypic effects to a single form of expression. A few examptes may suffice to itiustrate this point. When comA is overproduced, an oligosporogenic phenotype is observed (Weinrauch et ai, 1989). GomA is required both for competence and surfactin synthesis (Nakano and Zuber, 1989). A comP null mutation confers oligosporogeny, especially when the strain is also mutant for spolij (Weinrauch ef ai, 1990). The csh293 mutant is not only competence deficient but exhibits oligosporogeny under certain conditions (Jaacks et al., 1989). Recently M. M. Nakano and P. Zuber (personal communication) have shown that the cs/j295Tn9) 7 insertion has occurred in a large (approximately 20 kb pair) operon, srfA, which is also required for the post-exponential production of surfactin.
The degS" and degU'' mutants are able to sporulate in the presence of glucose, whereas sporulation in witd-type strains is severety depressed by this metabotite (Kunst e( a/., 1974). These mutations atso confer competence deficiency, non-motitity, and overproduction of degradative enzymes (Kunst e( a/., 1974; Lepesant ef a/., 1972; Steinmetz et ai, 1976). Nult degU mutants are competence deficient and deficient in the degradative enzyme response (Tanaka and Kawata, 1988). Nult mutations in s/n confer non-motility, in addition to competence deficiency (Gaur et ai., 1986). The overproduction of Sin results in inhibition of sporutation and of protease synthesis. The SpoOA, SpoOH and SpoOK products are required for both sporulation and competence. aiorB is a regulatory gene for certain sporulation genes, and for antibiotic and protease production, as welt as for competence (Atbano et aL, 1987; Ferrari efa/., 1988; Marahiet efa/., 1987; Perego etai, 1988; Strauch etai, 1989; Trowsdate etaL, 1978, 1979; Zuber and Losick, 1987).
The signal transduction network This partiat tisting demonstrates the interrelationships of the various post-exponential responses. The genes and gene products discussed above may be part of a signaltransduction network that relays environmental information to severat response-specific effector pathways. In some cases these responses may be mutuatly exclusive. For instance, entry into the sporutation pathway may prectude the simuttaneous expression of competence. The tatter response appears to require the presence of glucose, whereas sporulation is glucose-re pressed. This physiotogicat reciprocity is reftected on the genetic tevet. As noted above, ComA is required for competence but its overexpression inhibits sporutation (Weinrauch ef ai, 1989). SpoOF is required for sporulation, but overexpression of SpoOF inhibits competence (M. Lewandowski and 1. Smith, personal communication). Sin is required for competence, but its overexpression inhibits sporulation (Gaur efa/., 1986). These considerations are compatibte with the notion of a signat-transduction network that receives environmentat and intraceltular information from a variety of sources. This input is tikety to be received, at teast in part, by HK-tike moiecuies such as OomP, DegS, and SpoltJ. It is possible that additionat protein components act prior to the HK proteins to interpret extraceltutar and intracetlutar information. Sin and AbrB, which can be bypassed by overexpression of ComA, are possibte candidates for this rote. Processing of the HK-encoded information most tikely ensues, probably via phosphate transfer to cognate RR motecutes and subsequent information ftow through other components of the signal-transduction network. Crosstalk between HK and RR proteins and between down-
Reguiation of genetic competence stream components woutd ensure that the information gathered by a given input channet is avaitable to other components of fhe network. Consequently, the signaltransduction network might permit the combinatorial processing of input information, in order to specify particular responses. For instance, signats 1 and 2 may trigger the degradative enzyme response and sporulation, whereas signals 1, 3 and 4 may, in combination, uniquely determine the onset of competence. Downstream from the signal-transduction network there may be responsespecific regulators, in the case of competence, CTF might be such a molecule, in the case of sporutation, att of the stage tl (and tater-acting) regulators woutd betong to this category, and there may be stage zero sporulation-specific regulators as well. However, it is possible that some responses may not be dependent on specific proximal regulations: for instance, in the case of the degradative enzyme response, it is possible that phosphory tated DegU protein may interact directty with degradative enzyme promoters and stimutate transcription. In most cases the signals involved are unclear. Starvation for carbon, nitrogen or phosphate can trigger the onset of sporuiation (Schaeffer ef ai., 1965). The deveiopment of competence requires the presence of glucose, in the sense that substitution of gtycerol markedly reduces the expression of competence and of late competence genes (Albano ef ai. 1987). When overexpression of ComA is used to bypass a comP nuti mutation, the expression of competence and of (ate competence genes occurs independently of the presence of gtuoose (Weinrauch et ai, 1990). This resutt impties that the ComAComP input channet may be invotved in sensing the carbon source. Clearty, the systematic investigation of the nutritional signals required for the various possibie postexponentiat responses, and the genetic components involved in this signatling, are vital subjects for future work.
Growth stage and cell-type-specific regulation Most of the genes and mutations discussed above are invotved in nutritional signalling. The bypassing of nearly atl the regulatory gene requirements for competence by mecA and mecB mutations suggests that this is so, since the primary mec phenotype is to render the development of competence independent of the medium. Nevertheless, mec mutants display the wild-type growth-stage-specific regulation of competence. Which genes are required for this type of control? Which signals are involved? tt is possibte that growth stage signatling depends on a diffusible factor, the concentration of which is celldensity-dependent. Development in Myxococcus (Kim and Kaiser, 1990), competence in Streptococcus pneumoniae (Tomasz and Mosser, 1966), and sporulation in S.
17
subtilis (Grossman and Losick, 1988) seem to be regulated, in part, by diffusible factors. It has been reported that growth in conditioned medium permits the accelerated development of competence in S. subtilis (Joenje ef ai, 1972) and further work is ctearly necessary for exploration of the significance of this finding. If a diffusible factor is used for competence signatling, is this pathway independent of nutritional environment or is the production or response to the factor coupted to exhaustion of some key nutrient(s)? Is the diffusible sporulation factor atso invoived in signalling for competence? Alternatively, it may be that the apparent growth-stage-specific regutation of competence invotves a response to the environment or the sensing of an intraceltutar parameter tinked to the end of exponentiat growth, and does not invotve the action of a diffusible factor at all. Equatly mysterious is the significance of the heterogeneity of competent 6. subtilis cuttures. The devetopment of competence in onty about 10% of the culture may be merety an accidentat consequence of the limited expression of some essential component. It may also reflect a more highly regutated process. It is intriguing to consider the possibitity that the non-competent cell type is specialized to extrude DNA, and that competence involves a primitive sexual dimorphsim. It has been reported that germinating spores of S, subtilis are able to extrude transforming DNA in sequentiat genetic order (Borenstein and Ephrati-Etizur, 1969). Atso, the spontaneous release of transforming DNA occurs during the growth of S. subtilis cuttures both earty in the logarithmic growth phase, and post-exponentially, and appears not to be a consequence of celt tysis (Ephrati-Etizur, 1968). We have observed the devetopment of competence to fotlow exactly this kinetic pattern during growth (Aibano ef ai., 1987). If the notion of sexual dimorphism is correct, it woutd imply that the development of competence in only 10% of the culture is not a trivial phenomenon, but represents a regulated developmentat event. Clearly, as B. subtilis adjusts to retirement from active growth, a variety of options are avaitabte. The selection of an appropriate response to the new life situation depends at least in part on environmental signals, mediated by a complex network of regulatory elements. Unravetling this complexity will continue to present a challenging and fascinating task.
Acknowledgements The work quoted from our laboratory was supported by NIH grants All 0311 and GM37137. The author thanks M. M. Nakano, P. Zuber, A. D. Grossman, M. Lewandowski and I. Smith for communicating unpublished data, and E. Dubnau, A. D. Grossman, J. Hahn, L. Kong, R. Losick, M. Roggiani, I. Smith and Y. Weinrauch, for stimulating discussions.
18
D. Dubnau
References Albano, M., and Dubnau, D. (1989) JSacfer/o/171: 5376-5385. Albano, M. etal. (1989) Jeacteno/171: 5386-5404. Albano, M. et aS. (1987) J Bacteriol 169; 3110-3117. Anagnostopoulos, C , and Spizizen, J. (1961) J Baeteriot a^: 741-746. Antoniewski, C. etai (1990) JSacfeno/172: 86-93. Borenstein, S. and Ephrati-Eilzur, E. (1969) J Mol Biol 45: 137-152. Breitling, R., and Dubnau, D. (1990) J Sacfer/o/172: 1499-1508. Cahn, F.H., and Fox, M.S. (1968) J Bacteriol 95: 867-875. Coote, J.G. (1972) JGen Microbioi7"i: 17-27. Dooley, D.C. etai (1971) JSacfeno/108: 668-679. Dubnau, D., and Cirigliano,C. (1973) J8acfer/o/113:1512-1514. Dubnau, D.ef a/. (1988) JSacteno/170: 1054-1062. Dubnau, D. etal. (1990) JSacferio/172: 4048-4055. Ephrati-Elizur, E. (1968) Genet Res 11: 83-96. Fani, R. ef a/. (1984) JSacfeno/157: 153-157. Ferrari, F.A. etai {1985) Proc NatiAead Sci USA 82: 2647-2651. Ferrari, E. etai. (1988) JSacferioM70: 289-295. Gaur, N.K. etaL (1986) JSacferio/168: 860-869. Gaur, N.K. etai (1988) JSacfeno/170: 1046-1053. Grossman, A.D., and Losick, R. (1988) Proc NatI Acad Sci USA
85: 4369-4373. Guillen, H. ei al. (1989) J Bacteriof 171: 5354-5361. Hadden, C , and Nester, E.W. (1968) JSacfeno/95: 876-885. Hahn, J. etai (1987) J Bacteriol 169: 3104-3109. Henner, D.J. etai (1988) JSacfenb/170: 5102-5109. Jaacks, K.J. etaL (^969} J Bacteriol 17A: 4121-4129. Joenje.H. efa/. (1972) Biocfi/m Siophys Acfa 262; 189-199. Kim, S.K., and Kaiser, D. (1990) Proc Nati Acad Sci USA 87:
3635-3639. Kunst, F. etal. (1974) Biochimie56: 1481-1489. Kunst, F. etai (1988) JSacferio/170: 5093-5101. Lepesant, J.A. et al. (1972) Mol Gen Genet 118: 135-160.
Marahiei, M.A. etaL (1987) J Bacteriol 169: 2215-2222. Mastromei, G. et ai (1988) In 9th European Meeting on Genetic Transformation. Butler, L.O., Moseiey, B.E.B., and Harwood, C.R. (eds). Canterbury, UK: University of Kent. Mohan, S. et a/. (1989) J Bacterioi 17V. 6043-6051. Mohan, S., and Dubnau, D. (1990) J Bacteriol 172: 4064-4071. Msadek, T. etai {^990) JBacterion72: 824-834. Mulder, J.A., and Venema, G. (1982) J Bacteriol 150: 260-268. Nakano, M.M., and Zuber, P. (1989) JSacfeno/171: 5347-5353. Perego, M. ef a/, (1988) Moi Mierobiot 2:689-699. Perego, M. etai (1989) J Bacteriol 17V. 6187-6196. Piggot, P., and Coote, J.G. (1976) Sacferio//?ev 40: 908-962. Roggiani, M. efa/. (1990) J Sacferio/172: 4056-4063. Sadaie, Y., and Kada,T. (1983) JSacferio/153: 813-821. Schaeffer, P. ef al. (1965) Proc NatI Acad Sei USA 54: 704-711. Singh, R.N., and Pitale, M.P. (1967) Nature2-\3: 1262-1263. Slauch, J.M. efa/. (1988) JSacferio/170: 439-441. Spizizen, J. (1958) Proc/Vaf/z^cadSc/L/S/l 44: 1072-1078. Spizizen, J. (1965) In Spores IH. Campbell, L.L, and Halvorsen, H.O. (eds). Washington, D.C; American Society for Microbiology, pp. 125-137. Steinmetz, M. (1976)/Wo/Gen Genef 148: 281-285. Stock, J.B. (1989) Mierobiot Rev 53: 450-490. Strauch, M.A. etai (1989) EMBOja: 1615-1621. Tanaka, T., and Kawata, M. (1988) J Baeterioi 170: 3593-3600. Tomasz, A., and Mosser, J.L. |1966) Proc NatiAead Sei USA 55: 58-66. Trowsdafe, J. etai (1978) In SporesW/. Chambliss, G.,and Vory, J.C. (eds). Washington, D.C: American Society for Microbiology, pp. 131-135. Trowsdale, J. et al. (1979) Mol Gen Genet 173: 61-70. Weinrauch, Y. ef ai (1989) J Baeteriot 171: 5362-5375. Weinrauch, Y. et at. (1990) Genes Devel 4: 860-872. Weston, L.A., and Kadner, R.J. (1987) J Baeteriot 169: 35463555. Zuber, P., and Losick, R. (1987) JSacferio/169: 2223-2230.
