Accepted Article
Received Date : 24-Jan-2014 Revised Date : 28-Jan-2015 Accepted Date : 03-Feb-2015 Article type
: Original Article
The RING finger E3 ligase STRF1 is involved in membrane trafficking and modulates salt stress response in Arabidopsis thaliana Miaomiao Tian1,2,#, Lijuan Lou1,#, Lijing Liu1, Feifei Yu1, Qingzhen Zhao1,3, Huawei Zhang1, Yaorong Wu1, Sanyuan Tang1, Ran Xia1, Baoge Zhu1, Giovanna Serino4,5 and Qi Xie1,*
Running title: STRF1 in membrane trafficking and salt stress
1
State Key Laboratory of Plant Genomics, National Center for Plant Gene Research, Institute of
Genetics and Developmental Biology, Chinese Academy of Sciences, No.1 West Beichen Road, Chaoyang District, Beijing 100101, China 2
State Key Laboratory of Proteomics, Beijing Proteome Research Center, National Engineering
Research Center for Protein Drugs, National Center for Protein Sciences, Beijing Institute of Radiation Medicine, Beijing, P. R. China 3
School of Life Science, Liaocheng University, Liaocheng 252000, China
4
Department of Biology and Biotechnology “C. Darwin”, Sapienza University, Rome, 00185 Italy
5
The New York Botanical Garden, Bronx, NY, USA
#
Those authors contribute equal to this work
*
To whom correspondence should be addressed:
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as an 'Accepted Article', doi: 10.1111/tpj.12797 This article is protected by copyright. All rights reserved.
Accepted Article
Qi XIE State Key Laboratory of Plant Genomics Institute of Genetics and Developmental Biology Chinese Academy of Sciences No.1 West Beichen Road Road, Beijing 100101, China TEL: 86-10-64806619 FAX: 86-10-64806619 E-mail: [email protected] SUMMARY
Salt stress is a detrimental factor for plant growth and development. The response to salt stress has been shown to involve components in the intracellular trafficking system, as well as components of the ubiquitin-proteasome system (UPS). In this article, we have identified in Arabidopsis thaliana a little reported ubiquitin ligase involved in salt stress response, which we named STRF1 (Salt Tolerance RING Finger 1). STRF1 is a member of RING-H2 finger proteins and we demonstrate that it has ubiquitin ligase activity in vitro. We also show that STRF1 localizes mainly at the plasma membrane and at the intracellular endosomes. strf1-1 loss of function mutant seedlings exhibit accelerated endocytosis in roots, and have altered expression of several genes involved in the membrane trafficking system. Moreover, protein trafficking inhibitor, BFA treatment has increased BFA bodies in strf1-1 mutant. This mutant also showed increased tolerance to salt, ionic and osmotic stresses, reduced accumulation of reactive oxygen species during salt stress, and increased expression of AtRbohD, which encodes a NADPH oxidase involved in H2O2 production. We conclude that STRF1 is a membrane trafficking-related ubiquitin ligase, which helps the plant to respond to salt stress by monitoring intracellular membrane trafficking and ROS production.
Key words: STRF1, membrane trafficking, salt stress, ubiquitination
This article is protected by copyright. All rights reserved.
Accepted Article
INTRODUCTION
High salinity in soil is a vital problem for plants. It can cause both ionic and osmotic stress, which affect plant growth and development (Kim and Park, 2007). When plants encounter salt stress, they reprogram their cellular processes to cope with this new adverse environment. The molecular and genetic pathways involved in salt response have been extensively studied, and it is now known that this process involves a cascade of signaling events. An increase in salt levels is perceived by plasma membrane receptors, which in turn promote the release of second messengers (e.g., Ca2+ content, inositol phosphates and reactive oxygen species, ROS). These second messengers promote specific gene expression and allow the plant to cope with the adverse environment. This signaling cascade is conserved also in the response to other abiotic stresses, such as lower or higher temperature, drought, flooding, UV and strong light irradiation (Hasegawa et al., 2000; Mahajan et al., 2008; Mahajan and Tuteja, 2005; Xiong et al., 2002). In the recent years membrane trafficking proteins have also been reported to participate in abiotic stress. These membrane proteins include the SNARE (Soluble N-ethylmaleimide-sensitive factor attachment protein Receptors) proteins, which mediate intracellular vesicle trafficking, fusion and secretion in plant growth and development and are also involved in ABA signaling pathway and in abiotic stress response (Bassham and Blatt, 2008; Ebine et al., 2008; Grefen and Blatt, 2008; Leshem et al., 2006; Leyman et al., 1999; Shirakawa et al., 2010; Silva et al., 2010; Sokolovski et al., 2008; Zhang et al., 2007b; Zhu et al., 2002; Zouhar et al., 2009). Another membrane trafficking protein, Rab7, a member of the Rab family of small GTPases which in yeast and mammals controls intracellular vesicle trafficking from the late endosome to the vacuole (Rutherford and Moore, 2002; Woollard and Moore, 2008), has been reported to be involved in salt and osmotic stress response in plants (Agarwal et al., 2008; George and Parida, 2010; Mazel et al., 2004). Finally, phosphoinositide 3-kinases (PI3Ks), a dual-functional enzyme which contains a lipid kinase and a protein kinase activity and mediates intracellular membrane and vesicle trafficking pathway has been also shown to function in salt stress and ABA-induced ROS generation (Leshem et al., 2007; Park et al., 2003). E3 ubiquitin ligases have also been shown to participate in abiotic responses (Guo et al., 2013; Lee and Kim, 2011). Among all types of ubiquitin ligases, the class of RING finger E3 ligases has been specifically shown to play an important role in abiotic stress tolerance. For example, the RING finger E3 ligases, HOS1 (HIGH EXPRESSION OF OSMOTICALLY RESPONSIVE GENE 1) mediates the ubiquitination and degradation of ICE1 (Inducer of CBF expression 1) -and possibly also of other regulators- to negatively regulate cold response in Arabidopsis (Dong et al., 2006). We have shown that SDIR1, a C3H2C3 RING finger E3 ligase, promotes stress-responsive ABA signaling in Arabidopsis and is involved in the response to salt stress (Zhang et al., 2007a). In addition, RHA2a and RHA2b,
This article is protected by copyright. All rights reserved.
Accepted Article
two RING-H2 type E3 ligases, are positive regulators of ABA signaling and promote drought tolerance (Bu et al., 2009; Li et al., 2011). Recently, a RING E3 ligase from rice, OsDSG1, has been identified as a RING finger E3 ligase to mediate ABA signaling and to control stress response (Park et al., 2010). In order to isolate important plant RING finger E3 ligases involved in the response to salt stress, we have screened an Ac-Ds insertional collection in Arabidopsis RING finger genes and found a mutant which displayed salt tolerance. We named this mutant strf1-1 (salt tolerance RING finger 11). Molecular and genetic analyses confirmed that the phenotype was caused by a single knock out in the STRF1 gene. In vitro ubiquitination assays indicated that STRF1 is an active RING-C3H2C3-type E3 ligase. We further show the STRF1 localizes to the plasma membrane and to intracellular endosomes. Finally, we provide evidence that STRF1 promotes salt tolerance by regulating membrane trafficking and ROS production.
RESULTS
Identification of the STRF1 Gene In order to isolate novel E3 ligases of the RING finger family involved in the response to salt stress, we screened a pool of Ac-Ds Arabidopsis insertion lines in RING finger genes (Landsberg ecotype) (Parinov et al., 1999). A collection of 150 mutant lines and its relative wild type (WT) was sown in 1/2MS containing 200 mM NaCl. Salt-resistant seedlings were transferred to soil, and their offspring was scored again for the salt resistant phenotype on a higher salt concentration (250 mM NaCl). Here we describe the characterization of one of these salt-resistant mutants, that we named strf1-1 (salt tolerance RING finger 1). In order to remove possible extraneous mutations, we backcrossed the strf1-1 mutant line to the WT. Analysis of the segregation rate of the F2 population on Kanamycin after the backcross indicated that the results were consistent with a resistant: sensitive seedlings ratio of 3:1 (354 resistant and 122 sensitive seedlings), thus indicating a single transposon insertion. Tail-PCR and Blast results confirmed that the Ds element was inserted in the coding region of the At5g58580 gene, 292 bp downstream of the ATG (Figure 1a). RT-PCR experiments revealed that the full length STRF1 mRNA was absent in the strf1-1 mutant (Figure 1c). Because no other STRF1 insertion mutants could be recovered from all available T-DNA insertion collections, to further confirm that the strf1-1 phenotype was due to the absence of a full length STRF1 mRNA, we transformed strf1-1 plants with a construct overexpressing STRF1 (35S -
This article is protected by copyright. All rights reserved.
Accepted Article
This article is protected by copyright. All rights reserved.
Accepted Article
STRF1 is an Active Ubiquitin Ligase The STRF1 gene encodes a protein of 310 amino acids (aa) with a predicted molecular mass of 34.29 kiloDaltons, and which contains two domains: a transmembrane domain and a RING domain encompassing aa 29-51 and aa 138-179 respectively, as predicted by the SMART program (http://smart.embl-heidelberg.de/ ) (Figure 1b). The RING domain includes six highly conserved cysteines, two histidine residues, and is composed of two Zinc-finger motifs (Figure 1b and 3a). This suggests that STRF1 could have E3 ligase activity. Previous genome-wide studies had annotated STRF1 as ATL63, a member of ATL family (AguilarHenonin et al., 2006; Serrano et al., 2006). All members of the ATL family contain a RING-finger domain. Indeed, up to now, three members of the ATL family, ATL2, ATL9 and ATL31, have been shown to be active E3 ligases in Arabidopsis (Berrocal-Lobo et al., 2010; Nishizawa et al., 2008; Sato et al., 2009; Serrano et al., 2006). To test whether STRF1 also has ubiquitin ligase activity, we carried out an in vitro ubiquitination assay. To this aim, we expressed and purified the full length of STRF1 with MBP tag from E. coli and tested its self-ubiquitination activity by incubating it with wheat E1 (Triticum aestivum), human E2 (UBCh5b), and His-tagged ubiquitin, followed by immunoblot analysis. While in the absence of E1 or E2, no polyubiquitination conjugates could be observed (Figure 3b), clear poly-ubiquitinated MBPSTRF1 conjugates could be observed when all reagents were present. The result was double confirmed by anti-Ub (Figure 3b up panel) and anti-MBP (tagged to STRF1, Figure 3b low panel) antibodies. This result indicates that STRF1 is a functional E3 ligase in vitro, and that it is dependent on E1 and E2 activity.
STRF1 Associates with the Cell Membranes As already described, STRF1 contains a putative transmembrane domain at its N-terminus (Figure 1b), suggesting that STRF1 might be a membrane protein. In order to prove this hypothesis, we sought to determine the subcellular localization of STRF1 by transiently overexpressing a STRF1-GFP fusion protein in leaf cells via agroinfiltration. The activity of STRF1 in STRF1-GFP fusion protein was verified by transform 35S-STRF1-GFP to strf1-1 to assay on the salt sensitivity (Supplemental Figure S1). After 2 days from the inoculation, N. benthamiana leaves were subjected to subcellular fractionation and the presence of STRF1-GFP was verified by immunoblot analysis. As shown in Figure 4a, a full size STRF1-GFP fusion protein was detected only in the pellet fraction when proteins were extracted with a detergent-free buffer, while it was detected in soluble fraction when proteins
This article is protected by copyright. All rights reserved.
Accepted Article
were extracted with a buffer containing 1% Triton-X 100. These results suggested that STRF1 likely associates with the cellular membrane system. To further determine which sub-type of membrane STRF1 protein was localized to, N. benthamiana leaf cells transiently expressing the STRF1-GFP fusion protein were incubated with the lipophilic styryl dye FM4-64, which is known to stain endosomes and plasma membrane in Arabidopsis under low temperature, and observed under a confocal microscope (Jelinkova et al., 2010; Vida and Emr, 1995). As shown in Figure 4b, STRF1-GFP localized mainly to the plasma membrane, but also co-localized with small cytosolic particles (see arrows in Figure 4b). The same particles were also stained with FM4-64, suggesting that STRF1 localizes likely to intracellular endosomes. To further substantiate this subcellular localization pattern, we co-expressed STRF1-GFP and several markers of different subcellular compartments in Arabidopsis protoplast cells. The results are shown in Figure 5 and indicate that STRF1-GFP subcellular localization was mostly identical to that of Man49-mCherry, which is a cis-Golgi vesicle marker (Xiong et al., 2010). A similar colocalization was also found between STRF1-GFP and the RFP-tagged TGN/EE (trans-Golgi network/early endosome) marker SYP61 (Sanderfoot et al., 2001; Uemura et al., 2004). We also detected an overlapping subcellular distribution between STRF1-GFP and the mRFP-VSR2 marker, which marks the pre-vacuolar compartments (PVC) (Miao et al., 2008) (Figure 5a-c). These results indicated that STRF1 localizes to the plasma membrane, the Golgi apparatus, and the prevacuolar compartments and suggest that STRF1 might participate in salt stress response by regulating membrane trafficking.
STRF1 Regulates Endocytosis To test whether STRF1 has a role in membrane trafficking, we monitored the internalization levels of FM4-64 in root cells of the strf1-1 mutant, ox-STRF1-1 and of WT seedlings, treated or not with NaCl and mannitol. The results indicate that accumulation of FM4-64 in the strf1-1 mutant was already higher than in the WT under standard growth condition, but that it increased even more significantly after treatment with 200 mM NaCl and 400 mM mannitol (Figure 6a-d). Moreover, the response of ox-STRF1-1 plants in the FM4-64 uptake assays is similar to WT either in normal condition or salt stress condition (Supplemental Figure S2). This suggests that NaCl and mannitol accelerates endocytosis of FM4-64 already in the WT and, to a higher extent, in the strf1-1 mutant. In order to further support the STRF1 involved in membrane trafficking, we examined the effect of protein trafficking inhibitor -Brefeldin A (BFA) in root cells of the strf1-1 mutant, ox-STRF1-1 and
This article is protected by copyright. All rights reserved.
Accepted Article
of WT seedlings. The results showed that BFA compartments were increased in strf1-1 mutant when compared with ox-STRF1-1 and of WT seedlings (Figure 6e and 6f),. All these results indicated that STRF1 participated in membrane trafficking.
STRF1 is Necessary for the Proper Expression of Genes Involved in Membrane Trafficking We further confirmed the effect of STRF1 on membrane trafficking by monitoring its effects on the expression of genes encoding components of the membrane trafficking system. More than 500 genes affecting membrane trafficking had been identified in Arabidopsis (Oh et al., 2010); among those, we decided to monitor by qRT-PCR the expression of several those genes which have been found to be involved in salt stress response: ZATA-1 (encodes a clathrin adaptor subunit protein), whose expression is induced by salt stress (Oh et al., 2010); AtRab7, which encodes a member of the Rab family of small GTPases, and plays a role in membrane identification, vesicle targeting specificity as well as in salt stress response (Mazel et al., 2004); SYP61, encoding a syntaxin, which participates in membrane fusion and in osmotic and salt stress response (Zhu et al., 2002); PI3K, encoding a kinase involved in endocytosis as well as in salt stress response (Leshem et al., 2007). The expression of these four genes was assessed in strf1-1 seedlings treated or not with 200 mM NaCl for increasing times, and compared to their levels in the WT. The results are shown in Figure 7a and indicate that while ZATA-1 expression was slightly but significantly higher in strf1-1 than in the WT, the addition of salt progressively reduced this difference, which was completely lost after 6 hours of incubation (Figure 7a). A similar expression profile was observed for the AtRab7 gene. These results indicate that loss of STRF1 affects the expression of ZATA-1 and AtRab7 under standard growth condition, but not at the last stage of salt treatment. On the contrary, the expression of SYP61 did not significantly increase upon NaCl treatment in the WT or in strf1-1 (Supplemental Figure S3a). As for PI3K (Supplemental Figure S3b), its expression did not show any significant difference between the WT and strf1-1 in any growth conditions. In order to further clarify STRF1 function in membrane trafficking, we examined the phenotype of Atrab7strf1 double mutant on salt stress (Figure 7b and 7c). Because of the different ecotypes of Atrab7 and strf1 mutants, we adopted the microRNA technology to generate the Atrab7/amiR-STRF1 double mutant in the Atrab7 mutant plants. The results showed that Atrab7/amiR-STRF1 plants are sensitive to salt stress which mimic to Atrab7 mutant plants under same condition. Taken together, these results indicated that STRF1 might regulate the expression level of only a subset of endocytosis and membrane trafficking genes. At least one of possibility is that STRF1 functions in regulating AtRab7 expression to respond to salt stress.
This article is protected by copyright. All rights reserved.
Accepted Article
ROS Production is Inhibited in strf1-1 One of the major effects of many abiotic stresses, including salt, is the development of an oxidative stress and the production of Reactive Oxygen Species (ROS) (Apel and Hirt, 2004). It has been demonstrated that some membrane trafficking genes, which are also involved in salt stress response, can cause changes in ROS production. For example, AtRab7 overexpression in Arabidopsis leads to increased tolerance to salt stress and to reduced ROS accumulation, while PI3K was shown to coordinate the production of ROS that occurs during salt stress (Leshem et al., 2007; Mazel et al., 2004). The salt tolerant phenotype of strf1-1 prompted us to hypothesize that ROS levels might be altered in this mutant. To verify this hypothesis we monitored H2O2 levels in strf1-1 and WT seedlings by staining the seedlings with 3,3-diaminobenzidine (DAB). The results are reported in Figure8a and show that strf1-1 seedlings produced considerably less ROS if compared with the WT upon NaCl induction, while no detectable difference was observed in seedlings grown in control conditions. High salt is known to induce the expression of the AtRbohD, which encode a membrane-bound NADPH oxidase involved in H2O2 production (Leshem et al., 2007; Xie et al., 2011). Thus, we monitored the levels of AtRbohD expression in strf1-1 and WT seedlings by qRT-PCR (Figure 8b). Our results show that the AtRbohD transcript was significantly down-regulated in the strf1-1 mutant, if compared with the WT, after 2h and 6h of salt treatment. Taken together, these results suggested that STRF1 might be involved in salt-induced ROS production through the regulation of AtRbohD expression.
DISCUSSION
STRF1 is a Plasma Membrane Protein and an Endosomal E3 Ligase The ubiquitin-proteasome system is a widely used mechanism in essentially all plant developmental processes and physiological responses, including the response to abiotic environmental factors (Guo et al., 2013). In the last years ubiquitination has been shown to mediate transmembrane proteins stability, protein-protein interaction, protein activity and intracellular localization. Ubiquitin can indeed function as an internalization signal that can direct the substrate to specific endocytic/sorting compartments, followed by recycling to the plasma membrane or degradation in the lysosome (d'Azzo et al., 2005).
This article is protected by copyright. All rights reserved.
Accepted Article
In this work we have reported the identification of an unknown RING finger E3 ligase, STRF1, which associates with the cellular membrane, mediates endocytosis and is necessary for the proper plant response to salt stress. STRF1 belongs to the Arabidopsis ATL (Arabidopsis Toxicos en Levadura) gene family, whose members, if overexpressed in yeast, cause a conditional lethal phenotype (Aguilar-Henonin et al., 2006). The ATL protein family from Arabidopsis contains 80 members, all characterized by the presence of a conserved RING-H2 type finger, which has been shown to be active for ATL31, ATL9 and EL5 (Berrocal-Lobo et al., 2010; Koiwai et al., 2007; Nishizawa et al., 2008; Sato et al., 2009; Serrano et al., 2006). Some ATL members have been also functionally characterized and shown to play a role in diverse plant processes ranging from plant defense (ATL2 and ATL9; (Berrocal-Lobo et al., 2010; Serrano and Guzman, 2004)), to carbon/nitrogen response for growth phase transition (ATL31; (Sato et al., 2009)), to ABA sensitivity (ATL43; (Serrano et al., 2006)). This, together with the function and enzymatic activity that we report here for STRF1, suggests that the ATL family, although sharing similar domains and biochemical function, might have diverged functionally during evolution. Our subcellular localization studies demonstrate that STRF1 associates not only with the plasma membrane, as suggested by the presence of a transmembrane domain in its sequence, but also with endosomes and with the Golgi and PVC compartments (Figure 4b; Figure 5a-c). This indicates that STRF1 may function as a membrane trafficking-related E3 ligase in vivo. Indeed, other RING E3 ligases similar to STRF1 location have been identified in mammals. They include, among others, Tal1, which mediates Tsg101 ubiquitination and cargo sorting into vesicles (Amit et al., 2004) and RNF13, which localizes to the endosome membrane, and may take part in the ubiquitin-mediated endosome/lysosome recycling system (Bocock et al., 2009; Bocock et al., 2010; Bocock et al., 2011). Until now, only one E3 ligase from Arabidopsis, KEG (KEEP ON GOING), has been reported to localize to the TGN/EE, and to regulate endocytic trafficking and/or the formation of signaling complexes on TGN/EE vesicles during stress responses (Gu and Innes, 2011). STRF1 might be involved in a similar non-proteasome recycling system or function directly within the UPS pathway. More work will be required to address these hypotheses.
STRF1 Participates in Salt Stress Response By Regulating Membrane Trafficking and ROS Production The phenotype of STRF1 loss of function and gain of function transgenic lines indicate that STRF1 mediates the response to salt stress. Our results further suggest that STRF1 mediate both components –ionic and osmotic- of the salt stress response
This article is protected by copyright. All rights reserved.
Accepted Article
(Figure 1d and 2a). STRF1 might affect both components of the salt stress response because of its function in membrane trafficking. The topic about the relationship between membrane trafficking and salt stress is becoming attractive. For example, TNO1 (for TGN-localized SYP41-interacting protein) is involved in vacuolar trafficking, and tno1 mutant showed sensitive to high concentration of NaCl, KCl, LiCl and mannitol ((Kim and Bassham, 2011). EHD1 (EH domain containing proteins) possess salt tolerance by function in endosomal trafficking (Bar et al., 2013). Recently, works by Hao H et al. further indicated that salt stress stimulate RbohD endocytosis by dual-color fluorescence cross-correlation spectroscopy analysis (Hao et al., 2014). All these indicated that salt stress could increase endocytosis in Arabidopsis. Analysis of general membrane endocytosis in strf1-1 seedlings revealed higher uptake of the membrane dye FM4-64 in roots, especially in presence of high salt and mannitol concentrations (Figure 6a-d). This higher uptake might reflect increased endocytosis in plants that lack the STRF1 gene. We then used a membrane protein trafficking inhibitor agent, BFA, to treat the strf1-1 mutant plants. As expected, the BFA compartments were increased in strf1-1 mutant plants (Figure 6e and 6f). STRF1 function in endocytosis and membrane trafficking is also confirmed by the expression profile of several genes involved in membrane trafficking and known to respond to salt stress (Figure 7a). In particular, the expression level of one gene, AtRab7 is nearly 1.5 fold in the strf1-1 mutant, if compared with the WT and in absence of NaCl treatment. Mazel et al. (Mazel et al., 2004) had reported that AtRab7 overexpression, similarly to the strf1-1 mutation, can accelerate endocytosis in roots, leaves, and protoplasts in Arabidopsis. In addition, the AtRab7 overexpressor, similar to strf11 mutant, produces less ROS if compared with WT. We can therefore speculate that STRF1 may control endocytosis by regulating AtRab7 expression and function. We have also shown that STRF1 affects the expression of another gene, AtRbohD, which encodes a NADPH oxidase involved in ROS production. Indeed, AtRbohD expression was decreased of about 1.5 fold in the strf1-1 mutant if compared with the WT. Future experiments should address if STRF1 has a direct or indirect role in the regulation of the expression of these genes, and whether this can account, at least in part, for the phenotype of the strf1-1 mutant. A clear and complete picture of the role membrane trafficking in salt stress response is still missing. Some reports have shown that ROS production and salt stress signal transduction may also be involved in regulating membrane trafficking (Leshem et al., 2006; Leshem et al., 2007; Mazel et al., 2004). Our results also support this conclusion; clearly, the future discovery of other STRF1 interacting proteins as well as the future identification of STRF1 substrate(s) will be needed in order to shed light on the role of this ubiquitin ligase in membrane trafficking and salt stress response.
This article is protected by copyright. All rights reserved.
Accepted Article
EXPERIMENTAL PROCEDURES
Plant Materials and Growth Conditions The Arabidopsis thaliana ecotype Landsberg erecta (Ler) was used for this study. Seeds were surface sterilized with 10% bleach and washed four times with sterile water. Sterile seeds were suspended in 0.2% agarose, plated on 1/2 MS contain 1.5% sucrose, stratified in darkness for 4 days at 4°C and then transferred to a tissue culture room at 22°C under a 16-h-light/8-h-dark photoperiod. After 2 weeks, seedlings were potted in soil and placed in a growth chamber at 22°C and 70% humidity under a 16-h-light/8-h-dark photoperiod. The 1/2 MS medium was supplemented with 1.5% sucrose and NaCl, if required. For germination assays, seeds were collected at the same time, stratified and grown as indicated above and germination rate was scored every 12 hours.
Plant Constructs To produce 35S-STRF1-MYC plants, a 927-bp BamHI - EcoRI fragment containing the STRF1 cDNA was cloned into the vector pCambia1300-221-MYC which has been previously constructed by our laboratory (Zhang et al., 2007a), in which transgenic expression is under the control of the CaMV 35S promoter and the coding region of STRF1 is fused translational to six repetitions of the MYC epitope. To produce Col 0/amiR-STRF1-14, Atrab7/amiR-STRF1-7 plants, we adopted microRNA technology to knockdown STRF1 expression in Col 0 and Atrab7. The Arabidopsis pre-miR159a (Niu et al., 2006) sequence was used as a template for the construction of amiRNAs. The mature miR159 sequence was replaced with the designed amiRNA primers amiR-STRF1-1 (5/AGATCTTGATCTGACGATGGAAGGCGGGTCAATGTCTGTCAAAACATGAGTTGAGCAGGGTA-3/) and amiRSTRF1-2 (5/-GGCGGGTCAATGAGTGTCAAAA GAAGAGTAAAAGCCATTA-3/). The primer 1 contains the BglII site (in istalic) and the amiRNA* sequence (underlined). The primer 2 contains the mature amiRNA sequence (underlined). The PCR product was ligated into the pEASYBlunt vector and sub-cloned into the plant binary vector pCAMBIA1300-221 vector with the BglII/SpeI (which is in the pEASY-Blunt vector ) digested to generate the pCAMBIA-pre-amiRNA, in which pre-amiRNA is placed downstream of a 35S promoter. For transient expression in tobacco epidermal cells, a STRF1-GFP gene fusion was constructed under the control of 35S promoter in the pCAMBIA1300-221-GFP vector which has been previously constructed in our laboratory (Liu et al., 2011). In detail, a XhoI-STRF1-KpnI cDNA was obtained by amplification of the native cDNA with a STRF1-specific forward primer containing XhoI recognition
This article is protected by copyright. All rights reserved.
Accepted Article
site (STRF1 XhoI Fw) and a reverse primer containing a KpnI recognition site (STRF1 KpnI Rev), and cloned upstream of the GFP coding sequence in the pCAMBIA1300-221-GFP vector. Primers sequences are listed in Table S1.
Plant Transformation Arabidopsis transformation was performed by the vacuum infiltration method (Bechtold and Pelletier, 1998) using the Agrobacterium tumefaciens strain GV3101. T1 and T2 seeds were selected on 20 µg/mL hygromycin, and the T2 plants were transferred to soil to obtain homozygous T3 seeds. For the phenotypical analysis, one homozygous line (T3 or T4 generation) was used. The agroinfiltration procedure was performed as described by Liu et al. (2010). Two days after agroinfiltration, the leaves were observed under a confocal microscope (Leica). For Arabidopsis protoplast transformation, mesophyll protoplasts were isolated from 4-week-old rosette leaves and co-transfected with pGFP2-STRF1-GFP and different endomembrane organelle markers, as previously described (Chen et al., 2010). Transfected cells were kept in the dark at room temperature overnight, and observed the following day under a confocal microscope (Leica).
FM4-64 Staining Tobacco leaves and Arabidopsis seedling roots were stained with FM4-64 (Invitrogen) as described in (Leshem et al., 2007; Mazel et al., 2004). Briefly, tobacco leaves agroinfiltrated with STRF1-GFP were cut in small fragments, incubated in a medium containing 5µg/ml FM4-64 for 40 min, rinsed with water for several times and observed under a confocal microscope (Leica). Arabidopsis roots were prepared from 5-day-old seedlings that were rinsed with sterile water, incubated in a liquid medium with or without 200 mM NaCl for 40 min and dipped in a medium containing 2µM FM4-64 for 15 min. The degree of endocytosis was quantified by analyzing cytosolic FM4-64 fluorescence in confocal images of single cells, after converting the fluorescence intensity from individual confocal sections to gray-scale images.
BFA treatment Arabidopsis roots were prepared from 5-day-old seedlings that were briefly washed and incubated in 50μM BFA and 5μg/ml FM4-64 for 30 min. The BFA compartments were counted in confocal images of single cells.
This article is protected by copyright. All rights reserved.
Accepted Article
RT-PCR and qRT-PCR DNase I-treated total RNA (10µg) was denatured and subjected to reverse transcription reaction at 75°C for 15 min followed by 42°C for 1 h. STRF1 amplification was performed using STRF1-specific primers (STRF1 RT Fw and Rev). The following genes: ZATA-1 (At1g60970), AtSYP61 (At1g28490), AtRab7 (At1g49300), PI3K (At1g60490), AtRbohD (At5g47910) were also amplified with gene specific primers listed in Table S1. ACTIN-1 was used as an internal control. Experiments were repeated two times, each in three analytical repeats.
E3 Ubiquitin Ligase Activity Assay The STRF1 cDNA sequence (927bp) was cloned into the pMAL-c2 vector (New England Biolabs, Beverly, MA), expressed in E. coli as a fusion with a maltose binding protein (STRF1-MBP) and purified according to the manufacturer’s instructions. Crude extracts containing recombinant wheat E1 (GI: 136632), human E2 (UBCh5b) (~40ng), STRF1-MBP (~1µg), and ~2µg of purified His-tag Arabidopsis ubiquitin (UBC14, At4g0289) were used for the ubiquitin ligase activity assay as described by Zhang et al. and Zhao et al. (Zhang et al., 2007a; Zhao et al., 2013).
Protein Extraction and Immunoblot Analyses Subcellular fractionation was carried out from STRF1-GFP agroinfiltrated tobacco leaves as previously described (Sato et al., 2009). Proteins extracts were separated by SDS/PAGE, and analyzed by immunoblot. His-tagged ubiquitin was detected by an Ub antibody ((Liu et al., 2010)); STRF1-MBP was visualized by chemiluminescence as instructed by the manufacturer (New England Biolabs).
In vivo Detection of H2O2 The accumulation of H2O2 in plants upon salt treatment was detected by DAB (3, 3Diaminobenzidine) staining as described by Liu et al. (2011). Briefly, 14-day-old WT and strf1-1 seedlings were first incubated in with liquid medium for 1 day, followed by incubation in liquid medium containing 200 mM NaCl for different times. The true leaves were cut off and dipped in 1mg/ml DAB (pH 3.8) for 8h at 25°C in the light. The reaction was terminated by immersion of the leaves in a de-staining solution (20% acetic acid, 20% glycerol and 60% ethanol) and boiled for 3-10’. The leaves were observed under an optical microscope (Zeiss Imager A1).
This article is protected by copyright. All rights reserved.
Accepted Article
ACKNOWLEDGEMENTS
We thank Prof. Yihua Zhou for Man 49-mCherry, mRFP-SYP61 and mRFP-VSR2 plasmids, Dr. Nam Hai Chua for the pGFP2 vector. This research was supported by grant 973 Program 2011CB915402 from the National Basic Research Program of China and NSFC 91317308/31300221 from the National Science Foundation of China and also the state key laboratory of plant Genomics.
SUPPORTING INFORMATION Figure S1. The phenotype of ox-STRF1-GFP on salt stress. Figure S2. Internalization of the FM4-64 Dye in ox-STRF1-1 plants. Figure S3. Lack of STRF1 Does not Affect the Expression of the Membrane Trafficking Genes SYP61 and PI3K. Table S1. List of gene-specific primers used in this work.
REFERENCES
Agarwal, P.K., Agarwal, P., Jain, P., Jha, B., Reddy, M.K. and Sopory, S.K. (2008) Constitutive overexpression of a stress-inducible small GTP-binding protein PgRab7 from Pennisetum glaucum enhances abiotic stress tolerance in transgenic tobacco. Plant Cell Rep, 27, 105-115. Aguilar-Henonin, L., Bravo, J. and Guzman, P. (2006) Genetic interactions of a putative Arabidopsis thaliana ubiquitin-ligase with components of the Saccharomyces cerevisiae ubiquitination machinery. Curr Genet, 50, 257-268. Amit, I., Yakir, L., Katz, M., Zwang, Y., Marmor, M.D., Citri, A., Shtiegman, K., Alroy, I., Tuvia, S., Reiss, Y., Roubini, E., Cohen, M., Wides, R., Bacharach, E., Schubert, U. and Yarden, Y. (2004) Tal, a Tsg101-specific E3 ubiquitin ligase, regulates receptor endocytosis and retrovirus budding. Genes Dev, 18, 1737-1752. Apel, K. and Hirt, H. (2004) Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu Rev Plant Biol, 55, 373-399. Bar, M., Leibman, M., Schuster, S., Pitzhadza, H. and Avni, A. (2013) EHD1 functions in endosomal recycling and confers salt tolerance. PLoS One, 8, e54533.
This article is protected by copyright. All rights reserved.
Accepted Article
Bassham, D.C. and Blatt, M.R. (2008) SNAREs: cogs and coordinators in signaling and development. Plant Physiol, 147, 1504-1515. Bechtold, N. and Pelletier, G. (1998) In planta Agrobacterium-mediated transformation of adult Arabidopsis thaliana plants by vacuum infiltration. Methods Mol Biol, 82, 259-266. Berrocal-Lobo, M., Stone, S., Yang, X., Antico, J., Callis, J., Ramonell, K.M. and Somerville, S. (2010) ATL9, a RING Zinc Finger Protein with E3 Ubiquitin Ligase Activity Implicated in Chitin- and NADPH Oxidase-Mediated Defense Responses. PLoS One, 5, e14426. Bocock, J.P., Carmicle, S., Chhotani, S., Ruffolo, M.R., Chu, H. and Erickson, A.H. (2009) The PA-TMRING protein RING finger protein 13 is an endosomal integral membrane E3 ubiquitin ligase whose RING finger domain is released to the cytoplasm by proteolysis. Febs J, 276, 18601877. Bocock, J.P., Carmicle, S., Madamba, E. and Erickson, A.H. (2010) Nuclear targeting of an endosomal E3 ubiquitin ligase. Traffic, 11, 756-766. Bocock, J.P., Carmicle, S., Sircar, M. and Erickson, A.H. (2011) Trafficking and proteolytic processing of RNF13, a model PA-TM-RING family endosomal membrane ubiquitin ligase. Febs J, 278, 69-77. Bu, Q., Li, H., Zhao, Q., Jiang, H., Zhai, Q., Zhang, J., Wu, X., Sun, J., Xie, Q., Wang, D. and Li, C. (2009) The Arabidopsis RING finger E3 ligase RHA2a is a novel positive regulator of abscisic acid signaling during seed germination and early seedling development. Plant Physiol, 150, 463-481. Chen, H., Zhang, Z., Teng, K., Lai, J., Zhang, Y., Huang, Y., Li, Y., Liang, L., Wang, Y., Chu, C., Guo, H. and Xie, Q. (2010) Up-regulation of LSB1/GDU3 affects geminivirus infection by activating the salicylic acid pathway. Plant J, 62, 12-23. d'Azzo, A., Bongiovanni, A. and Nastasi, T. (2005) E3 ubiquitin ligases as regulators of membrane protein trafficking and degradation. Traffic, 6, 429-441. Dong, C.H., Agarwal, M., Zhang, Y., Xie, Q. and Zhu, J.K. (2006) The negative regulator of plant cold responses, HOS1, is a RING E3 ligase that mediates the ubiquitination and degradation of ICE1. Proc Natl Acad Sci U S A, 103, 8281-8286. Ebine, K., Okatani, Y., Uemura, T., Goh, T., Shoda, K., Niihama, M., Morita, M.T., Spitzer, C., Otegui, M.S., Nakano, A. and Ueda, T. (2008) A SNARE complex unique to seed plants is required for protein storage vacuole biogenesis and seed development of Arabidopsis thaliana. Plant Cell, 20, 3006-3021. George, S. and Parida, A. (2010) Over-expression of a Rab family GTPase from phreatophyte Prosopis juliflora confers tolerance to salt stress on transgenic tobacco. Mol Biol Rep.
This article is protected by copyright. All rights reserved.
Accepted Article
Grefen, C. and Blatt, M.R. (2008) SNAREs--molecular governors in signalling and development. Curr Opin Plant Biol, 11, 600-609. Gu, Y. and Innes, R.W. (2011) The KEEP ON GOING protein of Arabidopsis recruits the ENHANCED DISEASE RESISTANCE1 protein to trans-Golgi network/early endosome vesicles. Plant Physiol, 155, 1827-1838. Guo, L., Nezames, C.D., Sheng, L., Deng, X. and Wei, N. (2013) Cullin-RING ubiquitin ligase family in plant abiotic stress pathways(F). J Integr Plant Biol, 55, 21-30. Hao, H., Fan, L., Chen, T., Li, R., Li, X., He, Q., Botella, M.A. and Lin, J. (2014) Clathrin and Membrane Microdomains Cooperatively Regulate RbohD Dynamics and Activity in Arabidopsis. Plant Cell, 26, 1729-1745. Hasegawa, P.M., Bressan, R.A., Zhu, J.K. and Bohnert, H.J. (2000) Plant Cellular and Molecular Responses to High Salinity. Annu Rev Plant Physiol Plant Mol Biol, 51, 463-499. Jelinkova, A., Malinska, K., Simon, S., Kleine-Vehn, J., Parezova, M., Pejchar, P., Kubes, M., Martinec, J., Friml, J., Zazimalova, E. and Petrasek, J. (2010) Probing plant membranes with FM dyes: tracking, dragging or blocking? Plant J, 61, 883-892. Kim, S.G. and Park, C.M. (2007) Membrane-mediated salt stress signaling in flowering time control. Plant Signal Behav, 2, 517-518. Kim, S.J. and Bassham, D.C. (2011) TNO1 is involved in salt tolerance and vacuolar trafficking in Arabidopsis. Plant Physiol, 156, 514-526. Koiwai, H., Tagiri, A., Katoh, S., Katoh, E., Ichikawa, H., Minami, E. and Nishizawa, Y. (2007) RINGH2 type ubiquitin ligase EL5 is involved in root development through the maintenance of cell viability in rice. Plant J, 51, 92-104. Lee, J.H. and Kim, W.T. (2011) Regulation of abiotic stress signal transduction by E3 ubiquitin ligases in Arabidopsis. Mol Cells, 31, 201-208. Leshem, Y., Melamed-Book, N., Cagnac, O., Ronen, G., Nishri, Y., Solomon, M., Cohen, G. and Levine, A. (2006) Suppression of Arabidopsis vesicle-SNARE expression inhibited fusion of H2O2-containing vesicles with tonoplast and increased salt tolerance. Proc Natl Acad Sci U S A, 103, 18008-18013. Leshem, Y., Seri, L. and Levine, A. (2007) Induction of phosphatidylinositol 3-kinase-mediated endocytosis by salt stress leads to intracellular production of reactive oxygen species and salt tolerance. Plant J, 51, 185-197. Leyman, B., Geelen, D., Quintero, F.J. and Blatt, M.R. (1999) A tobacco syntaxin with a role in hormonal control of guard cell ion channels. Science, 283, 537-540.
This article is protected by copyright. All rights reserved.
Accepted Article
Li, H., Jiang, H., Bu, Q., Zhao, Q., Sun, J., Xie, Q. and Li, C. (2011) The Arabidopsis RING finger E3 ligase RHA2b acts additively with RHA2a in regulating abscisic acid signaling and drought response. Plant Physiol, 156, 550-563. Liu, L., Cui, F., Li, Q., Yin, B., Zhang, H., Lin, B., Wu, Y., Xia, R., Tang, S. and Xie, Q. (2011) The endoplasmic reticulum-associated degradation is necessary for plant salt tolerance. Cell Res, 21, 957-969. Liu, L., Zhang, Y., Tang, S., Zhao, Q., Zhang, Z., Zhang, H., Dong, L., Guo, H. and Xie, Q. (2010) An efficient system to detect protein ubiquitination by agroinfiltration in Nicotiana benthamiana. Plant J, 61, 893-903. Mahajan, S., Pandey, G.K. and Tuteja, N. (2008) Calcium- and salt-stress signaling in plants: shedding light on SOS pathway. Arch Biochem Biophys, 471, 146-158. Mahajan, S. and Tuteja, N. (2005) Cold, salinity and drought stresses: an overview. Arch Biochem Biophys, 444, 139-158. Mazel, A., Leshem, Y., Tiwari, B.S. and Levine, A. (2004) Induction of salt and osmotic stress tolerance by overexpression of an intracellular vesicle trafficking protein AtRab7 (AtRabG3e). Plant Physiol, 134, 118-128. Miao, Y., Li, K.Y., Li, H.Y., Yao, X. and Jiang, L. (2008) The vacuolar transport of aleurain-GFP and 2S albumin-GFP fusions is mediated by the same pre-vacuolar compartments in tobacco BY-2 and Arabidopsis suspension cultured cells. Plant J, 56, 824-839. Nishizawa, Y., Katoh, S., Koiwai, H. and Katoh, E. (2008) EL5 is involved in root development as an anti-cell death ubiquitin ligase. Plant Signal Behav, 3, 148-150. Niu, Q.W., Lin, S.S., Reyes, J.L., Chen, K.C., Wu, H.W., Yeh, S.D. and Chua, N.H. (2006) Expression of artificial microRNAs in transgenic Arabidopsis thaliana confers virus resistance. Nat Biotechnol, 24, 1420-1428. Oh, D.H., Lee, S.Y., Bressan, R.A., Yun, D.J. and Bohnert, H.J. (2010) Intracellular consequences of SOS1 deficiency during salt stress. J Exp Bot, 61, 1205-1213. Parinov, S., Sevugan, M., Ye, D., Yang, W.C., Kumaran, M. and Sundaresan, V. (1999) Analysis of flanking sequences from dissociation insertion lines: a database for reverse genetics in Arabidopsis. Plant Cell, 11, 2263-2270. Park, G.G., Park, J.J., Yoon, J., Yu, S.N. and An, G. (2010) A RING finger E3 ligase gene, Oryza sativa Delayed Seed Germination 1 (OsDSG1), controls seed germination and stress responses in rice. Plant Mol Biol, 74, 467-478. Park, K.Y., Jung, J.Y., Park, J., Hwang, J.U., Kim, Y.W., Hwang, I. and Lee, Y. (2003) A role for phosphatidylinositol 3-phosphate in abscisic acid-induced reactive oxygen species generation in guard cells. Plant Physiol, 132, 92-98.
This article is protected by copyright. All rights reserved.
Accepted Article
Rutherford, S. and Moore, I. (2002) The Arabidopsis Rab GTPase family: another enigma variation. Curr Opin Plant Biol, 5, 518-528. Sanderfoot, A.A., Kovaleva, V., Bassham, D.C. and Raikhel, N.V. (2001) Interactions between syntaxins identify at least five SNARE complexes within the Golgi/prevacuolar system of the Arabidopsis cell. Mol Biol Cell, 12, 3733-3743. Sato, T., Maekawa, S., Yasuda, S., Sonoda, Y., Katoh, E., Ichikawa, T., Nakazawa, M., Seki, M., Shinozaki, K., Matsui, M., Goto, D.B., Ikeda, A. and Yamaguchi, J. (2009) CNI1/ATL31, a RING-type ubiquitin ligase that functions in the carbon/nitrogen response for growth phase transition in Arabidopsis seedlings. Plant J, 60, 852-864. Serrano, M. and Guzman, P. (2004) Isolation and gene expression analysis of Arabidopsis thaliana mutants with constitutive expression of ATL2, an early elicitor-response RING-H2 zinc-finger gene. Genetics, 167, 919-929. Serrano, M., Parra, S., Alcaraz, L.D. and Guzman, P. (2006) The ATL gene family from Arabidopsis thaliana and Oryza sativa comprises a large number of putative ubiquitin ligases of the RINGH2 type. J Mol Evol, 62, 434-445. Shirakawa, M., Ueda, H., Shimada, T., Koumoto, Y., Shimada, T.L., Kondo, M., Takahashi, T., Okuyama, Y., Nishimura, M. and Hara-Nishimura, I. (2010) Arabidopsis Qa-SNARE SYP2 proteins localized to different subcellular regions function redundantly in vacuolar protein sorting and plant development. Plant J, 64, 924-935. Silva, P.A., Ul-Rehman, R., Rato, C., Di Sansebastiano, G.P. and Malho, R. (2010) Asymmetric localization of Arabidopsis SYP124 syntaxin at the pollen tube apical and sub-apical zones is involved in tip growth. BMC Plant Biol, 10, 179. Sokolovski, S., Hills, A., Gay, R.A. and Blatt, M.R. (2008) Functional interaction of the SNARE protein NtSyp121 in Ca2+ channel gating, Ca2+ transients and ABA signalling of stomatal guard cells. Mol Plant, 1, 347-358. Uemura, T., Ueda, T., Ohniwa, R.L., Nakano, A., Takeyasu, K. and Sato, M.H. (2004) Systematic analysis of SNARE molecules in Arabidopsis: dissection of the post-Golgi network in plant cells. Cell Struct Funct, 29, 49-65. Vida, T.A. and Emr, S.D. (1995) A new vital stain for visualizing vacuolar membrane dynamics and endocytosis in yeast. J Cell Biol, 128, 779-792. Woollard, A.A. and Moore, I. (2008) The functions of Rab GTPases in plant membrane traffic. Curr Opin Plant Biol, 11, 610-619. Xie, Y.J., Xu, S., Han, B., Wu, M.Z., Yuan, X.X., Han, Y., Gu, Q., Xu, D.K., Yang, Q. and Shen, W.B. (2011) Evidence of Arabidopsis salt acclimation induced by up-regulation of HY1 and the regulatory role of RbohD-derived reactive oxygen species synthesis. Plant J, 66, 280-292.
This article is protected by copyright. All rights reserved.
Accepted Article
Xiong, G., Li, R., Qian, Q., Song, X., Liu, X., Yu, Y., Zeng, D., Wan, J., Li, J. and Zhou, Y. (2010) The rice dynamin-related protein DRP2B mediates membrane trafficking, and thereby plays a critical role in secondary cell wall cellulose biosynthesis. Plant J, 64, 56-70. Xiong, L., Schumaker, K.S. and Zhu, J.K. (2002) Cell signaling during cold, drought, and salt stress. Plant Cell, 14 Suppl, S165-183. Zhang, Y., Yang, C., Li, Y., Zheng, N., Chen, H., Zhao, Q., Gao, T., Guo, H. and Xie, Q. (2007a) SDIR1 is a RING finger E3 ligase that positively regulates stress-responsive abscisic acid signaling in Arabidopsis. Plant Cell, 19, 1912-1929. Zhang, Z., Feechan, A., Pedersen, C., Newman, M.A., Qiu, J.L., Olesen, K.L. and ThordalChristensen, H. (2007b) A SNARE-protein has opposing functions in penetration resistance and defence signalling pathways. Plant J, 49, 302-312. Zhao, Q., Tian, M., Li, Q., Cui, F., Liu, L., Yin, B. and Xie, Q. (2013) A plant-specific in vitro ubiquitination analysis system. Plant J, 74, 524-533. Zhu, J., Gong, Z., Zhang, C., Song, C.P., Damsz, B., Inan, G., Koiwa, H., Zhu, J.K., Hasegawa, P.M. and Bressan, R.A. (2002) OSM1/SYP61: a syntaxin protein in Arabidopsis controls abscisic acidmediated and non-abscisic acid-mediated responses to abiotic stress. Plant Cell, 14, 30093028. Zhu, J.K. (2002) Salt and drought stress signal transduction in plants. Annu Rev Plant Biol, 53, 247273. Zouhar, J., Rojo, E. and Bassham, D.C. (2009) AtVPS45 is a positive regulator of the SYP41/SYP61/VTI12 SNARE complex involved in trafficking of vacuolar cargo. Plant Physiol, 149, 1668-1678.
This article is protected by copyright. All rights reserved.
Accepted Article
FIGURE LEGENDS
Figure1. STRF1 is a RING-H2 type regulator of salt response. (a) Genomic structure of the STRF1 locus and position of the Ds element in the strf1-1 mutant. STRF1 RT Fw and RT Rev are primers used for the RT-PCR analysis. (b) Protein domains arrangement of the full-length STRF1 protein. TM, transmembrane domain; RING, RING finger domain. (c) RT-PCR analysis of STRF1 transcript levels in seedlings from the wild-type (WT, Ler ecotype), strf1-1 and ox-STRF1-1 overexpressor (in the strf1-1 background). The ACTIN1 mRNA was used as a control. The primer pairs used for RT-PCR reaction are shown in Figure 1(a). (d) Phenotype of WT, strf1-1 and ox-STRF1-1 seedlings grown on ½ MS with (top) or without (bottom) 150 mM NaCl for 10 days. (e) Germination rate of WT, strf1-1 and ox-STRF1-1 seedlings grown on ½ MS with or without 150 mM NaCl. The values of means ±SD (n=108) are shown. Experiments were run in triplicates; a typical experiment is shown. *p-value
Received Date : 24-Jan-2014 Revised Date : 28-Jan-2015 Accepted Date : 03-Feb-2015 Article type
: Original Article
The RING finger E3 ligase STRF1 is involved in membrane trafficking and modulates salt stress response in Arabidopsis thaliana Miaomiao Tian1,2,#, Lijuan Lou1,#, Lijing Liu1, Feifei Yu1, Qingzhen Zhao1,3, Huawei Zhang1, Yaorong Wu1, Sanyuan Tang1, Ran Xia1, Baoge Zhu1, Giovanna Serino4,5 and Qi Xie1,*
Running title: STRF1 in membrane trafficking and salt stress
1
State Key Laboratory of Plant Genomics, National Center for Plant Gene Research, Institute of
Genetics and Developmental Biology, Chinese Academy of Sciences, No.1 West Beichen Road, Chaoyang District, Beijing 100101, China 2
State Key Laboratory of Proteomics, Beijing Proteome Research Center, National Engineering
Research Center for Protein Drugs, National Center for Protein Sciences, Beijing Institute of Radiation Medicine, Beijing, P. R. China 3
School of Life Science, Liaocheng University, Liaocheng 252000, China
4
Department of Biology and Biotechnology “C. Darwin”, Sapienza University, Rome, 00185 Italy
5
The New York Botanical Garden, Bronx, NY, USA
#
Those authors contribute equal to this work
*
To whom correspondence should be addressed:
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as an 'Accepted Article', doi: 10.1111/tpj.12797 This article is protected by copyright. All rights reserved.
Accepted Article
Qi XIE State Key Laboratory of Plant Genomics Institute of Genetics and Developmental Biology Chinese Academy of Sciences No.1 West Beichen Road Road, Beijing 100101, China TEL: 86-10-64806619 FAX: 86-10-64806619 E-mail: [email protected] SUMMARY
Salt stress is a detrimental factor for plant growth and development. The response to salt stress has been shown to involve components in the intracellular trafficking system, as well as components of the ubiquitin-proteasome system (UPS). In this article, we have identified in Arabidopsis thaliana a little reported ubiquitin ligase involved in salt stress response, which we named STRF1 (Salt Tolerance RING Finger 1). STRF1 is a member of RING-H2 finger proteins and we demonstrate that it has ubiquitin ligase activity in vitro. We also show that STRF1 localizes mainly at the plasma membrane and at the intracellular endosomes. strf1-1 loss of function mutant seedlings exhibit accelerated endocytosis in roots, and have altered expression of several genes involved in the membrane trafficking system. Moreover, protein trafficking inhibitor, BFA treatment has increased BFA bodies in strf1-1 mutant. This mutant also showed increased tolerance to salt, ionic and osmotic stresses, reduced accumulation of reactive oxygen species during salt stress, and increased expression of AtRbohD, which encodes a NADPH oxidase involved in H2O2 production. We conclude that STRF1 is a membrane trafficking-related ubiquitin ligase, which helps the plant to respond to salt stress by monitoring intracellular membrane trafficking and ROS production.
Key words: STRF1, membrane trafficking, salt stress, ubiquitination
This article is protected by copyright. All rights reserved.
Accepted Article
INTRODUCTION
High salinity in soil is a vital problem for plants. It can cause both ionic and osmotic stress, which affect plant growth and development (Kim and Park, 2007). When plants encounter salt stress, they reprogram their cellular processes to cope with this new adverse environment. The molecular and genetic pathways involved in salt response have been extensively studied, and it is now known that this process involves a cascade of signaling events. An increase in salt levels is perceived by plasma membrane receptors, which in turn promote the release of second messengers (e.g., Ca2+ content, inositol phosphates and reactive oxygen species, ROS). These second messengers promote specific gene expression and allow the plant to cope with the adverse environment. This signaling cascade is conserved also in the response to other abiotic stresses, such as lower or higher temperature, drought, flooding, UV and strong light irradiation (Hasegawa et al., 2000; Mahajan et al., 2008; Mahajan and Tuteja, 2005; Xiong et al., 2002). In the recent years membrane trafficking proteins have also been reported to participate in abiotic stress. These membrane proteins include the SNARE (Soluble N-ethylmaleimide-sensitive factor attachment protein Receptors) proteins, which mediate intracellular vesicle trafficking, fusion and secretion in plant growth and development and are also involved in ABA signaling pathway and in abiotic stress response (Bassham and Blatt, 2008; Ebine et al., 2008; Grefen and Blatt, 2008; Leshem et al., 2006; Leyman et al., 1999; Shirakawa et al., 2010; Silva et al., 2010; Sokolovski et al., 2008; Zhang et al., 2007b; Zhu et al., 2002; Zouhar et al., 2009). Another membrane trafficking protein, Rab7, a member of the Rab family of small GTPases which in yeast and mammals controls intracellular vesicle trafficking from the late endosome to the vacuole (Rutherford and Moore, 2002; Woollard and Moore, 2008), has been reported to be involved in salt and osmotic stress response in plants (Agarwal et al., 2008; George and Parida, 2010; Mazel et al., 2004). Finally, phosphoinositide 3-kinases (PI3Ks), a dual-functional enzyme which contains a lipid kinase and a protein kinase activity and mediates intracellular membrane and vesicle trafficking pathway has been also shown to function in salt stress and ABA-induced ROS generation (Leshem et al., 2007; Park et al., 2003). E3 ubiquitin ligases have also been shown to participate in abiotic responses (Guo et al., 2013; Lee and Kim, 2011). Among all types of ubiquitin ligases, the class of RING finger E3 ligases has been specifically shown to play an important role in abiotic stress tolerance. For example, the RING finger E3 ligases, HOS1 (HIGH EXPRESSION OF OSMOTICALLY RESPONSIVE GENE 1) mediates the ubiquitination and degradation of ICE1 (Inducer of CBF expression 1) -and possibly also of other regulators- to negatively regulate cold response in Arabidopsis (Dong et al., 2006). We have shown that SDIR1, a C3H2C3 RING finger E3 ligase, promotes stress-responsive ABA signaling in Arabidopsis and is involved in the response to salt stress (Zhang et al., 2007a). In addition, RHA2a and RHA2b,
This article is protected by copyright. All rights reserved.
Accepted Article
two RING-H2 type E3 ligases, are positive regulators of ABA signaling and promote drought tolerance (Bu et al., 2009; Li et al., 2011). Recently, a RING E3 ligase from rice, OsDSG1, has been identified as a RING finger E3 ligase to mediate ABA signaling and to control stress response (Park et al., 2010). In order to isolate important plant RING finger E3 ligases involved in the response to salt stress, we have screened an Ac-Ds insertional collection in Arabidopsis RING finger genes and found a mutant which displayed salt tolerance. We named this mutant strf1-1 (salt tolerance RING finger 11). Molecular and genetic analyses confirmed that the phenotype was caused by a single knock out in the STRF1 gene. In vitro ubiquitination assays indicated that STRF1 is an active RING-C3H2C3-type E3 ligase. We further show the STRF1 localizes to the plasma membrane and to intracellular endosomes. Finally, we provide evidence that STRF1 promotes salt tolerance by regulating membrane trafficking and ROS production.
RESULTS
Identification of the STRF1 Gene In order to isolate novel E3 ligases of the RING finger family involved in the response to salt stress, we screened a pool of Ac-Ds Arabidopsis insertion lines in RING finger genes (Landsberg ecotype) (Parinov et al., 1999). A collection of 150 mutant lines and its relative wild type (WT) was sown in 1/2MS containing 200 mM NaCl. Salt-resistant seedlings were transferred to soil, and their offspring was scored again for the salt resistant phenotype on a higher salt concentration (250 mM NaCl). Here we describe the characterization of one of these salt-resistant mutants, that we named strf1-1 (salt tolerance RING finger 1). In order to remove possible extraneous mutations, we backcrossed the strf1-1 mutant line to the WT. Analysis of the segregation rate of the F2 population on Kanamycin after the backcross indicated that the results were consistent with a resistant: sensitive seedlings ratio of 3:1 (354 resistant and 122 sensitive seedlings), thus indicating a single transposon insertion. Tail-PCR and Blast results confirmed that the Ds element was inserted in the coding region of the At5g58580 gene, 292 bp downstream of the ATG (Figure 1a). RT-PCR experiments revealed that the full length STRF1 mRNA was absent in the strf1-1 mutant (Figure 1c). Because no other STRF1 insertion mutants could be recovered from all available T-DNA insertion collections, to further confirm that the strf1-1 phenotype was due to the absence of a full length STRF1 mRNA, we transformed strf1-1 plants with a construct overexpressing STRF1 (35S -
This article is protected by copyright. All rights reserved.
Accepted Article
This article is protected by copyright. All rights reserved.
Accepted Article
STRF1 is an Active Ubiquitin Ligase The STRF1 gene encodes a protein of 310 amino acids (aa) with a predicted molecular mass of 34.29 kiloDaltons, and which contains two domains: a transmembrane domain and a RING domain encompassing aa 29-51 and aa 138-179 respectively, as predicted by the SMART program (http://smart.embl-heidelberg.de/ ) (Figure 1b). The RING domain includes six highly conserved cysteines, two histidine residues, and is composed of two Zinc-finger motifs (Figure 1b and 3a). This suggests that STRF1 could have E3 ligase activity. Previous genome-wide studies had annotated STRF1 as ATL63, a member of ATL family (AguilarHenonin et al., 2006; Serrano et al., 2006). All members of the ATL family contain a RING-finger domain. Indeed, up to now, three members of the ATL family, ATL2, ATL9 and ATL31, have been shown to be active E3 ligases in Arabidopsis (Berrocal-Lobo et al., 2010; Nishizawa et al., 2008; Sato et al., 2009; Serrano et al., 2006). To test whether STRF1 also has ubiquitin ligase activity, we carried out an in vitro ubiquitination assay. To this aim, we expressed and purified the full length of STRF1 with MBP tag from E. coli and tested its self-ubiquitination activity by incubating it with wheat E1 (Triticum aestivum), human E2 (UBCh5b), and His-tagged ubiquitin, followed by immunoblot analysis. While in the absence of E1 or E2, no polyubiquitination conjugates could be observed (Figure 3b), clear poly-ubiquitinated MBPSTRF1 conjugates could be observed when all reagents were present. The result was double confirmed by anti-Ub (Figure 3b up panel) and anti-MBP (tagged to STRF1, Figure 3b low panel) antibodies. This result indicates that STRF1 is a functional E3 ligase in vitro, and that it is dependent on E1 and E2 activity.
STRF1 Associates with the Cell Membranes As already described, STRF1 contains a putative transmembrane domain at its N-terminus (Figure 1b), suggesting that STRF1 might be a membrane protein. In order to prove this hypothesis, we sought to determine the subcellular localization of STRF1 by transiently overexpressing a STRF1-GFP fusion protein in leaf cells via agroinfiltration. The activity of STRF1 in STRF1-GFP fusion protein was verified by transform 35S-STRF1-GFP to strf1-1 to assay on the salt sensitivity (Supplemental Figure S1). After 2 days from the inoculation, N. benthamiana leaves were subjected to subcellular fractionation and the presence of STRF1-GFP was verified by immunoblot analysis. As shown in Figure 4a, a full size STRF1-GFP fusion protein was detected only in the pellet fraction when proteins were extracted with a detergent-free buffer, while it was detected in soluble fraction when proteins
This article is protected by copyright. All rights reserved.
Accepted Article
were extracted with a buffer containing 1% Triton-X 100. These results suggested that STRF1 likely associates with the cellular membrane system. To further determine which sub-type of membrane STRF1 protein was localized to, N. benthamiana leaf cells transiently expressing the STRF1-GFP fusion protein were incubated with the lipophilic styryl dye FM4-64, which is known to stain endosomes and plasma membrane in Arabidopsis under low temperature, and observed under a confocal microscope (Jelinkova et al., 2010; Vida and Emr, 1995). As shown in Figure 4b, STRF1-GFP localized mainly to the plasma membrane, but also co-localized with small cytosolic particles (see arrows in Figure 4b). The same particles were also stained with FM4-64, suggesting that STRF1 localizes likely to intracellular endosomes. To further substantiate this subcellular localization pattern, we co-expressed STRF1-GFP and several markers of different subcellular compartments in Arabidopsis protoplast cells. The results are shown in Figure 5 and indicate that STRF1-GFP subcellular localization was mostly identical to that of Man49-mCherry, which is a cis-Golgi vesicle marker (Xiong et al., 2010). A similar colocalization was also found between STRF1-GFP and the RFP-tagged TGN/EE (trans-Golgi network/early endosome) marker SYP61 (Sanderfoot et al., 2001; Uemura et al., 2004). We also detected an overlapping subcellular distribution between STRF1-GFP and the mRFP-VSR2 marker, which marks the pre-vacuolar compartments (PVC) (Miao et al., 2008) (Figure 5a-c). These results indicated that STRF1 localizes to the plasma membrane, the Golgi apparatus, and the prevacuolar compartments and suggest that STRF1 might participate in salt stress response by regulating membrane trafficking.
STRF1 Regulates Endocytosis To test whether STRF1 has a role in membrane trafficking, we monitored the internalization levels of FM4-64 in root cells of the strf1-1 mutant, ox-STRF1-1 and of WT seedlings, treated or not with NaCl and mannitol. The results indicate that accumulation of FM4-64 in the strf1-1 mutant was already higher than in the WT under standard growth condition, but that it increased even more significantly after treatment with 200 mM NaCl and 400 mM mannitol (Figure 6a-d). Moreover, the response of ox-STRF1-1 plants in the FM4-64 uptake assays is similar to WT either in normal condition or salt stress condition (Supplemental Figure S2). This suggests that NaCl and mannitol accelerates endocytosis of FM4-64 already in the WT and, to a higher extent, in the strf1-1 mutant. In order to further support the STRF1 involved in membrane trafficking, we examined the effect of protein trafficking inhibitor -Brefeldin A (BFA) in root cells of the strf1-1 mutant, ox-STRF1-1 and
This article is protected by copyright. All rights reserved.
Accepted Article
of WT seedlings. The results showed that BFA compartments were increased in strf1-1 mutant when compared with ox-STRF1-1 and of WT seedlings (Figure 6e and 6f),. All these results indicated that STRF1 participated in membrane trafficking.
STRF1 is Necessary for the Proper Expression of Genes Involved in Membrane Trafficking We further confirmed the effect of STRF1 on membrane trafficking by monitoring its effects on the expression of genes encoding components of the membrane trafficking system. More than 500 genes affecting membrane trafficking had been identified in Arabidopsis (Oh et al., 2010); among those, we decided to monitor by qRT-PCR the expression of several those genes which have been found to be involved in salt stress response: ZATA-1 (encodes a clathrin adaptor subunit protein), whose expression is induced by salt stress (Oh et al., 2010); AtRab7, which encodes a member of the Rab family of small GTPases, and plays a role in membrane identification, vesicle targeting specificity as well as in salt stress response (Mazel et al., 2004); SYP61, encoding a syntaxin, which participates in membrane fusion and in osmotic and salt stress response (Zhu et al., 2002); PI3K, encoding a kinase involved in endocytosis as well as in salt stress response (Leshem et al., 2007). The expression of these four genes was assessed in strf1-1 seedlings treated or not with 200 mM NaCl for increasing times, and compared to their levels in the WT. The results are shown in Figure 7a and indicate that while ZATA-1 expression was slightly but significantly higher in strf1-1 than in the WT, the addition of salt progressively reduced this difference, which was completely lost after 6 hours of incubation (Figure 7a). A similar expression profile was observed for the AtRab7 gene. These results indicate that loss of STRF1 affects the expression of ZATA-1 and AtRab7 under standard growth condition, but not at the last stage of salt treatment. On the contrary, the expression of SYP61 did not significantly increase upon NaCl treatment in the WT or in strf1-1 (Supplemental Figure S3a). As for PI3K (Supplemental Figure S3b), its expression did not show any significant difference between the WT and strf1-1 in any growth conditions. In order to further clarify STRF1 function in membrane trafficking, we examined the phenotype of Atrab7strf1 double mutant on salt stress (Figure 7b and 7c). Because of the different ecotypes of Atrab7 and strf1 mutants, we adopted the microRNA technology to generate the Atrab7/amiR-STRF1 double mutant in the Atrab7 mutant plants. The results showed that Atrab7/amiR-STRF1 plants are sensitive to salt stress which mimic to Atrab7 mutant plants under same condition. Taken together, these results indicated that STRF1 might regulate the expression level of only a subset of endocytosis and membrane trafficking genes. At least one of possibility is that STRF1 functions in regulating AtRab7 expression to respond to salt stress.
This article is protected by copyright. All rights reserved.
Accepted Article
ROS Production is Inhibited in strf1-1 One of the major effects of many abiotic stresses, including salt, is the development of an oxidative stress and the production of Reactive Oxygen Species (ROS) (Apel and Hirt, 2004). It has been demonstrated that some membrane trafficking genes, which are also involved in salt stress response, can cause changes in ROS production. For example, AtRab7 overexpression in Arabidopsis leads to increased tolerance to salt stress and to reduced ROS accumulation, while PI3K was shown to coordinate the production of ROS that occurs during salt stress (Leshem et al., 2007; Mazel et al., 2004). The salt tolerant phenotype of strf1-1 prompted us to hypothesize that ROS levels might be altered in this mutant. To verify this hypothesis we monitored H2O2 levels in strf1-1 and WT seedlings by staining the seedlings with 3,3-diaminobenzidine (DAB). The results are reported in Figure8a and show that strf1-1 seedlings produced considerably less ROS if compared with the WT upon NaCl induction, while no detectable difference was observed in seedlings grown in control conditions. High salt is known to induce the expression of the AtRbohD, which encode a membrane-bound NADPH oxidase involved in H2O2 production (Leshem et al., 2007; Xie et al., 2011). Thus, we monitored the levels of AtRbohD expression in strf1-1 and WT seedlings by qRT-PCR (Figure 8b). Our results show that the AtRbohD transcript was significantly down-regulated in the strf1-1 mutant, if compared with the WT, after 2h and 6h of salt treatment. Taken together, these results suggested that STRF1 might be involved in salt-induced ROS production through the regulation of AtRbohD expression.
DISCUSSION
STRF1 is a Plasma Membrane Protein and an Endosomal E3 Ligase The ubiquitin-proteasome system is a widely used mechanism in essentially all plant developmental processes and physiological responses, including the response to abiotic environmental factors (Guo et al., 2013). In the last years ubiquitination has been shown to mediate transmembrane proteins stability, protein-protein interaction, protein activity and intracellular localization. Ubiquitin can indeed function as an internalization signal that can direct the substrate to specific endocytic/sorting compartments, followed by recycling to the plasma membrane or degradation in the lysosome (d'Azzo et al., 2005).
This article is protected by copyright. All rights reserved.
Accepted Article
In this work we have reported the identification of an unknown RING finger E3 ligase, STRF1, which associates with the cellular membrane, mediates endocytosis and is necessary for the proper plant response to salt stress. STRF1 belongs to the Arabidopsis ATL (Arabidopsis Toxicos en Levadura) gene family, whose members, if overexpressed in yeast, cause a conditional lethal phenotype (Aguilar-Henonin et al., 2006). The ATL protein family from Arabidopsis contains 80 members, all characterized by the presence of a conserved RING-H2 type finger, which has been shown to be active for ATL31, ATL9 and EL5 (Berrocal-Lobo et al., 2010; Koiwai et al., 2007; Nishizawa et al., 2008; Sato et al., 2009; Serrano et al., 2006). Some ATL members have been also functionally characterized and shown to play a role in diverse plant processes ranging from plant defense (ATL2 and ATL9; (Berrocal-Lobo et al., 2010; Serrano and Guzman, 2004)), to carbon/nitrogen response for growth phase transition (ATL31; (Sato et al., 2009)), to ABA sensitivity (ATL43; (Serrano et al., 2006)). This, together with the function and enzymatic activity that we report here for STRF1, suggests that the ATL family, although sharing similar domains and biochemical function, might have diverged functionally during evolution. Our subcellular localization studies demonstrate that STRF1 associates not only with the plasma membrane, as suggested by the presence of a transmembrane domain in its sequence, but also with endosomes and with the Golgi and PVC compartments (Figure 4b; Figure 5a-c). This indicates that STRF1 may function as a membrane trafficking-related E3 ligase in vivo. Indeed, other RING E3 ligases similar to STRF1 location have been identified in mammals. They include, among others, Tal1, which mediates Tsg101 ubiquitination and cargo sorting into vesicles (Amit et al., 2004) and RNF13, which localizes to the endosome membrane, and may take part in the ubiquitin-mediated endosome/lysosome recycling system (Bocock et al., 2009; Bocock et al., 2010; Bocock et al., 2011). Until now, only one E3 ligase from Arabidopsis, KEG (KEEP ON GOING), has been reported to localize to the TGN/EE, and to regulate endocytic trafficking and/or the formation of signaling complexes on TGN/EE vesicles during stress responses (Gu and Innes, 2011). STRF1 might be involved in a similar non-proteasome recycling system or function directly within the UPS pathway. More work will be required to address these hypotheses.
STRF1 Participates in Salt Stress Response By Regulating Membrane Trafficking and ROS Production The phenotype of STRF1 loss of function and gain of function transgenic lines indicate that STRF1 mediates the response to salt stress. Our results further suggest that STRF1 mediate both components –ionic and osmotic- of the salt stress response
This article is protected by copyright. All rights reserved.
Accepted Article
(Figure 1d and 2a). STRF1 might affect both components of the salt stress response because of its function in membrane trafficking. The topic about the relationship between membrane trafficking and salt stress is becoming attractive. For example, TNO1 (for TGN-localized SYP41-interacting protein) is involved in vacuolar trafficking, and tno1 mutant showed sensitive to high concentration of NaCl, KCl, LiCl and mannitol ((Kim and Bassham, 2011). EHD1 (EH domain containing proteins) possess salt tolerance by function in endosomal trafficking (Bar et al., 2013). Recently, works by Hao H et al. further indicated that salt stress stimulate RbohD endocytosis by dual-color fluorescence cross-correlation spectroscopy analysis (Hao et al., 2014). All these indicated that salt stress could increase endocytosis in Arabidopsis. Analysis of general membrane endocytosis in strf1-1 seedlings revealed higher uptake of the membrane dye FM4-64 in roots, especially in presence of high salt and mannitol concentrations (Figure 6a-d). This higher uptake might reflect increased endocytosis in plants that lack the STRF1 gene. We then used a membrane protein trafficking inhibitor agent, BFA, to treat the strf1-1 mutant plants. As expected, the BFA compartments were increased in strf1-1 mutant plants (Figure 6e and 6f). STRF1 function in endocytosis and membrane trafficking is also confirmed by the expression profile of several genes involved in membrane trafficking and known to respond to salt stress (Figure 7a). In particular, the expression level of one gene, AtRab7 is nearly 1.5 fold in the strf1-1 mutant, if compared with the WT and in absence of NaCl treatment. Mazel et al. (Mazel et al., 2004) had reported that AtRab7 overexpression, similarly to the strf1-1 mutation, can accelerate endocytosis in roots, leaves, and protoplasts in Arabidopsis. In addition, the AtRab7 overexpressor, similar to strf11 mutant, produces less ROS if compared with WT. We can therefore speculate that STRF1 may control endocytosis by regulating AtRab7 expression and function. We have also shown that STRF1 affects the expression of another gene, AtRbohD, which encodes a NADPH oxidase involved in ROS production. Indeed, AtRbohD expression was decreased of about 1.5 fold in the strf1-1 mutant if compared with the WT. Future experiments should address if STRF1 has a direct or indirect role in the regulation of the expression of these genes, and whether this can account, at least in part, for the phenotype of the strf1-1 mutant. A clear and complete picture of the role membrane trafficking in salt stress response is still missing. Some reports have shown that ROS production and salt stress signal transduction may also be involved in regulating membrane trafficking (Leshem et al., 2006; Leshem et al., 2007; Mazel et al., 2004). Our results also support this conclusion; clearly, the future discovery of other STRF1 interacting proteins as well as the future identification of STRF1 substrate(s) will be needed in order to shed light on the role of this ubiquitin ligase in membrane trafficking and salt stress response.
This article is protected by copyright. All rights reserved.
Accepted Article
EXPERIMENTAL PROCEDURES
Plant Materials and Growth Conditions The Arabidopsis thaliana ecotype Landsberg erecta (Ler) was used for this study. Seeds were surface sterilized with 10% bleach and washed four times with sterile water. Sterile seeds were suspended in 0.2% agarose, plated on 1/2 MS contain 1.5% sucrose, stratified in darkness for 4 days at 4°C and then transferred to a tissue culture room at 22°C under a 16-h-light/8-h-dark photoperiod. After 2 weeks, seedlings were potted in soil and placed in a growth chamber at 22°C and 70% humidity under a 16-h-light/8-h-dark photoperiod. The 1/2 MS medium was supplemented with 1.5% sucrose and NaCl, if required. For germination assays, seeds were collected at the same time, stratified and grown as indicated above and germination rate was scored every 12 hours.
Plant Constructs To produce 35S-STRF1-MYC plants, a 927-bp BamHI - EcoRI fragment containing the STRF1 cDNA was cloned into the vector pCambia1300-221-MYC which has been previously constructed by our laboratory (Zhang et al., 2007a), in which transgenic expression is under the control of the CaMV 35S promoter and the coding region of STRF1 is fused translational to six repetitions of the MYC epitope. To produce Col 0/amiR-STRF1-14, Atrab7/amiR-STRF1-7 plants, we adopted microRNA technology to knockdown STRF1 expression in Col 0 and Atrab7. The Arabidopsis pre-miR159a (Niu et al., 2006) sequence was used as a template for the construction of amiRNAs. The mature miR159 sequence was replaced with the designed amiRNA primers amiR-STRF1-1 (5/AGATCTTGATCTGACGATGGAAGGCGGGTCAATGTCTGTCAAAACATGAGTTGAGCAGGGTA-3/) and amiRSTRF1-2 (5/-GGCGGGTCAATGAGTGTCAAAA GAAGAGTAAAAGCCATTA-3/). The primer 1 contains the BglII site (in istalic) and the amiRNA* sequence (underlined). The primer 2 contains the mature amiRNA sequence (underlined). The PCR product was ligated into the pEASYBlunt vector and sub-cloned into the plant binary vector pCAMBIA1300-221 vector with the BglII/SpeI (which is in the pEASY-Blunt vector ) digested to generate the pCAMBIA-pre-amiRNA, in which pre-amiRNA is placed downstream of a 35S promoter. For transient expression in tobacco epidermal cells, a STRF1-GFP gene fusion was constructed under the control of 35S promoter in the pCAMBIA1300-221-GFP vector which has been previously constructed in our laboratory (Liu et al., 2011). In detail, a XhoI-STRF1-KpnI cDNA was obtained by amplification of the native cDNA with a STRF1-specific forward primer containing XhoI recognition
This article is protected by copyright. All rights reserved.
Accepted Article
site (STRF1 XhoI Fw) and a reverse primer containing a KpnI recognition site (STRF1 KpnI Rev), and cloned upstream of the GFP coding sequence in the pCAMBIA1300-221-GFP vector. Primers sequences are listed in Table S1.
Plant Transformation Arabidopsis transformation was performed by the vacuum infiltration method (Bechtold and Pelletier, 1998) using the Agrobacterium tumefaciens strain GV3101. T1 and T2 seeds were selected on 20 µg/mL hygromycin, and the T2 plants were transferred to soil to obtain homozygous T3 seeds. For the phenotypical analysis, one homozygous line (T3 or T4 generation) was used. The agroinfiltration procedure was performed as described by Liu et al. (2010). Two days after agroinfiltration, the leaves were observed under a confocal microscope (Leica). For Arabidopsis protoplast transformation, mesophyll protoplasts were isolated from 4-week-old rosette leaves and co-transfected with pGFP2-STRF1-GFP and different endomembrane organelle markers, as previously described (Chen et al., 2010). Transfected cells were kept in the dark at room temperature overnight, and observed the following day under a confocal microscope (Leica).
FM4-64 Staining Tobacco leaves and Arabidopsis seedling roots were stained with FM4-64 (Invitrogen) as described in (Leshem et al., 2007; Mazel et al., 2004). Briefly, tobacco leaves agroinfiltrated with STRF1-GFP were cut in small fragments, incubated in a medium containing 5µg/ml FM4-64 for 40 min, rinsed with water for several times and observed under a confocal microscope (Leica). Arabidopsis roots were prepared from 5-day-old seedlings that were rinsed with sterile water, incubated in a liquid medium with or without 200 mM NaCl for 40 min and dipped in a medium containing 2µM FM4-64 for 15 min. The degree of endocytosis was quantified by analyzing cytosolic FM4-64 fluorescence in confocal images of single cells, after converting the fluorescence intensity from individual confocal sections to gray-scale images.
BFA treatment Arabidopsis roots were prepared from 5-day-old seedlings that were briefly washed and incubated in 50μM BFA and 5μg/ml FM4-64 for 30 min. The BFA compartments were counted in confocal images of single cells.
This article is protected by copyright. All rights reserved.
Accepted Article
RT-PCR and qRT-PCR DNase I-treated total RNA (10µg) was denatured and subjected to reverse transcription reaction at 75°C for 15 min followed by 42°C for 1 h. STRF1 amplification was performed using STRF1-specific primers (STRF1 RT Fw and Rev). The following genes: ZATA-1 (At1g60970), AtSYP61 (At1g28490), AtRab7 (At1g49300), PI3K (At1g60490), AtRbohD (At5g47910) were also amplified with gene specific primers listed in Table S1. ACTIN-1 was used as an internal control. Experiments were repeated two times, each in three analytical repeats.
E3 Ubiquitin Ligase Activity Assay The STRF1 cDNA sequence (927bp) was cloned into the pMAL-c2 vector (New England Biolabs, Beverly, MA), expressed in E. coli as a fusion with a maltose binding protein (STRF1-MBP) and purified according to the manufacturer’s instructions. Crude extracts containing recombinant wheat E1 (GI: 136632), human E2 (UBCh5b) (~40ng), STRF1-MBP (~1µg), and ~2µg of purified His-tag Arabidopsis ubiquitin (UBC14, At4g0289) were used for the ubiquitin ligase activity assay as described by Zhang et al. and Zhao et al. (Zhang et al., 2007a; Zhao et al., 2013).
Protein Extraction and Immunoblot Analyses Subcellular fractionation was carried out from STRF1-GFP agroinfiltrated tobacco leaves as previously described (Sato et al., 2009). Proteins extracts were separated by SDS/PAGE, and analyzed by immunoblot. His-tagged ubiquitin was detected by an Ub antibody ((Liu et al., 2010)); STRF1-MBP was visualized by chemiluminescence as instructed by the manufacturer (New England Biolabs).
In vivo Detection of H2O2 The accumulation of H2O2 in plants upon salt treatment was detected by DAB (3, 3Diaminobenzidine) staining as described by Liu et al. (2011). Briefly, 14-day-old WT and strf1-1 seedlings were first incubated in with liquid medium for 1 day, followed by incubation in liquid medium containing 200 mM NaCl for different times. The true leaves were cut off and dipped in 1mg/ml DAB (pH 3.8) for 8h at 25°C in the light. The reaction was terminated by immersion of the leaves in a de-staining solution (20% acetic acid, 20% glycerol and 60% ethanol) and boiled for 3-10’. The leaves were observed under an optical microscope (Zeiss Imager A1).
This article is protected by copyright. All rights reserved.
Accepted Article
ACKNOWLEDGEMENTS
We thank Prof. Yihua Zhou for Man 49-mCherry, mRFP-SYP61 and mRFP-VSR2 plasmids, Dr. Nam Hai Chua for the pGFP2 vector. This research was supported by grant 973 Program 2011CB915402 from the National Basic Research Program of China and NSFC 91317308/31300221 from the National Science Foundation of China and also the state key laboratory of plant Genomics.
SUPPORTING INFORMATION Figure S1. The phenotype of ox-STRF1-GFP on salt stress. Figure S2. Internalization of the FM4-64 Dye in ox-STRF1-1 plants. Figure S3. Lack of STRF1 Does not Affect the Expression of the Membrane Trafficking Genes SYP61 and PI3K. Table S1. List of gene-specific primers used in this work.
REFERENCES
Agarwal, P.K., Agarwal, P., Jain, P., Jha, B., Reddy, M.K. and Sopory, S.K. (2008) Constitutive overexpression of a stress-inducible small GTP-binding protein PgRab7 from Pennisetum glaucum enhances abiotic stress tolerance in transgenic tobacco. Plant Cell Rep, 27, 105-115. Aguilar-Henonin, L., Bravo, J. and Guzman, P. (2006) Genetic interactions of a putative Arabidopsis thaliana ubiquitin-ligase with components of the Saccharomyces cerevisiae ubiquitination machinery. Curr Genet, 50, 257-268. Amit, I., Yakir, L., Katz, M., Zwang, Y., Marmor, M.D., Citri, A., Shtiegman, K., Alroy, I., Tuvia, S., Reiss, Y., Roubini, E., Cohen, M., Wides, R., Bacharach, E., Schubert, U. and Yarden, Y. (2004) Tal, a Tsg101-specific E3 ubiquitin ligase, regulates receptor endocytosis and retrovirus budding. Genes Dev, 18, 1737-1752. Apel, K. and Hirt, H. (2004) Reactive oxygen species: metabolism, oxidative stress, and signal transduction. Annu Rev Plant Biol, 55, 373-399. Bar, M., Leibman, M., Schuster, S., Pitzhadza, H. and Avni, A. (2013) EHD1 functions in endosomal recycling and confers salt tolerance. PLoS One, 8, e54533.
This article is protected by copyright. All rights reserved.
Accepted Article
Bassham, D.C. and Blatt, M.R. (2008) SNAREs: cogs and coordinators in signaling and development. Plant Physiol, 147, 1504-1515. Bechtold, N. and Pelletier, G. (1998) In planta Agrobacterium-mediated transformation of adult Arabidopsis thaliana plants by vacuum infiltration. Methods Mol Biol, 82, 259-266. Berrocal-Lobo, M., Stone, S., Yang, X., Antico, J., Callis, J., Ramonell, K.M. and Somerville, S. (2010) ATL9, a RING Zinc Finger Protein with E3 Ubiquitin Ligase Activity Implicated in Chitin- and NADPH Oxidase-Mediated Defense Responses. PLoS One, 5, e14426. Bocock, J.P., Carmicle, S., Chhotani, S., Ruffolo, M.R., Chu, H. and Erickson, A.H. (2009) The PA-TMRING protein RING finger protein 13 is an endosomal integral membrane E3 ubiquitin ligase whose RING finger domain is released to the cytoplasm by proteolysis. Febs J, 276, 18601877. Bocock, J.P., Carmicle, S., Madamba, E. and Erickson, A.H. (2010) Nuclear targeting of an endosomal E3 ubiquitin ligase. Traffic, 11, 756-766. Bocock, J.P., Carmicle, S., Sircar, M. and Erickson, A.H. (2011) Trafficking and proteolytic processing of RNF13, a model PA-TM-RING family endosomal membrane ubiquitin ligase. Febs J, 278, 69-77. Bu, Q., Li, H., Zhao, Q., Jiang, H., Zhai, Q., Zhang, J., Wu, X., Sun, J., Xie, Q., Wang, D. and Li, C. (2009) The Arabidopsis RING finger E3 ligase RHA2a is a novel positive regulator of abscisic acid signaling during seed germination and early seedling development. Plant Physiol, 150, 463-481. Chen, H., Zhang, Z., Teng, K., Lai, J., Zhang, Y., Huang, Y., Li, Y., Liang, L., Wang, Y., Chu, C., Guo, H. and Xie, Q. (2010) Up-regulation of LSB1/GDU3 affects geminivirus infection by activating the salicylic acid pathway. Plant J, 62, 12-23. d'Azzo, A., Bongiovanni, A. and Nastasi, T. (2005) E3 ubiquitin ligases as regulators of membrane protein trafficking and degradation. Traffic, 6, 429-441. Dong, C.H., Agarwal, M., Zhang, Y., Xie, Q. and Zhu, J.K. (2006) The negative regulator of plant cold responses, HOS1, is a RING E3 ligase that mediates the ubiquitination and degradation of ICE1. Proc Natl Acad Sci U S A, 103, 8281-8286. Ebine, K., Okatani, Y., Uemura, T., Goh, T., Shoda, K., Niihama, M., Morita, M.T., Spitzer, C., Otegui, M.S., Nakano, A. and Ueda, T. (2008) A SNARE complex unique to seed plants is required for protein storage vacuole biogenesis and seed development of Arabidopsis thaliana. Plant Cell, 20, 3006-3021. George, S. and Parida, A. (2010) Over-expression of a Rab family GTPase from phreatophyte Prosopis juliflora confers tolerance to salt stress on transgenic tobacco. Mol Biol Rep.
This article is protected by copyright. All rights reserved.
Accepted Article
Grefen, C. and Blatt, M.R. (2008) SNAREs--molecular governors in signalling and development. Curr Opin Plant Biol, 11, 600-609. Gu, Y. and Innes, R.W. (2011) The KEEP ON GOING protein of Arabidopsis recruits the ENHANCED DISEASE RESISTANCE1 protein to trans-Golgi network/early endosome vesicles. Plant Physiol, 155, 1827-1838. Guo, L., Nezames, C.D., Sheng, L., Deng, X. and Wei, N. (2013) Cullin-RING ubiquitin ligase family in plant abiotic stress pathways(F). J Integr Plant Biol, 55, 21-30. Hao, H., Fan, L., Chen, T., Li, R., Li, X., He, Q., Botella, M.A. and Lin, J. (2014) Clathrin and Membrane Microdomains Cooperatively Regulate RbohD Dynamics and Activity in Arabidopsis. Plant Cell, 26, 1729-1745. Hasegawa, P.M., Bressan, R.A., Zhu, J.K. and Bohnert, H.J. (2000) Plant Cellular and Molecular Responses to High Salinity. Annu Rev Plant Physiol Plant Mol Biol, 51, 463-499. Jelinkova, A., Malinska, K., Simon, S., Kleine-Vehn, J., Parezova, M., Pejchar, P., Kubes, M., Martinec, J., Friml, J., Zazimalova, E. and Petrasek, J. (2010) Probing plant membranes with FM dyes: tracking, dragging or blocking? Plant J, 61, 883-892. Kim, S.G. and Park, C.M. (2007) Membrane-mediated salt stress signaling in flowering time control. Plant Signal Behav, 2, 517-518. Kim, S.J. and Bassham, D.C. (2011) TNO1 is involved in salt tolerance and vacuolar trafficking in Arabidopsis. Plant Physiol, 156, 514-526. Koiwai, H., Tagiri, A., Katoh, S., Katoh, E., Ichikawa, H., Minami, E. and Nishizawa, Y. (2007) RINGH2 type ubiquitin ligase EL5 is involved in root development through the maintenance of cell viability in rice. Plant J, 51, 92-104. Lee, J.H. and Kim, W.T. (2011) Regulation of abiotic stress signal transduction by E3 ubiquitin ligases in Arabidopsis. Mol Cells, 31, 201-208. Leshem, Y., Melamed-Book, N., Cagnac, O., Ronen, G., Nishri, Y., Solomon, M., Cohen, G. and Levine, A. (2006) Suppression of Arabidopsis vesicle-SNARE expression inhibited fusion of H2O2-containing vesicles with tonoplast and increased salt tolerance. Proc Natl Acad Sci U S A, 103, 18008-18013. Leshem, Y., Seri, L. and Levine, A. (2007) Induction of phosphatidylinositol 3-kinase-mediated endocytosis by salt stress leads to intracellular production of reactive oxygen species and salt tolerance. Plant J, 51, 185-197. Leyman, B., Geelen, D., Quintero, F.J. and Blatt, M.R. (1999) A tobacco syntaxin with a role in hormonal control of guard cell ion channels. Science, 283, 537-540.
This article is protected by copyright. All rights reserved.
Accepted Article
Li, H., Jiang, H., Bu, Q., Zhao, Q., Sun, J., Xie, Q. and Li, C. (2011) The Arabidopsis RING finger E3 ligase RHA2b acts additively with RHA2a in regulating abscisic acid signaling and drought response. Plant Physiol, 156, 550-563. Liu, L., Cui, F., Li, Q., Yin, B., Zhang, H., Lin, B., Wu, Y., Xia, R., Tang, S. and Xie, Q. (2011) The endoplasmic reticulum-associated degradation is necessary for plant salt tolerance. Cell Res, 21, 957-969. Liu, L., Zhang, Y., Tang, S., Zhao, Q., Zhang, Z., Zhang, H., Dong, L., Guo, H. and Xie, Q. (2010) An efficient system to detect protein ubiquitination by agroinfiltration in Nicotiana benthamiana. Plant J, 61, 893-903. Mahajan, S., Pandey, G.K. and Tuteja, N. (2008) Calcium- and salt-stress signaling in plants: shedding light on SOS pathway. Arch Biochem Biophys, 471, 146-158. Mahajan, S. and Tuteja, N. (2005) Cold, salinity and drought stresses: an overview. Arch Biochem Biophys, 444, 139-158. Mazel, A., Leshem, Y., Tiwari, B.S. and Levine, A. (2004) Induction of salt and osmotic stress tolerance by overexpression of an intracellular vesicle trafficking protein AtRab7 (AtRabG3e). Plant Physiol, 134, 118-128. Miao, Y., Li, K.Y., Li, H.Y., Yao, X. and Jiang, L. (2008) The vacuolar transport of aleurain-GFP and 2S albumin-GFP fusions is mediated by the same pre-vacuolar compartments in tobacco BY-2 and Arabidopsis suspension cultured cells. Plant J, 56, 824-839. Nishizawa, Y., Katoh, S., Koiwai, H. and Katoh, E. (2008) EL5 is involved in root development as an anti-cell death ubiquitin ligase. Plant Signal Behav, 3, 148-150. Niu, Q.W., Lin, S.S., Reyes, J.L., Chen, K.C., Wu, H.W., Yeh, S.D. and Chua, N.H. (2006) Expression of artificial microRNAs in transgenic Arabidopsis thaliana confers virus resistance. Nat Biotechnol, 24, 1420-1428. Oh, D.H., Lee, S.Y., Bressan, R.A., Yun, D.J. and Bohnert, H.J. (2010) Intracellular consequences of SOS1 deficiency during salt stress. J Exp Bot, 61, 1205-1213. Parinov, S., Sevugan, M., Ye, D., Yang, W.C., Kumaran, M. and Sundaresan, V. (1999) Analysis of flanking sequences from dissociation insertion lines: a database for reverse genetics in Arabidopsis. Plant Cell, 11, 2263-2270. Park, G.G., Park, J.J., Yoon, J., Yu, S.N. and An, G. (2010) A RING finger E3 ligase gene, Oryza sativa Delayed Seed Germination 1 (OsDSG1), controls seed germination and stress responses in rice. Plant Mol Biol, 74, 467-478. Park, K.Y., Jung, J.Y., Park, J., Hwang, J.U., Kim, Y.W., Hwang, I. and Lee, Y. (2003) A role for phosphatidylinositol 3-phosphate in abscisic acid-induced reactive oxygen species generation in guard cells. Plant Physiol, 132, 92-98.
This article is protected by copyright. All rights reserved.
Accepted Article
Rutherford, S. and Moore, I. (2002) The Arabidopsis Rab GTPase family: another enigma variation. Curr Opin Plant Biol, 5, 518-528. Sanderfoot, A.A., Kovaleva, V., Bassham, D.C. and Raikhel, N.V. (2001) Interactions between syntaxins identify at least five SNARE complexes within the Golgi/prevacuolar system of the Arabidopsis cell. Mol Biol Cell, 12, 3733-3743. Sato, T., Maekawa, S., Yasuda, S., Sonoda, Y., Katoh, E., Ichikawa, T., Nakazawa, M., Seki, M., Shinozaki, K., Matsui, M., Goto, D.B., Ikeda, A. and Yamaguchi, J. (2009) CNI1/ATL31, a RING-type ubiquitin ligase that functions in the carbon/nitrogen response for growth phase transition in Arabidopsis seedlings. Plant J, 60, 852-864. Serrano, M. and Guzman, P. (2004) Isolation and gene expression analysis of Arabidopsis thaliana mutants with constitutive expression of ATL2, an early elicitor-response RING-H2 zinc-finger gene. Genetics, 167, 919-929. Serrano, M., Parra, S., Alcaraz, L.D. and Guzman, P. (2006) The ATL gene family from Arabidopsis thaliana and Oryza sativa comprises a large number of putative ubiquitin ligases of the RINGH2 type. J Mol Evol, 62, 434-445. Shirakawa, M., Ueda, H., Shimada, T., Koumoto, Y., Shimada, T.L., Kondo, M., Takahashi, T., Okuyama, Y., Nishimura, M. and Hara-Nishimura, I. (2010) Arabidopsis Qa-SNARE SYP2 proteins localized to different subcellular regions function redundantly in vacuolar protein sorting and plant development. Plant J, 64, 924-935. Silva, P.A., Ul-Rehman, R., Rato, C., Di Sansebastiano, G.P. and Malho, R. (2010) Asymmetric localization of Arabidopsis SYP124 syntaxin at the pollen tube apical and sub-apical zones is involved in tip growth. BMC Plant Biol, 10, 179. Sokolovski, S., Hills, A., Gay, R.A. and Blatt, M.R. (2008) Functional interaction of the SNARE protein NtSyp121 in Ca2+ channel gating, Ca2+ transients and ABA signalling of stomatal guard cells. Mol Plant, 1, 347-358. Uemura, T., Ueda, T., Ohniwa, R.L., Nakano, A., Takeyasu, K. and Sato, M.H. (2004) Systematic analysis of SNARE molecules in Arabidopsis: dissection of the post-Golgi network in plant cells. Cell Struct Funct, 29, 49-65. Vida, T.A. and Emr, S.D. (1995) A new vital stain for visualizing vacuolar membrane dynamics and endocytosis in yeast. J Cell Biol, 128, 779-792. Woollard, A.A. and Moore, I. (2008) The functions of Rab GTPases in plant membrane traffic. Curr Opin Plant Biol, 11, 610-619. Xie, Y.J., Xu, S., Han, B., Wu, M.Z., Yuan, X.X., Han, Y., Gu, Q., Xu, D.K., Yang, Q. and Shen, W.B. (2011) Evidence of Arabidopsis salt acclimation induced by up-regulation of HY1 and the regulatory role of RbohD-derived reactive oxygen species synthesis. Plant J, 66, 280-292.
This article is protected by copyright. All rights reserved.
Accepted Article
Xiong, G., Li, R., Qian, Q., Song, X., Liu, X., Yu, Y., Zeng, D., Wan, J., Li, J. and Zhou, Y. (2010) The rice dynamin-related protein DRP2B mediates membrane trafficking, and thereby plays a critical role in secondary cell wall cellulose biosynthesis. Plant J, 64, 56-70. Xiong, L., Schumaker, K.S. and Zhu, J.K. (2002) Cell signaling during cold, drought, and salt stress. Plant Cell, 14 Suppl, S165-183. Zhang, Y., Yang, C., Li, Y., Zheng, N., Chen, H., Zhao, Q., Gao, T., Guo, H. and Xie, Q. (2007a) SDIR1 is a RING finger E3 ligase that positively regulates stress-responsive abscisic acid signaling in Arabidopsis. Plant Cell, 19, 1912-1929. Zhang, Z., Feechan, A., Pedersen, C., Newman, M.A., Qiu, J.L., Olesen, K.L. and ThordalChristensen, H. (2007b) A SNARE-protein has opposing functions in penetration resistance and defence signalling pathways. Plant J, 49, 302-312. Zhao, Q., Tian, M., Li, Q., Cui, F., Liu, L., Yin, B. and Xie, Q. (2013) A plant-specific in vitro ubiquitination analysis system. Plant J, 74, 524-533. Zhu, J., Gong, Z., Zhang, C., Song, C.P., Damsz, B., Inan, G., Koiwa, H., Zhu, J.K., Hasegawa, P.M. and Bressan, R.A. (2002) OSM1/SYP61: a syntaxin protein in Arabidopsis controls abscisic acidmediated and non-abscisic acid-mediated responses to abiotic stress. Plant Cell, 14, 30093028. Zhu, J.K. (2002) Salt and drought stress signal transduction in plants. Annu Rev Plant Biol, 53, 247273. Zouhar, J., Rojo, E. and Bassham, D.C. (2009) AtVPS45 is a positive regulator of the SYP41/SYP61/VTI12 SNARE complex involved in trafficking of vacuolar cargo. Plant Physiol, 149, 1668-1678.
This article is protected by copyright. All rights reserved.
Accepted Article
FIGURE LEGENDS
Figure1. STRF1 is a RING-H2 type regulator of salt response. (a) Genomic structure of the STRF1 locus and position of the Ds element in the strf1-1 mutant. STRF1 RT Fw and RT Rev are primers used for the RT-PCR analysis. (b) Protein domains arrangement of the full-length STRF1 protein. TM, transmembrane domain; RING, RING finger domain. (c) RT-PCR analysis of STRF1 transcript levels in seedlings from the wild-type (WT, Ler ecotype), strf1-1 and ox-STRF1-1 overexpressor (in the strf1-1 background). The ACTIN1 mRNA was used as a control. The primer pairs used for RT-PCR reaction are shown in Figure 1(a). (d) Phenotype of WT, strf1-1 and ox-STRF1-1 seedlings grown on ½ MS with (top) or without (bottom) 150 mM NaCl for 10 days. (e) Germination rate of WT, strf1-1 and ox-STRF1-1 seedlings grown on ½ MS with or without 150 mM NaCl. The values of means ±SD (n=108) are shown. Experiments were run in triplicates; a typical experiment is shown. *p-value
