Microbial Pathogenesis 75 (2014) 59e67

Contents lists available at ScienceDirect

Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath

The RND protein is involved in the vulnibactin export system in Vibrio vulnificus M2799 Hiroaki Kawano a, Katsushiro Miyamoto a, Megumi Yasunobe a, Masahiro Murata a, Tomoka Myojin a, Takahiro Tsuchiya a, Tomotaka Tanabe b, Tatsuya Funahashi b, Takaji Sato c, Takashi Azuma c, Yoshiki Mino c, Hiroshi Tsujibo a, * a b c

Department of Microbiology, Osaka University of Pharmaceutical Sciences, 4-20-1 Nasahara, Takatsuki, Osaka 569-1094, Japan Laboratory of Hygienic Chemistry, College of Pharmaceutical Sciences, Matsuyama University, 4-2 Bunkyo-cho, Matsuyama, Ehime 790-8578, Japan Department of Analytical Chemistry, Osaka University of Pharmaceutical Sciences, 4-20-1 Nasahara, Takatsuki, Osaka 569-1094, Japan

a r t i c l e i n f o

a b s t r a c t

Article history: Received 8 April 2014 Received in revised form 28 August 2014 Accepted 1 September 2014 Available online 6 September 2014

Vibrio vulnificus, an opportunistic marine bacterium that causes a serious, often fatal, infection in humans, requires iron for its pathogenesis. This bacterium exports vulnibactin for iron acquisition from the environment. The mechanisms of vulnibactin biosynthesis and ferric-vulnibactin uptake systems have recently been reported, while the vulnibactin export system has not been reported. Mutant growth under low-iron concentration conditions and a bioassay of the culture supernatant indicate that the VV1_0612 protein plays a crucial role in the vulnibactin secretion as a component of the resistancenodulation-division (RND)-type efflux system in V. vulnificus M2799. To identify which RND protein(s) together with VV1_0612 TolC constituted the RND efflux system for vulnibactin secretion, deletion mutants of 11 RND protein-encoding genes were constructed. The growth inhibition of a multiple mutant (D11) of the RND protein-encoding genes was observed 6 h after the beginning of the culture. Furthermore, DVV1_1681 exhibited a growth curve that was similar to that of D11, while the multiple mutant except DVV1_1681 showed the same growth as the wild-type strain. These results indicate that the VV1_1681 protein is involved in the vulnibactin export system of V. vulnificus M2799. This is the first genetic evidence that vulnibactin is secreted through the RND-type efflux systems in V. vulnificus. © 2014 Elsevier Ltd. All rights reserved.

Keywords: Vibrio vulnificus Vulnibactin secretion RND-type efflux system

1. Introduction Vibrio vulnificus is a gram-negative halophilic marine pathogen associated with human diseases such as septicemia and serious wound infections [1,2]. Septicemia is often acquired by eating raw oysters or shellfish, and wound infections are associated with the exposure of wounds to seawater. Primary septicemia is often associated with patients who have diseases predisposing them to iron overload, such as cirrhosis, hemochromatosis, and alcoholism,

Abbreviations: RND, resistance-nodulation-division; DHBA, 2,3dihydroxybenzoic acid; ICS, isochorismate synthase; VuuB, vulnibactin utilization protein; FatB, a periplasmic ferric-vulnibactin-binding protein; VuuA, ferric-vulnibactin receptor protein; VatD, a periplasmic ferric-aerobactin-binding protein; MFP, membrane fusion protein; LB, Luria-Bertani; HI, heart infusion containing 2% NaCl; EDDA, ethylenediamine-di (o-hydroxyphenylacetic acid); Cm, chloramphenicol; Tet, tetracycline; RT-PCR, reverse transcription-PCR; ABC, ATP-binding cassette; MFS, major facilitator superfamily; Fur, ferric uptake regulator. * Corresponding author. Tel./fax: þ81 72 690 1057. E-mail address: [email protected] (H. Tsujibo). http://dx.doi.org/10.1016/j.micpath.2014.09.001 0882-4010/© 2014 Elsevier Ltd. All rights reserved.

or who are immunocompromised [3]. To date, several potential virulence factors of V. vulnificus, such as metalloprotease [4,5], hemolysin [6], RTX toxin [7e9], capsular polysaccharide [10,11], and iron acquisition factors including a siderophore [12] have been identified. Among the above-mentioned factors, the iron acquisition system is a well-known crucial virulence factor [12]. In our previous report, we showed that V. vulnificus M2799, a clinical isolate, possesses 100-fold higher lethality in mice than an environmental isolate, strain JCM3731 [13]. The cytotoxicity of V. vulnificus M2799 toward various cultured cells was high compared with strain JCM3731 [13]. Iron is an essential micronutrient for almost all life forms, and its acquisition from the environment is vital to bacteria [14]. At physiological pH, iron is rapidly oxidized to the ferric state [Fe(III)] as an insoluble hydroxide. Within human tissues, most iron is tightly bound to high-affinity iron-binding proteins, such as hemoglobin, transferrin, lactoferrin, and ferritin [15]. Because iron availability is limited in the human body, pathogenic bacteria possess intricate mechanisms to scavenge iron from the host.

60

H. Kawano et al. / Microbial Pathogenesis 75 (2014) 59e67

Table 1 Strains and plasmids used in this study. Strain or plasmid Bacterial strains V. vulnificus M2799 DVV2_0029 DVV1_0612 Dics DVV2_1007 DVV1_1079 DVV1_1681 DVV1_3156 DVV2_0029 DVV2_0195 DVV2_0340 DVV2_1320 D2 D3 D4 D5 D6 D7 D8 D9 D10 D11 E. coli SY327lpir SM10lpir Plasmids Gene deletion pDM4 pDdVV1_0612 pDdVV1_1079 pDdVV1_1681 pDdVV1_2874 pDdVV1_3156 pDdVV2_0029 pDdVV2_0195 pDdVV2_0340 pDdVV2_0529 pDdVV2_0852 pDdVV2_0928 pDdVV2_1007 pDdVV2_1320 Complementation pRK415 pRVV1_0612

Description

Reference

Clinical isolate; virulent M2799DVV2_0029 M2799DVV1_0612 M2799Dics (DVV2_0835) M2799DVV2_1007 M2799DVV1_1079 M2799DVV1_1681 M2799DVV1_3156 M2799DVV2_0029 M2799DVV2_0195 M2799DVV2_0340 M2799DVV2_1320 DVV2_0340, DVV2_0529 DVV2_0340, DVV2_0529, DVV2_1320 DVV2_0340, DVV2_0529, DVV2_1320, DVV2_0340, DVV2_0529, DVV2_1320, DVV2_0340, DVV2_0529, DVV2_1320, DVV2_0340, DVV2_0529, DVV2_1320, DVV2_0340, DVV2_0529, DVV2_1320, DVV2_0340, DVV2_0529, DVV2_1320, DVV2_0340, DVV2_0529, DVV2_1320, DVV2_0340, DVV2_0529, DVV2_1320, DVV1_1681

e This This [20] This This This This This This This This This This This This This This This This This This

DVV2_0195 DVV2_0195, DVV2_0928 DVV2_0195, DVV2_0928, DVV2_0029 DVV2_0195, DVV2_0928, DVV2_0029, DVV1_1079 DVV2_0195, DVV2_0928, DVV2_0029, DVV1_1079, DVV1_3156 DVV2_0195, DVV2_0928, DVV2_0029, DVV1_1079, DVV1_3156, DVV1_2874 DVV2_0195, DVV2_0928, DVV2_0029, DVV1_1079, DVV1_3156, DVV1_2874, DVV2_0852 DVV2_0195, DVV2_0928, DVV2_0029, DVV1_1079, DVV1_3156, DVV1_2874, DVV2_0852,

study study study study study study study study study study study study study study study study study study study study

araD D (lac-pro) argE(Am) nalA recA56 lpirR6K thi thr leu tonA lacY supE recA::RP4-2-Tc::Mu lpirR6K; Kmr; conjugal donor

[28] [28]

R6K ori sacB; suicide vector; oriT of RP4; Cmr pDM4 DVV1_0612 fragment; for marker less deletion pDM4 DVV1_1079 fragment; for marker less deletion pDM4 DVV1_1681 fragment; for marker less deletion pDM4 DVV1_2874 fragment; for marker less deletion pDM4 DVV1_3156 fragment; for marker less deletion pDM4 DVV1_0029 fragment; for marker less deletion pDM4 DVV1_0195 fragment; for marker less deletion pDM4 DVV1_0340 fragment; for marker less deletion pDM4 DVV2_0529 fragment; for marker less deletion pDM4 DVV2_0852 fragment; for marker less deletion pDM4 DVV2_0928 fragment; for marker less deletion pDM4 DVV2_1007 fragment; for marker less deletion pDM4 DVV2_1320 fragment; for marker less deletion

[29] This This This This This This This This This This This This This

Broad-host-range plasmid; Tetr VV1_0612 locus in pRK415

[30] This study

study study study study study study study study study study study study study

Cmr, chloramphenicol resistance; Kmr, kanamycin resistance; Tetr, tetracycline resistance.

V. vulnificus sequesters iron through the biosynthesis and secretion of a low molecular weight compound called siderophore [12,16]. V. vulnificus M2799 produces a catecholate siderophore called vulnibactin [17]. Vulnibactin consists of one residue of 2,3dihydroxybenzoic acid (DHBA), two residues of salicylic acid, and two residues of L-threonine on a norspermidine backbone. Vulnibactin is a siderophore with a structure that is similar to that of vibriobactin from Vibrio cholerae [17,18], except that vulnibactin contains two salicylic acid residues plus one DHBA molecule, whereas vibriobactin contains three DHBA residues. Tan et al. suggested that salicylic acid serves as a scavenger of hydroxyl radicals and plays an important role in the virulence of V. vulnificus [19]. It has been reported that isochorismate synthase (ICS) and isochorismatase were essential for the biosynthesis of vulnibactin [12,20]. Furthermore, the vulnibactin-mediated iron uptake system plays an essential role in the use of transferrin-bound iron and the virulence of V. vulnificus in animal models [12,21]. In our previous report, we used a proteomic approach to study the differential expression of proteins from V. vulnificus M2799 under iron-repleted and low-iron concentration conditions during

the early-, mid-, and late-logarithmic growth phases. A total of 32, 53, and 42 iron-regulated spots were detected by two-dimensional differential gel electrophoresis in the early-, mid-, and latelogarithmic growth phases, respectively [22]. Furthermore, we constructed deletion mutants of the genes encoding the proteins involved in the vulnibactin-mediated iron uptake system, ICS, ferric-vulnibactin utilization protein (VuuB), periplasmic ferricvulnibactinebinding protein (FatB), and ferric-vulnibactin receptor protein (VuuA). The Dics and DvuuA mutants were unable to grow under low-iron concentration conditions compared with the isogenic wild-type strain, indicating that the involvement of ICS in the vulnibactin biosynthesis pathway and uptake of ferricvulnibactin through the VuuA receptor protein are essential for V. vulnificus M2799 growth under low-iron concentration conditions. A similar growth impairment was also observed in DfatB, and the growth recovery of this mutant was observed 6 h after the beginning of the culture. These results indicate that there must be other periplasmic ferric-vulnibactin-binding proteins in V. vulnificus M2799 that complement the defective fatB gene. Complementary growth studies confirmed that VatD protein, which functions as a

H. Kawano et al. / Microbial Pathogenesis 75 (2014) 59e67

periplasmic ferric-aerobactin-binding protein, participated in the ferric-vulnibactin uptake system in the absence of FatB [20]. However, the vulnibactin export system of V. vulnificus remains to be clarified. In Escherichia coli, TolC protein was implicated in the export of newly synthesized enterobactin siderophore across the outer membrane [23]. Resistance nodulation cell division (RND) proteins are a typical type I secretion system of gram-negative bacteria and function as a huge protein complex spanning the inner and outer membrane. The protein complex is composed of an outer membrane channel protein, a membrane fusion protein (MFP), and an RND inner membrane protein. In E. coli, it is known that the major multidrug RND-type efflux system is a TolCeAcrAB complex, which is composed of TolC, AcrA, and AcrB as an outer membrane channel protein, an MFP, and an RND inner membrane protein. There are seven RND proteins (AcrB, AcrD, AcrF, MdtB, MdtC, MdtF, and CusA) in E. coli, whereas only two outer membrane channel proteins, TolC and CusC, have been shown to be responsible for the efflux [24,25]. RND-type efflux complexes such as TolCeAcrAB transport a very broad variety of substances, including antibiotics, dyes, detergents, and heavy metal cations [26,27]. In this study, to identify the genes encoding the proteins involved in the vulnibactin export system, we constructed the mutants of genes encoding the outer membrane channel proteins and their cognate RND proteins. Growth analyses of these mutants were investigated under low-iron concentration conditions. 2. Materials and methods 2.1. Strains, plasmids, media, and growth conditions The bacterial strains and plasmids used in this study are listed in Table 1. The competent E. coli SY327lpir [28] was used for the construction of recombinant plasmids. Plasmids pDM4 [29] and pRK415 [30] were used for gene deletion and complementation analysis, respectively. The recombinant plasmids were subsequently transformed into E. coli SM10lpir [28] possessing conjugal activity to V. vulnificus cells. The suicide plasmid pDM4 was kindly provided by Prof. Debra L. Milton (Department of Molecular Biology, Umea University, Umea, Sweden). E. coli strains were cultured in Luria-Bertani (LB) medium with the appropriate antibiotics. The medium used for the conjugation of V. vulnificus M2799 was LB medium containing 1.5% NaCl. For growth examination and RNA isolation, V. vulnificus M2799 was precultured in a heart infusion broth (Eiken Chemical, Tokyo, Japan) containing 2% NaCl (HI medium) at 37  C and 200 rpm overnight. The culture was diluted 1:100 into fresh broth and then shaken at 37  C at 200 rpm. HI medium with the iron chelator ethylenediamine-di (o-hydroxyphenylacetic acid) (EDDA, Sigma, St. Louis, MO, USA) at a final concentration of 10 mg/ml was used for growth examination under the low-iron concentration condition. To purify vulnibactin, V. vulnificus M2799 was cultured in T medium [17] containing 0.15 mM FeCl3 for 28 h. In the vulnibactin detection test of culture supernatant, 10 mM purified vulnibactin was added to HI medium with EDDA as a control. 2.2. Antibiotics The concentrations of antibiotics for E. coli strains were as follows: chloramphenicol (Cm), 10 mg/ml; and tetracycline (Tet), 15 mg/ ml. The concentrations of antibiotics for the V. vulnificus strains were as follows: Cm, 5 mg/ml; polymyxin B, 100 U/ml; and Tet, 15 mg/ml. When used in the preculture for the complementation

61

analysis, the Tet concentration for the V. vulnificus strains was reduced to 5 mg/ml to maintain growth. 2.3. BLAST search and nucleotide sequencing BLAST search for outer membrane channel proteins was performed based on the amino acid sequence of E. coli TolC, a representative outer membrane channel protein, against the currently available genome sequence of V. vulnificus CMCP6 [31]. Nucleotide sequencing of tolC homologs was carried out by the dideoxy chain termination method employing the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) on a DNA sequencer (ABI Prism 310 Genetic Analyzer, Applied Biosystems). Sequence data were analyzed using the GENETYX-WIN program (Software Development Co., Ltd., Tokyo, Japan). Chromosomal DNA was extracted from the M2799 culture using a Blood & Cell Culture DNA Midi Kit (Qiagen, Hilden, Germany). The PCR primers were designed based on the nucleotide sequences of V. vulnificus CMCP6. The PCR primers (VV1_0612_del_check_F and VV1_0612_del_check_R and VV2_1007_del_check_F and VV2_1007_del_check_R) were synthesized based on VV1_0612 and VV2_1007, respectively (Table 2). PCR amplification was performed by KOD-Plus-DNA polymerase (Toyobo, Osaka, Japan) for 30 cycles consisting of 94  C for 15 s, 55  C for 30 s, and 68  C for 1 min. The 2440 bp and 2100 bp products were amplified and analyzed by direct sequencing. The nucleotide sequence data have been deposited in the DDBJ, EMBL, and GenBank nucleotide sequence databases under the accession numbers AB921202 and AB921203. Similarly, a search for possible RND proteins was performed based on the amino acid sequence of E. coli AcrB. The nucleotide sequences of RND protein-encoding genes were directly referred from CMCP6 genome sequence information. 2.4. Construction of gene-deletion mutants by marker exchange and complementation analysis Plasmid construction, filter mating, and complementation analyses were done as reported previously [20]. The plasmids that were constructed for this study and the details of the deletion mutants are summarized in Table 1. The primers were constructed based on the V. vulnificus CMCP6 genome sequence [31] (Table 2). 2.5. Purification of vulnibactin The purification of vulnibactin from V. vulnificus M2799 culture supernatant was performed according to the method of Okujo et al. with slight modifications [17]. The culture supernatant (2.5 l), adjusted to pH 4.0 with 60% citric acid, was adsorbed onto XAD-7 resin and eluted with 300 ml methanol. The eluant was evaporated and redissolved in 1 ml methanol. The resulting fraction was subjected to HPLC on an ODS column (Cosmosil 5C18 ARII, 10  250 mm, Nacalai Tesque, Kyoto, Japan; 50e100% acetonitrile containing 0.05% trifluoroacetic acid in 20 min; flow rate, 2.0 ml/ min; UV detection at 307 nm) to yield vulnibactin (ca. 1.0 mg). The retention time of vulnibactin by HPLC was 15.0 min. 2.6. Detection of vulnibactin in the culture supernatants using the Dics strain V. vulnificus M2799 (wild-type) and DVV1_0612 were grown in HI medium containing EDDA (HI-EDDA) at 37  C and 200 rpm for 6 h until the optical densities (OD600) reached approximately 0.9. Culture supernatants were separated by centrifugation and filtered

62

H. Kawano et al. / Microbial Pathogenesis 75 (2014) 59e67

Table 2 Primers used in this study. Primer names

Table 2 (continued ) Nucleotide sequencesa (5'-3')

Construction of deletion mutants of tolC homologs VV1_0612_upF GATGCTCGAGTGCTCCGACACGAATTTGTT VV1_0612_upR GGCTACGGATCCCTGCACCAATAAGTAGTG VV1_0612_dnF CAGGCGGATCCTACACTGAGCGAGCAAGAT VV1_0612_dnR ACCGCATGCTTGTTGCCGTGAATACCGATG VV1_0612_del_check_F CCGAAACAAGTTGTCCGACTTCTAGGCCAG VV1_0612_del_check_R ACTAATGGCTGCTTCGACATCCTTCATGCA VV2_1007_upF TTCTGCTCGAGGTTGCTCCCTATCCTGATG VV2_1007_upR ATGGGGATCCCATGGCTGGGCAAACTCAGC VV2_1007_dnF CTCAGGATCCGATCAACTGGAACCAAGTGT VV2_1007_dnR GAGCTGCATGCGGCGTCGCGAAGGAAGGCC VV2_1007_del_check_F GCTGCGACGGAAATGATGTCGTTAGCCGAC VV2_1007_del_check_R TTTGGCGTACACACTTGAGGCTGCTTTCAC Construction of deletion mutants of RND protein homologs VV1_1079_upF TTTGCTCGAGCTTCGCCAAGTCGAACGAGA VV1_1079_upR CTGAGGATCCCCATGATGATGATGAACACC VV1_1079_dnF TTGAGGATCCGCAAGCGCAGCGTAATGAGC VV1_1079_dnR CGCTGCATGCAGTGAGGAGAAGCGTCGCCA VV1_1079_del_check_F GTGAAGTTGCGCTACTCAACAATATTGAAG VV1_1079_del_check_R GCGTAGAGGCTGTTGTCACTTTGTGCTCAC VV1_1681_upF GATGCCCTCGAGCTCGCCAAGCCGAAATTG VV1_1681_upR AAAAGGATCCGGATCGCGAAAGGCTCTCCG VV1_1681_dnF ATGCAGGATCCCCAGTGGAGCATGACTTGG VV1_1681_dnR AAGTGCATGCATCTACAAAAGAAATTGGTC VV1_1681_del_check_F CTACAAAAATTGGTGATTGAAGCCGACGTC VV1_1681_del_check_R CTAACTTTAATCCGCGTCGACTGCATCCCG VV1_2874_upF GCTTCTCGAGCAGCTGTATGTCAATCAGCC VV1_2874_upR TGGTGGATCCCTCATTGTTCGCCTCCTGAG VV1_2874_dnF GTGGCGGATCCGAAATAATTAATCGGCCTA VV1_2874_dnR CTTTAGCATGCTCCGTGACCGCGGGCACTT VV1_2874_del_check_F AATTTGAAAACGTTCAAGTTGGGCAGCAAG VV1_2874_del_check_R CATCAACCATCCCGACCGCTTGCATGAAGG VV1_3156_upF GGGCATTGACTCGAGGATTAACGCCGAAAC VV1_3156_upR CTTTCGGGATCCGGCATCTCGCGCACTGCC VV1_3156_dnF GGCGGGATCCGAAAGCCGCGTCGCTGTTGG VV1_3156_dnR TTTTCGCATGCTTGTCGGGTTTAATCACCC VV1_3156_del_check_F TATGCCTGTGACAGCAACATCCAGCGCTTG VV1_3156_del_check_R CTGCTCTCCACGGGCAACTTAGGGGATACC VV2_0029_upF CAAACTCGAGCCGTGACGCTGGCGTTTACC VV2_0029_upR ACACGGATCCGCTTTGCAATGGTATAGCCA VV2_0029_dnF TTGACGGATCCACCAGAAGCACGAAACACC VV2_0029_dnR CCTAGCATGCTGGCGCTCTTCTTTGGGCGC VV2_0029_del_check_F TGACCTTGAAGCATTACTCCACCCAAGCGG VV2_0029_del_check_R AACCGCGTGACTATAAACCAAGGTGTTTTC VV2_0195_upF TGAACTCGAGCACACAAAGTATGGATTACC VV2_0195_upR ATAAGGATCCAGCTGATGACTTTGTTCTTG VV2_0195_dnF GGCAGGATCCGGTTTCGCGACGGTACTAAC VV2_0195_dnR CGTTGCATGCAAATCTTGGTTACACCTTTG VV2_0195_del_check_F TACGTGCGAATTGAGTTGTCCGACAACGTG VV2_0195_del_check_R CGCGTTACGGTGATATTTACAGTAAAGACG VV2_0340_upF TTTGCTCGAGTGTATATCCCGTTTCCGGGC VV2_0340_upR AGCGGGGATCCGCTGATGGCAACACTTGGT VV2_0340_dnF ACGCGGATCCCAGCAAGTATCCAATCCCCG VV2_0340_dnR CAACAAAGCATGCCCAGGCATCACACCAAT VV2_0340_del_check_F CTGTTGCGCAAGCGAAAGAATCTCTCGGTT VV2_0340_del_check_R CGAACACTCCGACTTGAAAGCCAAGCACTG VV2_0529_upF AACGCTCGAGAGAACATGATCTACATGTCG VV2_0529_upR CCCTTTGGATCCTAGGTTGAACTGAACTTC VV2_0529_dnF CCTCTGGATCCATGGTGCCACTCAGTACAC VV2_0529_dnR GCCACCTGCATGCCTTCCCTTTGCTGCTTG VV2_0529_del_check_F TACCGCATTCAGCATTAGCGAGCGTGAGCG VV2_0529_del_check_R TGCGGATGAAGTTCGTGCTCTAGCCAGCCG VV2_0852_upF CGCCCCTCGAGGCGCTTCCCGATCTCTCTG VV2_0852_upR TTGCTGGATCCTTAAGTTGTAAGCACGCAA VV2_0852_dnF CCCAGTCAGGATCCCAGTGCTAACGGTGAT VV2_0852_dnR GCTGGCATGCCAACGTCAGACATGCCTTCC VV2_0852_del_check_F TCTGCGCACTTTATGCTCGATTCTGAATCC VV2_0852_del_check_R TTTTTGAAGGTGATTTTCATGTCATCACTC VV2_0928_upF TTTGCTCGAGCTTCGCCAAGTCGAACGAGA VV2_0928_upR CTGAGGATCCCCATGATGATGATGAACACC VV2_0928_dnF TTGAGGATCCGCAAGCGCAGCGTAATGAGC VV2_0928_dnR CGCTGCATGCAGTGAGGAGAAGCGTCGCCA VV2_0928_del_check_F GTGAAGTTGCGCTACTCAACAATATTGAAG VV2_0928_del_check_R GCGTAGAGGCTGTTGTCACTTTGTGCTCAC

Primer names

Nucleotide sequencesa (5'-3')

VV2_1320_upF VV2_1320_upR VV2_1320_dnF VV2_1320_dnR VV2_1320_del_check_F VV2_1320_del_check_R Complementation analysis VV1_0612_Fw VV1_0612_Rv Real-time RT-PCR VV1_0612 RTPCR_Fw VV1_0612 RTPCR_Rv VV1_1079 RTPCR_Fw VV1_1079 RTPCR_Rv VV1_1681 RTPCR_Fw VV1_1681 RTPCR_Rv VV1_2874 RTPCR_Fw VV1_2874 RTPCR_Rv VV1_3156 RTPCR_Fw VV1_3156 RTPCR_Rv VV2_0029 RTPCR_Fw VV2_0029 RTPCR_Rv VV2_0195 RTPCR_Fw VV2_0195 RTPCR_Rv VV2_0340 RTPCR_Fw VV2_0340 RTPCR_Rv VV2_0529 RTPCR_Fw VV2_0529 RTPCR_Rv VV2_0852 RTPCR_Fw VV2_0852 RTPCR_Rv VV2_0928 RTPCR_Fw VV2_0928 RTPCR_Rv VV2_1007 RTPCR_Fw VV2_1007 RTPCR_Rv VV2_1320 RTPCR_Fw VV2_1320 RTPCR_Rv 16S RTPCR_Fw 16S RTPCR_Rv

TCCCCTCGAGTGCAGGAGCTTGATTGGAAC AACGGGATCCTTGATGCGCAGGGCGTCGTC GATGGGATCCAACTCGGCGTGGAGAATATT TTGGCATGCTCAGCGAATGGCCAAGCAGAA TGGTCACCGCGCACGGTATTGATGTGATGG ACGGCGCGAAAACGCTCACGGCTCGCTTTC

a

CGATGGATCCTGCCTGCGACAATTTCCAAC AAAGGAATTCATTGCTGTCACCCTTTTCTT GAAGTGCGAGCGCAAAACA CGCGCAGAAACAACAGATTG TCCAGTTTTAGCGGTATCCATCA ATTCTCGCACCTGCATCTTGA CGCTTGAACTGCCAAAGATTG TTGCCCTCGAATCCGAAAC GCGTTGGAAAGCTGGTTAGC ATGAAACGCTGCAAACCCTTA CGCGCTACGCAGTGAGAA GCGCGGTGCGAACAG GAGCATCGGTTGCGAACTTT CCCCATAAACAGCAGCAACA TTCAAGAAAAGCCCGACAATG CACGCCTGAAGCAAATGAAAC GCAAAATGTGTGGACTAGCGATAA CATTCTCGCCGCCCTTT CGTGTCGCCCAAATTGAGT AAGTCCGGAGAGCGTTTTTTC GCGCGGTTACTCGTTTTTTG GAGAGCGCGCCCAATACAT TGGCTCCTGTGGCTTATGACT TTCGCCGCCATAAAAACTG GGCTATTACCCGACCCTCAGA GTCAGGCCCGCATTAAACTC GGAGTTTGATCCGCCCTACA CGCAAATGCTCTCTTCCACTT GGGACGACGTCAAGTCATCA AGTTGGCCGCCCTCTGTAT

The mutagenized restriction sites are underlined.

with a 0.22-mm pore size filter to remove living cells. The supernatants were stored at 30  C until use. The ICS mutant (Dics) was cultured on the above-mentioned culture-filtrates and then shaken at 37  C at 200 rpm for 8 h. The mutant was also cultured on HIEDDA medium containing 10 mM purified vulnibactin. 2.7. Quantitative RT-PCR Cells were cultured in HI medium in the presence and absence of EDDA until the OD600 reached approximately 1.0. Then, the cells were treated with RNA Protect Bacteria Reagent (Qiagen) to maintain the stability of the RNA. Total cellular RNA was isolated using an RNeasy Kit (Qiagen). During isolation, RNA was treated with DNase I to avoid DNA contamination. Total RNA (1 mg) and 1 mg random primers (Invitrogen, Carlsbad, CA, USA) were used to generate the reverse transcripts. The reaction was carried out at 37  C for 60 min with Moloney murine leukemia virus reverse transcriptase (RNase H minus, Promega, Madison, WI, USA) and terminated by heating at 70  C for 15 min. PCR amplification of the reverse transcript was monitored using SYBR Premix Ex Taq (Takara, Shiga, Japan) in a Thermal Cycler Dice Real Time System (Takara). The reverse transcript (1 ml) was used in the real-time PCR. After the initial denaturation of 30 s at 95  C, the DNA was amplified up to 40 cycles, with each cycle consisting of denaturation at 95  C for 5 s and annealing and extension at 60  C for 30 s. Specific primers (Table 2) amplifying the mean products of approximately 80 bp were designed with Primer Express software, version 3.0.1 (Applied Biosystems). Copy numbers of mRNA transcripts were

H. Kawano et al. / Microbial Pathogenesis 75 (2014) 59e67

created using each PCR product, which was amplified with the primer set del_check_F and del_check_R (Table 2). The amount of target mRNA was normalized relative to an endogenous control of 16S rRNA. 3. Results 3.1. BLAST search and nucleotide sequencing To determine the proteins functioning as outer and inner membrane proteins of the RND-type efflux system for vulnibactin transport, proteins homologous to E. coli TolC and AcrB were screened by BLAST. E. coli TolC was homologous to two putative outer membrane channel proteins, VV1_0612 and VV2_1007, of V. vulnificus CMCP6. Eleven putative RND proteins (VV1_1079, VV1_1681, VV1_2874, VV1_3156, VV2_0029, VV2_0195, VV2_0340, VV2_0529, VV2_0852, VV2_0928, and VV2_1320) were encoded in the V. vulnificus CMCP6 genome. BLAST results are summarized in Table 3. To amplify the VV1_0612 and VV2_1007 genes, PCR was performed with the primers designed based on the sequences of the V. vulnificus CMCP6 genome. The nucleotide sequences of PCR products of V. vulnificus M2799 were determined by the dideoxy chain termination method. The identities of E. coli TolC and other closely related Vibrio strains are shown in Fig. 1. The open reading frames (ORFs) of the V. vulnificus M2799 VV1_0612 and VV2_1007 genes consist of 1326 and 1272 bp, respectively, and encode proteins consisting of 441 and 423 amino acid residues with molecular masses of 48 and 46 kDa, respectively. Significant identities were found when these proteins were compared with those from E. coli TolC [VV1_0612 (46%) and VV2_1007 (24%)], V. vulnificus CMCP6 VV1_0612 TolC [VV1_0612 (99%) and VV2_1007 (24%)] and VV2_1007 TolC [VV1_0612 (25%) and VV2_1007 (99%)], and V. cholerae TolC [VV1_0612 (79%) and VV2_1007 (24%)]. 3.2. Growth of the deletion mutants of tolC homologs under lowiron concentration conditions To obtain sufficient iron, many bacteria have developed the ability to synthesize low-molecular weight, high-affinity iron chelators known as siderophores to scavenge iron with high efficiency. V. vulnificus M2799 acquires iron through the secretion of a

Table 3 Putative RND-type efflux system in Vibrio vulnificus CMCP6. VV number

Description

Identity against E. coli TolC or AcrB (%)

TolC homolog VV1_0612

46

VV2_1007

24

RND protein VV1_1079 VV1_1681 VV1_2874 VV1_3156 VV2_0029 VV2_0195 VV2_0340 VV2_0529 VV2_0852

VV2_0928 VV2_1320

Type I secretion outer membrane protein, TolC Type I secretion outer membrane protein, TolC homolog RND multidrug efflux transporter Multidrug resistance protein Transporter, AcrB/D/F family RND multidrug efflux transporter Transporter, AcrB/D/F family Acriflavin resistance protein Acriflavin resistance protein RND family multidrug efflux inner membrane protein Cobaltezincecadmium resistance protein CzcA/cation efflux system protein CusA Multidrug resistance protein Cation/multidrug efflux pump

34 23 23 30 24 24 15 40 24

22 13

63

catecholate siderophore called vulnibactin [17]. To investigate whether the VV1_0612 or/and the VV2_1007 protein(s) participate in vulnibactin secretion as the outer membrane channel protein, we constructed the deletion mutants (DVV1_0612 and DVV2_1007) and examined the growth of these mutants under low-iron concentration conditions. The Dics strain was unable to grow under low-iron concentration conditions as previously reported ([20], Fig. 2A). The DVV1_0612 strain was also unable to grow under lowiron concentration conditions compared with the wild-type and DVV2_1007 strains (Fig. 2A), suggesting that the VV1_0612 protein plays a crucial role in the iron utilization of M2799 cells. To confirm whether the VV1_0612 protein is involved in the iron acquisition system, complementation analysis of DVV1_0612 was performed. The growth of the recombinant mutant was restored to the level of the wild-type strain (Fig. 2B). These results suggest that the VV1_0612 protein is actually involved in the iron acquisition system via vulnibactin. 3.3. Vulnibactin secretion in the DVV1_0612 by bioassay In E. coli, siderophore enterobactin has been shown to be secreted via the outer membrane channel protein TolC. Therefore, the TolC mutant did not export enterobactin into the extracellular milieu [23]. To investigate whether the vulnibactin can be secreted via the VV1_0612 protein, the growth of Dics under low-iron concentration conditions was examined. Although Dics cannot synthesize vulnibactin, the strain has the vulnibactin-mediated iron acquisition system. Therefore, when vulnibactin is supplemented exogenously, this strain can grow via the vulnibactin-mediated iron acquisition system. Okujo et al. showed that 0.8 mmol vulnibactin was purified from 1 l of the culture supernatant of V. vulnificus M2799 [17]. Then, vulnibactin that was purified from the strain was added to the medium at the final concentration of 10 mM. As shown in Fig. 3, the growth of Dics was recovered by the addition of purified vulnibactin or the culture supernatant from the wild-type strain. However, the strain was unable to grow with the addition of the culture supernatant from DVV1_0612. These results indicate that DVV1_0612 is unable to export vulnibactin into the extracellular milieu. 3.4. Gene expression of RND protein-encoding genes under the iron-repleted and the low-iron concentration conditions To investigate the regulation of the RND protein-encoding genes, quantitative RT-PCR was performed under the ironrepleted and the low-iron concentration conditions (Fig. 4). Of these genes, the copy numbers of VV1_1079 and VV2_0928 transcripts were relatively high under iron-repleted conditions compared with the other RND protein-encoding genes. In contrast, the copy numbers of the VV1_3156, VV2_0029, VV2_0529, and VV2_0852 transcripts were remarkably lower than those of the other genes. The expression level of the VV1_1079, VV1_3156, VV2_0029, VV2_0195, and VV2_1320 genes increased under the low-iron concentration conditions whereas that from VV2_0340 decreased. These results suggest that the VV1_1079, VV1_3156, VV2_0029, VV2_0195, and VV2_1320 genes are negatively regulated but the VV2_0340 gene is positively regulated by iron. 3.5. Growth of the mutants of genes encoding RND proteins under low-iron concentration conditions To investigate which RND protein(s) together with the VV1_0612 outer membrane channel protein constitutes the RNDtype efflux system for vulnibactin secretion, deletion mutants of genes encoding RND proteins whose gene expression increased

64

H. Kawano et al. / Microbial Pathogenesis 75 (2014) 59e67

Fig. 1. TolC homologs in Vibrio vulnificus M2799 and their amino acid sequence identities with those from Escherichia coli and other closely related Vibrio strains. The orientation of the open reading frames (ORFs) is shown by arrows.

Fig. 2. Growth of the deletion mutants of tolC homologs (A) and its complementation analysis (B) under low-iron concentration conditions. (A) The deletion mutants of the gene encoding TolC homologs were cultured in heart infusion containing 2% NaCl (HI) medium containing 10 mg/ml ethylenediamine-di (o-hydroxyphenylacetic acid) (EDDA), and the optical density (OD600) was measured at the indicated time points. Data from three independent experiments are shown; standard deviations are indicated by vertical lines. (B) Plasmid pRVV1_0612 was transferred into DVV1_0612.

under low-iron concentration conditions were constructed. We constructed the mutants of the iron-regulated genes, VV1_1079, VV1_3156, VV2_0029, VV2_0195, and VV2_1320 (Table 1), and the growth of these mutants under low-iron concentration conditions was investigated. As shown in Fig. 5A, no significant growth impairment was observed in the five mutants compared with the wild-type strain. These results imply that an individual gene is not essential as the RND protein for vulnibactin secretion. We next constructed the multiple genes mutant of all RND protein-encoding genes, VV1_1079, VV1_1681, VV1_2874, VV1_3156, VV2_0029, VV2_0195, VV2_0340, VV2_0529, VV2_0852, VV2_0928, and VV2_1320. The mutant with 11 deleted genes was designated as D11. The growth of D11 was also investigated under low-iron concentration conditions. As shown in Fig. 5B, the growth inhibition of D11 was observed 6 h after the beginning of the culture. Furthermore, the multiple mutant except DVV1_1681 (D10) and DVV1_1681 were constructed. The DVV1_1681 strain exhibited a growth curve that was similar to that of D11, while D10 showed the same growth as the wild-type strain. These results indicate that the VV1_1681 protein is involved in the vulnibactin export system of V. vulnificus M2799. 4. Discussion Iron is essential for the growth of most bacteria. However, soluble iron in the human body is quite limiting because it is

normally bound with high affinity to iron-chelating proteins such as transferrin and lactoferrin. Many bacteria possess specialized iron acquisition systems to scavenge iron from the chelating molecules. V. vulnificus acquires iron through the secretion of a catecholate siderophore called vulnibactin [17]. The mechanisms of iron uptake, such as vulnibactin synthesis [12,20,32] and ferricvulnibactin uptake systems [20,33], have recently been reported. However, the export system of vulnibactin from intracellular to extracellular milieus has not been reported until now. In this study, we focused on the RND-type efflux system and tried to identify the proteins constituting the system involved in the secretion of vulnibactin. RND-type efflux systems are typical transporters of gramnegative bacteria and function as a huge protein complex spanning the cytoplasmic membrane and the outer membrane. This system is composed of an outer membrane channel protein, an MFP, and an RND protein [34]. Because the RND efflux complex requires a channel protein, the outer membrane protein is essential for the transportation of substrates across the outer membrane. If the RND-type efflux systems are actually involved in vulnibactin secretion through the outer membrane, the mutants of the corresponding genes would not export vulnibactin into the milieu. BLAST analysis revealed that two outer membrane channel proteins (VV1_0612 and VV2_1007) and 11 putative RND proteins were encoded by the V. vulnificus CMCP6 genome (Table 3). The MFPs for RND-type efflux systems and major facilitator superfamily (MFS)

H. Kawano et al. / Microbial Pathogenesis 75 (2014) 59e67

Fig. 3. Detection of vulnibactin in the culture supernatants by bioassay. The Dics strain was cultured on medium containing purified vulnibactin, the culture supernatant of the wild-type strain, and the culture supernatant of DVV1_0612. Data from three independent experiments are shown; standard deviations are indicated by vertical lines.

protein, which are considered to be involved in vulnibactin efflux across the cytoplasmic membrane, were not examined in this study. The growth of DVV1_0612 but not DVV2_1007 under low-iron concentration conditions was significantly impaired, which was similar to Dics, and the growth was restored by the complementation of VV1_0612 (Fig. 2). In addition, no growth retardation was observed in DVV1_0612 under iron-repleted conditions (data not shown). Furthermore, culture supernatant from DVV1_0612 did not compensate the growth defect of Dics that could not synthesize vulnibactin. The Dics strain could be rescued with vulnibactin and the culture supernatant from the wild-type strain (Fig. 3). The growth ability of DVV1_0612 under low-iron concentration conditions was reverted by the addition of the purified vulnibactin (data not shown). These results indicate that the VV1_0612 protein plays a crucial role in vulnibactin secretion as a component of RND-type efflux systems in M2799 cells under low-iron concentration conditions. In E. coli, the outer membrane protein TolC, which is used by several RND proteins, has been shown to be involved in enterobactin secretion [23]. To identify which RND protein(s) together with the VV1_0612 TolC constituted the RND efflux complex(s), we constructed the multiple mutants of RND inner membrane proteins, and the growth of the mutants was assessed under low-iron concentration conditions. The growth defect was observed in DVV1_1681. The growth inhibition of this mutant was observed 6 h

65

after the beginning of the culture. The growth ability was also reverted by the addition of the purified vulnibactin (data not shown). These results indicate that the VV1_1681 protein was involved in the vulnibactin export system of V. vulnificus M2799. Additionally, there must be unidentified RND protein(s) that complement the defect of the VV1_1681 gene. The VV1_0612 protein is the TolC homolog and thereby may also interact with different types of transporters such as the ATP-driven ABC transporters [35e37]. We focused on the TolC/MacAB efflux transporter system, which has been shown to export macrolide-type antibiotics from bacterial cells [36]. BLAST results indicated that the E. coli MacB homolog was composed of three ORFs (VV2_1004, VV2_1005, and VV2_1006). The deletion mutant of VV2_1005 and VV2_1006 was constructed, and the growth was tested under low-iron concentration conditions. However, the mutant did not show any growth impairment under the low-iron concentration conditions (data not shown). This result also strengthens our hypothesis that there is an unknown RND protein(s) in V. vulnificus M2799. This is the first genetic evidence that vulnibactin is secreted through the RND-type efflux systems in V. vulnificus. Furthermore, the TolC proteins have been shown to contribute to the pathogenicity of V. vulnificus. VV1_0612 TolC was revealed to be responsible for RtxA toxin secretion in V. vulnificus MO6-24/O [38]. Similarly, it has been shown that V. cholerae RTX toxin is secreted by a four-component type I secretion system composed of RtxB, RtxD, RtxE, and TolC [39]. In addition, the cytotoxicity and biofilm formation in DVV2_1007 were both decreased, indicating that the VV2_1007 protein is associated with the virulence of V. vulnificus MO6-24/O [40]. Therefore, the TolC proteins in V. vulnificus seem to fulfill the function as the access point for the export pathway of several virulence factors including vulnibactin and RtxA. In V. vulnificus M2799, VV1_0612 TolC plays a crucial role in the vulnibactin export system (Fig. 2A). A model for the export and the uptake of vulnibactin in V. vulnificus M2799 cell is presented in Fig. 6. This is the simplest model that is consistent with our present and previous data, but more complex models involving additional factors are also possible. In vulnibactin-mediated iron uptake system, VuuA was the only vulnibactin outer membrane receptor, whereas VatD could replace

Fig. 4. Gene expression of the resistance-nodulation-division (RND) protein-encoding genes under the iron-repleted and low-iron concentration conditions. Total RNA was isolated and converted to the reverse transcript, which was analyzed for specific mRNA transcript levels by real-time RT-PCR. Copy numbers of mRNA transcripts were determined using each PCR product. The values are normalized to the 16S rRNA gene expression. Data from three independent experiments are shown; standard deviations are indicated by vertical lines.

66

H. Kawano et al. / Microbial Pathogenesis 75 (2014) 59e67

Fig. 5. Growth of the deletion mutants of RND protein-encoding genes under low-iron concentration conditions. (A) The deletion mutants of the RND protein-encoding genes were cultured in HI medium containing 10 mg/ml EDDA, and the OD600 was measured at the indicated time points. Data from three independent experiments are shown; standard deviations are indicated by vertical lines. (B) The multiple deletion mutants of the RND protein-encoding genes were cultured in the same medium.

the function of FatB as a periplasmic ferric-vulnibactin binding protein [20]. Similarly, vulnibactin export systems of this strain seem to be composed of a single common outer membrane channel protein, VV1_0612 TolC, and several RND proteins including VV1_1681. Furthermore, when the E. coli tolC mutant was grown under low-iron concentration conditions, enterobactin accumulated in the periplasmic space. As a consequence, the bacterial morphology was impaired, possibly by sequestering iron and inhibiting iron-dependent reactions involved in cell division or peptidoglycan synthesis [41]. In addition, the DVV1_0612 strain of V. vulnificus M2799 was unable to grow under low-iron concentration conditions. These results indicate that the TolC proteins might be a new target for the treatment of gram-negative bacterial infections. It has been reported that Fur, a transcriptional repressor that responds to iron utilization [42], represses the expression of several genes such as desA, vuuA, and vatD under iron-repleted conditions [33,43,44]. In our data, the gene expression of

VV1_1079, VV1_3156, VV2_0029, VV2_0195, and VV2_1320 was remarkably upregulated under low-iron concentration conditions (Fig. 4). Judging from the nucleotide sequences of these geneoperon-promoter regions, a putative Fur box (GAATAATTAATCAATATTT) was identified only in the upstream region (VV2_1322 promoter) of the VV2_1320 gene (data not shown). These results suggest that the gene expression of VV2_1320 in V. vulnificus M2799 is regulated by Fur. 5. Conclusions We proposed a model of a vulnibactin-export system in V. vulnificus M2799 whereby vulnibactin is exported from the cytoplasm to the extracellular milieu through RND-type efflux systems. The systems are composed of VV1_0612 TolC and several RND proteins including the VV1_1681 protein (Fig. 6). VV1_0612 TolC is essential for the vulnibactin export system. However, the other RND protein(s) involved in the system remains to be investigated. Genetic approaches to identify the RND-type efflux systems are currently underway. Acknowledgments This study was supported in part by a Grants-in-Aid for the Strategic Research Foundation Grant-aided Project for Private Universities from the Ministry of Education, Culture, Sports, Science and Technology (MEXT), Japan, 2011-2015 (S1101031). We thank Prof. Shin-ichi Miyoshi for supplying the V. vulnificus clinical isolate strain M2799. References

Fig. 6. Schematic representation of the vulnibactin-mediated iron uptake system of V. vulnificus M2799.

[1] Klontz KC, Lieb S, Schreiber M, Janowski HT, Baldy LM, Gunn RA. Syndromes of Vibrio vulnificus infections. Clinical and epidemiologic features in Florida cases, 1981e1987. Ann Intern Med 1988;109:318e23. [2] Tacket CO, Brenner F, Blake PA. Clinical features and an epidemiological study of Vibrio vulnificus infections. J Infect Dis 1984;149:558e61. [3] Johnston JM, Becker SF, McFarland LM. Vibrio vulnificus. Man and the sea. J Am Med Assoc 1985;253:2850e3. [4] Kothary MH, Kreger AS. Purification and characterization of an elastolytic protease of Vibrio vulnificus. J Gen Microbiol 1987;133:1783e91. [5] Miyoshi N, Shimizu C, Miyoshi S, Shinoda S. Purification and characterization of Vibrio vulnificus protease. Microbiol Immunol 1987;31:13e25. [6] Fan JJ, Shao CP, Ho YC, Yu CK, Hor LI. Isolation and characterization of a Vibrio vulnificus mutant deficient in both extracellular metalloprotease and cytolysin. Infect Immun 2001;69:5943e8.

H. Kawano et al. / Microbial Pathogenesis 75 (2014) 59e67 [7] Chung KJ, Cho EJ, Kim MK, Kim YR, Kim SH, Yang HY, et al. RtxA1-induced expression of the small GTPase Rac2 plays a key role in the pathogenicity of Vibrio vulnificus. J Infect Dis 2010;201:97e105. [8] Kim YR, Lee SE, Kook H, Yeom JA, Na HS, Kim SY, et al. Vibrio vulnificus RTX toxin kills host cells only after contact of the bacteria with host cells. Cell Microbiol 2008;10:848e62. [9] Kwak JS, Jeong HG, Satchell KJ. Vibrio vulnificus rtxA1 gene recombination generates toxin variants with altered potency during intestinal infection. Proc Natl Acad Sci U S A 2011;108:1645e50. [10] Simpson LM, White VK, Zane SF, Oliver JD. Correlation between virulence and colony morphology in Vibrio vulnificus. Infect Immun 1987;55:269e72. [11] Wright AC, Powell JL, Kaper JB, Morris Jr JG. Identification of a group 1-like capsular polysaccharide operon for Vibrio vulnificus. Infect Immun 2001;69: 6893e901. [12] Litwin CM, Rayback TW, Skinner J. Role of catechol siderophore synthesis in Vibrio vulnificus virulence. Infect Immun 1996;64:2834e8. [13] Tsuchiya T, Mitsuo E, Hayashi N, Hikita Y, Nakao H, Yamamoto S, et al. Vibrio vulnificus damages macrophages during the early phase of infection. Infect Immun 2007;75:4592e6. [14] Wooldridge KG, Williams PH. Iron uptake mechanisms of pathogenic bacteria. FEMS Microbiol Rev 1993;12:325e48. [15] Ratledge C, Dover LG. Iron metabolism in pathogenic bacteria. Annu Rev Microbiol 2000;54:881e941. [16] Morris JG, Wright AC, Simpson LM, Wood PK, Johnson DE, Oliver JD. Virulence of Vibrio vulnificus: association with utilization of transferrin-bound iron, and lack of correlation with levels of cytotoxin or protease production. FEMS Microbiol Lett 1987;40:55e9. [17] Okujo N, Saito M, Yamamoto S, Yoshida T, Miyoshi S, Shinoda S. Structure of vulnibactin, a new polyamine-containing siderophore from Vibrio vulnificus. Biometals 1994;7:109e16. [18] Griffiths GL, Sigel SP, Payne SM, Neilands JB. Vibriobactin, a siderophore from Vibrio cholerae. J Biol Chem 1984;259:383e5. [19] Tan W, Verma V, Jeong K, Kim SY, Jung CH, Lee SE, et al. Molecular characterization of vulnibactin biosynthesis in Vibrio vulnificus indicates the existence of an alternative siderophore. Front Microbiol 2014;5:1e11. [20] Kawano H, Miyamoto K, Sakaguchi I, Myojin T, Moriwaki M, Tsuchiya T, et al. Role of periplasmic binding proteins, FatB and VatD, in the vulnibactin utilization system of Vibrio vulnificus M2799. Microb Pathog 2013;65:73e81. [21] Kim CM, Park RY, Park JH, Sun HY, Bai YH, Ryu PY, et al. Vibrio vulnificus vulnibactin, but not metalloprotease VvpE, is essentially required for ironuptake from human holotransferrin. Biol Pharm Bull 2006;29:911e8. [22] Miyamoto K, Kosakai K, Ikebayashi S, Tsuchiya T, Yamamoto S, Tsujibo H. Proteomic analysis of Vibrio vulnificus M2799 grown under iron-repleted and iron-depleted conditions. Microb Pathog 2009;46:171e7. [23] Bleuel C, Grosse C, Taudte N, Scherer J, Wesenberg D, Krauss GJ, et al. TolC is involved in enterobactin efflux across the outer membrane of Escherichia coli. J Bacteriol 2005;187:6701e7. [24] Whitney EN. The tolC locus in Escherichia coli K12. Genetics 1971;67:39e53. [25] Franke S, Grass G, Rensing C, Nies DH. Molecular analysis of the coppertransporting efflux system CusCFBA of Escherichia coli. J Bacteriol 2003;185: 3804e12.

67

[26] Nies DH. Efflux-mediated heavy metal resistance in prokaryotes. FEMS Microbiol Rev 2003;27:313e39. [27] Nikaido H. Multidrug efflux pumps of gram-negative bacteria. J Bacteriol 1996;178:5853e9. [28] Miller VL, Mekalanos JJ. A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae requires toxR. J Bacteriol 1988;170: 2575e83. [29] Milton DL, O'Toole R, Horstedt P, Wolf-Watz H. Flagellin A is essential for the virulence of Vibrio anguillarum. J Bacteriol 1996;178:1310e9. [30] Keen NT, Tamaki S, Kobayashi D, Trollinger D. Improved broad-host-range plasmids for DNA cloning in gram-negative bacteria. Gene 1988;70:191e7. [31] Kim YR, Lee SE, Kim CM, Kim SY, Shin EK, Shin DH, et al. Characterization and pathogenic significance of Vibrio vulnificus antigens preferentially expressed in septicemic patients. Infect Immun 2003;71:5461e71. [32] Kim IH, Shim JI, Lee KE, Hwang W, Kim IJ, Choi SH, et al. Nonribosomal peptide synthase is responsible for the biosynthesis of siderophore in Vibrio vulnificus MO6-24/O. J Microbiol Biotechnol 2008;18:35e42. [33] Webster ACD, Litwin CM. Cloning and characterization of vuuA, a gene encoding the Vibrio vulnificus ferric vulnibactin receptor. Infect Immun 2000;68:526e34. [34] Koronakis V, Andersen C, Hughes C. Channel-tunnels. Curr Opin Struct Biol 2001;11:403e7. [35] Lomovskaya O, Lewis K. Emr, an Escherichia coli locus for multidrug resistance. Proc Natl Acad Sci U S A 1992;89:8938e42. [36] Kobayashi N, Nishino K, Yamaguchi A. Novel macrolide-specific ABC-type efflux transporter in Escherichia coli. J Bacteriol 2001;183:5639e44. [37] Nishino K, Yamaguchi A. EvgA of the two-component signal transduction system modulates production of the YhiUV multidrug transporter in Escherichia coli. J Bacteriol 2002;184:2319e23. [38] Hwang W, Lee NY, Kim J, Lee MA, Kim KS, Lee KH, et al. Functional characterization of EpsC, a component of the type II secretion system, in the pathogenicity of Vibrio vulnificus. Infect Immun 2011;79:4068e80. [39] Boardman BK, Satchell KJ. Vibrio cholerae strains with mutations in an atypical type I secretion system accumulate RTX toxin intracellularly. J Bacteriol 2004;186:8137e43. [40] Lee KE, Bang JS, Baek CH, Park DK, Hwang W, Choi SH, et al. IVET-based identification of virulence factors in Vibrio vulnificus MO6-24/O. J Microbiol Biotechnol 2007;17:234e43. [41] Vega DE, Young KD. Accumulation of periplasmic enterobactin impairs the growth and morphology of Escherichia coli tolC mutants. Mol Microbiol 2014;91:508e21. [42] Hantke K. Iron and metal regulation in bacteria. Curr Opin Microbiol 2001;4: 172e7. [43] Tanabe T, Takata N, Naka A, Moon YH, Nakao H, Inoue Y, et al. Identification of an AraC-like regulator gene required for induction of the 78-kDa ferrioxamine B receptor in Vibrio vulnificus. FEMS Microbiol Lett 2005;249:309e14. [44] Tanabe T, Naka A, Aso H, Nakao H, Narimatsu S, Inoue Y, et al. A novel aerobactin utilization cluster in Vibrio vulnificus with a gene involved in the transcription regulation of the iutA homologue. Microbiol Immunol 2005;49: 823e34.