Mol Cell Biochem DOI 10.1007/s11010-014-2081-8
The study of regulatory effects of Pdx-1, MafA and NeuroD1 on the activity of porcine insulin promoter and the expression of human islet amyloid polypeptide Xiao-Dan Liu • Jin-Xue Ruan • Ji-Han Xia Shu-Lin Yang • Jun-Hua Fan • Kui Li
•
Received: 13 March 2014 / Accepted: 3 May 2014 Ó Springer Science+Business Media New York 2014
Abstract The purpose of the present study was to determine the activation of porcine insulin promoter (PIP) by three transcription factors: pancreatic and duodenal homeobox 1 (Pdx-1), v-maf musculoaponeurotic fibrosarcoma oncogene (MafA) and neurogenic differentiation 1 (NeuroD1) in non-beta islet cells cultured in vitro. In addition, the expression of the exogenous human islet amyloid polypeptide (hIAPP) gene driving by PIP in porcine kidney 15 (PK15) cells co-transfected with these transcription factors was also examined. In the present study, a series of vectors for gene overexpression were constructed, including pGL3-Pdx-1, pGL3-MafA, pGL3NeuroD1, pGL3-PIP-LUC and pcDNA3.1-PIP-hIAPP. The dual-luciferase reporter assay showed that the PIP activity was increased in PK15 cells when overexpressing the exogenous transcription factors Pdx-1, MafA and NeuroD1. Introducing the PIP-hIAPP expression vector into PK15 cells combined with exogenous Pdx-1, MafA and NeuroD1 resulted in the efficient expression of hIAPP at the gene level, but not the protein. The current systematic porcine insulin promoter analysis provided the basic information for future utilization of porcine insulin.
Abbreviations PIP Porcine insulin promoter Pdx-1 p Pancreatic and duodenal homeobox 1 MafA v-maf musculoaponeurotic fibrosarcoma oncogene NeuroD1 Neurogenic differentiation 1 hIAPP Human islet amyloid polypeptide PK15 Porcine kidney 15 cell INS Insulin PCAF P300/CBP-associated factor bHLH Basic helix-loop-helix qPCR Quantitative real-time polymerase chain reaction CDS The coding DNA sequences NCBI The National Center for Biotechnology Information LUC The luciferase GAPDH Glyceraldehyde-3-phosphate dehydrogenase RIP The rat insulin 1 promoter HIP The human insulin promoter
Introduction Keywords Insulin promoter Transcription factor Luciferase Human islet amyloid polypeptide PK15 cell
X.-D. Liu J.-X. Ruan J.-H. Xia S.-L. Yang (&) J.-H. Fan K. Li Key Laboratory for Farm Animal Genetic Resources and Utilization of Ministry of Agriculture of China, Institute of Animal Science, Chinese Academy of Agricultural Science, Beijing 100193, People’s Republic of China e-mail: [email protected] X.-D. Liu e-mail: [email protected]
Type 2 diabetes mellitus is mainly characterized by insulin resistance, which may be combined with impaired insulin secretion. As type 2 diabetes progresses, insulin secretion usually decreases to below normal levels, which is accompanied by insulin resistance [1]. Therefore, structural and functional damage to pancreatic islet b cells and b cells apoptosis play important roles in the development and progression of type 2 diabetes. Due to the similarities between pigs and humans in terms of anatomy, physiology and nutritional metabolism, pigs have been considered a suitable animal for modeling human metabolic diseases [2].
123
Mol Cell Biochem
However, the process of establishing pig diabetes models and evaluating the diabetic phenotypes of the pigs is rather lengthy. The study of the regulation of pancreatic b cell function through genetic modifications at the individual level is time consuming. In addition, b cells are terminally differentiated somatic cells. It is difficult to achieve efficient gene transfer to the isolated and cultured b cells. Therefore, the construction of biological models using nonb cells to study gene expression and regulation in b cells is of great significance for generating genetically modified pigs and for studying target gene functions. The human islet amyloid polypeptide (hIAPP) and insulin (INS) genes are specifically expressed in pancreatic islet b cells. The cis-acting elements in porcine insulin promoter (PIP) include A, C and E elements [3, 4], which interact with the transcription factors pancreatic and duodenal homeobox 1 (Pdx-1), v-maf musculoaponeurotic fibrosarcoma oncogene (MafA) and neurogenic differentiation 1 (NeuroD1), respectively [3–6] The A box in the insulin promoter consists of up to five regulatory elements [7], including A5, A3, A2, A1 and GG2 [8]. The A box is rich in adenine/thymine (A/T) bases. The DNA motif 50 CC [CT] TAAT [TG]-30 serves as a binding site for Pdx-1. In the motif, TAAT is the core region that interacts with the Pdx-1 protein [9], a member of the homeobox protein family [3–7, 9, 10]. The transcription factor MafA binds to the C1 element in the insulin promote [3–6, 11]. MafA is mainly present in the nuclei of pancreatic islet b cells. MafA binds to DNA as a dimer and interacts with other transcription factors [4], such as NeuroD1, P300/CBPassociated factor (PCAF) and Pdx-1, to stimulate transcriptional activity. The core sequence of the E element is 50 -CANNTG-30 [12], which serves as the binding site for proteins of the basic helix-loop-helix (bHLH) family. The trans-acting factors that interact with the E element mainly include NeuroD1 (also known as BETA2) [3–6, 13], E2/5, E12 and E7. NeuroD1 is abundant in pancreatic islet, whereas E2/5 and E47 are widely distributed. NeuroD1 forms heterodimers with other bHLH proteins such as E47 [3]. The heterodimers bind to the E element and stimulate the transcriptional activity of the promoter [4]. Studies have shown that all three transcription factors, Pdx-1, MafA and NeuroD1, efficiently activate transcription from murine and human insulin promoters. However, the three transcription factors exert distinct effects on the insulin promoters of different species [4]. Approximately 90 % of patients with type 2 diabetes show hIAPP precipitation-induced b cell apoptosis in pancreatic islets. The amyloid precipitates are primarily composed of extracellular hIAPP multimers. hIAPP is composed of 37 amino acids and is secreted simultaneously with insulin [14–16]. Humans, non-human primates and cats express a type of IAPP that forms amyloid protein,
123
while IAPPs in rodents and pigs fail to form amyloid protein. Interspecies variations in the amino acid sequence of IAPP are mainly observed at residues 20–29 [15]. These residues (AILSS) display the most prominent effect on amyloid fibril formation. Studies have shown that both hIAPP and insulin are synthesized and secreted by pancreatic b cells. Under physiological conditions, hIAPP collaborates with blood sugar, regulating hormones such as insulin to precisely control blood glucose levels in humans. Studies have also indicated that hIAPP has a strong tendency to misfold and form amyloid polypeptides [15]. hIAPP is currently known to be one of the polypeptides with the greatest capacity for the formation of amyloid aggregates [15]. It is capable of interacting with the lipid membrane and destroying the cell membrane barrier. In addition, multimeric hIAPP interrupts b cell coupling and induces b cell apoptosis [14, 15]. Therefore, the formation of hIAPP amyloid deposition is considered to be an important pathogenic factor for type 2 diabetes. The present study focused on the regulatory effects of the transcription factors Pdx-1, MafA and NeuroD1 on transcription from PIP in non-b cells and the feasibility of constructing a cellular model to control target gene expression in non-b cells.
Materials and methods Materials The porcine kidney cell line (PK15) and the human pancreatic carcinoma cell line (Panc-1) were obtained from the Research Center of Basic Medical Science at the Institute of Basic Medical Sciences Chinese Academy of Medical Sciences (IBMSCAMS, Beijing, China). The DH5a competent bacterial cells were purchased from GeneWiz Biotechnology Co., Ltd (Beijing, China). The endotoxin-free plasmid extraction kit was purchased from Tiangen Biotech (Beijing, China) Co., Ltd. Restriction enzymes were purchased from NEB (USA). The LipofectamineTM 2,000 liposomal transfection reagent was purchased from Invitrogen (USA). The Dual-Luciferase Reporter Assay kit was purchased from Progema (USA). The high purity total RNA extraction kit was purchased from Biotake (China). The reverse transcription reagent kit was purchased from Thermo Scientific (USA). SYBR Ò Premix Ex TaqTM was purchased from Takara (Japan). The total cellular protein extraction kit and protein assay kit were purchased from Thermo Scientific (USA). The anti-hIAPP primary antibody was purchased from Santa Cruz Biotechnology, Inc. (USA). The anti-b-actin primary antibody was purchased from Abcam (UK). All secondary antibodies were purchased from Beijing Cowin Biosciences Co., Ltd (Beijing, China).
Mol Cell Biochem Table 1 Primer information
Gene name Pdx-1 MafA NeuroD1 hIAPP GAPDH
Primer sequence (50 –30 )
Length of PCR product (bp)
pdx1-f
AAGTCTACCAAGGCTCACGC
159
pdx1-r
GCGCGGCCTAGAGATGTATT
Primer name
mafa-f
AGGAGGAGGTCATCCGGCTC
mafa-r
TTGTACAGGTCCCGCTCTTTG
neurod1-f
TCTTGCGTTCAGGCAAAAGC
neurod1-f
AAGTCCGAGGATTGAGCTGC
hiapp-f
ACCATCTGAAAGCTACACCCAT
hiapp-r
GGCACCAAAGTTGTTGCTGG
gapdh-f
AGGGCATCCTGGGCTACACT
gapdh-r
TCCACCACCCTGTTGCTGTAG
Gene expression in muscle, liver, pancreatic and kidney tissues Four types of tissue samples (muscle, liver, pancreas and kidney) were collected from Wuzhishan miniature pigs. Total RNA was extracted from the tissue samples. The expression levels of the transcription factors Pdx-1, MafA and NeuroD1 were analyzed by quantitative real-time polymerase chain reaction (qPCR). The sequences of the primers utilized in qPCR are summarized in Table 1. Plasmids The Pdx-1, MafA and NeuroD1 genes were synthesized by Shanghai Generay Biotech Co., Ltd. (China) according to the coding DNA Sequences (CDS) stored in the National Center for Biotechnology Information (NCBI) database. They were cloned into the NcoI/XbaI restriction sites of the pGL3-control vector to replace the original luciferase (LUC) gene. The resulting recombinant plasmid vectors were named pGL3-Pdx-1, pGL3-MafA and pGL3-NeuroD1, respectively. The PIP sequences [2] and hIAPP gene according to the coding DNA Sequences (CDS) stored in the NCBI database were synthesized by Shanghai Generay Biotech Co., Ltd. (China) They were cloned into the MfeI/Bst1107I restriction sites of the pcDNA3.1(?) plasmid. The resulting recombinant plasmid was named pcDNA3.1-PIP-hIAPP. To construct vector of overexpression of reporter, the following upstream and downstream primers were designed and synthesized using the PIP-containing plasmid pcDNA3.1-PIP-hIAPP: F: 50 -gcGAGCTCGAGTTCAGCTGAGCT-30 ; SacI R: 50 -cccAAGCTTgggAGGACCTGGGGGAC-30 . HindIII
187 117 122 166
The SacI and HindIII restriction enzyme sites were added to the ends of the primers (lowercase letters indicated the protected bases). A fraction of the PIP approximately 1,500 bp in length was amplified by PCR. The PCR products were verified by electrophoresis on a 1 % agarose gel, and the target fragment was recovered from the gel. The recovered fragment was incubated with the pGM-T cloning vector at 4 °C overnight to generate the pGM-T-PIP recombinant plasmid, which was then transformed into DH5a competent cells. The pGM-T-PIP recombinant plasmid was extracted, digested with the restriction endonucleases SacI and HindIII and subjected to electrophoresis on a 1 % agarose gel. The DNA fragment of approximately 1,500 bp was recovered from the agarose gel. Meanwhile, the pGL3-basic plasmid was digested with the restriction endonucleases SacI and HindIII, and the resulting DNA fragments were separated by electrophoresis on a 0.7 % agarose gel. A DNA fragment of approximately 4,800 bp was recovered from the agarose gel. The 1,500 and 4,800 bp fragments were ligated overnight at 4 °C and transformed into DH5a competent cells. The recombinant plasmid pGL3-PIPLUC was extracted.
Reporter assay PK15 cells were cultured in 24-well cell culture plates to 80–90 % confluency and then subjected to transfection using the lipofectamineTM 2000 reagent according to the manufacturer’s instructions. The PK15 cells in each well were transfected with a total of 1.6 lg plasmids, including 800 ng of pGL3-PIP-LUC, 200 ng of pRL-TK, 200 ng of an expression vector encoding one of the transcription factors and the pGL3-basic plasmid. In addition, the PK15 negative control group was transfected with pEGFP to determine the transfection efficiency. The plasmids
123
Mol Cell Biochem Table 2 List of the plasmids transfected into various groups of PK15 cells Experimental group
1
2
3
4
5
6
7
8
pGL3-PIP-LUC
?
?
?
?
?
?
?
?
pRL-TK
?
?
?
?
?
?
?
?
pGL3-Pdx-1
-
?
-
-
?
?
-
?
pGL3-MafA
-
-
?
-
?
-
?
?
pGL3-NeuroD
-
-
-
?
-
?
?
?
‘‘ ? ’’ indicates that the plasmid was used to transfect PK15 cells, ‘‘ - ’’ indicates untransfected plasmid Table 3 List of the plasmids transfected into various groups of cells Experimental group
1
2
3
4
5
6
7
Cell type
PK15
pcDNA3.1-PIP-hIAPP pEGFP
? ?
? ?
? ?
? ?
? ?
? ?
? ?
pGL3-Pdx-1
-
?
-
-
?
?
pGL3-MafA
-
-
?
-
?
pGL3-NeuroD
-
-
-
?
-
8
9 Panc-1
Fig. 1 The expression levels of the three transcription factors in muscle, liver, kidney and pancreas
? ?
? ?
Data analysis
–
?
-
-
?
?
-
?
?
?
-
‘‘ ? ’’ indicates that the plasmid was transfected into the PK15 cells, ‘‘ - ’’ indicates untransfected plasmids
transfected into various groups of PK15 cells are summarized in Table 2. Firefly and Renilla luciferase activities were determined in extracts of transfected cells using the Dual-Luciferase Reporter Assay System 48 h posttransfection. hIAPP expression analysis The PK15 and Panc-1 cell lines were cultured in 24-well cell culture plates to 80–90 % confluency and then subjected to eukaryotic cell transfection using the lipofectamineTM 2000 reagent according to the manufacturer’s instructions. The cells in each well were transfected with 800 ng of pcDNA3.1-PIP-hIAPP plasmid, 200 ng of pRL-TK plasmid and 200 ng of an expression vector encoding one of the transcription factors. In addition, the cells were transfected with the pGL3-basic plasmid, which brought the total amount of the plasmids in the transfections to 1.6 lg. The Panc-1 positive control group was transfected with 800 ng of pcDNA3.1-PIP-hIAPP plasmid, 200 ng of pEGFP plasmid and 600 ng of pGL3-basic plasmid. The cells were divided into two large groups (groups I and II) for the analysis of the RNA and protein expression levels. Each large group was further divided into nine small subgroups. The plasmids transfected into each group of cells are shown in Table 3. Cells in group I were analyzed by qPCR 36 h post-transfection, and cells in group II were analyzed by Western blot and radioimmunoassays 36 h post-transfection.
123
Data analysis was performed using the SPSS version 19.0 software. Mean values and standard deviations of the luciferase assay data were calculated and utilized to construct bar graphs in Excel.
Results The expression of transcription factors in the muscle, liver, pancreatic and kidney tissues The mRNAs expressed in the muscle, liver, pancreatic and kidney tissues of the Wuzhishan miniature pigs were analyzed by qPCR. The gene expression levels of the transcription factors Pdx-1, MafA and NeuroD1 in all four tissues are shown in Fig. 1. The results showed that the gene expression levels of the transcription factors Pdx-1, MafA and NeuroD1 in the pancreas were significantly higher than those in the other three tissues, indicating that all three transcription factors were specifically expressed in pancreatic cells. Restriction enzyme digestion of plasmids The pGL3-Pdx-1, pGL3-MafA and pGL3-NeuroD1 plasmids were subjected to single restriction endonuclease digestion with HindIII (Fig. 2A) and double restriction endonuclease digestion with HindIII/XbaI (Fig. 2B). The recombinant vector pGL3-PIP-LUC was subjected to single restriction endonuclease digestion with HindIII and double restriction endonuclease digestion with HindIII/ ScaI (Fig. 2C). The pcDNA3.1-PIP-hIAPP plasmid was subjected to single restriction endonuclease digestion by MfeI and double restriction endonuclease digestion by MfeI/Bst1107I (Fig. 2D). The results of agarose gel
Mol Cell Biochem Fig. 2 Electrophoretic bands of plasmids after restriction enzyme digestion. A pGL3-Pdx1, pGL3-MafA and pGL3NeuroD1 digested by single restriction enzyme, B pGL3Pdx-1, pGL3-MafA and pGL3NeuroD1 digested by double restriction enzyme, C pGL3PIP-LUC digested by restriction enzyme, D pcDNA3.1-PIPhIAPP digested by restriction enzyme, 1–5: pGL3-Pdx-1, pGL3-MafA, pGL3-NeuroD1, pGL3-PIP-LUC and pcDNA3.1PIP-hIAPP plasmid, s: single restriction enzyme digestion, d: double restriction enzyme digestion
electrophoresis showed that sizes of the bands were consistent with sizes of the corresponding restriction fragments. Dual-luciferase activity assay At 48 h after transfection, the activities of the two luciferase were examined. The relative luciferase activity in each group of cells is shown in Fig. 3. Among these transcription factors, MafA exerted the strongest stimulatory effect on PIP when acting alone, resulting in an approximate 15-fold increase in PIP activity (P \ 0.05). Pdx-1 collaborated with either MafA or NeuroD1 and displayed a cumulative effect on PIP activation. MafA and NeuroD1 interacted with each other and exerted a strong synergistic stimulation of PIP activity, resulting in an approximate 40-fold activation of PIP compared with cells lacking any transcription factor (P \ 0.05). All three transcription factors might interact with PIP jointly. However, the stimulatory effect on PIP activity was weaker than the synergistic effect of MafA and NeuroD1. The results demonstrated that the activity of the luciferase was significantly increased in PK15 cells co-transfected with the transcription factor overexpression vectors in comparison with cells lacking the transcription factors. Examine hIAPP expression in pcDNA3.1-PIP-hIAPP transfected cells qPCR was performed using hIAPP as the target gene and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the reference gene. The qPCR data were analyzed and plotted using the 2-DDCt method, and the fluorescencebased quantitative expression profile of the hIAPP gene is
Fig. 3 Examination of the activities of the dual-luciferase reporter gene in PK15 cells
shown in Fig. 4A. The results of qPCR showed that the expression level of the hIAPP gene was markedly increased in PK15 cells transfected with the transcription factor overexpression vectors. This result indicated that the high level of hIAPP expression driven by PIP was achieved in the presence of transcription factors that specifically interacted with PIP. The results of the Western blot analysis (Fig. 4B) and radioimmunoassay (Fig. 4C) showed that there was no significant differences in the expression levels of the mature hIAPP protein in PK15 cells transfected with the different transcription factors and control. In contrast, the expression level of the mature hIAPP protein displayed an approximate four fold increase in Panc-1 cells. Compared with the results of qPCR shown in Fig. 4A, hIAPP expression at the gene level did not positively correlate
123
Mol Cell Biochem
Fig. 4 Examination of hIAPP gene expression in PK15 cells. qPCR (A), Western blot (B), Radioimmunoassay (C)
with hIAPP expression at the protein level in PK15. These results indicated in PK15 cells hIAPP mRNA failed to produce the mature hIAPP protein efficiently.
Discussion The cis-acting elements in PIP interact with trans-acting factors that are expressed in a tissue-specific and timespecific fashion to regulate insulin gene transcription. Various transcription factor binding sites are located 300–400 bp upstream of the insulin gene and interact with transcription factors primarily expressed in the pancreas. The transcription factors Pdx-1, MafA and NeuroD1 bind to the A, C and E elements in the insulin promoter [3, 4], respectively, and regulate the transcriptional activity of the insulin promoter [4, 7, 17, 18]. In mammals, the sequences of the cis-acting elements in the insulin promoter are highly conserved. A large number of studies investigated the effects of the transcription factors Pdx-1 [19–22], MafA [22, 23] and NeuroD1 [20, 22] on the activities of the mouse and human insulin promoters [7, 20]. These transcription factors, alone or together, interact with the murine and human insulin promoters and effectively enhance the expression of the downstream target genes [7]. A dualluciferase activity assay was performed in the present study, and the results indicated that all three transcription factors, Pdx-1, MafA and NeuroD1, activated PIP to a certain extent. These results indicated that the three transcription factors, acting alone or in collaboration, enhanced
123
to varying degrees the transcription of the luciferase gene under the control of PIP. When all three transcription factors interacted with PIP jointly, the stimulatory effect was weaker compared with the synergistic effect of MafA and NeuroD1. The mechanisms underlying this phenomenon might involve competition between Pdx-1 and MafA or NeuroD1 or the inhibition of the synergistic effect of MafA and NeuroD1 by Pdx-1. Hilary at el reported that Pdx-1 mediates the maximal transcriptional activation at the rat insulin 1 promoter (RIP) and the human insulin promoter (HIP) in Hela cells, resulting in four fold and 40-fold activation, respectively [4].In contrast, the other transcription factors exhibited significantly weaker effects on promoter activation [4]. Pdx-1, MafA and NeuroD1 exert a synergistic effect on the RIP but an addictive effect on HIP [4]. The results of the present study are somewhat inconsistent with the results obtained by Hilary et al. on RIP and HIP [4]. These inconsistent observations suggest that the transcription factors Pdx-1, MafA and NeuroD1 exert distinct regulatory effects on insulin promoters of different species, which might be related to nucleic acid sequences of cis-acting elements in different insulin promoters and secondary structures between the elements. Alternatively, these different regulatory effects may be related to the other factors in cells [12]. The translation of hIAPP mRNA in pancreatic islet b cells is a complex process that involves a variety of key enzymes. In pancreatic islet b cells, PC1/3 and PC2 are the key enzymes involved in hIAPP translation that are mainly expressed in the endocrine and neuroendocrine cells [17,
Mol Cell Biochem
24, 25]. The expression of PC2 and PC1/3 is restricted to endocrine or neuroendocrine cells during hormonal biosynthesis [26]. In cells lacking PC2 and PC 1/3, hIAPP mRNA cannot be translated into a mature protein. Significant differences were observed in hIAPP translation between the PK15 cells and the pancreatic islet b cells. The results of the protein expression analysis shown in Fig. 3 were compared to those in Fig. 4b, c. The transfection of PK15 cells with an exogenous luciferase vector containing PIP resulted in high-efficiency expression of the firefly luciferase protein. In contrast, PK15 cells transfected with an exogenous hIAPP expression vector containing PIP failed to produce the hIAPP protein efficiently. These results indicated the presence of specific regulatory pathways for the translation of the hIAPP gene. Paulsson et al. transfected the GH4C1 and COS7 cell lines that lack PC2 and PC1/3 expression with an h-proIAPP expression vector and then stained the cells with an antiserum specific for hIAPP. The results revealed the presence of large amounts of precipitate particles around the nucleus. In addition, after the AtT-20 cell line that expresses PC1/3 but not PC2 was transfected with exogenous h-proIAPP expression vector, the immunofluorescence assay detected a small amount of precipitate particles in the vicinity of the nucleus. Both types of transfected cell lines were also stained with Congo red. After staining, the precipitate particles displayed strong green fluorescence under polarized light, indicating that the particles were amyloid protein multimers. In the absence of PC1/3, PC2 also exhibited the ability to cleave proIAPP to some extent. The transfection of the GH3 cell line that solely expresses PC2 with vectors expressing h-proIAPP resulted in the appearance of aggregates in the cytoplasm. No precipitate particles were observed near the nucleus. An immunofluorescence analysis showed that these aggregates were different from the ones found in the GH4C1, COS7 and AtT-20 cell lines. Moreover, the aggregates could not be stained with Congo red, indicating that these particles were not amyloid protein multimers [26]. Non-b cells such as PK15 lack the regulated secretory pathway and enzymes (PC2 and PC1/3) that convert the IAPP propeptide to mature IAPP. Therefore, large amounts of proIAPP accumulate in the vicinity of the nucleus. Immature hIAPP and proIAPP form early human islet amyloid protein multimers in the vicinity of the nucleus, resulting in decreased secretion of monomeric hIAPP protein into the cytoplasm. In the present study, the results of the Western blot analysis and radioimmunoassay only showed mature monomeric IAPP. Therefore, the results shown in Fig. 4b, c showed the expression levels of mature monomeric hIAPP in the cells, which accounted for the lack of a positive correlation between the level of IAPP protein expression and level of IAPP gene expression. The transfection efficiencies in different groups of cells might
vary, which would have an impact on the final results. In addition, oxidative stress would affect hIAPP aggregation in the cells [26, 27]. The present study showed that the transcription factors Pdx-1, MafA and NeuroD1 effectively stimulated the transcriptional activity of PIP. In addition, the transfection of non-b cells with the hIAPP overexpression vector resulted in the expression of hIAPP mRNA but not the mature hIAPP protein. Therefore, the successful construction of transgenic animals must take into account whether the constructed exogenous target gene can be efficiently transcribed into mRNA and subsequently translated into functional protein to exert physiological functions in the target cells. Acknowledgments We thank Bingjun Hu and Siyuan Kong for tissue preparation. This research was supported by the National Natural Science Foundation of China (31372276), the Agricultural Science and Technology Innovation Program (ASTIP-IAS05), Development Program of China (SQ2011AAJY2795), National Key Technology Support Program (2012BAI39B04, 2011BAI15B02), The National Basic Research Program (2011CBA01005), National Science and Technology Major Project (2014ZX08010-003).
References 1. Alberti KG, Zimmet PZ (1998) Definition, diagnosis and classification of diabetes mellitus and its complications. Part 1: diagnosis and classification of diabetes mellitus provisional report of a WHO consultation. Diabet Med 15(7):539–553 2. Grzech M, Dahlhoff M, Herbach N et al (2010) Specific transgene expression in mouse pancreatic b-cells under the control of the porcine insulin promoter. Mol Cell Endocrinol 315(1–2):219–224 3. Han S, Yasuda K, Kataoka K (2011) ATF2 Interacts with b-Cellenriched transcription factors, MafA, Pdx1, and Beta2, and activates insulin gene transcription. J Biol Chem 286(12):10449–10456 4. Docherty HM, Hay CW, Ferguson LA et al (2005) Relative contribution of PDX-1, MafA and E47/b2 to the regulation of the human insulin promoter. Biochem J 389(Pt3):813–820 5. Shao SY, Fang Z, Yu XF et al (2009) Transcription factors involved in glucose-stimulated insulin secretion of pancreatic beta cells. Biochem Biophys Res Commun 384(4):401–404 6. Barrow J, Hay CW, Ferguson LA et al (2006) Transcription factor cycling on the insulin promoter. FEBS Lett 580(2): 711–715 7. Al-Quobaili F, Montenarh T (2008) Pancreatic duodenal homeobox factor-1 and diabetes mellitus type 2 (Review). Int J Mol Med 21(4):399–404 8. Aramata S, Han S, Yasuda K et al (2005) Synergistic activation of the insulin gene promoter by the b-cell enriched transcription factors MafA, Beta 2, and Pdx1. J Biol Chem 286(12): 10449–10456 9. Kaneto H, Miyatsuka T, Kawamori D et al (2007) Pleiotropic roles of PDX-1 in the pancreas. Rev Diabet Stud 4(4):209–225 10. Rudnik A, Ling TY, Odagiri H et al (1994) Pancreatic b ells express a diverse set of homeobox genes. Proc Natl Acad Sci USA 91:12203–12207 11. Kaneto H, Matsuoka T, Kawashima S et al (2009) Role of MafA in pancreatic b-cells. Adv Drug Deliv Rev 61:489–496
123
Mol Cell Biochem 12. Wolf G, Hessabi B, Karkour A et al (2010) The activation of the rat insulin gene by BETA2 and PDX-1 in Rat Insulinoma Cells Is Repressed by Pax6. Mol Endocrinol 24(12):2331–2342 13. Song YD, Lee EJ, Yashar P et al (2007) Islet cell differentiation in liver by combinatorial expression of transcription factors neurogenin-3, BETA2, and RIPE3b1. Biochem Biophys Res Commun 354(2):334–339 14. Westemark P (2011) Amyloid in the islets of Langerhans: thoughts and some historical aspects. Ups J Med Sci 116(2):81–89 15. Kurganov B, Doh M, Arispe N (2004) Aggregation of liposomes induced by the toxic peptides Alzheimer’s, human amylin and prion(106–126): facilitation by membrane-bound GMI ganglioside. Peptides 25(2):217–232 16. Matveyenko AV, Butler PC (2006) Islet amyloid polypeptide (IAPP) transgenic rodents as models for type 2 diabetes. ILAR J 47(3):225–233 17. Raikwar SP, Zavazava N (2012) PDX1-engineered embryonic stem cell-derived insulin producing cells regulate hyperglycemia in diabetic. Transplant Res 1(1):19 18. Hang Y, Stein R (2011) MafA and MafB activity in pancreatic b cells. Trends Endocrinol Metab 22(9):364–373 19. Keller DM, McWeeney S, Arsenlis A et al (2007) Characterization of pancreatic transcription factor Pdx-1 binding sites using promoter microarray and serial analysis of chromatin occupancy. J Biol Chem 282(44):32084–32092
123
20. Babu DA, Chakrabarti SK, Garmey JC et al (2008) Pdx1 and BETA2/NeuroD1 participate in a transcriptional complex that mediates short-rang DNA looping at the insulin gene. J Biol Chem 283(13):8164–8172 21. Bernardo AS, Hay CW, Docherty K et al (2008) Pancreatic transcription factors and their role in the birth, life and survival of the pancreatic b cell. Mol Cell Endocrinol 294(1–2):1–9 22. Fu Z, Gilbert ER, Liu D (2013) Regulation of insulin synthesis and secretion and pancreatic Beta-cell dysfunction in diabetes. Curr Diabetes Rev 9(1):25–53 23. Zhao L, Guo M, Matsuoka TA et al (2005) The islet b Cellenriched MafA activator is a key regulator of insulin gene transcription. J Biol Chem 280(12):11887–11894 24. Marzban L, Rhodes CJ, Steiner DF et al (2006) Impaired NH2terminal processing of human proislet amyloid polypeptide by the prohormone convertase PC2 leads to amyloid formation and cell death. Diabetes 55(8):2192–2201 25. Watanabe M, Umeyama K, Kawano HO et al (2007) The production of a diabetic mouse using constructs encoding porcine insulin promoter-driven mutant human hepatocyte nuclear factor1. J Reprod Dev 53(2):189–200 26. Paulsson JF, Westermark GT (2005) Aberrant processing of human proislet amyloid polypeptide results in increased amyloid formation. Diabetes 54(7):2117–2125 27. Bonner-Weir S, O’Brien TD (2008) Islet in type 2 diabetes. In honor of Dr. Robert C. Turner. Diabetes 57(11):2899–2904
The study of regulatory effects of Pdx-1, MafA and NeuroD1 on the activity of porcine insulin promoter and the expression of human islet amyloid polypeptide Xiao-Dan Liu • Jin-Xue Ruan • Ji-Han Xia Shu-Lin Yang • Jun-Hua Fan • Kui Li
•
Received: 13 March 2014 / Accepted: 3 May 2014 Ó Springer Science+Business Media New York 2014
Abstract The purpose of the present study was to determine the activation of porcine insulin promoter (PIP) by three transcription factors: pancreatic and duodenal homeobox 1 (Pdx-1), v-maf musculoaponeurotic fibrosarcoma oncogene (MafA) and neurogenic differentiation 1 (NeuroD1) in non-beta islet cells cultured in vitro. In addition, the expression of the exogenous human islet amyloid polypeptide (hIAPP) gene driving by PIP in porcine kidney 15 (PK15) cells co-transfected with these transcription factors was also examined. In the present study, a series of vectors for gene overexpression were constructed, including pGL3-Pdx-1, pGL3-MafA, pGL3NeuroD1, pGL3-PIP-LUC and pcDNA3.1-PIP-hIAPP. The dual-luciferase reporter assay showed that the PIP activity was increased in PK15 cells when overexpressing the exogenous transcription factors Pdx-1, MafA and NeuroD1. Introducing the PIP-hIAPP expression vector into PK15 cells combined with exogenous Pdx-1, MafA and NeuroD1 resulted in the efficient expression of hIAPP at the gene level, but not the protein. The current systematic porcine insulin promoter analysis provided the basic information for future utilization of porcine insulin.
Abbreviations PIP Porcine insulin promoter Pdx-1 p Pancreatic and duodenal homeobox 1 MafA v-maf musculoaponeurotic fibrosarcoma oncogene NeuroD1 Neurogenic differentiation 1 hIAPP Human islet amyloid polypeptide PK15 Porcine kidney 15 cell INS Insulin PCAF P300/CBP-associated factor bHLH Basic helix-loop-helix qPCR Quantitative real-time polymerase chain reaction CDS The coding DNA sequences NCBI The National Center for Biotechnology Information LUC The luciferase GAPDH Glyceraldehyde-3-phosphate dehydrogenase RIP The rat insulin 1 promoter HIP The human insulin promoter
Introduction Keywords Insulin promoter Transcription factor Luciferase Human islet amyloid polypeptide PK15 cell
X.-D. Liu J.-X. Ruan J.-H. Xia S.-L. Yang (&) J.-H. Fan K. Li Key Laboratory for Farm Animal Genetic Resources and Utilization of Ministry of Agriculture of China, Institute of Animal Science, Chinese Academy of Agricultural Science, Beijing 100193, People’s Republic of China e-mail: [email protected] X.-D. Liu e-mail: [email protected]
Type 2 diabetes mellitus is mainly characterized by insulin resistance, which may be combined with impaired insulin secretion. As type 2 diabetes progresses, insulin secretion usually decreases to below normal levels, which is accompanied by insulin resistance [1]. Therefore, structural and functional damage to pancreatic islet b cells and b cells apoptosis play important roles in the development and progression of type 2 diabetes. Due to the similarities between pigs and humans in terms of anatomy, physiology and nutritional metabolism, pigs have been considered a suitable animal for modeling human metabolic diseases [2].
123
Mol Cell Biochem
However, the process of establishing pig diabetes models and evaluating the diabetic phenotypes of the pigs is rather lengthy. The study of the regulation of pancreatic b cell function through genetic modifications at the individual level is time consuming. In addition, b cells are terminally differentiated somatic cells. It is difficult to achieve efficient gene transfer to the isolated and cultured b cells. Therefore, the construction of biological models using nonb cells to study gene expression and regulation in b cells is of great significance for generating genetically modified pigs and for studying target gene functions. The human islet amyloid polypeptide (hIAPP) and insulin (INS) genes are specifically expressed in pancreatic islet b cells. The cis-acting elements in porcine insulin promoter (PIP) include A, C and E elements [3, 4], which interact with the transcription factors pancreatic and duodenal homeobox 1 (Pdx-1), v-maf musculoaponeurotic fibrosarcoma oncogene (MafA) and neurogenic differentiation 1 (NeuroD1), respectively [3–6] The A box in the insulin promoter consists of up to five regulatory elements [7], including A5, A3, A2, A1 and GG2 [8]. The A box is rich in adenine/thymine (A/T) bases. The DNA motif 50 CC [CT] TAAT [TG]-30 serves as a binding site for Pdx-1. In the motif, TAAT is the core region that interacts with the Pdx-1 protein [9], a member of the homeobox protein family [3–7, 9, 10]. The transcription factor MafA binds to the C1 element in the insulin promote [3–6, 11]. MafA is mainly present in the nuclei of pancreatic islet b cells. MafA binds to DNA as a dimer and interacts with other transcription factors [4], such as NeuroD1, P300/CBPassociated factor (PCAF) and Pdx-1, to stimulate transcriptional activity. The core sequence of the E element is 50 -CANNTG-30 [12], which serves as the binding site for proteins of the basic helix-loop-helix (bHLH) family. The trans-acting factors that interact with the E element mainly include NeuroD1 (also known as BETA2) [3–6, 13], E2/5, E12 and E7. NeuroD1 is abundant in pancreatic islet, whereas E2/5 and E47 are widely distributed. NeuroD1 forms heterodimers with other bHLH proteins such as E47 [3]. The heterodimers bind to the E element and stimulate the transcriptional activity of the promoter [4]. Studies have shown that all three transcription factors, Pdx-1, MafA and NeuroD1, efficiently activate transcription from murine and human insulin promoters. However, the three transcription factors exert distinct effects on the insulin promoters of different species [4]. Approximately 90 % of patients with type 2 diabetes show hIAPP precipitation-induced b cell apoptosis in pancreatic islets. The amyloid precipitates are primarily composed of extracellular hIAPP multimers. hIAPP is composed of 37 amino acids and is secreted simultaneously with insulin [14–16]. Humans, non-human primates and cats express a type of IAPP that forms amyloid protein,
123
while IAPPs in rodents and pigs fail to form amyloid protein. Interspecies variations in the amino acid sequence of IAPP are mainly observed at residues 20–29 [15]. These residues (AILSS) display the most prominent effect on amyloid fibril formation. Studies have shown that both hIAPP and insulin are synthesized and secreted by pancreatic b cells. Under physiological conditions, hIAPP collaborates with blood sugar, regulating hormones such as insulin to precisely control blood glucose levels in humans. Studies have also indicated that hIAPP has a strong tendency to misfold and form amyloid polypeptides [15]. hIAPP is currently known to be one of the polypeptides with the greatest capacity for the formation of amyloid aggregates [15]. It is capable of interacting with the lipid membrane and destroying the cell membrane barrier. In addition, multimeric hIAPP interrupts b cell coupling and induces b cell apoptosis [14, 15]. Therefore, the formation of hIAPP amyloid deposition is considered to be an important pathogenic factor for type 2 diabetes. The present study focused on the regulatory effects of the transcription factors Pdx-1, MafA and NeuroD1 on transcription from PIP in non-b cells and the feasibility of constructing a cellular model to control target gene expression in non-b cells.
Materials and methods Materials The porcine kidney cell line (PK15) and the human pancreatic carcinoma cell line (Panc-1) were obtained from the Research Center of Basic Medical Science at the Institute of Basic Medical Sciences Chinese Academy of Medical Sciences (IBMSCAMS, Beijing, China). The DH5a competent bacterial cells were purchased from GeneWiz Biotechnology Co., Ltd (Beijing, China). The endotoxin-free plasmid extraction kit was purchased from Tiangen Biotech (Beijing, China) Co., Ltd. Restriction enzymes were purchased from NEB (USA). The LipofectamineTM 2,000 liposomal transfection reagent was purchased from Invitrogen (USA). The Dual-Luciferase Reporter Assay kit was purchased from Progema (USA). The high purity total RNA extraction kit was purchased from Biotake (China). The reverse transcription reagent kit was purchased from Thermo Scientific (USA). SYBR Ò Premix Ex TaqTM was purchased from Takara (Japan). The total cellular protein extraction kit and protein assay kit were purchased from Thermo Scientific (USA). The anti-hIAPP primary antibody was purchased from Santa Cruz Biotechnology, Inc. (USA). The anti-b-actin primary antibody was purchased from Abcam (UK). All secondary antibodies were purchased from Beijing Cowin Biosciences Co., Ltd (Beijing, China).
Mol Cell Biochem Table 1 Primer information
Gene name Pdx-1 MafA NeuroD1 hIAPP GAPDH
Primer sequence (50 –30 )
Length of PCR product (bp)
pdx1-f
AAGTCTACCAAGGCTCACGC
159
pdx1-r
GCGCGGCCTAGAGATGTATT
Primer name
mafa-f
AGGAGGAGGTCATCCGGCTC
mafa-r
TTGTACAGGTCCCGCTCTTTG
neurod1-f
TCTTGCGTTCAGGCAAAAGC
neurod1-f
AAGTCCGAGGATTGAGCTGC
hiapp-f
ACCATCTGAAAGCTACACCCAT
hiapp-r
GGCACCAAAGTTGTTGCTGG
gapdh-f
AGGGCATCCTGGGCTACACT
gapdh-r
TCCACCACCCTGTTGCTGTAG
Gene expression in muscle, liver, pancreatic and kidney tissues Four types of tissue samples (muscle, liver, pancreas and kidney) were collected from Wuzhishan miniature pigs. Total RNA was extracted from the tissue samples. The expression levels of the transcription factors Pdx-1, MafA and NeuroD1 were analyzed by quantitative real-time polymerase chain reaction (qPCR). The sequences of the primers utilized in qPCR are summarized in Table 1. Plasmids The Pdx-1, MafA and NeuroD1 genes were synthesized by Shanghai Generay Biotech Co., Ltd. (China) according to the coding DNA Sequences (CDS) stored in the National Center for Biotechnology Information (NCBI) database. They were cloned into the NcoI/XbaI restriction sites of the pGL3-control vector to replace the original luciferase (LUC) gene. The resulting recombinant plasmid vectors were named pGL3-Pdx-1, pGL3-MafA and pGL3-NeuroD1, respectively. The PIP sequences [2] and hIAPP gene according to the coding DNA Sequences (CDS) stored in the NCBI database were synthesized by Shanghai Generay Biotech Co., Ltd. (China) They were cloned into the MfeI/Bst1107I restriction sites of the pcDNA3.1(?) plasmid. The resulting recombinant plasmid was named pcDNA3.1-PIP-hIAPP. To construct vector of overexpression of reporter, the following upstream and downstream primers were designed and synthesized using the PIP-containing plasmid pcDNA3.1-PIP-hIAPP: F: 50 -gcGAGCTCGAGTTCAGCTGAGCT-30 ; SacI R: 50 -cccAAGCTTgggAGGACCTGGGGGAC-30 . HindIII
187 117 122 166
The SacI and HindIII restriction enzyme sites were added to the ends of the primers (lowercase letters indicated the protected bases). A fraction of the PIP approximately 1,500 bp in length was amplified by PCR. The PCR products were verified by electrophoresis on a 1 % agarose gel, and the target fragment was recovered from the gel. The recovered fragment was incubated with the pGM-T cloning vector at 4 °C overnight to generate the pGM-T-PIP recombinant plasmid, which was then transformed into DH5a competent cells. The pGM-T-PIP recombinant plasmid was extracted, digested with the restriction endonucleases SacI and HindIII and subjected to electrophoresis on a 1 % agarose gel. The DNA fragment of approximately 1,500 bp was recovered from the agarose gel. Meanwhile, the pGL3-basic plasmid was digested with the restriction endonucleases SacI and HindIII, and the resulting DNA fragments were separated by electrophoresis on a 0.7 % agarose gel. A DNA fragment of approximately 4,800 bp was recovered from the agarose gel. The 1,500 and 4,800 bp fragments were ligated overnight at 4 °C and transformed into DH5a competent cells. The recombinant plasmid pGL3-PIPLUC was extracted.
Reporter assay PK15 cells were cultured in 24-well cell culture plates to 80–90 % confluency and then subjected to transfection using the lipofectamineTM 2000 reagent according to the manufacturer’s instructions. The PK15 cells in each well were transfected with a total of 1.6 lg plasmids, including 800 ng of pGL3-PIP-LUC, 200 ng of pRL-TK, 200 ng of an expression vector encoding one of the transcription factors and the pGL3-basic plasmid. In addition, the PK15 negative control group was transfected with pEGFP to determine the transfection efficiency. The plasmids
123
Mol Cell Biochem Table 2 List of the plasmids transfected into various groups of PK15 cells Experimental group
1
2
3
4
5
6
7
8
pGL3-PIP-LUC
?
?
?
?
?
?
?
?
pRL-TK
?
?
?
?
?
?
?
?
pGL3-Pdx-1
-
?
-
-
?
?
-
?
pGL3-MafA
-
-
?
-
?
-
?
?
pGL3-NeuroD
-
-
-
?
-
?
?
?
‘‘ ? ’’ indicates that the plasmid was used to transfect PK15 cells, ‘‘ - ’’ indicates untransfected plasmid Table 3 List of the plasmids transfected into various groups of cells Experimental group
1
2
3
4
5
6
7
Cell type
PK15
pcDNA3.1-PIP-hIAPP pEGFP
? ?
? ?
? ?
? ?
? ?
? ?
? ?
pGL3-Pdx-1
-
?
-
-
?
?
pGL3-MafA
-
-
?
-
?
pGL3-NeuroD
-
-
-
?
-
8
9 Panc-1
Fig. 1 The expression levels of the three transcription factors in muscle, liver, kidney and pancreas
? ?
? ?
Data analysis
–
?
-
-
?
?
-
?
?
?
-
‘‘ ? ’’ indicates that the plasmid was transfected into the PK15 cells, ‘‘ - ’’ indicates untransfected plasmids
transfected into various groups of PK15 cells are summarized in Table 2. Firefly and Renilla luciferase activities were determined in extracts of transfected cells using the Dual-Luciferase Reporter Assay System 48 h posttransfection. hIAPP expression analysis The PK15 and Panc-1 cell lines were cultured in 24-well cell culture plates to 80–90 % confluency and then subjected to eukaryotic cell transfection using the lipofectamineTM 2000 reagent according to the manufacturer’s instructions. The cells in each well were transfected with 800 ng of pcDNA3.1-PIP-hIAPP plasmid, 200 ng of pRL-TK plasmid and 200 ng of an expression vector encoding one of the transcription factors. In addition, the cells were transfected with the pGL3-basic plasmid, which brought the total amount of the plasmids in the transfections to 1.6 lg. The Panc-1 positive control group was transfected with 800 ng of pcDNA3.1-PIP-hIAPP plasmid, 200 ng of pEGFP plasmid and 600 ng of pGL3-basic plasmid. The cells were divided into two large groups (groups I and II) for the analysis of the RNA and protein expression levels. Each large group was further divided into nine small subgroups. The plasmids transfected into each group of cells are shown in Table 3. Cells in group I were analyzed by qPCR 36 h post-transfection, and cells in group II were analyzed by Western blot and radioimmunoassays 36 h post-transfection.
123
Data analysis was performed using the SPSS version 19.0 software. Mean values and standard deviations of the luciferase assay data were calculated and utilized to construct bar graphs in Excel.
Results The expression of transcription factors in the muscle, liver, pancreatic and kidney tissues The mRNAs expressed in the muscle, liver, pancreatic and kidney tissues of the Wuzhishan miniature pigs were analyzed by qPCR. The gene expression levels of the transcription factors Pdx-1, MafA and NeuroD1 in all four tissues are shown in Fig. 1. The results showed that the gene expression levels of the transcription factors Pdx-1, MafA and NeuroD1 in the pancreas were significantly higher than those in the other three tissues, indicating that all three transcription factors were specifically expressed in pancreatic cells. Restriction enzyme digestion of plasmids The pGL3-Pdx-1, pGL3-MafA and pGL3-NeuroD1 plasmids were subjected to single restriction endonuclease digestion with HindIII (Fig. 2A) and double restriction endonuclease digestion with HindIII/XbaI (Fig. 2B). The recombinant vector pGL3-PIP-LUC was subjected to single restriction endonuclease digestion with HindIII and double restriction endonuclease digestion with HindIII/ ScaI (Fig. 2C). The pcDNA3.1-PIP-hIAPP plasmid was subjected to single restriction endonuclease digestion by MfeI and double restriction endonuclease digestion by MfeI/Bst1107I (Fig. 2D). The results of agarose gel
Mol Cell Biochem Fig. 2 Electrophoretic bands of plasmids after restriction enzyme digestion. A pGL3-Pdx1, pGL3-MafA and pGL3NeuroD1 digested by single restriction enzyme, B pGL3Pdx-1, pGL3-MafA and pGL3NeuroD1 digested by double restriction enzyme, C pGL3PIP-LUC digested by restriction enzyme, D pcDNA3.1-PIPhIAPP digested by restriction enzyme, 1–5: pGL3-Pdx-1, pGL3-MafA, pGL3-NeuroD1, pGL3-PIP-LUC and pcDNA3.1PIP-hIAPP plasmid, s: single restriction enzyme digestion, d: double restriction enzyme digestion
electrophoresis showed that sizes of the bands were consistent with sizes of the corresponding restriction fragments. Dual-luciferase activity assay At 48 h after transfection, the activities of the two luciferase were examined. The relative luciferase activity in each group of cells is shown in Fig. 3. Among these transcription factors, MafA exerted the strongest stimulatory effect on PIP when acting alone, resulting in an approximate 15-fold increase in PIP activity (P \ 0.05). Pdx-1 collaborated with either MafA or NeuroD1 and displayed a cumulative effect on PIP activation. MafA and NeuroD1 interacted with each other and exerted a strong synergistic stimulation of PIP activity, resulting in an approximate 40-fold activation of PIP compared with cells lacking any transcription factor (P \ 0.05). All three transcription factors might interact with PIP jointly. However, the stimulatory effect on PIP activity was weaker than the synergistic effect of MafA and NeuroD1. The results demonstrated that the activity of the luciferase was significantly increased in PK15 cells co-transfected with the transcription factor overexpression vectors in comparison with cells lacking the transcription factors. Examine hIAPP expression in pcDNA3.1-PIP-hIAPP transfected cells qPCR was performed using hIAPP as the target gene and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) as the reference gene. The qPCR data were analyzed and plotted using the 2-DDCt method, and the fluorescencebased quantitative expression profile of the hIAPP gene is
Fig. 3 Examination of the activities of the dual-luciferase reporter gene in PK15 cells
shown in Fig. 4A. The results of qPCR showed that the expression level of the hIAPP gene was markedly increased in PK15 cells transfected with the transcription factor overexpression vectors. This result indicated that the high level of hIAPP expression driven by PIP was achieved in the presence of transcription factors that specifically interacted with PIP. The results of the Western blot analysis (Fig. 4B) and radioimmunoassay (Fig. 4C) showed that there was no significant differences in the expression levels of the mature hIAPP protein in PK15 cells transfected with the different transcription factors and control. In contrast, the expression level of the mature hIAPP protein displayed an approximate four fold increase in Panc-1 cells. Compared with the results of qPCR shown in Fig. 4A, hIAPP expression at the gene level did not positively correlate
123
Mol Cell Biochem
Fig. 4 Examination of hIAPP gene expression in PK15 cells. qPCR (A), Western blot (B), Radioimmunoassay (C)
with hIAPP expression at the protein level in PK15. These results indicated in PK15 cells hIAPP mRNA failed to produce the mature hIAPP protein efficiently.
Discussion The cis-acting elements in PIP interact with trans-acting factors that are expressed in a tissue-specific and timespecific fashion to regulate insulin gene transcription. Various transcription factor binding sites are located 300–400 bp upstream of the insulin gene and interact with transcription factors primarily expressed in the pancreas. The transcription factors Pdx-1, MafA and NeuroD1 bind to the A, C and E elements in the insulin promoter [3, 4], respectively, and regulate the transcriptional activity of the insulin promoter [4, 7, 17, 18]. In mammals, the sequences of the cis-acting elements in the insulin promoter are highly conserved. A large number of studies investigated the effects of the transcription factors Pdx-1 [19–22], MafA [22, 23] and NeuroD1 [20, 22] on the activities of the mouse and human insulin promoters [7, 20]. These transcription factors, alone or together, interact with the murine and human insulin promoters and effectively enhance the expression of the downstream target genes [7]. A dualluciferase activity assay was performed in the present study, and the results indicated that all three transcription factors, Pdx-1, MafA and NeuroD1, activated PIP to a certain extent. These results indicated that the three transcription factors, acting alone or in collaboration, enhanced
123
to varying degrees the transcription of the luciferase gene under the control of PIP. When all three transcription factors interacted with PIP jointly, the stimulatory effect was weaker compared with the synergistic effect of MafA and NeuroD1. The mechanisms underlying this phenomenon might involve competition between Pdx-1 and MafA or NeuroD1 or the inhibition of the synergistic effect of MafA and NeuroD1 by Pdx-1. Hilary at el reported that Pdx-1 mediates the maximal transcriptional activation at the rat insulin 1 promoter (RIP) and the human insulin promoter (HIP) in Hela cells, resulting in four fold and 40-fold activation, respectively [4].In contrast, the other transcription factors exhibited significantly weaker effects on promoter activation [4]. Pdx-1, MafA and NeuroD1 exert a synergistic effect on the RIP but an addictive effect on HIP [4]. The results of the present study are somewhat inconsistent with the results obtained by Hilary et al. on RIP and HIP [4]. These inconsistent observations suggest that the transcription factors Pdx-1, MafA and NeuroD1 exert distinct regulatory effects on insulin promoters of different species, which might be related to nucleic acid sequences of cis-acting elements in different insulin promoters and secondary structures between the elements. Alternatively, these different regulatory effects may be related to the other factors in cells [12]. The translation of hIAPP mRNA in pancreatic islet b cells is a complex process that involves a variety of key enzymes. In pancreatic islet b cells, PC1/3 and PC2 are the key enzymes involved in hIAPP translation that are mainly expressed in the endocrine and neuroendocrine cells [17,
Mol Cell Biochem
24, 25]. The expression of PC2 and PC1/3 is restricted to endocrine or neuroendocrine cells during hormonal biosynthesis [26]. In cells lacking PC2 and PC 1/3, hIAPP mRNA cannot be translated into a mature protein. Significant differences were observed in hIAPP translation between the PK15 cells and the pancreatic islet b cells. The results of the protein expression analysis shown in Fig. 3 were compared to those in Fig. 4b, c. The transfection of PK15 cells with an exogenous luciferase vector containing PIP resulted in high-efficiency expression of the firefly luciferase protein. In contrast, PK15 cells transfected with an exogenous hIAPP expression vector containing PIP failed to produce the hIAPP protein efficiently. These results indicated the presence of specific regulatory pathways for the translation of the hIAPP gene. Paulsson et al. transfected the GH4C1 and COS7 cell lines that lack PC2 and PC1/3 expression with an h-proIAPP expression vector and then stained the cells with an antiserum specific for hIAPP. The results revealed the presence of large amounts of precipitate particles around the nucleus. In addition, after the AtT-20 cell line that expresses PC1/3 but not PC2 was transfected with exogenous h-proIAPP expression vector, the immunofluorescence assay detected a small amount of precipitate particles in the vicinity of the nucleus. Both types of transfected cell lines were also stained with Congo red. After staining, the precipitate particles displayed strong green fluorescence under polarized light, indicating that the particles were amyloid protein multimers. In the absence of PC1/3, PC2 also exhibited the ability to cleave proIAPP to some extent. The transfection of the GH3 cell line that solely expresses PC2 with vectors expressing h-proIAPP resulted in the appearance of aggregates in the cytoplasm. No precipitate particles were observed near the nucleus. An immunofluorescence analysis showed that these aggregates were different from the ones found in the GH4C1, COS7 and AtT-20 cell lines. Moreover, the aggregates could not be stained with Congo red, indicating that these particles were not amyloid protein multimers [26]. Non-b cells such as PK15 lack the regulated secretory pathway and enzymes (PC2 and PC1/3) that convert the IAPP propeptide to mature IAPP. Therefore, large amounts of proIAPP accumulate in the vicinity of the nucleus. Immature hIAPP and proIAPP form early human islet amyloid protein multimers in the vicinity of the nucleus, resulting in decreased secretion of monomeric hIAPP protein into the cytoplasm. In the present study, the results of the Western blot analysis and radioimmunoassay only showed mature monomeric IAPP. Therefore, the results shown in Fig. 4b, c showed the expression levels of mature monomeric hIAPP in the cells, which accounted for the lack of a positive correlation between the level of IAPP protein expression and level of IAPP gene expression. The transfection efficiencies in different groups of cells might
vary, which would have an impact on the final results. In addition, oxidative stress would affect hIAPP aggregation in the cells [26, 27]. The present study showed that the transcription factors Pdx-1, MafA and NeuroD1 effectively stimulated the transcriptional activity of PIP. In addition, the transfection of non-b cells with the hIAPP overexpression vector resulted in the expression of hIAPP mRNA but not the mature hIAPP protein. Therefore, the successful construction of transgenic animals must take into account whether the constructed exogenous target gene can be efficiently transcribed into mRNA and subsequently translated into functional protein to exert physiological functions in the target cells. Acknowledgments We thank Bingjun Hu and Siyuan Kong for tissue preparation. This research was supported by the National Natural Science Foundation of China (31372276), the Agricultural Science and Technology Innovation Program (ASTIP-IAS05), Development Program of China (SQ2011AAJY2795), National Key Technology Support Program (2012BAI39B04, 2011BAI15B02), The National Basic Research Program (2011CBA01005), National Science and Technology Major Project (2014ZX08010-003).
References 1. Alberti KG, Zimmet PZ (1998) Definition, diagnosis and classification of diabetes mellitus and its complications. Part 1: diagnosis and classification of diabetes mellitus provisional report of a WHO consultation. Diabet Med 15(7):539–553 2. Grzech M, Dahlhoff M, Herbach N et al (2010) Specific transgene expression in mouse pancreatic b-cells under the control of the porcine insulin promoter. Mol Cell Endocrinol 315(1–2):219–224 3. Han S, Yasuda K, Kataoka K (2011) ATF2 Interacts with b-Cellenriched transcription factors, MafA, Pdx1, and Beta2, and activates insulin gene transcription. J Biol Chem 286(12):10449–10456 4. Docherty HM, Hay CW, Ferguson LA et al (2005) Relative contribution of PDX-1, MafA and E47/b2 to the regulation of the human insulin promoter. Biochem J 389(Pt3):813–820 5. Shao SY, Fang Z, Yu XF et al (2009) Transcription factors involved in glucose-stimulated insulin secretion of pancreatic beta cells. Biochem Biophys Res Commun 384(4):401–404 6. Barrow J, Hay CW, Ferguson LA et al (2006) Transcription factor cycling on the insulin promoter. FEBS Lett 580(2): 711–715 7. Al-Quobaili F, Montenarh T (2008) Pancreatic duodenal homeobox factor-1 and diabetes mellitus type 2 (Review). Int J Mol Med 21(4):399–404 8. Aramata S, Han S, Yasuda K et al (2005) Synergistic activation of the insulin gene promoter by the b-cell enriched transcription factors MafA, Beta 2, and Pdx1. J Biol Chem 286(12): 10449–10456 9. Kaneto H, Miyatsuka T, Kawamori D et al (2007) Pleiotropic roles of PDX-1 in the pancreas. Rev Diabet Stud 4(4):209–225 10. Rudnik A, Ling TY, Odagiri H et al (1994) Pancreatic b ells express a diverse set of homeobox genes. Proc Natl Acad Sci USA 91:12203–12207 11. Kaneto H, Matsuoka T, Kawashima S et al (2009) Role of MafA in pancreatic b-cells. Adv Drug Deliv Rev 61:489–496
123
Mol Cell Biochem 12. Wolf G, Hessabi B, Karkour A et al (2010) The activation of the rat insulin gene by BETA2 and PDX-1 in Rat Insulinoma Cells Is Repressed by Pax6. Mol Endocrinol 24(12):2331–2342 13. Song YD, Lee EJ, Yashar P et al (2007) Islet cell differentiation in liver by combinatorial expression of transcription factors neurogenin-3, BETA2, and RIPE3b1. Biochem Biophys Res Commun 354(2):334–339 14. Westemark P (2011) Amyloid in the islets of Langerhans: thoughts and some historical aspects. Ups J Med Sci 116(2):81–89 15. Kurganov B, Doh M, Arispe N (2004) Aggregation of liposomes induced by the toxic peptides Alzheimer’s, human amylin and prion(106–126): facilitation by membrane-bound GMI ganglioside. Peptides 25(2):217–232 16. Matveyenko AV, Butler PC (2006) Islet amyloid polypeptide (IAPP) transgenic rodents as models for type 2 diabetes. ILAR J 47(3):225–233 17. Raikwar SP, Zavazava N (2012) PDX1-engineered embryonic stem cell-derived insulin producing cells regulate hyperglycemia in diabetic. Transplant Res 1(1):19 18. Hang Y, Stein R (2011) MafA and MafB activity in pancreatic b cells. Trends Endocrinol Metab 22(9):364–373 19. Keller DM, McWeeney S, Arsenlis A et al (2007) Characterization of pancreatic transcription factor Pdx-1 binding sites using promoter microarray and serial analysis of chromatin occupancy. J Biol Chem 282(44):32084–32092
123
20. Babu DA, Chakrabarti SK, Garmey JC et al (2008) Pdx1 and BETA2/NeuroD1 participate in a transcriptional complex that mediates short-rang DNA looping at the insulin gene. J Biol Chem 283(13):8164–8172 21. Bernardo AS, Hay CW, Docherty K et al (2008) Pancreatic transcription factors and their role in the birth, life and survival of the pancreatic b cell. Mol Cell Endocrinol 294(1–2):1–9 22. Fu Z, Gilbert ER, Liu D (2013) Regulation of insulin synthesis and secretion and pancreatic Beta-cell dysfunction in diabetes. Curr Diabetes Rev 9(1):25–53 23. Zhao L, Guo M, Matsuoka TA et al (2005) The islet b Cellenriched MafA activator is a key regulator of insulin gene transcription. J Biol Chem 280(12):11887–11894 24. Marzban L, Rhodes CJ, Steiner DF et al (2006) Impaired NH2terminal processing of human proislet amyloid polypeptide by the prohormone convertase PC2 leads to amyloid formation and cell death. Diabetes 55(8):2192–2201 25. Watanabe M, Umeyama K, Kawano HO et al (2007) The production of a diabetic mouse using constructs encoding porcine insulin promoter-driven mutant human hepatocyte nuclear factor1. J Reprod Dev 53(2):189–200 26. Paulsson JF, Westermark GT (2005) Aberrant processing of human proislet amyloid polypeptide results in increased amyloid formation. Diabetes 54(7):2117–2125 27. Bonner-Weir S, O’Brien TD (2008) Islet in type 2 diabetes. In honor of Dr. Robert C. Turner. Diabetes 57(11):2899–2904
