Vaccine 33 (2015) 3542–3548
Contents lists available at ScienceDirect
Vaccine journal homepage: www.elsevier.com/locate/vaccine
The swine CD81 enhances E2-based DNA vaccination against classical swine fever Wenliang Li a,∗ , Li Mao a , Bin Zhou b , Xia Liu a , Leilei Yang a , Wenwen Zhang a , Jieyuan Jiang a,∗ a Institute of Veterinary Medicine, Jiangsu Academy of Agricultural Sciences; Key Laboratory of Veterinary Biological Engineering and Technology, Ministry of Agriculture; National Center for Engineering Research of Veterinary Bio-products, Nanjing 210014, China b College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, China
a r t i c l e
i n f o
Article history: Received 13 February 2015 Received in revised form 11 May 2015 Accepted 21 May 2015 Available online 4 June 2015 Keywords: CSFV DNA vaccine CD81 E2 glycoprotein Adjuvant
a b s t r a c t Classical swine fever (CSF) is a highly contagious and economically important viral disease that affects the pig industry worldwide. The glycoprotein E2 of CSFV can induce neutralizing antibodies and protective immunity, and is widely used for novel vaccine development. The objective of this study was to explore whether a tetraspanin molecule CD81 could improve the immune responses of an E2-based DNA vaccine. Plasmids pVAX-CD81, pVAX-E2 and pVAX-CD81-E2 were constructed and the expression of target proteins was confirmed in BHK-21 cells by indirect immunofluorescence assay. BALB/c mice were divided into 5 groups and immunized with different plasmids (pVAX-E2, pVAX-CD81-E2, pVAXE2 + pVAX-CD81, pVAX-CD81 and PBS) three times with two weeks interval. The results showed that the introduction of CD81 promoted higher humoral and cellular immune responses than E2 expression alone (P < 0.05). In addition, immunization with pVAX-CD81-E2 induced stronger immune responses than pVAX-E2 + pVAX-CD81. Furthermore, four groups of pigs were immunized with pVAX-E2, pVAX-CD81E2, pVAX-CD81 and PBS, respectively. Humoral and cellular immune responses detection showed similar results with those in mice. Compared to pVAX-E2, pVAX-CD81-E2 induced higher titers of neutralizing antibodies after viral challenge and conferred stronger protection. These results confirmed the capacity of swine CD81 enhancing the humoral and cellular responses with an adjuvant effect on CSFV DNA vaccine. This is the first report demonstrating the adjuvant effect of CD81 to enhance the DNA vaccination for swine pathogen. © 2015 Elsevier Ltd. All rights reserved.
1. Introduction Classical swine fever (CSF) is a highly contagious disease, has severe impact on the swine industry worldwide [1]. The causative agent, classical swine fever virus (CSFV), belongs to the genus pestivirus of the Flaviviridae family, together with bovine viral diarrhea virus type 1 and 2 (BVDV 1, BVDV 2), border disease virus (BDV) and several newly found atypical pestiviruses [2,3]. In China, CSF is still one of the most important infectious diseases and the Hog cholera lapinized virus (HCLV) vaccine has been widely used to prevent and control the disease [4]. However, use of HCLV does not allow discrimination of infected and vaccinated animals (DIVA) [5].
∗ Corresponding authors. Institute of Veterinary Medicine, Jiangsu Academy of Agricultural Sciences, Nanjing 210014, China. Tel.: +86 25 84391152/+86 25 84391135; fax: +86 25 84390330. E-mail addresses: kfl[email protected] (W. Li), [email protected] (J. Jiang). http://dx.doi.org/10.1016/j.vaccine.2015.05.055 0264-410X/© 2015 Elsevier Ltd. All rights reserved.
Researches have been focused on the glycoprotein E2-based marker vaccines against CSF, and some of them were systemically evaluated and undergoing the licensing procedures [4,6], including the chimeric adenovirus/alphavirus vector-based vaccine rAdV-SFV-E2 [7] and the chimeric pestivirus-based vaccine CP7 E2alf [8]. Immune protection of E2-based DNA vaccines has been evaluated [9,10]. But the protective effect was not sufficient. Approaches have been described to co-deliver cytokines or adjuvant molecules to promote the immune responses, such as IL-3, IL-12, IL-18, CD40L, CCL20 and TRIF [11–14]. CD81, also named as TAPA-1, is a member of the tetraspanin superfamily of cell surface proteins [15]. CD81 plays important roles in adaptive immunity [16]. Researches have confirmed CD81 forms a B cell co-receptor complex with CD19, CD21, Iga, and Igb, and enhances B cell signaling during the process of B cell activation [17]; CD81 could promote IL-4 secretion and antibody production [18]; and also control the organization of the immune synapse (IS) and T cell activation [19]. In addition, the CD19/CD21/CD81
W. Li et al. / Vaccine 33 (2015) 3542–3548
molecular complex bridges the adaptive and innate immune systems [20]. But to date, no study has been done to identify the adjuvant effects of CD81. In this study, we examined the effect of CD81 for improving immune responses of the E2-based DNA vaccine in mice and pigs. Viral challenge has been done in pigs to examine the promotion of protection. 2. Materials and methods 2.1. CD81 antibody preparation Protein expression was performed as previously reported [21]. Briefly, the recombinant Escherichia coli strain BL21/pGEX-CD81LEL containing CD81 LEL region gene was grown in LB medium containing 50 g/mL ampicillin and induced by 0.5 mM IPTG for 4 h at 37 ◦ C. The cells were harvested by centrifugation at 8000 rpm for 10 min, resuspended in PBS, and then lysated by ultrasonication on ice. After centrifugation at 8000 g for 10 min at 4 ◦ C, the pellet was resuspended and purified by GST column (GenScript Co. Ltd., Nanjing, China) according to the manufacturer’s protocol. Rabbit was immunized with purified CD81LEL protein four times with 2week intervals (0.25 mg per time). Serum was harvested one week after the last immunization and identified by ELISA and western blot with GST-CD81LEL protein. 2.2. Construction of the eukaryotic expression plasmid pVAX-CD81, pVAX-E2 and pVAX-CD81-E2 RNA was extracted from CSFV C strain vaccine (TechBank Bio-tech Co. Ltd., Nanjing, China). A pair of primers kE2F: ATGGATCCGCCACCATGGTCGTGCAA and kE2R: TGCCTCGAGTCACTTTTCGAACTGCG containing BamHI site and kozak sequence in kE2F and XhoI in kE2R, respectively, were used for CSFV E2 gene amplification. The RT-PCR products were purified, digested with BamHI and XhoI followed by cloning into the same sites of the pVAX-1 vector, generating the recombinant plasmid pVAX-E2. Swine CD81 gene was amplified from pT-CD81 [21] using primers CD81F: CTAAAGCTTGCCACCATGGGGGTAGAGG and CD81R: CTAGGATCCTCGTACACCGAGCTGTT containing Hind III site and kozak sequence in CD81F and BamHI in CD81R, respectively, and cloned into pVAX-1 vector. As for pVAX-CD81-E2 construction, CD81 gene was amplified using primers CD81F and CD81R1: CTGGGATCCGTACACCGAGCTGTTCC, which doesn’t contain stop codon, digested and cloned into Hind III and BamHI digested pVAX-E2. All plasmids were confirmed by enzyme digestion and sequencing analysis. 2.3. Identification of protein expression by indirect immunofluorescence assays (iIFA) on BHK-21 cells The plasmids pVAX-CD81, pVAX-E2 and pVAX-CD81-E2 were extracted by AxyPrepTM Plasmid Miniprep kit (Axygen Co. Ltd., Hangzhou, China) and the concentration was measured by NanoDrop 2000 (Thermo). BHK-21 cells were grown in Dulbecco’s Modified Essential Medium (DMEM) containing 10% fetal bovine serum (FBS) at 37 ◦ C and 5% CO2 . The cells were seeded in 24-well plate 24 h before transfection to reach 80% confluence at transfection. pVAX-CD81, pVAX-E2 and pVAX-CD81-E2 were transfected into the cells using lipofectamineTM 2000 (Invitrogen, USA) according to the manufacturer’s instruction. After 48 h post-transfection, the expression of these proteins was detected by iIFA. Briefly, the cells were fixed with absolute ethyl alcohol at 4 ◦ C for 30 min, incubated with the primary rabbit polyclonal antibody against CD81 (1:200 diluted in PBS) or CSFV E2 specific monoclonal antibody (WH303, AHVLA, UK; 1:200 diluted in PBS) at 37 ◦ C for
3543
1 h. After three washes with PBS, the cells were incubated with Cy3-labeled goat anti-rabbit IgG (BOSTER, Wuhan, China) or FITClabeled goat anti-mouse IgG (BOSTER, Wuhan, China) 37 ◦ C for 30 min (1:200 diluted in PBS). After thorough washing, the fluorescence signals were observed under a fluorescence microscopy (ZEISS). 2.4. Immunization experiment in mice One hundred six-week-old female BALB/c mice were randomly divided into 5 groups (20 mice per group). All mice were injected with 50 L of lidocaine hydrochloride in the medialrectus muscle 24 h before plasmids inoculation. The mice of groups pVAXE2, pVAX-CD81-E2 and pVAX-E2 + pVAX-CD81 were vaccinated with corresponding plasmids (100 g pVAX-E2 plus 100 g pVAX1/mouse, 100 g pVAX-CD81-E2 plus 100 g pVAX-1/mouse, 100 g pVAX-E2 plus 100 g pVAX-CD81/mouse), respectively. Mice of groups pVAX-CD81 and NC were inoculated with pVAX-C81 (200 g/mouse) and PBS as control. The mice were boosted twice with 2-week intervals following the same inoculation protocols. Sera samples were collected at 0, 14, 28 and 42 days post immunization (dpi) and were stored at −20 ◦ C for antibody detection. At day of 0, 14, 28 and 42 dpi, five mice in each group were euthanatized; lymphocytes were separated from spleen and subjected to cellular immune responses detection. 2.5. Immunization and challenge experiment in pigs Sixteen four-week-old piglets (free of CSFV, PRRSV and PCV2 infection) were randomly divided into 4 groups. The pigs of groups pVAX-E2 and pVAX-CD81-E2 were vaccinated with pVAXE2 (0.5 mg/pig) and pVAX-CD81-E2 (0.5 mg/pig), respectively. Pigs of groups pVAX-CD81 and NC were inoculated with pVAX-CD81 (0.5 mg/pig) and PBS as control. The pigs were boosted twice with 2-week intervals following the same inoculation protocols. Sera samples were collected at 0, 14, 28 and 42 dpi and were stored at −20 ◦ C. At day of 0, 14, 28 and 42 dpi, blood was collected from each pig and PBMCs were separated for cellular immune responses detection. Pigs in groups pVAX-E2, pVAX-CD81-E2 and pVAX-CD81 were intranasally challenged at 56 dpi with 105 TCID50 CSFV Shimen strain (from the China Institute of Veterinary Drug Control). The rectal body temperature and clinical signs were monitored daily; and the serum samples were collected at 0, 4, 7, 10 and 14 days post challenge (dpc) for viremia and antibody detection. 2.6. Humoral immune response detection 2.6.1. iELISA The levels of E2-specific IgG antibodies in mouse and pig serum samples were determined using iELISA. Briefly, baculovirusexpressed E2 protein (0.4 g/well) was coated in the 96-well ELISA plate (Costar) overnight at 4 ◦ C, and then the plates were blocked with 5% skim milk in PBST. Sera from each group (1:100 diluted) were added and incubated at 37 ◦ C for 1 h. After washed with PBST for three times, each well received 100 L of 1/2000 diluted HRPlabeled goat anti-mouse IgG (Transgen Co. Ltd., Beijing, China). Finally, the plates were washed thoroughly followed by adding 100 L TMB solution (Beyotime Biotech., China). The absorbance of each well was read in a spectrophotometer (BIO-TEK) at 450 nm. 2.6.2. Blocking ELISA CSFV specific antibodies presented in mouse and pig serum samples were tested by CSFV antibody ELISA kit (Blocking ELISA based on E2 MAb, IDEXX), according to the manufacturer’s instruction.
3544
W. Li et al. / Vaccine 33 (2015) 3542–3548
2.6.3. Virus neutralizing antibody detection Virus neutralization test (VNT) was performed to determine neutralizing antibodies (NAs) level against CSFV. Briefly, sera samples collected on 42 dpi, 7 and 14 dpc were heat-inactivated for 30 min at 56 ◦ C. Replicates of 2-fold serially diluted sera (starting from 1/4) were mixed with an equal volume of 100 TCID50 of CSFV (Shimen strain, from the China Institute of Veterinary Drug Control) and incubated at 37 ◦ C for 1 h. Each of the mixtures was then added to PK-15 cell monolayer in 96-well culture plates. After 48 h incubation, the culture plates were fixed for 30 min with absolute ethyl alcohol and subjected to immunofluorescence staining with the monoclonal antibody WH303 (AHVLA, UK; 1:200 diluted in PBS) and FITC-conjugated goat anti-mouse IgG (BOSTER, Wuhan, China; 1:200 diluted in PBS). The fluorescence signals were observed under a fluorescence microscopy (ZEISS) and neutralizing titers were expressed as the reciprocal of the highest dilution that caused complete neutralization. 2.7. Cellular immune response detection 2.7.1. Lymphocytes proliferation assay Proliferation ability of the lymphocytes was determined by MTT assay. At 0, 14, 28 and 42 dpi, the lymphocytes were separated from mice spleen or pigs PBMCs by lymphocyte separation medium (BOSTER, Wuhan, China). Cells were suspended to 5 × 106 cells/mL with complete RPMI 1640 medium (RPMI 1640 containing 10% FCS) and seeded in 96-well with 100 L/well. Inactive CSFV (200 TCID50 ) was used as stimuli and 20 g/mL of Concanavalin A (Sigma) was used as positive control. All treatments were performed in triplicates. The cells were incubated for 72 h at 37 ◦ C at a humidified chamber. Then, MTT reagent (5 mg/mL, 10 L/well) was added to each well and incubated for 6 h. DMSO was added and absorbance at 490 nm was recorded on a micro-plate reader (BIO-TEK). The stimulation index (SI) was calculated as the ratio of the average OD value of wells containing stimulated cells to those of wells containing un-stimulated cells. 2.7.2. Cytokine measurements At 28 and 42 dpi, the levels of IFN-␥ and IL-4 were determined. Mouse IFN-␥ and IL-4 in cell culture supernatant were determined by ELISA kits (Invitrogen, USA); IFN-␥ and IL-4 in swine PBMCs culture supernatant were analyzed using ELISA kits (R&D, USA), according to the manufacturer’s instructions, respectively. Standard curves were generated using serially diluted IFN-␥ and IL-4 standards. The concentrations of the IFN-␥ and IL-4 were calculated according to the corresponding standard curves.
with the guidelines of Jiangsu Province Animal Regulations (Government Decree No. 45). 2.10. Statistical analysis Data were presented as mean ± S.D. The differences in the levels of antibody titers, SI, cytokines concentration between different groups were determined by one-way repeated measurement ANOVA. Statistical analyses were performed using SPSS v.16. Differences were considered statistically significant when P < 0.05. 3. Results 3.1. CD81 antibody preparation After immunization of rabbit with recombinant protein, specific antibody was induced since 14 dpi, and reached the highest titer of 51,200 at the final time point (49 dpi) as determined by ELISA. The antibody reacted well with recombinant CD81 protein in Western blot (data not shown). 3.2. Plasmids construction and identification The target genes were amplified and cloned into the eukaryotic expression plasmid pVAX-1, which were confirmed by enzyme digestion and sequencing (data not shown). CD81 and E2 proteins were expressed in BHK-21 cells transfected with the plasmids pVAX-CD81, pVAX-E2, respectively, as indicated by iIFA (Fig. 1). And pVAX-CD81-E2 transfected BHK-21 cells showed both two kinds of fluorescence signals (Fig. 1). 3.3. Humoral immune responses detection in mice As determined by iELISA, vaccination with the E2 expressing plasmids induced the production of E2-specific antibodies from 28 dpi (Fig. 2). Mice of pVAX-CD81-E2 and pVAX-E2 + pVAX-CD81 groups developed significantly higher antibody titers at 28 and 42 dpi (P < 0.05). In addition, the pVAX-CD81-E2 group showed significantly higher titers than pVAX-E2 + pVAX-CD81 group at 28 dpi (P < 0.05). No antibody was detected in pVAX-CD81 or PBS immunized groups. Unexpectedly, antibody detection by blocking ELISA showed negative results at each time point. And CSFV NAs was not detected in all of the samples (data not shown). 3.4. Lymphocytes proliferation and cytokines detection in mice
2.8. Real-time qRT-PCR Total RNA in the serum samples were extracted by Transzol UP reagent (Transgen Co. Ltd., Beijing, China). Real-time qRT-PCR amplification was carried out with TransScript Probe one-step qRT-PCR supermix (Transgen Co. Ltd., Beijing, China) in a 20 L reaction mixture containing 10 L of 2 × Supermix, 20 pM of each primer (F: 5 -GCTCCCTGGGTGGTCTAAGTC-3 ; R: 5 -GGCTTCTGCTCACGTCGAA-3 ), 20 pM of probe (5 -FAMAGTACAGGACAGTCGTCA-TARAM-3 ), 0.5 L of E-Mix, 0.4 L of passive reference Dye and 4 L extracted RNA. The reaction was run in ABI Step One following the manufacturer’s instruction. 2.9. Ethical approval The immunization, challenge, collection of serum samples and separation of mice spleen cells were performed in strict accordance
Data from MTT assay showed that immunization with recombinant plasmids induced the proliferation of the lymphocytes from 28 dpi (Fig. 3A). At 28 dpi, both of the groups pVAX-E2 + pVAXCD81 and pVAX-CD81-E2 showed significantly higher SI values than control groups (pVAX-CD81 and NC) (P < 0.05), while the difference with group pVAX-E2 was not significant (P > 0.05). At 42 dpi, groups pVAX-E2 and pVAX-E2 + pVAX-CD81 developed significantly higher proliferation responses than control groups (P < 0.05) and pVAX-CD81-E2 group induced the highest response (P < 0.05). The levels of IFN-␥ and IL-4 were analyzed using ELISA kits. All recombinant plasmids induced significantly higher levels of IFN-␥ and IL-4 secretion at 28 and 42 dpi (P < 0.05, Fig. 3B and C). pVAX-CD81-E2 and pVAX-E2 + pVAX-CD81 groups induced significantly higher levels of IFN-␥ than pVAX-E2 group at 42 dpi (P < 0.05, Fig. 3B). pVAX-CD81-E2 group showed higher IL-4 secretion than pVAX-E2 and pVAX-E2 + pVAX-CD81 groups at 42 dpi (P < 0.05, Fig. 3C).
W. Li et al. / Vaccine 33 (2015) 3542–3548
3545
Fig. 1. Transient expression of CSFV E2 and CD81 in BHK-21 cells using immunofluorescence assays. BHK-21 cells were transfected with plasmid pVAX-CD81, pVAX-E2 or pVAXCD81-E2 and cultured for 48 h. The expression of target proteins was detected with rabbit anti-CD81 polyclonal antibody plus Cy3-labeled secondary antibody (right penal) or MAb WH303 plus FITC-labeled secondary antibody (left penal). The scale bar indicated 50 nm.
3.5. Humoral immune responses detection in pigs As shown in Fig. 4A, data from iELISA indicated E2-specific antibodies could be significantly induced from 28 dpi (P < 0.05). Pigs in pVAX-CD81-E2 group developed significantly higher
antibody titers than those in pVAX-E2 group (P < 0.05). Results of blocking ELISA showed a similar trend (Fig. 4B); the pVAX-CD81E2 group had significantly higher titers than pVAX-E2 group at 28 dpi (P < 0.05) while the difference was not significant at 42 dpi (P > 0.05). No antibody was detected in the two control groups. CSFV NAs was not induced before 28 dpi, and only three pigs in pVAX-CD81-E2 and pVAX-E2 groups showed low levels of NAs at 42 dpi (Table 1). After challenge, pigs in these two groups developed high titers of NAs since 7 dpc; pigs immunized with pVAX-CD81-E2 elicited, at 7 and 14 dpc, higher levels of NAs (Table 1).
3.6. Lymphocytes proliferation and cytokines detection in pigs
Fig. 2. Detection of antibody response in mice. Mice were immunized with plasmid pVAX-E2, pVAX-CD81-E2, pVAX-E2 + pVAX-CD81, pVAX-CD81 and PBS, respectively, and boosted twice at 14 and 28 dpi. Serum samples were collected at 0, 14, 28 and 42 dpi. The titers of the E2-specific antibody were detected by iELISA. Data were shown as mean + S.D. Columns at each time point marked with different letters are significantly different from each other (P < 0.05).
Data from MTT assay showed that immunization with recombinant plasmids induced significant proliferation of the lymphocytes at 42 dpi and the difference between pVAX-CD81-E2 and pVAX-E2 was significant (P < 0.05, Fig. 5A). At 28 dpi, only pVAX-CD81-E2 group developed significant lymphocytes proliferation (P < 0.05, Fig. 5A). Both of the pVAX-CD81-E2 and pVAX-E2 immunization induced significantly higher levels of IFN-␥ than control groups at 28 and 42 dpi; and the IFN-␥ concentration of pVAX-CD81-E2 group was significantly higher than that of pVAX-E2 group (P < 0.05, Fig. 5B).
3546
W. Li et al. / Vaccine 33 (2015) 3542–3548
Fig. 4. Detection of antibody responses in pigs. Pigs were immunized with plasmid pVAX-E2, pVAX-CD81-E2, pVAX-CD81 and PBS, respectively, and boosted twice at 14 and 28 dpi. Serum samples were collected at 0, 14, 28 and 42 dpi. E2-specific antibodies were detected by iELISA (A) and blocking ELISA kit (B). The line indicated the cutoff value of blocking ELISA. Data were shown as mean + S.D. Columns at each time point marked with different letters are significantly different from each other (P < 0.05).
3.7. CD81 promoted the protection against CSFV challenge
IL-4 was also significantly induced in pVAX-E2 and pVAX-CD81-E2 groups at 28 and 42 dpi (P < 0.05, Fig. 5C). The difference between pVAX-E2 and pVAX-CD81-E2 groups was not significant at 28 dpi, while became significant at 42 dpi (Fig. 5C).
Clinical symptoms and survival rates of the pigs were monitored. As shown in Fig. 6, pigs of group pVAX-CD81 showed fever (above 40 ◦ C), with a peak of 41.8 ◦ C. Pigs in this group exhibited typical CSF signs since 5 dpc and died at 9, 10, 12 and 13 dpc, respectively. Two pigs in group pVAX-E2 showed fever and CSF signs and one pig died at 12 dpc. All pigs in group pVAX-CD81-E2 survived, though two of them showed slight fever at 6–9 dpc. Viral RNA in the blood samples were tested by RT-PCR on days 0, 4, 7, 10 and 14 dpc (Table 2). The results showed that all pigs in group pVAX-CD81 developed detectable viremia during 4–10 dpc. In group pVAX-E2, viremia could be detected in three pigs from 4 dpc to 10 dpc. While in the pVAX-CD81-E2 vaccinated group, only two pigs showed detectable CSFV RNA at 4 dpc.
Table 1 Detection of serum neutralizing antibodies in pigs.
Table 2 Viremia detection after CSFV challenge.
Fig. 3. Detection of cellular immune responses in mice. The lymphocytes from the spleen of mice were separated and the proliferation was determined by MTT assay and the results were shown as SI (A). Levels of IFN-␥ (B) and IL-4 (C) presented in cell culture supernatants of 28 and 42 dpi were determined by commercial ELISA kits. Data were shown as mean + S.D. Columns at each time point marked with different letters are significantly different from each other (P < 0.05).
Groups pVAX-E2
pVAX-CD81-E2
pVAX-CD81
NC
a
Pig no. 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943
0 dpi – – – – – – – – – – – – – – – –
Not detected because of pig death.
28 dpi – – – – – – – – – – – – – – – –
42 dpi – – 1/12 – – 1/20 1/16 – – – – – – – – –
7 dpc
14 dpc
1/32 1/128 1/128 1/64 1/128 1/256 1/256 1/64 – – – – – – – –
a
ND 1/256 1/256 1/128 1/256 1/512 1/256 1/128 ND ND ND ND – – – –
Groups
Pig no.
0 dpc
4 dpc
7 dpc
10 dpc
14 dpc
pVAX-E2
928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943
− − − − − − − − − − − − − − − −
+ − + + − − + + + + + + − − − −
+ − − + − − − − + + + + − − − −
+ − − − − − − − + + ND + − − − −
NDa − − − − − − − ND ND ND ND − − − −
pVAX-CD81-E2
pVAX-CD81
NC
a
Not detected because of pig death.
W. Li et al. / Vaccine 33 (2015) 3542–3548
Fig. 5. Detection of cellular immune responses in pigs. The PBMCs were separated and the proliferation was determined by MTT assay (A). Levels of IFN-␥ (B) and IL4 (C) presented in cell culture supernatants of 28 and 42 dpi were determined by commercial ELISA kits. Data were shown as mean + S.D. Columns at each time point marked with different letters are significantly different from each other (P < 0.05).
Fig. 6. Rectal temperature measurement in pigs. Rectal temperature of each pig was daily measured after CSFV challenge. Pig with rectal temperature ≥ 40 ◦ C was considered as pyrexia.
4. Discussions DNA vaccine is a relatively new generation of vaccine with several advantages [22]. The preparation of DNA vaccine is
3547
relatively simple; the vaccination is safe and very low anti-vector immune responses are induced; furthermore, DNA vaccine could induce both of the humoral and cellular immune responses, resulting in better protective effects [9,23]. This new strategy has been performed for CSFV. However, in animal species the efficacy of DNA vaccine is relatively low. Several efforts have been tried to improve the efficacy of DNA vaccines such as co-delivery of adjuvant cytokines, chemokines and co-stimulatory molecules [11–14]. CD81 is a tetraspanin protein located on cell surface and plays important roles in B and T cells function [16]. CD81 forms coreceptor complex with CD19, CD21. When antigens engage their cognate BCR and simultaneously bind the CD19/CD81/CD21 complex, the threshold for B cell activation is lowered, enhancing signaling events [17]. Previous studies have demonstrated that CD81 on B cells induced the activation of multiple kinases and triggered B cell receptor (BCR) signaling [24,25]. CD81 is localized at the central zone of the immune synapse in both B and T cells and polarizes immune responses toward a Th2 phenotype [18,19,26]. No study has been done to evaluate the immunomodulatory effect of swine CD81. In this study, we examined the adjuvant effect of CD81 on CSFV DNA vaccine in mice and pigs. The CSFV genome RNA encodes a 3898 amino acids polyprotein, which is further processed to the mature viral structural proteins (C, Erns , E1, and E2) and nonstructural proteins (Npro , p7, NS2, NS3, NS4A, NS4B, NS5A, and NS5B) [27]. Erns and E2 are envelope glycoproteins located on the surface of the virus. Both of them could elicit protective immunity against CSFV challenge in pigs and E2 is a better candidate to be incorporated in genetically engineered CSFV vaccines [7–9,28,29]. Recently, Gavrilov et al. have reported that glycosylation of Erns and E2 is essential for their immunogenicity and unglycosylated proteins expressed by baculovirus failed to induce protection against CSFV infection [30]. Thus, when E2 expression plasmids were constructed in the present study, we amplified the coding region of E2 protein of CSFV C strain, as well as the 16 residues from E1 to act as glycosylation signal peptide [30]. The vaccination with recombinant plasmids in mice and in pigs elicited antibody responses after the second inoculation. And coexpressing of CD81 with E2 speeded up the humoral responses elicited. Lymphocytes proliferation and cytokines secretion were detected in mice since 28 dpi (Fig. 3). Interestingly, antibody responses in immunized mice could only be detected by iELISA; both of the blocking ELISA and VNT gave negative results. In addition, vaccination with baculovirus expressed E2 protein in mice also did not induce detectable antibodies by IDEXX blocking ELISA (unpublished data by our lab). We hypothesized that the immune system of mice could not recognize the epitopes evolved in these two detection methods and we concluded mice is not a suitable model for CSFV vaccine evaluation. In pigs, the development of antibodies was detected by iELISA and blocking ELISA from 28 dpi (Fig. 4). But vaccinated pigs showed a delay in the induction of neutralizing antibodies; only some of them produced low levels of neutralizing antibodies at 42 dpi (Table 1). After challenge, neutralizing antibodies were promptly induced as early as 7 dpc. These results were similar with previous reports: the rapid production of neutralizing antibodies occurred upon viral challenge [9,11,13,14]. In addition, pVAX-CD81-E2 induced higher neutralizing antibodies than pVAX-E2 (Table 1), suggesting that co-expression of CD81 improves the antigen presentation and subsequent immune responses. Studies have shown that immunization with E2 DNA vaccine induced specific T cell responses, especially the IFN-␥ secretion [9,11]. Our results consisted with these reports and indicated that CD81 expressing promote the T cell responses, including the proliferation of lymphocytes, secretion of IFN-␥ and IL-4 (Figs. 3 and 5). To determine the protective effect of this DNA vaccine, pigs were challenged two weeks after the third vaccination (56 dpi). Clinical
3548
W. Li et al. / Vaccine 33 (2015) 3542–3548
symptoms, viremia and survival rates were examined and recorded. pVAX-CD81 vaccinated pigs showed fever and severe CSF signs since 5 dpc; all pigs developed detectable viremia during 4–10 dpc and died before 14 dpc. Two pVAX-E2 vaccinated pigs showed fever and CSF signs and one pig died at 12 dpc; viremia could be detected from three pigs. While in the pVAX-CD81-E2 group, only two pigs showed slight fever at 6–9 dpc and detectable CSFV RNA at 4 dpc; all pigs survived. These results were associated with the vaccines induced cellular immune responses and the NAs levels after challenge, supporting that both of the cellular immune responses and neutralizing antibodies are important to protection against CSFV infection. In this study, co-delivery of E2 and CD81 expressing plasmids possessed relatively lower immune responses than CD81-E2 fusion expressing plasmid in mice. Thus we didn’t choose the former in pig’s vaccination. We speculated that fusion expression of CD81 with E2 might improve the simultaneously expression of these two proteins in the same cells and thus facilitate the effect of CD81 on E2. Of course, the exact mechanism needs further analysis. To our knowledge, this is the first report emphasized the capacity of swine CD81 to enhance E2-based DNA vaccine in the cellular, humoral responses and protection against viral challenge. We concluded that CD81 enhances the effects of the DNA vaccine and could be used as a potential genetic adjuvant for other DNA vaccines. Acknowledgments This work was supported by the Special Fund for Independent innovation of Agricultural Science and Technology in Jiangsu province (CX(12)5049) and Jiangsu Provincial Natural Science Foundation of China (BK20130729). References [1] Greiser-Wilke I, Moennig V. Vaccination against classical swine fever virus: limitations and new strategies. Anim Health Res Rev 2004;5:223–6. [2] Greiser-Wilke I, Blome S, Moennig V. Diagnostic methods for detection of Classical swine fever virus—status quo and new developments. Vaccine 2007;25:5524–30. [3] Liu L, Xia H, Wahlberg N, Belak S, Baule C. Phylogeny, classification and evolutionary insights into pestiviruses. Virology 2009;385:351–7. [4] Luo Y, Li S, Sun Y, Qiu HJ. Classical swine fever in China: a mini review. Vet Microbiol 2014;172:1–6. [5] Newcomer BW, Givens MD. Approved and experimental countermeasures against pestiviral diseases: Bovine viral diarrhea, classical swine fever and border disease. Antiviral Res 2013;100:133–50. [6] Dong XN, Chen YH. Marker vaccine strategies and candidate CSFV marker vaccines. Vaccine 2007;25:205–30. [7] Sun Y, Tian DY, Li S, Meng QL, Zhao BB, Li Y, et al. Comprehensive evaluation of the adenovirus/alphavirus-replicon chimeric vector-based vaccine rAdV-SFVE2 against classical swine fever. Vaccine 2013;31:538–44. [8] Gabriel C, Blome S, Urniza A, Juanola S, Koenen F, Beer M. Towards licensing of CP7 E2alf as marker vaccine against classical swine fever—duration of immunity. Vaccine 2012;30:2928–36.
[9] Ganges L, Barrera M, Nunez JI, Blanco I, Frias MT, Rodriguez F, et al. A DNA vaccine expressing the E2 protein of classical swine fever virus elicits T cell responses that can prime for rapid antibody production and confer total protection upon viral challenge. Vaccine 2005;23:3741–52. [10] Yu X, Tu C, Li H, Hu R, Chen C, Li Z, et al. DNA-mediated protection against classical swine fever virus. Vaccine 2001;19:1520–5. [11] Wan C, Yi L, Yang Z, Yang J, Shao H, Zhang C, et al. The Toll-like receptor adaptor molecule TRIF enhances DNA vaccination against classical swine fever. Vet Immunol Immunopathol 2010;137:47–53. [12] Andrew M, Morris K, Coupar B, Sproat K, Oke P, Bruce M, et al. Porcine interleukin-3 enhances DNA vaccination against classical swine fever. Vaccine 2006;24:3241–7. [13] Wienhold D, Armengol E, Marquardt A, Marquardt C, Voigt H, Buttner M, et al. Immunomodulatory effect of plasmids co-expressing cytokines in classical swine fever virus subunit gp55/E2-DNA vaccination. Vet Res 2005;36:571–87. [14] Tarradas J, Alvarez B, Fraile L, Rosell R, Munoz M, Galindo-Cardiel I, et al. Immunomodulatory effect of swine CCL20 chemokine in DNA vaccination against CSFV. Vet Immunol Immunopathol 2011;142:243–51. [15] Oren R, Takahashi S, Doss C, Levy R, Levy S. TAPA-1, the target of an antiproliferative antibody, defines a new family of transmembrane proteins. Mol Cell Biol 1990;10:4007–15. [16] Levy S. Function of the tetraspanin molecule CD81 in B and T cells. Immunol Res 2014;58:179–85. [17] Cho KW, Kim SJ, Park CG, Park J, Cho JY, Kang HS, et al. Molecular cloning and expression analysis of pig CD81. Vet Immunol Immunopathol 2007;120:254–9. [18] Maecker HT, Do MS, Levy S. CD81 on B cells promotes interleukin 4 secretion and antibody production during T helper type 2 immune responses. Proc Natl Acad Sci USA 1998;95:2458–62. [19] Rocha-Perugini V, Zamai M, Gonzalez-Granado JM, Barreiro O, Tejera E, YanezMo M, et al. CD81 controls sustained T cell activation signaling and defines the maturation stages of cognate immunological synapses. Mol Cell Biol 2013;33:3644–58. [20] Fearon DT, Carroll MC. Regulation of B lymphocyte responses to foreign and self-antigens by the CD19/CD21 complex. Annu Rev Immunol 2000;18: 393–422. [21] Li WL, Mao L, Jiang JY. Cloning and sequence analysis of pig CD81 and prokaryotic expression of its large extracellular loop region. Chin J Prev Vet Med 2012;34:993–5. [22] Henke A. DNA immunization—a new chance in vaccine research. Med Microbiol Immunol 2002;191:187–90. [23] Rodriguez F, Whitton JL. Enhancing DNA immunization. Virology 2000;268:233–8. [24] Schick MR, Nguyen VQ, Levy S. Anti-TAPA-1 antibodies induce protein tyrosine phosphorylation that is prevented by increasing intracellular thiol levels. J Immunol 1993;151:1918–25. [25] Mattila PK, Feest C, Depoil D, Treanor B, Montaner B, Otipoby KL, et al. The actin and tetraspanin networks organize receptor nanoclusters to regulate B cell receptor-mediated signaling. Immunity 2013;38:461–74. [26] Deng J, Dekruyff RH, Freeman GJ, Umetsu DT, Levy S. Critical role of CD81 in cognate T-B cell interactions leading to Th2 responses. Int Immunol 2002;14:513–23. [27] Huang YL, Deng MC, Wang FI, Huang CC, Chang CY. The challenges of classical swine fever control: modified live and E2 subunit vaccines. Virus Res 2014;179:1–11. [28] Sun Y, Yang Y, Zheng H, Xi D, Lin M, Zhang X, et al. Co-expression of Erns and E2 genes of classical swine fever virus by replication-defective recombinant adenovirus completely protects pigs against virulent challenge with classical swine fever virus. Res Vet Sci 2013;94:354–60. [29] Zhang H, Li X, Peng G, Tang C, Zhu S, Qian S, et al. Glycoprotein E2 of classical swine fever virus expressed by baculovirus induces the protective immune responses in rabbits. Vaccine 2014;32:6607–13. [30] Gavrilov BK, Rogers K, Fernandez-Sainz IJ, Holinka LG, Borca MV, Risatti GR. Effects of glycosylation on antigenicity and immunogenicity of classical swine fever virus envelope proteins. Virology 2011;420:135–45.
Contents lists available at ScienceDirect
Vaccine journal homepage: www.elsevier.com/locate/vaccine
The swine CD81 enhances E2-based DNA vaccination against classical swine fever Wenliang Li a,∗ , Li Mao a , Bin Zhou b , Xia Liu a , Leilei Yang a , Wenwen Zhang a , Jieyuan Jiang a,∗ a Institute of Veterinary Medicine, Jiangsu Academy of Agricultural Sciences; Key Laboratory of Veterinary Biological Engineering and Technology, Ministry of Agriculture; National Center for Engineering Research of Veterinary Bio-products, Nanjing 210014, China b College of Veterinary Medicine, Nanjing Agricultural University, Nanjing 210095, China
a r t i c l e
i n f o
Article history: Received 13 February 2015 Received in revised form 11 May 2015 Accepted 21 May 2015 Available online 4 June 2015 Keywords: CSFV DNA vaccine CD81 E2 glycoprotein Adjuvant
a b s t r a c t Classical swine fever (CSF) is a highly contagious and economically important viral disease that affects the pig industry worldwide. The glycoprotein E2 of CSFV can induce neutralizing antibodies and protective immunity, and is widely used for novel vaccine development. The objective of this study was to explore whether a tetraspanin molecule CD81 could improve the immune responses of an E2-based DNA vaccine. Plasmids pVAX-CD81, pVAX-E2 and pVAX-CD81-E2 were constructed and the expression of target proteins was confirmed in BHK-21 cells by indirect immunofluorescence assay. BALB/c mice were divided into 5 groups and immunized with different plasmids (pVAX-E2, pVAX-CD81-E2, pVAXE2 + pVAX-CD81, pVAX-CD81 and PBS) three times with two weeks interval. The results showed that the introduction of CD81 promoted higher humoral and cellular immune responses than E2 expression alone (P < 0.05). In addition, immunization with pVAX-CD81-E2 induced stronger immune responses than pVAX-E2 + pVAX-CD81. Furthermore, four groups of pigs were immunized with pVAX-E2, pVAX-CD81E2, pVAX-CD81 and PBS, respectively. Humoral and cellular immune responses detection showed similar results with those in mice. Compared to pVAX-E2, pVAX-CD81-E2 induced higher titers of neutralizing antibodies after viral challenge and conferred stronger protection. These results confirmed the capacity of swine CD81 enhancing the humoral and cellular responses with an adjuvant effect on CSFV DNA vaccine. This is the first report demonstrating the adjuvant effect of CD81 to enhance the DNA vaccination for swine pathogen. © 2015 Elsevier Ltd. All rights reserved.
1. Introduction Classical swine fever (CSF) is a highly contagious disease, has severe impact on the swine industry worldwide [1]. The causative agent, classical swine fever virus (CSFV), belongs to the genus pestivirus of the Flaviviridae family, together with bovine viral diarrhea virus type 1 and 2 (BVDV 1, BVDV 2), border disease virus (BDV) and several newly found atypical pestiviruses [2,3]. In China, CSF is still one of the most important infectious diseases and the Hog cholera lapinized virus (HCLV) vaccine has been widely used to prevent and control the disease [4]. However, use of HCLV does not allow discrimination of infected and vaccinated animals (DIVA) [5].
∗ Corresponding authors. Institute of Veterinary Medicine, Jiangsu Academy of Agricultural Sciences, Nanjing 210014, China. Tel.: +86 25 84391152/+86 25 84391135; fax: +86 25 84390330. E-mail addresses: kfl[email protected] (W. Li), [email protected] (J. Jiang). http://dx.doi.org/10.1016/j.vaccine.2015.05.055 0264-410X/© 2015 Elsevier Ltd. All rights reserved.
Researches have been focused on the glycoprotein E2-based marker vaccines against CSF, and some of them were systemically evaluated and undergoing the licensing procedures [4,6], including the chimeric adenovirus/alphavirus vector-based vaccine rAdV-SFV-E2 [7] and the chimeric pestivirus-based vaccine CP7 E2alf [8]. Immune protection of E2-based DNA vaccines has been evaluated [9,10]. But the protective effect was not sufficient. Approaches have been described to co-deliver cytokines or adjuvant molecules to promote the immune responses, such as IL-3, IL-12, IL-18, CD40L, CCL20 and TRIF [11–14]. CD81, also named as TAPA-1, is a member of the tetraspanin superfamily of cell surface proteins [15]. CD81 plays important roles in adaptive immunity [16]. Researches have confirmed CD81 forms a B cell co-receptor complex with CD19, CD21, Iga, and Igb, and enhances B cell signaling during the process of B cell activation [17]; CD81 could promote IL-4 secretion and antibody production [18]; and also control the organization of the immune synapse (IS) and T cell activation [19]. In addition, the CD19/CD21/CD81
W. Li et al. / Vaccine 33 (2015) 3542–3548
molecular complex bridges the adaptive and innate immune systems [20]. But to date, no study has been done to identify the adjuvant effects of CD81. In this study, we examined the effect of CD81 for improving immune responses of the E2-based DNA vaccine in mice and pigs. Viral challenge has been done in pigs to examine the promotion of protection. 2. Materials and methods 2.1. CD81 antibody preparation Protein expression was performed as previously reported [21]. Briefly, the recombinant Escherichia coli strain BL21/pGEX-CD81LEL containing CD81 LEL region gene was grown in LB medium containing 50 g/mL ampicillin and induced by 0.5 mM IPTG for 4 h at 37 ◦ C. The cells were harvested by centrifugation at 8000 rpm for 10 min, resuspended in PBS, and then lysated by ultrasonication on ice. After centrifugation at 8000 g for 10 min at 4 ◦ C, the pellet was resuspended and purified by GST column (GenScript Co. Ltd., Nanjing, China) according to the manufacturer’s protocol. Rabbit was immunized with purified CD81LEL protein four times with 2week intervals (0.25 mg per time). Serum was harvested one week after the last immunization and identified by ELISA and western blot with GST-CD81LEL protein. 2.2. Construction of the eukaryotic expression plasmid pVAX-CD81, pVAX-E2 and pVAX-CD81-E2 RNA was extracted from CSFV C strain vaccine (TechBank Bio-tech Co. Ltd., Nanjing, China). A pair of primers kE2F: ATGGATCCGCCACCATGGTCGTGCAA and kE2R: TGCCTCGAGTCACTTTTCGAACTGCG containing BamHI site and kozak sequence in kE2F and XhoI in kE2R, respectively, were used for CSFV E2 gene amplification. The RT-PCR products were purified, digested with BamHI and XhoI followed by cloning into the same sites of the pVAX-1 vector, generating the recombinant plasmid pVAX-E2. Swine CD81 gene was amplified from pT-CD81 [21] using primers CD81F: CTAAAGCTTGCCACCATGGGGGTAGAGG and CD81R: CTAGGATCCTCGTACACCGAGCTGTT containing Hind III site and kozak sequence in CD81F and BamHI in CD81R, respectively, and cloned into pVAX-1 vector. As for pVAX-CD81-E2 construction, CD81 gene was amplified using primers CD81F and CD81R1: CTGGGATCCGTACACCGAGCTGTTCC, which doesn’t contain stop codon, digested and cloned into Hind III and BamHI digested pVAX-E2. All plasmids were confirmed by enzyme digestion and sequencing analysis. 2.3. Identification of protein expression by indirect immunofluorescence assays (iIFA) on BHK-21 cells The plasmids pVAX-CD81, pVAX-E2 and pVAX-CD81-E2 were extracted by AxyPrepTM Plasmid Miniprep kit (Axygen Co. Ltd., Hangzhou, China) and the concentration was measured by NanoDrop 2000 (Thermo). BHK-21 cells were grown in Dulbecco’s Modified Essential Medium (DMEM) containing 10% fetal bovine serum (FBS) at 37 ◦ C and 5% CO2 . The cells were seeded in 24-well plate 24 h before transfection to reach 80% confluence at transfection. pVAX-CD81, pVAX-E2 and pVAX-CD81-E2 were transfected into the cells using lipofectamineTM 2000 (Invitrogen, USA) according to the manufacturer’s instruction. After 48 h post-transfection, the expression of these proteins was detected by iIFA. Briefly, the cells were fixed with absolute ethyl alcohol at 4 ◦ C for 30 min, incubated with the primary rabbit polyclonal antibody against CD81 (1:200 diluted in PBS) or CSFV E2 specific monoclonal antibody (WH303, AHVLA, UK; 1:200 diluted in PBS) at 37 ◦ C for
3543
1 h. After three washes with PBS, the cells were incubated with Cy3-labeled goat anti-rabbit IgG (BOSTER, Wuhan, China) or FITClabeled goat anti-mouse IgG (BOSTER, Wuhan, China) 37 ◦ C for 30 min (1:200 diluted in PBS). After thorough washing, the fluorescence signals were observed under a fluorescence microscopy (ZEISS). 2.4. Immunization experiment in mice One hundred six-week-old female BALB/c mice were randomly divided into 5 groups (20 mice per group). All mice were injected with 50 L of lidocaine hydrochloride in the medialrectus muscle 24 h before plasmids inoculation. The mice of groups pVAXE2, pVAX-CD81-E2 and pVAX-E2 + pVAX-CD81 were vaccinated with corresponding plasmids (100 g pVAX-E2 plus 100 g pVAX1/mouse, 100 g pVAX-CD81-E2 plus 100 g pVAX-1/mouse, 100 g pVAX-E2 plus 100 g pVAX-CD81/mouse), respectively. Mice of groups pVAX-CD81 and NC were inoculated with pVAX-C81 (200 g/mouse) and PBS as control. The mice were boosted twice with 2-week intervals following the same inoculation protocols. Sera samples were collected at 0, 14, 28 and 42 days post immunization (dpi) and were stored at −20 ◦ C for antibody detection. At day of 0, 14, 28 and 42 dpi, five mice in each group were euthanatized; lymphocytes were separated from spleen and subjected to cellular immune responses detection. 2.5. Immunization and challenge experiment in pigs Sixteen four-week-old piglets (free of CSFV, PRRSV and PCV2 infection) were randomly divided into 4 groups. The pigs of groups pVAX-E2 and pVAX-CD81-E2 were vaccinated with pVAXE2 (0.5 mg/pig) and pVAX-CD81-E2 (0.5 mg/pig), respectively. Pigs of groups pVAX-CD81 and NC were inoculated with pVAX-CD81 (0.5 mg/pig) and PBS as control. The pigs were boosted twice with 2-week intervals following the same inoculation protocols. Sera samples were collected at 0, 14, 28 and 42 dpi and were stored at −20 ◦ C. At day of 0, 14, 28 and 42 dpi, blood was collected from each pig and PBMCs were separated for cellular immune responses detection. Pigs in groups pVAX-E2, pVAX-CD81-E2 and pVAX-CD81 were intranasally challenged at 56 dpi with 105 TCID50 CSFV Shimen strain (from the China Institute of Veterinary Drug Control). The rectal body temperature and clinical signs were monitored daily; and the serum samples were collected at 0, 4, 7, 10 and 14 days post challenge (dpc) for viremia and antibody detection. 2.6. Humoral immune response detection 2.6.1. iELISA The levels of E2-specific IgG antibodies in mouse and pig serum samples were determined using iELISA. Briefly, baculovirusexpressed E2 protein (0.4 g/well) was coated in the 96-well ELISA plate (Costar) overnight at 4 ◦ C, and then the plates were blocked with 5% skim milk in PBST. Sera from each group (1:100 diluted) were added and incubated at 37 ◦ C for 1 h. After washed with PBST for three times, each well received 100 L of 1/2000 diluted HRPlabeled goat anti-mouse IgG (Transgen Co. Ltd., Beijing, China). Finally, the plates were washed thoroughly followed by adding 100 L TMB solution (Beyotime Biotech., China). The absorbance of each well was read in a spectrophotometer (BIO-TEK) at 450 nm. 2.6.2. Blocking ELISA CSFV specific antibodies presented in mouse and pig serum samples were tested by CSFV antibody ELISA kit (Blocking ELISA based on E2 MAb, IDEXX), according to the manufacturer’s instruction.
3544
W. Li et al. / Vaccine 33 (2015) 3542–3548
2.6.3. Virus neutralizing antibody detection Virus neutralization test (VNT) was performed to determine neutralizing antibodies (NAs) level against CSFV. Briefly, sera samples collected on 42 dpi, 7 and 14 dpc were heat-inactivated for 30 min at 56 ◦ C. Replicates of 2-fold serially diluted sera (starting from 1/4) were mixed with an equal volume of 100 TCID50 of CSFV (Shimen strain, from the China Institute of Veterinary Drug Control) and incubated at 37 ◦ C for 1 h. Each of the mixtures was then added to PK-15 cell monolayer in 96-well culture plates. After 48 h incubation, the culture plates were fixed for 30 min with absolute ethyl alcohol and subjected to immunofluorescence staining with the monoclonal antibody WH303 (AHVLA, UK; 1:200 diluted in PBS) and FITC-conjugated goat anti-mouse IgG (BOSTER, Wuhan, China; 1:200 diluted in PBS). The fluorescence signals were observed under a fluorescence microscopy (ZEISS) and neutralizing titers were expressed as the reciprocal of the highest dilution that caused complete neutralization. 2.7. Cellular immune response detection 2.7.1. Lymphocytes proliferation assay Proliferation ability of the lymphocytes was determined by MTT assay. At 0, 14, 28 and 42 dpi, the lymphocytes were separated from mice spleen or pigs PBMCs by lymphocyte separation medium (BOSTER, Wuhan, China). Cells were suspended to 5 × 106 cells/mL with complete RPMI 1640 medium (RPMI 1640 containing 10% FCS) and seeded in 96-well with 100 L/well. Inactive CSFV (200 TCID50 ) was used as stimuli and 20 g/mL of Concanavalin A (Sigma) was used as positive control. All treatments were performed in triplicates. The cells were incubated for 72 h at 37 ◦ C at a humidified chamber. Then, MTT reagent (5 mg/mL, 10 L/well) was added to each well and incubated for 6 h. DMSO was added and absorbance at 490 nm was recorded on a micro-plate reader (BIO-TEK). The stimulation index (SI) was calculated as the ratio of the average OD value of wells containing stimulated cells to those of wells containing un-stimulated cells. 2.7.2. Cytokine measurements At 28 and 42 dpi, the levels of IFN-␥ and IL-4 were determined. Mouse IFN-␥ and IL-4 in cell culture supernatant were determined by ELISA kits (Invitrogen, USA); IFN-␥ and IL-4 in swine PBMCs culture supernatant were analyzed using ELISA kits (R&D, USA), according to the manufacturer’s instructions, respectively. Standard curves were generated using serially diluted IFN-␥ and IL-4 standards. The concentrations of the IFN-␥ and IL-4 were calculated according to the corresponding standard curves.
with the guidelines of Jiangsu Province Animal Regulations (Government Decree No. 45). 2.10. Statistical analysis Data were presented as mean ± S.D. The differences in the levels of antibody titers, SI, cytokines concentration between different groups were determined by one-way repeated measurement ANOVA. Statistical analyses were performed using SPSS v.16. Differences were considered statistically significant when P < 0.05. 3. Results 3.1. CD81 antibody preparation After immunization of rabbit with recombinant protein, specific antibody was induced since 14 dpi, and reached the highest titer of 51,200 at the final time point (49 dpi) as determined by ELISA. The antibody reacted well with recombinant CD81 protein in Western blot (data not shown). 3.2. Plasmids construction and identification The target genes were amplified and cloned into the eukaryotic expression plasmid pVAX-1, which were confirmed by enzyme digestion and sequencing (data not shown). CD81 and E2 proteins were expressed in BHK-21 cells transfected with the plasmids pVAX-CD81, pVAX-E2, respectively, as indicated by iIFA (Fig. 1). And pVAX-CD81-E2 transfected BHK-21 cells showed both two kinds of fluorescence signals (Fig. 1). 3.3. Humoral immune responses detection in mice As determined by iELISA, vaccination with the E2 expressing plasmids induced the production of E2-specific antibodies from 28 dpi (Fig. 2). Mice of pVAX-CD81-E2 and pVAX-E2 + pVAX-CD81 groups developed significantly higher antibody titers at 28 and 42 dpi (P < 0.05). In addition, the pVAX-CD81-E2 group showed significantly higher titers than pVAX-E2 + pVAX-CD81 group at 28 dpi (P < 0.05). No antibody was detected in pVAX-CD81 or PBS immunized groups. Unexpectedly, antibody detection by blocking ELISA showed negative results at each time point. And CSFV NAs was not detected in all of the samples (data not shown). 3.4. Lymphocytes proliferation and cytokines detection in mice
2.8. Real-time qRT-PCR Total RNA in the serum samples were extracted by Transzol UP reagent (Transgen Co. Ltd., Beijing, China). Real-time qRT-PCR amplification was carried out with TransScript Probe one-step qRT-PCR supermix (Transgen Co. Ltd., Beijing, China) in a 20 L reaction mixture containing 10 L of 2 × Supermix, 20 pM of each primer (F: 5 -GCTCCCTGGGTGGTCTAAGTC-3 ; R: 5 -GGCTTCTGCTCACGTCGAA-3 ), 20 pM of probe (5 -FAMAGTACAGGACAGTCGTCA-TARAM-3 ), 0.5 L of E-Mix, 0.4 L of passive reference Dye and 4 L extracted RNA. The reaction was run in ABI Step One following the manufacturer’s instruction. 2.9. Ethical approval The immunization, challenge, collection of serum samples and separation of mice spleen cells were performed in strict accordance
Data from MTT assay showed that immunization with recombinant plasmids induced the proliferation of the lymphocytes from 28 dpi (Fig. 3A). At 28 dpi, both of the groups pVAX-E2 + pVAXCD81 and pVAX-CD81-E2 showed significantly higher SI values than control groups (pVAX-CD81 and NC) (P < 0.05), while the difference with group pVAX-E2 was not significant (P > 0.05). At 42 dpi, groups pVAX-E2 and pVAX-E2 + pVAX-CD81 developed significantly higher proliferation responses than control groups (P < 0.05) and pVAX-CD81-E2 group induced the highest response (P < 0.05). The levels of IFN-␥ and IL-4 were analyzed using ELISA kits. All recombinant plasmids induced significantly higher levels of IFN-␥ and IL-4 secretion at 28 and 42 dpi (P < 0.05, Fig. 3B and C). pVAX-CD81-E2 and pVAX-E2 + pVAX-CD81 groups induced significantly higher levels of IFN-␥ than pVAX-E2 group at 42 dpi (P < 0.05, Fig. 3B). pVAX-CD81-E2 group showed higher IL-4 secretion than pVAX-E2 and pVAX-E2 + pVAX-CD81 groups at 42 dpi (P < 0.05, Fig. 3C).
W. Li et al. / Vaccine 33 (2015) 3542–3548
3545
Fig. 1. Transient expression of CSFV E2 and CD81 in BHK-21 cells using immunofluorescence assays. BHK-21 cells were transfected with plasmid pVAX-CD81, pVAX-E2 or pVAXCD81-E2 and cultured for 48 h. The expression of target proteins was detected with rabbit anti-CD81 polyclonal antibody plus Cy3-labeled secondary antibody (right penal) or MAb WH303 plus FITC-labeled secondary antibody (left penal). The scale bar indicated 50 nm.
3.5. Humoral immune responses detection in pigs As shown in Fig. 4A, data from iELISA indicated E2-specific antibodies could be significantly induced from 28 dpi (P < 0.05). Pigs in pVAX-CD81-E2 group developed significantly higher
antibody titers than those in pVAX-E2 group (P < 0.05). Results of blocking ELISA showed a similar trend (Fig. 4B); the pVAX-CD81E2 group had significantly higher titers than pVAX-E2 group at 28 dpi (P < 0.05) while the difference was not significant at 42 dpi (P > 0.05). No antibody was detected in the two control groups. CSFV NAs was not induced before 28 dpi, and only three pigs in pVAX-CD81-E2 and pVAX-E2 groups showed low levels of NAs at 42 dpi (Table 1). After challenge, pigs in these two groups developed high titers of NAs since 7 dpc; pigs immunized with pVAX-CD81-E2 elicited, at 7 and 14 dpc, higher levels of NAs (Table 1).
3.6. Lymphocytes proliferation and cytokines detection in pigs
Fig. 2. Detection of antibody response in mice. Mice were immunized with plasmid pVAX-E2, pVAX-CD81-E2, pVAX-E2 + pVAX-CD81, pVAX-CD81 and PBS, respectively, and boosted twice at 14 and 28 dpi. Serum samples were collected at 0, 14, 28 and 42 dpi. The titers of the E2-specific antibody were detected by iELISA. Data were shown as mean + S.D. Columns at each time point marked with different letters are significantly different from each other (P < 0.05).
Data from MTT assay showed that immunization with recombinant plasmids induced significant proliferation of the lymphocytes at 42 dpi and the difference between pVAX-CD81-E2 and pVAX-E2 was significant (P < 0.05, Fig. 5A). At 28 dpi, only pVAX-CD81-E2 group developed significant lymphocytes proliferation (P < 0.05, Fig. 5A). Both of the pVAX-CD81-E2 and pVAX-E2 immunization induced significantly higher levels of IFN-␥ than control groups at 28 and 42 dpi; and the IFN-␥ concentration of pVAX-CD81-E2 group was significantly higher than that of pVAX-E2 group (P < 0.05, Fig. 5B).
3546
W. Li et al. / Vaccine 33 (2015) 3542–3548
Fig. 4. Detection of antibody responses in pigs. Pigs were immunized with plasmid pVAX-E2, pVAX-CD81-E2, pVAX-CD81 and PBS, respectively, and boosted twice at 14 and 28 dpi. Serum samples were collected at 0, 14, 28 and 42 dpi. E2-specific antibodies were detected by iELISA (A) and blocking ELISA kit (B). The line indicated the cutoff value of blocking ELISA. Data were shown as mean + S.D. Columns at each time point marked with different letters are significantly different from each other (P < 0.05).
3.7. CD81 promoted the protection against CSFV challenge
IL-4 was also significantly induced in pVAX-E2 and pVAX-CD81-E2 groups at 28 and 42 dpi (P < 0.05, Fig. 5C). The difference between pVAX-E2 and pVAX-CD81-E2 groups was not significant at 28 dpi, while became significant at 42 dpi (Fig. 5C).
Clinical symptoms and survival rates of the pigs were monitored. As shown in Fig. 6, pigs of group pVAX-CD81 showed fever (above 40 ◦ C), with a peak of 41.8 ◦ C. Pigs in this group exhibited typical CSF signs since 5 dpc and died at 9, 10, 12 and 13 dpc, respectively. Two pigs in group pVAX-E2 showed fever and CSF signs and one pig died at 12 dpc. All pigs in group pVAX-CD81-E2 survived, though two of them showed slight fever at 6–9 dpc. Viral RNA in the blood samples were tested by RT-PCR on days 0, 4, 7, 10 and 14 dpc (Table 2). The results showed that all pigs in group pVAX-CD81 developed detectable viremia during 4–10 dpc. In group pVAX-E2, viremia could be detected in three pigs from 4 dpc to 10 dpc. While in the pVAX-CD81-E2 vaccinated group, only two pigs showed detectable CSFV RNA at 4 dpc.
Table 1 Detection of serum neutralizing antibodies in pigs.
Table 2 Viremia detection after CSFV challenge.
Fig. 3. Detection of cellular immune responses in mice. The lymphocytes from the spleen of mice were separated and the proliferation was determined by MTT assay and the results were shown as SI (A). Levels of IFN-␥ (B) and IL-4 (C) presented in cell culture supernatants of 28 and 42 dpi were determined by commercial ELISA kits. Data were shown as mean + S.D. Columns at each time point marked with different letters are significantly different from each other (P < 0.05).
Groups pVAX-E2
pVAX-CD81-E2
pVAX-CD81
NC
a
Pig no. 928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943
0 dpi – – – – – – – – – – – – – – – –
Not detected because of pig death.
28 dpi – – – – – – – – – – – – – – – –
42 dpi – – 1/12 – – 1/20 1/16 – – – – – – – – –
7 dpc
14 dpc
1/32 1/128 1/128 1/64 1/128 1/256 1/256 1/64 – – – – – – – –
a
ND 1/256 1/256 1/128 1/256 1/512 1/256 1/128 ND ND ND ND – – – –
Groups
Pig no.
0 dpc
4 dpc
7 dpc
10 dpc
14 dpc
pVAX-E2
928 929 930 931 932 933 934 935 936 937 938 939 940 941 942 943
− − − − − − − − − − − − − − − −
+ − + + − − + + + + + + − − − −
+ − − + − − − − + + + + − − − −
+ − − − − − − − + + ND + − − − −
NDa − − − − − − − ND ND ND ND − − − −
pVAX-CD81-E2
pVAX-CD81
NC
a
Not detected because of pig death.
W. Li et al. / Vaccine 33 (2015) 3542–3548
Fig. 5. Detection of cellular immune responses in pigs. The PBMCs were separated and the proliferation was determined by MTT assay (A). Levels of IFN-␥ (B) and IL4 (C) presented in cell culture supernatants of 28 and 42 dpi were determined by commercial ELISA kits. Data were shown as mean + S.D. Columns at each time point marked with different letters are significantly different from each other (P < 0.05).
Fig. 6. Rectal temperature measurement in pigs. Rectal temperature of each pig was daily measured after CSFV challenge. Pig with rectal temperature ≥ 40 ◦ C was considered as pyrexia.
4. Discussions DNA vaccine is a relatively new generation of vaccine with several advantages [22]. The preparation of DNA vaccine is
3547
relatively simple; the vaccination is safe and very low anti-vector immune responses are induced; furthermore, DNA vaccine could induce both of the humoral and cellular immune responses, resulting in better protective effects [9,23]. This new strategy has been performed for CSFV. However, in animal species the efficacy of DNA vaccine is relatively low. Several efforts have been tried to improve the efficacy of DNA vaccines such as co-delivery of adjuvant cytokines, chemokines and co-stimulatory molecules [11–14]. CD81 is a tetraspanin protein located on cell surface and plays important roles in B and T cells function [16]. CD81 forms coreceptor complex with CD19, CD21. When antigens engage their cognate BCR and simultaneously bind the CD19/CD81/CD21 complex, the threshold for B cell activation is lowered, enhancing signaling events [17]. Previous studies have demonstrated that CD81 on B cells induced the activation of multiple kinases and triggered B cell receptor (BCR) signaling [24,25]. CD81 is localized at the central zone of the immune synapse in both B and T cells and polarizes immune responses toward a Th2 phenotype [18,19,26]. No study has been done to evaluate the immunomodulatory effect of swine CD81. In this study, we examined the adjuvant effect of CD81 on CSFV DNA vaccine in mice and pigs. The CSFV genome RNA encodes a 3898 amino acids polyprotein, which is further processed to the mature viral structural proteins (C, Erns , E1, and E2) and nonstructural proteins (Npro , p7, NS2, NS3, NS4A, NS4B, NS5A, and NS5B) [27]. Erns and E2 are envelope glycoproteins located on the surface of the virus. Both of them could elicit protective immunity against CSFV challenge in pigs and E2 is a better candidate to be incorporated in genetically engineered CSFV vaccines [7–9,28,29]. Recently, Gavrilov et al. have reported that glycosylation of Erns and E2 is essential for their immunogenicity and unglycosylated proteins expressed by baculovirus failed to induce protection against CSFV infection [30]. Thus, when E2 expression plasmids were constructed in the present study, we amplified the coding region of E2 protein of CSFV C strain, as well as the 16 residues from E1 to act as glycosylation signal peptide [30]. The vaccination with recombinant plasmids in mice and in pigs elicited antibody responses after the second inoculation. And coexpressing of CD81 with E2 speeded up the humoral responses elicited. Lymphocytes proliferation and cytokines secretion were detected in mice since 28 dpi (Fig. 3). Interestingly, antibody responses in immunized mice could only be detected by iELISA; both of the blocking ELISA and VNT gave negative results. In addition, vaccination with baculovirus expressed E2 protein in mice also did not induce detectable antibodies by IDEXX blocking ELISA (unpublished data by our lab). We hypothesized that the immune system of mice could not recognize the epitopes evolved in these two detection methods and we concluded mice is not a suitable model for CSFV vaccine evaluation. In pigs, the development of antibodies was detected by iELISA and blocking ELISA from 28 dpi (Fig. 4). But vaccinated pigs showed a delay in the induction of neutralizing antibodies; only some of them produced low levels of neutralizing antibodies at 42 dpi (Table 1). After challenge, neutralizing antibodies were promptly induced as early as 7 dpc. These results were similar with previous reports: the rapid production of neutralizing antibodies occurred upon viral challenge [9,11,13,14]. In addition, pVAX-CD81-E2 induced higher neutralizing antibodies than pVAX-E2 (Table 1), suggesting that co-expression of CD81 improves the antigen presentation and subsequent immune responses. Studies have shown that immunization with E2 DNA vaccine induced specific T cell responses, especially the IFN-␥ secretion [9,11]. Our results consisted with these reports and indicated that CD81 expressing promote the T cell responses, including the proliferation of lymphocytes, secretion of IFN-␥ and IL-4 (Figs. 3 and 5). To determine the protective effect of this DNA vaccine, pigs were challenged two weeks after the third vaccination (56 dpi). Clinical
3548
W. Li et al. / Vaccine 33 (2015) 3542–3548
symptoms, viremia and survival rates were examined and recorded. pVAX-CD81 vaccinated pigs showed fever and severe CSF signs since 5 dpc; all pigs developed detectable viremia during 4–10 dpc and died before 14 dpc. Two pVAX-E2 vaccinated pigs showed fever and CSF signs and one pig died at 12 dpc; viremia could be detected from three pigs. While in the pVAX-CD81-E2 group, only two pigs showed slight fever at 6–9 dpc and detectable CSFV RNA at 4 dpc; all pigs survived. These results were associated with the vaccines induced cellular immune responses and the NAs levels after challenge, supporting that both of the cellular immune responses and neutralizing antibodies are important to protection against CSFV infection. In this study, co-delivery of E2 and CD81 expressing plasmids possessed relatively lower immune responses than CD81-E2 fusion expressing plasmid in mice. Thus we didn’t choose the former in pig’s vaccination. We speculated that fusion expression of CD81 with E2 might improve the simultaneously expression of these two proteins in the same cells and thus facilitate the effect of CD81 on E2. Of course, the exact mechanism needs further analysis. To our knowledge, this is the first report emphasized the capacity of swine CD81 to enhance E2-based DNA vaccine in the cellular, humoral responses and protection against viral challenge. We concluded that CD81 enhances the effects of the DNA vaccine and could be used as a potential genetic adjuvant for other DNA vaccines. Acknowledgments This work was supported by the Special Fund for Independent innovation of Agricultural Science and Technology in Jiangsu province (CX(12)5049) and Jiangsu Provincial Natural Science Foundation of China (BK20130729). References [1] Greiser-Wilke I, Moennig V. Vaccination against classical swine fever virus: limitations and new strategies. Anim Health Res Rev 2004;5:223–6. [2] Greiser-Wilke I, Blome S, Moennig V. Diagnostic methods for detection of Classical swine fever virus—status quo and new developments. Vaccine 2007;25:5524–30. [3] Liu L, Xia H, Wahlberg N, Belak S, Baule C. Phylogeny, classification and evolutionary insights into pestiviruses. Virology 2009;385:351–7. [4] Luo Y, Li S, Sun Y, Qiu HJ. Classical swine fever in China: a mini review. Vet Microbiol 2014;172:1–6. [5] Newcomer BW, Givens MD. Approved and experimental countermeasures against pestiviral diseases: Bovine viral diarrhea, classical swine fever and border disease. Antiviral Res 2013;100:133–50. [6] Dong XN, Chen YH. Marker vaccine strategies and candidate CSFV marker vaccines. Vaccine 2007;25:205–30. [7] Sun Y, Tian DY, Li S, Meng QL, Zhao BB, Li Y, et al. Comprehensive evaluation of the adenovirus/alphavirus-replicon chimeric vector-based vaccine rAdV-SFVE2 against classical swine fever. Vaccine 2013;31:538–44. [8] Gabriel C, Blome S, Urniza A, Juanola S, Koenen F, Beer M. Towards licensing of CP7 E2alf as marker vaccine against classical swine fever—duration of immunity. Vaccine 2012;30:2928–36.
[9] Ganges L, Barrera M, Nunez JI, Blanco I, Frias MT, Rodriguez F, et al. A DNA vaccine expressing the E2 protein of classical swine fever virus elicits T cell responses that can prime for rapid antibody production and confer total protection upon viral challenge. Vaccine 2005;23:3741–52. [10] Yu X, Tu C, Li H, Hu R, Chen C, Li Z, et al. DNA-mediated protection against classical swine fever virus. Vaccine 2001;19:1520–5. [11] Wan C, Yi L, Yang Z, Yang J, Shao H, Zhang C, et al. The Toll-like receptor adaptor molecule TRIF enhances DNA vaccination against classical swine fever. Vet Immunol Immunopathol 2010;137:47–53. [12] Andrew M, Morris K, Coupar B, Sproat K, Oke P, Bruce M, et al. Porcine interleukin-3 enhances DNA vaccination against classical swine fever. Vaccine 2006;24:3241–7. [13] Wienhold D, Armengol E, Marquardt A, Marquardt C, Voigt H, Buttner M, et al. Immunomodulatory effect of plasmids co-expressing cytokines in classical swine fever virus subunit gp55/E2-DNA vaccination. Vet Res 2005;36:571–87. [14] Tarradas J, Alvarez B, Fraile L, Rosell R, Munoz M, Galindo-Cardiel I, et al. Immunomodulatory effect of swine CCL20 chemokine in DNA vaccination against CSFV. Vet Immunol Immunopathol 2011;142:243–51. [15] Oren R, Takahashi S, Doss C, Levy R, Levy S. TAPA-1, the target of an antiproliferative antibody, defines a new family of transmembrane proteins. Mol Cell Biol 1990;10:4007–15. [16] Levy S. Function of the tetraspanin molecule CD81 in B and T cells. Immunol Res 2014;58:179–85. [17] Cho KW, Kim SJ, Park CG, Park J, Cho JY, Kang HS, et al. Molecular cloning and expression analysis of pig CD81. Vet Immunol Immunopathol 2007;120:254–9. [18] Maecker HT, Do MS, Levy S. CD81 on B cells promotes interleukin 4 secretion and antibody production during T helper type 2 immune responses. Proc Natl Acad Sci USA 1998;95:2458–62. [19] Rocha-Perugini V, Zamai M, Gonzalez-Granado JM, Barreiro O, Tejera E, YanezMo M, et al. CD81 controls sustained T cell activation signaling and defines the maturation stages of cognate immunological synapses. Mol Cell Biol 2013;33:3644–58. [20] Fearon DT, Carroll MC. Regulation of B lymphocyte responses to foreign and self-antigens by the CD19/CD21 complex. Annu Rev Immunol 2000;18: 393–422. [21] Li WL, Mao L, Jiang JY. Cloning and sequence analysis of pig CD81 and prokaryotic expression of its large extracellular loop region. Chin J Prev Vet Med 2012;34:993–5. [22] Henke A. DNA immunization—a new chance in vaccine research. Med Microbiol Immunol 2002;191:187–90. [23] Rodriguez F, Whitton JL. Enhancing DNA immunization. Virology 2000;268:233–8. [24] Schick MR, Nguyen VQ, Levy S. Anti-TAPA-1 antibodies induce protein tyrosine phosphorylation that is prevented by increasing intracellular thiol levels. J Immunol 1993;151:1918–25. [25] Mattila PK, Feest C, Depoil D, Treanor B, Montaner B, Otipoby KL, et al. The actin and tetraspanin networks organize receptor nanoclusters to regulate B cell receptor-mediated signaling. Immunity 2013;38:461–74. [26] Deng J, Dekruyff RH, Freeman GJ, Umetsu DT, Levy S. Critical role of CD81 in cognate T-B cell interactions leading to Th2 responses. Int Immunol 2002;14:513–23. [27] Huang YL, Deng MC, Wang FI, Huang CC, Chang CY. The challenges of classical swine fever control: modified live and E2 subunit vaccines. Virus Res 2014;179:1–11. [28] Sun Y, Yang Y, Zheng H, Xi D, Lin M, Zhang X, et al. Co-expression of Erns and E2 genes of classical swine fever virus by replication-defective recombinant adenovirus completely protects pigs against virulent challenge with classical swine fever virus. Res Vet Sci 2013;94:354–60. [29] Zhang H, Li X, Peng G, Tang C, Zhu S, Qian S, et al. Glycoprotein E2 of classical swine fever virus expressed by baculovirus induces the protective immune responses in rabbits. Vaccine 2014;32:6607–13. [30] Gavrilov BK, Rogers K, Fernandez-Sainz IJ, Holinka LG, Borca MV, Risatti GR. Effects of glycosylation on antigenicity and immunogenicity of classical swine fever virus envelope proteins. Virology 2011;420:135–45.
