JOURNAL OF VIROLOGY, Dec. 1990, p. 5851-5860 0022-538X/90/125851-10$02.00/0 Copyright C 1990, American Society for Microbiology

Vol. 64, No. 12

The Upstream Factor-Binding Site Is Not Essential for Activation of Transcription from the Adenovirus Major Late Promoter MICHAEL REACH,1 LEE E. BABISS,2 AND C. S. H. YOUNG'* Department of Microbiology, College of Physicians and Surgeons, Columbia University, New York, New York 10032,' and Department of Molecular Cell Biology, Rockefeller University, New York, New York 100212 Received 17 July 1990/Accepted 12 September 1990

An adenovirus major late promoter (MLP) has been constructed with a 4-bp alteration in the sequence which binds the transcription factor known as USF or MLTF. This upstream element has often been considered necessary and sufficient for maximal transcription of the MLP. A duplex oligonucleotide containing the mutant sequence was not capable of binding specific proteins in a band shift assay, nor was it capable of inhibiting such binding by the wild-type sequence. In an in vitro assay, the mutant sequence was incapable of inhibiting transcription from a duplex sequence containing the MLP, whereas the wild-type sequence could. These two pieces of evidence suggest that the sequence is functionally impaired. Surprisingly, a virus containing the mutant MLP had a normal replication phenotype. On more detailed examination however, we show that the mutant viral MLP was deficient in transcription at 9 h postinfection but that the rate of transcription was close to normal by 20 h postinfection. An inverted CAAT box located immediately upstream of the USF-binding element was not previously thought to be of importance to the functioning of the MLP. However, a single point mutation in the CAAT box, placed in the USF mutant background, had a marked effect upon transcription from the MLP. This result suggests that the MLP may exhibit functional redundancy in which either the USF-binding site or the CAAT box can serve as an upstream promoter element. Neither of the mutant viruses displayed any change in the levels of the divergent IVa2 transcription unit, suggesting that the levels of divergent transcription are not determined by competition for limiting transcription factors. Over the last decade, a general picture of the structure of mammalian promoters has emerged. cis-Acting DNA sequence elements have been identified and trans-acting transcription factors have been isolated and cloned (for reviews, see references 12, 21, 33, 37, and 39). Emphasis has now shifted to the mechanisms by which tissue-specific transcription regulation is achieved (for a review, see reference 45), and a detailed biochemical description of the proteins involved in these reactions is under way. Yet, despite these advances, the behavior of most mutant mammalian promoters in their correct genomic context has not been addressed because of the difficulties of replacing the wild-type version of the promoters with mutant counterparts by homologous recombination. The transcriptional behavior of promoters may be affected by their context, and these effects may be missing in simplified reconstructed systems. The major exception to the lack of contextual analysis in mammalian promoters has occurred in viruses, when it is possible to reconstruct the genome in its entirety, and mutated promoter elements can be examined for their detailed transcriptional phenotypes (as in the herpesvirus thymidine kinase gene [6] and the simian virus 40 early promoter [18]). The major late promoter (MLP) of adenovirus is one of the viral promoters that have been extensively studied as models for eucaryotic transcription. In the MLP, the requirements for specific cis-acting sequences have been examined, using in vitro transcription and plasmid-borne transfection assays (7, 16, 25, 26, 40, 41, 48, 56), as well as at ectopic sites (30, 35) in the viral genome. These studies have defined cellular factor-binding sites important to promoter function under the experimental conditions employed. The MLP has been thought to be an example of a simple promoter in that it *

functions with a TATA element located at an appropriate distance from the start site and an upstream element to which a trans-acting factor termed USF or MLTF binds (40, 46, 48). Data suggest that the TATA box-binding factor TFIID interacts with USF to give maximal expression (48). Although the requirements for maximal activity of the MLP have been defined previously, these studies did not address the more complex regulatory circuits that may be operating in viral infection. The promoter is subject to control by adenovirus Ela protein (27, 43) by unknown mechanisms (see, for example, references 22 and 29) and is activated at late times by DNA replication (20, 52). The latter effect may be mediated both by cis-acting effects of DNA replication itself (52) and also by the action of a newly described factor induced at late times (20) which binds to sequences identified as being downstream of the transcription start site (20, 28). The degree to which these controls are dependent upon the MLP being in its correct position within the viral chromosome are not known. Thus we have chosen to make mutations in the various promoter elements and to study them in the correct position. As part of this survey, we have studied the function of the upstream promoter elements and have determined the impact of the altered sites on the viral life cycle. We demonstrate that the mechanism of promoter expression in the virus is more complicated than previous studies suggest. As with many other promoters, the MLP may exhibit functional redundancy of upstream elements, and we discuss the implications for the mechanism of promoter activity. MATERIALS AND METHODS

Oligonucleotide-directed mutagenesis. A 453-bp fragment extending from a XhoI site at bp 5778 to a Hindlll site at bp 6231 was cloned into the same sites in an M13mpl8 vector (55) containing the polylinker from pIC7 (36). Mutagenesis

Corresponding author. 5851

5852

REACH ET AL.

was performed by the techniques of Kunkel (23). Briefly, the MLP-containing M13 was grown in the dut ung mutant Escherichia coli CJ236, causing T's to be replaced by U's. Viral DNA was isolated, and the resulting uracil-containing template was hybridized to an oligonucleotide primer containing the desired alteration, which was then extended by a modified form of T7 polymerase (Sequenase [United States Biochemical]) to copy the entire M13 genome. The doublestranded DNA was transfected into competent JM109 (55) in which replication favors the mutation-containing strand over the wild-type uracil-containing strand. Six of the resulting plaques were screened for those containing the mutation, by sequencing the viral DNA using the dideoxy method (47). Oligonucleotides were purchased from Genetic Designs (now Genosys), The Woodlands, Tex., or from the oligonucleotide-synthesizing facility, Comprehensive Cancer Center, Columbia University, New York, N.Y. The mutationcontaining oligonucleotides (mutated bases underlined) were as follows: USFO 5' CCCGG-CAIGTAGCATACACC 3' CAAT 5' CCTATAAACCCATCACCTTCC 3' Construction of an adenovirus MLP replacement vector. For ease of replacement of the wild type by the mutated MLP sequences, modifications were made to plasmid pO26.5 (1). This plasmid contains adenovirus sequences extending from the viral left-hand end at map unit (m.u.) 0 to m.u. 26.5 (bp 9523). The MLP/IVa2 region of study is located at around m.u. 16.7 and is flanked by two convenient restriction sites, a XhoI site at bp 5778 and a HindlIl site at bp 6231. In order to allow the easy replacement of promoter fragments, a HindlIl site at bp 2798 and a XhoI site at bp 8244 were removed by amino acid-conserving oligonucleotide-directed mutagenesis, and a plasmid containing unique flanking sites was rebuilt by standard cloning techniques (32). This plasmid, pMR1, was further modified to contain a 6-bp insert, creating an EcoRI site at the PvuII site at bp 6069. This site (which confers no phenotype) can be used as a screen in the replacement described below. The modified plasmid is referred to as pMR2. Testing of MLP mutations by overlap recombination. After mutagenesis, the XhoI-to-HindIII MLP fragment was excised from the M13 vector replicative-form DNA into pMR2 (Fig. 1). Individual clones were screened for the loss of the EcoRI site present at bp 6069 in the parental plasmid, and it was assumed that the derivative lacking the site contained the mutant MLP in its place. To test the viability of a particular mutant MLP, small DNA preparations of the mutation-containing plasmid were digested with EcoRI. After inactivation of the restriction enzyme, the unpurified mix was cotransfected (15, 53) on human A549 cells with a right terminal adenovirus genomic fragment extending from the XhoI site at 22.9 m.u. from the phenotypically wild-type virus LLX1 (1). Recombination in the overlapping sequence from 22.9 to 26.5 m.u. will yield a full-length genome, and if the mutation does not confer a lethal phenotype, will give rise to plaques on the transfection plates. The presence of the mutations in the resulting viruses was confirmed by cloning the XhoI-to-HindIII fragment into a pSP64-derived plasmid, followed by double-stranded sequencing using the method of Zagursky et al. (57). Mutant viruses were plaque purified once before further analysis. Viral replication. Growth curves were performed on human A549 cells, derived from a small cell carcinoma of the lung (14). Cells were grown to confluency in 35-mm-diameter dishes in Dulbecco modified Eagle medium plus 10% sup-

J. VIROL.

plemental calf serum (Hyclone). Infections were performed by removing the medium and adding 0.2 ml of virus at a multiplicity of infection of 10 PFU per cell and incubating at 37°C for 1 h, with periodic shaking. The plates were then overlaid with infecting fluid (24). The infected cells were harvested at intervals by freezing individual dishes, and virus was liberated by repeated freezing and thawing. Titration was performed on A549 cells by fluorescent focus assay (44). DNA replication. Viral DNA was extracted by a modification (53) of the Hirt technique (19), from A549 cells infected identically to those used for the growth curves. The DNA was transferred to a Nytran filter (Schleicher & Schuell), using a slot blot apparatus. The filter was blocked for 2 h in a solution containing 4x Denhardt solution, 0.1% sodium dodecyl sulfate, and 5x SSC (lx SSC is 0.15 M NaCl plus 0.015 M sodium citrate), and then probed with the MLP derivative of the pSP64 plasmid described above, which had been labeled by random priming synthesis (13) using both [ct32P]dGTP and [ct-32P]dCTP (3,000 Ci/mM; New England Nuclear Corp.). The filter was washed first with 2x SSC0.1% sodium dodecyl sulfate for 30 min at 65°C and then in 2 x SSC at 65°C for 30 min, air dried, and exposed to Kodak XAR-5 film for 1 h. Mobility shift assays. Single-stranded oligonucleotides containing either the wild-type USF-binding site or the 4-base alteration contained in USFO were phosphorylated, using 10 U of polynucleotide kinase and 100 ,uCi of [_y-32P]ATP in a 10-,ul reaction. The phosphorylated oligonucleotides were purified from the unincorporated [32P]ATP by elution from NAP-5 columns (Pharmacia). The labeled single-stranded oligonucleotides were then hybridized with their unlabeled complementary strand by heating to 65°C in 100 mM NaCl-1 mM EDTA and slow cooling to 30°C. The technique for the mobility shift was adapted from that of Shore et al. (50). The labeled duplex oligonucleotides were added to 40 RI of 5x FPB (100 mM NaCl, 10 mM Tris [pH 7.4], 100 ,ug of bovine serum albumin) plus 160 p.l of H20. The HeLa nuclear extract, prepared by a protocol modified from Dignam et al. (11), was preincubated for 2 min with competitor oligonucleotide when indicated, probe was added, and the mix was incubated at room temperature for 20 min, and then electrophoresed through a 5% native polyacrylamide gel to separate bound from unbound probe. The gel was dried and exposed to Kodak XAR-5 film for 45 min. In vitro transcription assays. The duplex oligonucleotides used in the mobility shift assays were used as competitors for transcription factors in an in vitro transcription assay based on the use of the G-less cassette (48, 49). Rat liver protein extract was mixed with a plasmid which contained the sequence of interest upstream of the G-less cassette and competitor oligonucleotide when indicated, and incubated with a solution containing [32P]UTP (35 mM), CTP, ATP (0.6 mM), and 3' O-methyl-GTP at 30°C for 30 min. The reactions were phenol extracted, and the nucleic acids were precipitated by ethanol overnight at -20°C. Pellets were sus-

pended in running buffer containing 90% formamide, and samples were electrophoresed on a 5% denaturing polyacrylamide gel. RNase protection assays. Riboprobes (38) specific for Elb, IVa2, and late leader 3 were made by incubating linearized template DNA with 10 ,ul of a solution containing [ot-32P]UTP, 2 mM GTP, CTP, ATP, and 0.1 mM UTP with SP6 RNA polymerase in a 25-,lA reaction at 40°C for 45 min and then treated with RNase-free DNase (Promega). Follow-

IN VIVO TRANSCRIPTION FROM ADENOVIRUS MLP

ing DNase treatment, 15 ,ug of yeast tRNA (Bethesda Research Laboratories), 200 ,ul of 4 M ammonium acetate, 180 ,ul of H20, and 1 ml of ethanol were added. Precipitation of RNA was performed on dry ice for 10 min, the precipitate was centrifuged for 10 min, and the pellet was washed with 70% ethanol and dried. Amounts of RNA corresponding to 106 cpm of the riboprobe preparation were used in the subsequent hybridization reactions. Cytoplasmic RNA was isolated at indicated times postinfection (p.i.) as follows. A total of 50 x 106 infected HeLa cells were pelleted, washed once with ice-cold phosphate-buffered saline without magnesium, resuspended in 1 ml of phosphate-buffered saline, and transferred to a microcentrifuge tube. The cells were pelleted for 20 s in a microcentrifuge in the cold room and suspended in 260,ul of lysis buffer. Five microliters of 5% Nonidet P-40 was added, and the tube was vortexed and then kept on ice for 5 min. Nuclei were pelleted, and the supernatant was kept. Two hundred microliters of 2x PK buffer (2x PK buffer is 0.2 M Tris chloride buffer [pH 7.5]-25 mM EDTA-0.3 M NaCl-2% [wt/vol] sodium dodecyl sulfate) was added, followed by 10 IlI of a proteinase K solution (10 and incubated for 30 min at ,ug/,ul; Boehringer Mannheim), 65°C. The solution was extracted twice with phenol and with chloroform-isoamyl alcohol and then precipitated with ethanol. Fifteen micrograms of total cytoplasmic RNA was hybridized to riboprobe in 75% formamide for 18 h and then digested with 50 U of T2 RNase (Bethesda Research Labo,ul of T2 buffer for 2 h. The mix was ratories) per ml in 350 phenol extracted, and the ethanol precipitate was then electrophoresed on a 5% denaturing acrylamide gel. Primer extensions. The technique used was that of Hernandez and Keller (17), as modified by Yumi Kasai and Jane Flint (personal communication). Total cytoplasmic mRNA was isolated by the method described above. mRNA was hybridized to oligonucleotide primers, kindly provided by Y. Kasai and J. Flint, specific for either MLP or IVa2 transcripts. The oligonucleotides were then extended by using avian myeloblastosis virus reverse transcriptase with [cI-32P]dCTP, dGTP, dATP, and TTP, and the products were electrophoresed on a 6% denaturing polyacrylamide gel. Nuclear run on transcription assays. A total of 1.5 108 HeLa cells in spinner culture were infected with the appropriate viruses and at the indicated times were centrifuged, washed twice with ice-cold phosphate-buffered saline suspended in 1 volume of RSB (10 mM Tris chloride buffer [pH 7.4], 10 mM NaCl, 1.5mM MgCl2, 0.5 mM phenylmethylsulfonyl fluoride, 0.5 mM dithiothreitol), and incubated on ice for 10min. All subsequent manipulations were performed on ice or 4°C. at Cells were centrifuged and resuspended in 1/4 volume of RSB, Dounce homogenized, and recentrifuged, and the nuclear pellet was suspended in 1/10 volume of RSB plus 0.025% Nonidet P-40. They were Dounce homogenized again, and the nuclei were added to the top of RSB containing 30% sucrose. The tubes were spun at 1,000 rpm in an IEC model PR2 centrifuge for 15 min, the supernatant was removed with a pipette, and the purified nuclei were suspended in 2x transcription buffer (2X transcription buffer is 40 mM Tris chloride buffer [pH 7.9]-200 mM KCI-9 mM MgCl2-10 mM dithiothreitol-40% [vol/vol] glycerol) and recentrifuged. The pellet was suspended in an equal volume of a solution containing 0.8 MM [32p]UTP (3,000 CiImM; New England Nuclear Corp.), 2 mM ATP, at The CTP, and GTP and incubated for 15 min 30°C. preparation was chased with an equal molarity of cold UTP 10 One hundred microliters of RNase-free DNase for min. (Bethesda Research Laboratories) was added and incubated x

A

RI

X

m

5853

H

H 26.5

pMR2

m.u.

RF DNA

0 m.u.

X

m

H

RMutant pMR2

/

26.5 m.u.

O m.u.

B

m

26-5 m.u.

_, 100 m.u.

22.9 m.u.

EjI

LLX1 DNA

FIG. 1. Strategy for replacement of the wild-type MLP sequence by mutant sequences. The details of the reconstruction cloning and the overlap recombination methods are described in Materials and Methods. (A) Replacement of wild-type sequence by mutant sequence in plasmid pMR2. The XhoI-to-HindIII fragment is derived from M13 replicative-form (RF) DNA. (B) Cotransfection of the plasmid and the viral DNA fragment. Abbreviations: X, XhoI site at bp 5778; H, HindIll site at bp 6231; R, artificial EcoRI site at bp 6069; m, mutated sequence in the MLP region. In plasmid pMR2, the thick line represents adenovirus sequences, and the thin line represents pBR322 sequences. The adenovirus sequences at the left-hand end and at bp 9523 are bounded by the EcoRI and BamHI sites of pBR322, respectively.

for 15 min at room temperature, followed by an equal volume of 2x PK buffer. Proteinase K was added to a final 200 and incubated for 30 min at concentration of,ug/ml 37°C. Three to four volumes of RNAzol B (Cinna/Biotecx, Friendswood, Tex.) were added, the mixture was vortexed vigorously, and centrifuged at 8,000 rpm in a Sorvall SS34 rotor at 4°C for 10 min. The supernatant was kept, 1/4 volume of ammonium acetate was added, and RNA was precipitated with ethanol. The precipitation step was repeated four times to remove unincorporated label. The final RNA pellet was suspended in 1 ml of 10 mM Tris EDTA, and a sample was used to determine the radioactive counts. In the subsequent hybridizations, 107 and 106 CpM were used for early and late time points, respectively. Nytran filters (Schleicher & Schuell) containing,ug 15 of various single-stranded M13 clone DNAs were prepared on a slot blot apparatus. The DNA was cross-linked to the filters with a Stratagene UV crosslinker and baked for min 30 in a vacuum oven. Hybridization in the presence of 50% deionized formamide was done by standard procedures.

5854

REACH ET AL.

J. VIROL.

RESULTS

WT PROBE

Introduction of a mutated MLP into virus. To examine the

effects of mutations upon the function of the adenovirus MLP in vivo, we have developed a system that allows the easy placement of an altered MLP in the correct viral genomic location (Fig. 1). This allows a rapid survey of mutations in the promoter elements. Although it is known that the DNA polymerase encoded on the opposite strand to the MLP transcription unit can tolerate many amino acid substitutions and in-frame insertions (1; also unpublished results), the mutations introduced maintained the wild-type sequence of the DNA polymerase so that any phenotypic consequences could be ascribed unambiguously to the MLP (or IVa2) transcription unit. To test the viability of a particular mutant MLP, mutation-containing plasmids are cotransfected on human A549 cells with an adenovirus fragment that extends from 22.9 to 100 m.u. Recombination in the overlapping sequence will yield a full-length genome, and if the mutation does not confer a lethal phenotype, will give rise to plaques on the transfection plates. The presence of the mutations in the resulting viruses can be confirmed by cloning and sequencing of the appropriate region. Elimination of the USF-binding site. The first element to be examined in detail was the USF-binding site, which on the basis of previous work, was suggested to be the only upstream element necessary for maximal activity of the MLP (30, 48). The element is a nearly perfect palindrome 5' GGCCACGTGACC 3' extending from -63 to -52 relative to the MLP start site at + 1. To eliminate binding of USF, a 4-bp alteration in the binding site was constructed as follows: -63

-52

wild type: GGCCACGTGACC mutant: TGCIACATGGCC Changes at these sites were demonstrated previously to reduce transcription (25) and the G residue at position -63 is conserved in the mouse metallothionein promoter (2). Plasmids containing these mutations formed the same numbers of plaques in the overlap reactions as the wild-type plasmid. Virus carrying the mutant USF site formed the same size plaques as the wild type, although the individual infected cells displayed a more birefringent morphology. To investigate the ability of the altered USF site (USFO) to bind its cognate factor, we performed a mobility shift assay with HeLa cell nuclear extract. An oligonucleotide containing the normal USF-binding site (wild-type probe) was incubated with extract and electrophoresed on a native polyacrylamide gel (Fig. 2, lanes 1 to 6). As shown in lane 4, the mobility of the probe was reduced, with the appearance of two slower-migrating bands. Extract incubated with a 50-fold molar excess of unlabeled oligonucleotide containing the wild-type sequence, eliminated the appearance of the bands (lane 3), whereas competition with the mutant sequence or with an unrelated oligonucleotide, at 100-fold molar excess, eliminated only the lower band (lanes 5 and 6). From these and other results with oligonucleotides containing mutant USF sites (results not shown), we suggest that the upper band is specific for the USF interaction and that the lower band is caused by some nonspecific interaction. As additional evidence in support of this conclusion, the wildtype oligonucleotide was incubated with yeast whole-cell extract. Yeast extract contains a factor capable of binding to the USF site (4). As expected, wild-type oligonucleotide incubated with yeast extract showed a slightly greater de-

USFO PROBE

y -HELA-- -HELACOMPETITOR COMPETITOR - - W - U Oc --U W Oc

-

..........

1 2 3 4 5 6 7 8 9 10 11

FIG. 2. Analysis of the retardation of duplex oligonucleotides containing wild-type (WT) or mutant USF-binding sequences by HeLa cell nuclear extracts. The methods for band shifting are described in Materials and Methods. The sequence of the wild-type oligonucleotide was 5' GGTGTAGGCCACGTGACCGGG 3' and its complement (the sequence protected by USF binding is in italics). The mutant sequence was 5' GGTGTATGCTACATGGCCGGG 3' and its complement (the mutated bases are in boldface type). The competitions were performed with wild-type sequence (W), USFO sequence (U), or a sequence capable of binding the transcription factor Octl (Oc). Incubations were performed with HeLa nuclear extract, a yeast whole-cell extract (y), or nothing (-).

crease in mobility of the specific band than that with HeLa extract (lane 2). Further corroborating evidence that the upper band is specific for USF binding came from incubation with antibodies directed against USF. When extracts were preincubated with the antibody, the upper band was eliminated (data not shown). When the USFO oligonucleotide was used as a probe (Fig. 2, lanes 7 to 11) only the lower nonspecific shifted band was observed (lane 8). As expected, the lower band shift was inhibited by the mutant, wild-type, and unrelated oligonucleotides. The mutant oligonucleotide also has been shown to be incapable of binding purified USF (Polly Gregor,

personal communication). These results strongly suggest that the mutant USFO sequence cannot bind USF in this in vitro system. From results to be shown later, we can also infer that the mutant sequence cannot bind USF in the infected cell. The mutated USF-binding sequence does not inhibit in vitro transcription. Before examining the transcriptional characteristics of the virus containing the mutant USF-binding site in detail, it seemed prudent to determine whether the mutant site affects in vitro transcription. One method to examine transcription factors necessary for promoter activity in an in vitro transcription assay is to attempt to allow competition for these factors with oligonucleotides containing factor binding sites. If the factors are involved in promoter function, sequestration of the particular factors by the oligonucleotides will result in a decrease in promoter activity. We employed an in vitro transcription system derived from rat liver extracts and a supercoiled plasmid containing the MLP extending from -88 to +33, fused to a G-less cassette (49). Transcription reactions containing only three nucleotides, ATP, UTP, and CTP, give rise to transcripts 250 nucleotides in length. The ability of the cold oligonucleotides used in the mobility shift assay to compete and hence to lower transcription was determined. As expected, transcription from the MLP-containing template was decreased

IN VIVO TRANSCRIPTION FROM ADENOVIRUS MLP

VOL. 64, 1990

0

0-0en CD

0 c)O

00CzZ Z Z (a o CD (a CEC

c C cl n

(D

5855

V) -n m

(.

A 6 hrs

I2

12hrs

hrs+Ara

24hrs --I

2

U) m

3

4

5

7

6

8

10

9

12 M1 1

1

_

iO

0

rn411

0. 4

mu__

90

-~~~~~~~~ = = I: FIG. 3. In vitro transcription competition assay. In vitro transcription assays were set up as described in Materials and Methods. The extended transcription product is 250 nucleotides in length (arrow) and migrates slightly slower than the 242-bp band of the MspI-digested and end-labeled pBR322 markers (results not shown). Reactions were preincubated with wild-type (WT) or mutant oligonucleotide, as indicated, prior to the incorporation reaction.

6 hrs

B

2

4

3i 4

5

5

24 hrs

12 hrs

12 hrs+Ara

M...... 2.3..

M

-a

1--.ST 6.17 i 8 .--1 9 1:10

6.

221

217I

201

with wild-type oligonucleotide (Fig. 3, lanes 3 and 4). On the other hand, the mutation-containing oligonucleotide, which failed to produce a specific shift, did not decrease expression (lanes 1 and 2). These in vitro transcription results, together with the findings of the mobility shift assay, suggest that the USFO sequence is unable to bind factor(s) necessary for increased MLP activity. Analysis of RNA production in vivo: RNase protection assays. Despite the inability of the mutant sequence to bind USF, we were surprised to find that the sequence could be incorporated into viable virus. Thus it was of some importance to determine whether the elimination of USF binding, as suggested by the results above, resulted in a change to the transcriptional program of the virus. In order to examine the transcription phenotype of the mutant MLP, we measured steady-state accumulation of cytoplasmic RNA sequences derived from transcription from the major late, IVa2, Elb, and protein IX promoters by RNase T2 protection assays. Cytoplasmic RNA was isolated at different times p.i. from HeLa cells infected with the wild-type or mutant viruses, hybridized to each of the specific riboprobes, digested with RNase T2, and electrophoresed on a denaturing polyacrylamide gel. One set of infected cells from each infection was incubated in the presence of AraC to inhibit DNA replication. The results from the MLP are shown in Fig. 4A. As expected, expression was not observed from the MLP of either virus at 6 h p.i. or in the presence of AraC (wild type in lanes 3 and 6 and USFO in lanes 2 and 5). Specific protected probe bands corresponding to MLP expression (band corresponding to 89 bases in length) are visible at 12 h p.i., but the amount from USFO-infected cells (lane 8) was twofold less than that from the wild type (lane 9). This result was observed in several repeated experiments in which the amount of late transcription from the mutant promoter was reduced two- to fivefold compared with that from the wild type. However, by 24 h p.i. the deficiency in USFO and wild-type mRNA production was less (lanes 11 and 12); this has been observed in several experiments. The results from the studies of the Elb and protein IX promoters are shown in Fig. 4B. As expected,

12

19C-

up

::; .:. .-

C M

622 527 404--

- 205

904opmI- 195

iiillimilij-0

m .,m ol

,r- f- :;i.;;

6 hrs 12 hrs+Ara 2 3 .4 5 6

12 hrs

7

- r7 110 8 -8 9

24 hrs .-11 1 2

_ 4

_

-441

FIG. 4. Steady-state viral mRNA levels in wild-type- and mutant-infected cells. Cells infected with wild-type, USFO, and USFO/ CAAT viruses were harvested at 6, 12, and 24 h p.i. All panels show data derived from a single experiment and a single autoradiographic exposure. Below each panel is diagrammed the structure of the riboprobe sequences synthesized from the plasmid and the adenovirus sequences with which they are expected to hybridize (see text). (A) Sequences protected by the leader 3-specific probe; (B) those sequences protected by a probe specific for protein IX and Elb; (C) those sequences corresponding to IVa2. Markers (M) are end-labeled fragments of MspI-digested pBR322. Lanes 1, 4, 7, and 10, cells infected with USFO/CAAT; lanes 2, 5, 8, and 11, cells infected with USFO; lanes 3, 6, 9, and 12, cells infected with wild type. Quantitation of the radioactive bands was performed by two-dimensional beta-emission spectroscopy of the dried gel, using a Betagen Betascope 603 blot analyzer.

5856

REACH ET AL.

sequences corresponding to expression from the Elb promoter (the band labeled 195), can be detected at 6 h p.i., at 12 h p.i. in the presence of AraC, and at 24 h p.i. (the 183-nucleotide protected band was omitted from the autoradiograph [see diagram]). There was no difference between the mutant and wild-type infections (compare lanes 2, 5, and 8 with lanes 3, 6, and 9). These results serve as a control, showing that the two infections were established under similar conditions. The expression from the protein IX promoter (band labeled 205) is also indistinguishable between mutant and wild-type infections, and again this suggests that the establishment and time course of infection was similar in the two sets of cells. In the presence of AraC, no hybridizing material was visible, since this promoter is only active after DNA replication. The apparent loss of RNA hybridizing at 24 h p.i. is explained by the use of 15-fold-less material, so that the relative differences between mutant and wild type for other species of RNA could be observed. The IVa2 promoter is divergent from the MLP, the start sites of transcription are separated by 210 nucleotides, and it is expressed only after DNA replication (10). It was thought that they share common promoter elements and that the USF site was necessary to activate both promoters (42). However, unlike the situation with the MLP, IVa2 RNA expression in the wild-type and USFO infections was identical at 12 p.i. (Fig. 4C, lanes 8 and 9, band labeled 441). Again as expected, expression could not be detected at 6 h p.i. or in the presence of AraC (lanes 2 and 3, and lanes 5 and 6). The lower amount of IVa2 expression of USFO at 24 h (lane 11) was not observed in other experiments and is not observed in the double mutant infection discussed later. The results of the RNase protection experiments show a subtle effect upon expression from the MLP. This suggests that the mutations present in USFO have affected the structure and function of the MLP and they are consistent with the idea that USF binding has been altered in vivo as well as in vitro. Although the differences in mRNA accumulation between the wild type and the mutant at the two times were small, the finding that late mRNA expression was nearly equivalent at 24 h p.i. suggests that the USFO MLP is impaired at early times, while later on both promoters are nearly equal in strength. Viral DNA replication in mutant and wild-type infection. Decreased level of expression from the mutant MLP at intermediate times p.i. might occur if the template has not replicated to the same extent as in the wild-type infection. DNA replication has been shown to increase MLP expression (20, 52). Protein IX and IVa2 expression is an indirect measure of DNA replication, since they too depend upon DNA replication. Expression from these promoters was equivalent in both USFO- and wild-type-infected cells at 12 h p.i. (Fig. 4B, lanes 8 and 9 and Fig. 4C, lanes 8 and 9), suggesting that a decrease in DNA replication is not responsible for the decrease in MLP activity. Direct measurements of the rate of viral DNA replication in wild-type- and mutant-infected cells showed that they were similar (Fig. 5, rows WT and USFO). Direct measurement of the counts on the filter at 12 h showed that they were within twofold of one another. Moreover, when the extent of hybridization to the filters at each time point was plotted, the rate of increase was identical. Primer extension assays. To examine whether the mutation in the MLP affects the choice of initiation sites for the major late and IVa2 transcripts, primer extensions were performed on cytoplasmic mRNAs obtained from cells infected for 18 and 24 h with the mutant and wild-type viruses (Fig. 6). With

J. VIROL.

p.i

hours

2 12 15 18 WT

USFO USFO/CAAT

j

9

*

FIG. 5. DNA replication in wild-type (WT) and mutant virus infection. A549 cells in monolayer culture were infected at 10 PFU per cell and harvested at the times indicated. DNA was extracted by a modification of the Hirt technique and examined by slot blot, using labeled adenovirus probe. Quantitation was as described in the legend to Fig. 4.

the IVa2 primer (right side of Fig. 6), the two pairs of doublets were of the expected sizes for extension to the IVa2 start sites and the quantities were equivalent in the two infections. The lanes corresponding to the MLP-specific primer also show the expected extension products, although the amounts from the mutant-infected cells were somewhat lower at both time points. Quantitation by densitometry of the MLP-specific bands from a lower exposure of the gel shows a less than twofold difference between the mutant and wild-type infections. Major late Primer 24h 18h k

I

IZa2 Primer lBh 24h

mmI

MARKER tStart sites

.w m;. ."f

.s,

M. ,4

.1

z,

M.

im,

T'

Startsites -

;Xz

Free Priners-

A.

4 ..

FIG. 6. Primer extension analysis of cytoplasmic viral RNA. Cytoplasmic RNA isolated from infected cells, was hybridized to primers specific for the major late and IVa2 transcription units, and then extended by avian myeloblastosis virus reverse transcriptase. The extended products should be 36 bases long for the major late mRNAs and 55 and 57 for the IVa2 mRNAs. In the panel with major late primer, the samples were run in every other lane, while with the IVa2 primer, they were in adjacent lanes. The marker is a dideoxy sequencing reaction to show sizes. WT, Wild type.

IN VIVO TRANSCRIPTION FROM ADENOVIRUS MLP

VOL. 64, 1990

9 hr p.i.

A

A

2 2 h r p.i.

5857

8-

-o--WT

7

6- -*"-USFO - - USFO-CCCAT 5 -

B

B

_0

__-

2-

C

M13 Actin .....

ML

ML

E2b

E2b

I,,,

C

ML E2b

ML E2b

00

FIG. 7. Transcription in isolated infected-cell nuclei. Spinner HeLa cells were infected at a multiplicity of infection of 50 PFU per cell for the 9-h infection and 20 for the 22-h infection. Nuclei were isolated and, after incubation with [32P]UTP, RNA was isolated and hybridized to single-stranded DNA-containing filter slots as shown in panels C. Adenovirus sequences between the HindIll sites at bp 11555 and bp 13636 were cloned in either orientation in M13mpl8 to give sequences complementary to the major late transcription unit (ML) or the E2b transcription unit. In the 9-h sample, panel A corresponds to RNA from USFO-infected cells and panel B corresponds to wild-type-infected cells. The autoradiographic exposure times for the 9-h samples were 2 h for the MLP filter slots and 14 h for the others. In the 22-h sample, panels A and B correspond to wild-type-infected and USFO-infected cells, respectively. The 22-h sample autoradiographic exposure was 14 h.

The fact that both sets of messages start at their respective normal sites and are quantitatively similar suggests that the mutations present in USFO do not alter the positioning of the polymerase when initiating transcription in either direction. They also confirm the observations of the RNase experiments in showing that the total quantity of RNA made is similar between the mutant and wild type at late times. Rate of transcription initiation at wild-type and mutant MLPs. The subtle temporal effects of the mutation in the USF binding site, observed in vivo, are most probably caused by an alteration in the rate of transcription initiation at the MLP. Changes in promoter structure are unlikely to have consequences for RNA processing, transport, or stability. To demonstrate this unequivocally however, it is necessary to measure transcriptional initiation by using a nuclear run-on assay. Nuclei were isolated from infected cells at 9 and 22 h p.i. and incubated with [32P]UTP, to allow previously initiated RNA polymerases to elongate. RNA was isolated and hybridized to single-strand sequences specific for either the major late transcription unit or the complementary E2b transcription unit (Fig. 7). At 9 h p.i., the ratio of counts hybridizing to the two strands, as measured by two-dimensional beta-emission spectroscopy, is different in the wild-type and mutant infections. In the experiment shown, the MLP/E2b ratio was approximately 16.4 in the wild type but only 5.3 in the mutant. In a second experiment, this threefold difference in ratios was again observed. At late times, the ratio of hybridization is similar in the two infections, with the MLP-specific sequences being in considerable excess, as expected at this stage of infection. The transcription initiation results thus agree with the RNase protection assays in showing a temporal deficiency in the functioning of the MLP at earlier times, which is absent at 22 h p.i.

10

20

30

Time (hours)

40

50

FIG. 8. Viral replication cycles. A549 cells in monolayer culture infected at a multiplicity of infection of 10 PFU per cell, and samples were taken at intervals. Virus was titrated by fluorescent focus assay. were

Possible role of other promoter elements. One plausible interpretation of the results described above is that it is possible to eliminate the binding of USF to the upstream promoter element of the MLP without affecting expression severely. It is possible that in the absence of a functional upstream element, another promoter element may compensate. As part of our comprehensive survey of the elements important to MLP expression, we have investigated the possible role of the upstream inverted CAAT sequence. This element has been shown to bind a heterodimeric transcription factor, CP1, in vitro (3). Its role in in vitro transcription or transient transfection assays of MLP function suggested that it played a minor role (31, 40, 41). We chose to make a change in the CCAAT sequence at the central conserved nucleotide, which is known to contact CP1 (3). The alteration changed the sequence to CCCAT. The mutation does not alter the appearance and number of plaques upon overlap transfection. However, an MLP with both the mutant CCCAT and the USFO sequence produced plaques which were much smaller than the wild type and in which the infected cells were morphologically distinct. The phenotype of this mutant was examined in viral growth curves, DNA replication kinetics, and accumulation of cytoplasmic RNA (Fig. 4, 5, and 8). There was a protracted eclipse period for the double mutant compared with either single mutation or the wild type, and the burst was lowered by some 10-fold at 42 h p.i. The level of expression of the MLP from the double mutant infection was measured by a T2 RNase protection assay. These results were obtained in parallel infections to those described previously in Fig. 4. While expression from the E1B, protein IX, and IVa2 promoters was very similar to that seen with the USFO and mutant infections (Fig. 4B and C), expression from the MLP was severely affected at both 12 and 24 h p.i. (Fig. 4A, lanes 7 and 10). DNA replication was unaffected in the double mutant (Fig. 5, row USFO/ CAAT), although the input level of DNA was considerably elevated (see the visible hybridizing band at the 2-h time interval in the double mutant). This is caused by an inability to titrate the virus accurately because of the small plaque size, which would lead to an underestimate of the true infectious titer. Analysis of RNA production by nuclear run-on assay and of viral protein synthesis show that the

5858

REACH ET AL.

double mutant infection is considerably delayed, commensurate with the delay in the replication cycle (data not shown). Taken together, the results with the double mutant show that while mutation in either upstream element alone is insufficient to affect expression from the MLP severely, mutations in both are highly deleterious to promoter function. It is also worth reemphasizing that effects upon MLP function do not have any consequences for the divergent IVa2 promoter. DISCUSSION Ever since the demonstration that the adenovirus MLP can be specifically transcribed in crude cellular extracts (34, 54), the MLP has remained one of the primary models for the investigation of the structure and function of eucaryotic promoters. Results from both in vitro and in vivo studies had suggested that the MLP is a very simple promoter, containing a single upstream binding site which binds a cellular transcription factor necessary for activation (5, 48). Interaction of this factor with the general transcription factor TFIID at the TATA box is sufficient to give maximal levels of transcription in vitro (48). As mentioned in the introduction however, the regulatory circuits of which the MLP forms a part, are not reproduced in the in vitro systems. An important way to examine the roles of promoter elements in vivo is to make mutations in them by sitedirected mutagenesis and to test the phenotypic consequences in the correct genomic context in the intact virus. Although this is a more laborious method than the customary transient expression assay (40, 41), the results obtained are a true reflection of the consequences for the viral transcription cycle, since both structural and temporal controls on viral gene expression are intact. The replacement system we have developed especially for this mutational survey (Fig. 1), allows specific bases to be mutated and the easy replacement of wild type by mutant MLP regions in the correct genomic location within the intact virus. This method allows a more specific and rapid mutational survey than the bisulfite mutagenesis protocol used previously (1). The results of the replacement of the wild-type USFbinding site by a 4-base mutation were surprising. As expected, oligonucleotides containing this mutation were unable to bind USF in a gel mobility shift assay (Fig. 2) and the sequence was unable to compete for transcription factors in in vitro assays (Fig. 3). Furthermore, experiments with transient expression vectors, in which the chloramphenicol acetyltransferase gene was under the control of the MLP, showed that the USF mutant sequence was 20-fold less active than the wild type (data not shown). On the other hand, despite these hallmarks of transcriptional incompetence, virus containing this mutation were easy to obtain and displayed a gross replicative phenotype similar to the wild type (Fig. 8). On more detailed examination, there was a subtle but reproducible difference in activity of the MLP of USFO and wild type. USFO mRNA accumulation (Fig. 4) was lowered some two- to threefold from that of the wild type at 12 h p.i., but at 24 h p.i., this difference was considerably less (varying in different experiments from a 1.5-fold decrease to near equivalence). Nuclear run-on experiments (Fig. 7) showed that the transcription rate at 22 h p.i. was indistinguishable between the mutant and the wild type, while at 9 h p.i., expression from the mutant was reduced some three- to fourfold. Taken together, these data suggest that USF is involved in activation only during a

J. VIROL.

portion of the infection, but by 18 h the MLP has become independent of USF. This interpretation differs from one in which the mutant MLP is defective throughout the infection. The MLP has been shown to be transactivated early by the immediate-early gene product Ela (43), possibly through the TATA box (27). If, on the other hand, Ela transactivation of the MLP were dependent on USF binding, the early defect in USFO expression could be explained, implying a novel role of USF in Ela transactivation. A possible explanation for the decreased level of expression from the mutant MLP at intermediate times p.i. would be that the template has not replicated to the same extent as in the wild-type infection. To address this possibility, DNA replication was measured directly. The results indicate that at 12 h p.i. DNA replication is about twofold lower in USFO-infected cells compared with wild-type infected cells. However, protein IX and IVa2 expression, which are completely dependent on DNA replication, were equivalent in both USFO- and wild-type-infected cells at 12 h p.i., as measured by nuclear run-on and RNase T2 assays. Therefore it is likely that the twofold difference observed in DNA replication is not significant and does not account for reduced MLP transcription of USFO. Regardless of the interpretation of the small differences in transcription observed between the mutant and wild type at intermediate times p.i., MLP expression in the virus at late times was not dependent on USF binding for activity. This apparent incongruity between the in vitro and in vivo results could arise from a number of mechanistic possibilities as follows. (i) Transcription at late times from the viral genome can occur at high efficiency with only the general transcriptional machinery, including factor TFIID binding to the TATA box. (ii) While binding of USF in vitro is not observed, the binding constant in vivo is still sufficiently high that adequate binding takes place. (iii) Some other element compensates for the lack of the USF-binding site under the culture conditions employed. Candidates for such elements include the upstream CP1-binding site (3) and the binding sites of the newly described factor DEF (20, 28). As we discuss below, the third possibility seems the most likely, and specifically we suggest that CP1 may compensate for the lack of USF binding. It has been shown that the MLP contains an inverted binding site for the transcription factor CP1 (3). Previous in vitro and in vivo studies have suggested that this normally plays little role in the attainment of maximal levels of transcription from the MLP. Our results also show that a single point mutation in the CCAAT sequence can be incorporated into virus with no observable phenotype (results not shown). But, as we show (Fig. 8), virus containing both the USFO mutation and CCCAT mutation was severely crippled. Transcription from the MLP containing the double mutation was decreased about 15-fold at both 12 and 24 h p.i. (Fig. 4A). The results suggest that in the absence of USF binding, the CCAAT sequence plays an important role in MLP expression. Thus the MLP, like many other promoters, may display functional redundancy of upstream promoter elements. A suggestion that this might be the case came from transient transfection assays with plasmids with deletions in the upstream region (40). Deletions encompassing both the USF- and CP1-binding sites were considerably more deficient in expression than those encompassing one or the other binding site. The suggested functional redundancy may be accompanied by mechanistic heterogeneity as well, if CP1 and USF exert their transcriptional transactivation effects via different mechanisms (for a discussion, see reference 51).

IN VIVO TRANSCRIPTION FROM ADENOVIRUS MLP

VOL. 64, 1990

It remains to be seen whether or not the virus uses the two different mechanisms in different cellular environments. So far we have not been able to show cell type specificity for any of the single mutations examined, although the growth deficiency of the double mutant is much more marked in 293 cells derived from human embryonic kidney than in lung carcinoma A549 cells (data not shown). Recently it has been shown that the inverted CAAT box can act as a terminator for transcription originating upstream of the MLP (8, 9). One possible interpretation of the phenotype of the double mutation is that such termination does not occur in the absence of the binding of both transcription factors, whereas the presence of one or the other is sufficient. Unimpeded transcription might inhibit transcription from the MLP of the double mutant. Further work is necessary to determine whether transcription upstream of the MLP is detectable in the double mutant. Previous results (42) have suggested that the USF-binding site plays a role in the expression of the divergent IVa2 transcription unit whose start site is located 210 bases upstream from that of the major late transcription start site. However in our results with both the USFO and double mutants (Fig. 4), IVa2 expression was not affected, suggesting that the virus employs neither binding site for transcription control of the IVa2 promoter. The results also show (contrary to results obtained in vitro [42]) that simple competition for transcription initiation is not sufficient for regulating the stoichiometry of the divergent promoters. The rationale for studying mutations in the MLP in the context of the intact virus and in the correct genomic location was that the previous in vivo and in vitro studies had been unable to reproduce the known temporal control of the promoter. Our results have revealed that conclusions drawn from in vitro studies are not always reproduced in vivo. In addition to the results reported here, mutations in other MLP'elements also yield results that differ from those obtained in vitro. For example, single base pair changes at positions -27 and -30 in the TATA box, known to reduce transcription up to 10-fold (7) and to affect the ratio of MLP and IVa2 expression (42), also function normally in virus and display unaltered mRNA accumulation and transcription start sites (unpublished data). Thus we may conclude that examining mutations in the MLP in their natural environment forms an integral part of the structural analysis of this model promoter, not only revealing previously unsuspected functional redundancy but also acting as a necessary test of the biological validity of conclusions drawn from in vitro studies. ACKNOWLEDGMENTS We thank Scott Zeitlin for unfailing help, good humor, and encouragement, and the virology group at Columbia for constructive criticism. We also thank the following for materials and advice: Vincent Racaniello, Eric Moss, and Roy Bohenzky for considerable help, Yumi Kasai and Jane Flint for the primers used in the primer extension assays, Polly Gregor for antiserum to USF and for showing that the USFO oligonucleotide did not bind purified USF, and Michelle Sawadogo for advice concerning the structure of the upstream promoter element sequence. David Shore introduced us to techniques of band shifting and provided yeast whole-cell extract. This work was supported at Columbia University by Public Health Service grant GM38125 from the National Institute of General Medical Sciences awarded to Saul Silverstein and by a grant to the Columbia Comprehensive Cancer Center, CA13696; at Rockefeller University, it was supported by grant JFRA-235 from the American Cancer Society and by Public Health Service grant

5859

CA48707-10 from the National Institutes of Health awarded to L.E.B. LITERATURE CITED 1. Brunet, L. J., L. E. Babiss, C. S. H. Young, and D. R. Mills. 1987. Mutations in the adenovirus major late promoter: effects upon viability and transcription during infection. Mol. Cell. Biol. 7:1091-1100. 2. Carthew, R. W., L. A. Chodosh, and P. A. Sharp. 1987. The major late transcription factor binds to and activates the mouse metallothionein 1 promoter. Genes Dev. 1:973-980. 3. Chodosh, L. A., A. S. Baldwin, R. W. Carthew, and P. A. Sharp. 1988. Human CCAAT-binding proteins have heterologous sub-

units. Cell 53:11-24.

4. Chodosh, L. A., S. Buratowski, and P. A. Sharp. 1989. A yeast protein possesses the DNA binding properties of the adenovirus major late transcription factor. Mol. Cell. Biol. 9:820-822. 5. Chodosh, L. A., R. W. Carthew, and P. A. Sharp. 1986. A single polypeptide possesses the binding and transcription activities of the adenovirus major late transcription factor. Mol. Cell. Biol. 6:4723-4733. 6. Coen, D. M., S. P. Weinheimer, and S. L. McKnight. 1986. A

genetic approach to promoter recognition during trans induction of viral gene expression. Science 234:53-59. 7. Concino, M. F., F. L. Lee, J. P. Merryweather, and R. Weinmann. 1984. The adenovirus major late promoter TATA box and 8.

9. 10. 11.

12. 13. 14.

15.

16.

17. 18.

initiation site are both necessary for transcription in vitro. Nucleic Acids Res. 12:7423-7433. Connelly, S., and J. L. Manley. 1989. RNA polymerase II transcription termination is mediated specifically by protein binding to a CCAAT box sequence. Mol. Cell. Biol. 9:52545259. Connelly, S., and J. L. Manley. 1989. A CCAAT box sequence in the adenovirus major late promoter functions as part of an RNA polymerase II termination signal. Cell 57:561-571. Crossland, L. D., and H. J. Raskas. 1983. Identification of adenovirus genes that require template replication for expression. J. Virol. 46:737-748. Dignam, J. D., R. M. Lebowitz, and R. G. Roeder. 1983. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei. Nucleic Acids Res. 11:1475-1489. Dynan, W. S., and R. Tjian. 1985. Control of eukaryotic messenger RNA synthesis by sequence-specific DNA binding proteins. Nature (London) 316:774-778. Feinberg, A. P., and B. Vogelstein. 1983. A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem. 132:6-13. Giard, D. J., S. A. Aaronson, G. J. Todaro, P. Arnstein, J. H. Kersey, H. Dosik, and W. P. Parks. 1973. In vitro cultivation of human tumors: establishment of cell lines derived from a series of solid tumors. J. Natl. Cancer Inst. 51:1417-1423. Graham, F. L., and A. J. van der Eb. 1973. A new technique for the assay of infectivity of human adenovirus type 5 DNA. Virology 52:456-467. Hen, R., P. Sassone-Corsi, J. Corden, M. P. Gaub, and P. Chambon. 1982. Sequences upstream from the TATA box are required in vivo and in vitro for efficient transcription from the adenovirus serotype 2 major late promoter. Proc. Natl. Acad. Sci. USA 79:7132-7136. Hernandez, N., and W. Keller. 1983. Splicing of in vitro synthesized messenger RNA precursors in HeLa cell extracts. Cell 35:89-99. Herr, W., and Y. Gluzman. 1985. Duplications of a mutated simian virus 40 enhancer restore its activity. Nature (London)

313:711-714. 19. Hirt, B. 1967. Selective extraction of polyoma DNA from infected mouse cell cultures. J. Mol. Biol. 26:365-369. 20. Jansen-Durr, P., G. Mondesert, and C. K6dinger. 1989. Replication-dependent activation of the adenovirus major late promoter is mediated by the increased binding of a transcription factor to sequences in the first intron. J. Virol. 63:5124-5132. 21. Jones, J., P. Rigby, and E. Ziff. 1988. Trans-acting protein

5860

22. 23. 24. 25. 26.

27.

28.

29. 30.

31.

32. 33. 34.

35.

36. 37.

38.

39.

REACH ET AL.

factors and the regulation of eukaryotic transcription: lessons from studies on DNA tumor viruses. Genes Dev. 2:267-281. Kovesdi, I., R. Reichel, and J. R. Nevins. 1986. Identification of a cellular transcription factor involved in Ela trans-activation. Cell 45:219-228. Kunkel, T. A. 1985. Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc. Natl. Acad. Sci. USA 82:488-492. Lawrence, W. C., and H. S. Ginsberg. 1967. Intracellular uncoating of type 5 adenovirus deoxyribonucleic acid. J. Virol. 1:851-867. Lee, R. F., M. F. Concino, and R. Weinmann. 1988. Genetic profile of the transcriptional signals from the adenovirus major late promoter. Virology 165:52-56. Lennard, A. C., and J. M. Egly. 1987. The bidirectional upstream element of the adenovirus-2 major late promoter binds a single monomeric molecule of the upstream factor. EMBO J. 6:3027-3034. Leong, K., L. Brunet, and A. J. Berk. 1988. Factors responsible for the higher transcriptional activity of extracts of adenovirusinfected cells fractionate with the TATA box factor. Mol. Cell. Biol. 8:1765-1774. Leong, K., W. Lee, and A. J. Berk. 1990. High-level transcription from the adenovirus major late promoter requires downstream binding sites for late-phase-specific factors. J. Virol. 64:51-60. Lillie, J. W., and M. R. Green. 1989. Transcription activation by the adenovirus Ela protein. Nature (London) 338:39-44. Logan, J., and T. Shenk. 1986. In vivo identification of sequence elements required for normal function of the adenovirus major late transcriptional control region. Nucleic Acids Res. 14:63276335. Maity, S. N., P. T. Golumbek, G. Karsenty, and B. de Crombrugghe. 1988. Selective activation of transcription by a novel CCAAT binding factor. Science 241:582-585. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular cloning: a laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. Maniatis, T., S. Goodbourn, and J. A. Fischer. 1987. Regulation of inducible and tissue-specific gene expression. Science 236: 1237-1245. Manley, J. A., A. Fire, A. Cano, P. A. Sharp, and M. L. Gefter. 1980. DNA-dependent transcription of adenovirus genes in a soluble whole cell extract. Proc. Natl. Acad. Sci. USA 77:38553859. Mansour, J. L., T. Grodzicker, and R. Tjian. 1986. Downstream sequences affect transcription initiation from the adenovirus major late promoter. Mol. Cell. Biol. 6:2684-2694. Marsh, J. L., M. Erfle, and E. J. Wyke. 1984. The pIC plasmid and phage vectors with versatile sites for recombinant selection by insertional inactivation. Gene 32:481-485. McKnight, S., and R. Tjian. 1986. Transcriptional selectivity of viral genes in mammalian cells. Cell 46:795-805. Melton, D. A., P. A. Kreig, M. R. Rebagliatti, T. Maniatis, K. Zinn, and M. R. Green. 1984. Efficient in vitro synthesis of biologically active RNA and RNA hybridization probes from plasmids containing a bacteriophage SP6 promoter. Nucleic Acids Res. 12:7035-7070. Mitchell, P. J., and R. Tjian. 1989. Transcriptional regulation in mammalian cells by sequence-specific DNA binding proteins. Science 245:371-378.

J. VIROL. 40. Miyamoto, N. G., V. Moncollin, J. M. Egly, and P. Chambon. 1985. Specific interaction between a transcription factor and the upstream element of the adenovirus-2 major late promoter. EMBO J. 4:3563-3570. 41. Miyamoto, N. G., V. Moncollin, M. Wintzerith, R. Hen, J. M. Egly, and P. Chambon. 1984. Stimulation of in vitro transcription by the upstream element of the adenovirus 2 major late promoter involves a specific factor. Nucleic Acids Res. 12: 8779-8799. 42. Natarajan, V., M. J. Madden, and N. P. Salzman. 1985. Positive and negative control sequences within the distal domain of the adenovirus IVa2 promoter overlap with the major late promoter. J. Virol. 55:10-15. 43. Nevins, J. R. 1981. Mechanism of activation of early viral transcription by the adenovirus Ela gene product. Cell 26:213220. 44. Philipson, L. 1961. Adenovirus assay by fluorescent cell-counting procedure. Virology 15:263-268. 45. Ptashne, M. 1988. How transcriptional activators work. Nature (London) 335:683-689. 46. Safer, B., R. B. Cohen, S. Garfinkel, and J. A. Thompson. 1988. DNA affinity labeling of adenovirus type 2 upstream promoter sequence-binding factors identifies two distinct proteins. Mol. Cell. Biol. 8:105-113. 47. Sanger, F., S. Nicklen, and A. R. Coulson. 1977. DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74:5463-5467. 48. Sawadogo, M., and R. G. Roeder. 1985. Interaction of a genespecific transcription factor with the adenovirus major late promoter upstream of the TATA box. Cell 43:165-175. 49. Sawadogo, M., and R. G. Roeder. 1985. Factors involved in specific transcription by human RNA polymerase II: analysis by a rapid and quantitative in vitro assay. Proc. Natl. Acad. Sci. USA 82:4394-4398. 50. Shore, D., D. J. Stillman, A. H. Brand, and K. A. Nasmyth. 1987. Identification of silencer binding proteins from yeast: possible roles in SIR control and DNA replication. EMBO J. 6:461-467. 51. Taylor, I. C. A., and R. E. Kingston. 1990. Factor substitution in a human HSP70 gene promoter: TATA-dependent and TATAindependent interactions. Mol. Cell. Biol. 10:165-175. 52. Thomas, P. G., and M. B. Mathews. 1980. DNA replication and the early to late transition in adenovirus infection. Cell 22:523533. 53. Volkert, F. C., and C. S. H. Young. 1983. The genetic analysis of recombination using adenovirus overlapping terminal DNA fragments. Virology 125:175-193. 54. Weil, P. A., D. S. Luse, J. Segall, and R. G. Roeder. 1979. Selective and accurate initiation of transcription at the Ad2 major late promoter in a soluble system dependent on purified RNA polymerase II and DNA. Cell 18:469-484. 55. Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved M13 phage cloning vectors and host strains: nucleotide sequences of the M13mpl8 and pUC19 vectors. Gene 33:103-119. 56. Yu, Y.-T., and J. L. Manley. 1984. Generation and functional analysis for base-substitution mutants of the adenovirus 2 major late promoter. Nucleic Acids Res. 12:9309-9321. 57. Zagursky, R. J., K. Baumeister, N. Lomax, and M. L. Berman. 1985. Rapid and easy sequencing of large linear double-stranded DNA and supercoiled plasmid DNA. Gene Anal. Tech. 2:89-94.