+
MODEL
Journal of Pediatric Urology (2015) xx, 1.e1e1.e5
The variations in the AXIN1 gene and susceptibility to cryptorchidism Bin Zhou a,1, Tielong Tang b,1, Peng Chen c, Yan Pu c, Mingfu Ma d,e, Danyan Zhang d,e, Lianbing Li d,e, Peng Zhang f, Yaping Song a, Lin Zhang a,c a
Laboratory of Molecular Translational Medicine, West China Institute of Women and Children’s Health, Key Laboratory of Obstetric & Gynecologic and Pediatric Diseases and Birth Defects of Ministry of Education, West China Second University Hospital, Sichuan University, Chengdu, PR China
b
Department of Urology, Affiliated Hospital of North Sichuan Medical College, Nanchong, PR China
c Department of Forensic Biology, West China School of Preclinical and Forensic Medicine, Sichuan University, Chengdu, PR China
Summary Background Cryptorchidism is one of the most common congenital anomalies in newborn boys. Although the mechanism responsible for the pathophysiology of cryptorchidism has not yet been well addressed, the Wnt signaling pathway has been involved in the development of cryptorchidism. Axin1 is a central component of the Wnt signaling pathway and may play a critical role in the development of cryptorchidism. Objective We assumed that cryptorchidism risk and the AXIN1 gene may have an association. Thus we picked out three tag SNPs (single nucleotide polymorphisms) in the AXIN1 gene and aimed to investigate whether cryptorchidism risk is associated with polymorphisms in the AXIN1 gene.
d
Key Laboratory of Birth Defects and Reproductive Health of National Health and Family Planning Commission, Chongqing 400020, PR China
e
Chongqing Population and Family Planning Science and Technology Research Institute, Chongqing 400020, PR China
f
Department of Urology, West China Hospital, Sichuan University, Chengdu, PR China Correspondence to: Lin Zhang, Department of Forensic Biology, West China School of Preclinical and Forensic Medicine, Sichuan University, Chengdu 610041, PR China [email protected] (L. Zhang)
Study design The variants were discriminated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) methods. A total of 113 cases and 179 controls were recruited to participate in this study, including 92 unilateral cryptorchidism and 21 bilateral cases. In bilateral cases, the position of the testis was decided by the higher one. Results A significantly increased cryptorchidism risk was found to be associated with both the T allele
Table Tag SNP
(p Z 2e4, OR 1.96, 95% CI 1.37e2.78) and T/T genotype (p Z 6e4, OR 4.00, 95% CI 1.79e9.09) of rs370681 polymorphism, and, compared with the C/C genotype, a significantly increased cryptorchidism risk was associated with the C/TeT/T genotype (p Z 4e4, OR 2.44, 95% CI 1.47e4.00) of rs370681 polymorphisms. Discussion Among the three tag SNPs we have chosen in AXIN1, two SNPs are located in the intron region, the other SNP is located in the synonymous codon region. Evidential research has indicated that introns and other non-protein-coding RNAs may have evolved to function as network control molecules in higher organisms. Therefore, we suspected that the tag SNPs may work as controls influencing the conduct of other genes rather than affecting the structure of the protein by influencing the coding of amino acid. There were limitations in our study. One is that we did not test the expression level of Axin1. Secondly, the number of the study subjects is limited. Finally, the molecular mechanisms by which AXIN1 is involved in susceptibility to cryptorchidism should be characterized. Conclusions We assessed the impact of the genetic variability of the AXIN1 gene on cryptorchidism. We have offered primary evidence that the T allele and T/T genotype of rs370681 polymorphisms and C/T genotype of rs1805105 polymorphisms in AXIN1 gene are more frequent in patients with cryptorchidism.
Three tag SNPs in AXIN1 gene and cryptorchidism risk. Genetic model Dominant OR (95% CI)
Recessive p
OR (95% CI) 04
Overdominant P-value OR (95% CI)
p
Keywords AXIN1; Cryptorchidism; Polymorphisms; Association
rs370681 2.44 (1.47e4.00) 4e 2.56 (1.22e5.26) 0.012 rs1805105 1.64 (1.02e2.63) 0.041 1.01 (0.44e2.31) 0.98 rs12921862 1.44 (0.67e3.06) 0.34 3.22 (0.37e27.91) 0.23
Received 6 August 2014 Accepted 15 February 2015 Available online xxx
Note. Values in bold indicate a significant difference at the 5% level. OR Z odds ration; SNP Z single nucleotide polymorphism.
1
1.54 (0.96e2.50) 0.074 1.72 (1.05e2.86) 0.032 1.22 (0.55e2.74) 0.62
These authors contributed equally to this work.
http://dx.doi.org/10.1016/j.jpurol.2015.02.007 1477-5131/ª 2015 Published by Elsevier Ltd on behalf of Journal of Pediatric Urology Company.
Please cite this article in press as: Zhou B, et al., The variations in the AXIN1 gene and susceptibility to cryptorchidism, Journal of Pediatric Urology (2015), http://dx.doi.org/10.1016/j.jpurol.2015.02.007
+
MODEL
1.e2
Introduction Cryptorchidism is one of the most common genital anomalies in newborn boys, affecting 3e5% of male full-term neonates [1], and it has the potential to impact the health of the human male. In fact, although it is often considered as a mild malformation, it represents the best-characterized risk factor for reduced fertility and testicular cancer. The etiology of cryptorchidism is considered to be multifactorial, and it occurs most often as an isolated disorder with no obvious cause [2]. However, research on possible genetic causes of cryptorchidism has increased recently. Abundant animal evidence supports a genetic cause [3,4]. AXIN1, the encoding gene for Axin1, which was initially identified from analysis of the mouse Fused locus, plays a critical role during embryonic development. Axin1 is a multidomain scaffolding protein that interacts with multiple proteins and serves as a key negative regulator of Wnt signaling by the b-catenin destruction complex. Interestingly, evidential research has revealed that Wnt signaling pathway could play a critical role in development of cryptorchidism [5e9]. Furthermore, in the absence of a Wnt signaling pathway, Axin1 is also involved in regulation of TGF-b, SAPK/ JNK, and P53 signaling pathways [10,11]. Studies on mouse have shown that complete inactivation of AXIN1 function leads to early embryonic lethality at day 9.5, with forebrain truncation, neural tube defects, and embryonic axis duplications. In other words, Axin1 may participate in embryonic and postnatal development and diseases [12]. Thus, we assumed that cryptorchidism risk and the AXIN1 gene may have an association and we aimed to provide more data. The AXIN1 gene is located within a 65-kb region on chromosome 16p13.3. To find out if AXIN1 is involved in the development of cryptorchidism, we investigated the association between these three tag SNPs and cryptorchidism risk in a caseecontrol study of 113 unrelated cryptorchidism patients and 179 healthy control subjects in a Han Chinese population.
Material and methods Subjects This study was performed with the approval of the ethics committee of the West China Hospital and all the participants’ parents provided written informed consent. A hospital-based caseecontrol study was conducted, including 113 patients with cryptorchidism and 179 unrelated healthy volunteers. Patients participating in the study attended the West China Hospital between September 2008 and June 2012. The boys were examined shortly after birth and at 3 months of age. The examination technique and definition of cryptorchidism developed by Scorer [13] were applied. All examinations were done in warm conditions with the child supine. Testicular position was recorded after manipulation of the testis to the most distal position along the pathway of normal descent using firm, but not forced, traction. Re-confirmation of the diagnosis was performed before the orchidopexy, when the patient is around 1 year old. Ninety-two cases were unilateral cryptorchidism and 21 cases were bilateral. Among the
B. Zhou et al. patients, 32 cases were located in the superficial inguinal pouch, 28 cases in the prescrotal region, 27 cases in the external ring, 17 cases in the inguinal canal, and nine cases in the internal ring. A group of control subjects (mean age 3.8 1.2 years, range 1 monthe10 years) presented for resection for foreskin. Infant of premature or low birthweight and subjects with any personal or family history of cryptorchidism or other serious disease were intentionally excluded from the whole groups (including patients and control subjects). All subjects were from the Han Chinese population living in Sichuan Province, southwest China.
SNP selection and genotyping A tag SNP is a representative SNP in a region of the genome with high linkage disequilibrium (the non-random association of alleles at two or more loci). We have selected tag SNPs according to data from tag SNPs genotyped in the CHB population sample of the HapMap Project (Data Release 24/ phaseⅡ, NCBI build 36 assembly, dpSNPb126). Tag SNPs of the AXIN1 gene, rs370681, and rs12921862, located in the intron region, and rs1805105, located in the synonymous codon region, were picked out for population Han Chinese in Beijing, China (CHB) using the algorithm Tagger pairwiseTagging from the international HapMap project (http:// www.hapmap.org/index.html.zh). Genomic DNA for each individual was extracted from 200 mL of EDTA-anticoagulated peripheral blood samples by a DNA isolation kit from Bioteke (Peking, China). The procedure was performed according to the instruction manual. Primers were established with online software (http:// frodo.wi.mit.edu/primer3/). The primer sequences and specific restriction enzymes for DNA sequencing analysis are shown in Table 1. About 10% of the samples were randomly selected to perform repeated assays and the results were 100% concordant.
Statistical analysis All data were analyzed using SPSS 13.0 (SPSS Inc, Chicago, IL, USA). Genotype frequencies of these three SNPs were obtained by directed computing and the HardyeWeinberg equilibrium was evaluated by the chi-square test. Genotypic association tests in a caseecontrol pattern assuming codominant, dominant, recessive, overdominant, or logadditive genetic models were performed using SNPstats. Odds ratio (OR) and corresponding 95% confidence intervals (CIs) were reported to evaluate the effects of any difference between alleles and genotypes. A p value 0.05 or less was regarded as statistically significant in patients with cryptorchidism compared with healthy controls.
Results Three tag SNPs in our study were successfully genotyped in 113 cryptorchidism patients and 179 control subjects. Genotype distributions of these three polymorphisms were consistent with the HardyeWeinberg equilibrium. Allele frequencies of the AXIN1 tag SNPs in the cryptorchidism and control individuals are shown in Table 2. The frequency of the T allele of the rs370681 locus is significantly higher in patients
Please cite this article in press as: Zhou B, et al., The variations in the AXIN1 gene and susceptibility to cryptorchidism, Journal of Pediatric Urology (2015), http://dx.doi.org/10.1016/j.jpurol.2015.02.007
+
MODEL
AXIN1 gene variations Table 1
1.e3
Primer sequences and enzymes.
SNPs
Primer (50 e30 )
Annealing temperature ( C)
Enzyme
Product length
rs370681
F: gaggcctaagctccaggcact R: aaggaaagtgggttctccaccca F: ctggatacctgccgacctta R: acctttccctggcttgttct F: ctcacgccagtgcctctact R: atgccatccatgtggaaact
56
BtsI
213
64
FokI
158
64
ScrFI
158
rs1805105 rs12921862
with cryptorchidism (p Z 2e4, OR 1.96, 95% CI 1.37e2.78), but allele frequencies of rs1805105 and rs12921862 polymorphisms have no differences between cryptorchidism patients and control subjects (p Z 0.119, OR 0.732, 95% CI 0.502e1.067; p Z 0.245, OR 1.572, 95% CI 0.785e3.148). As shown in Table 3, distributions of rs370681 polymorphisms were significantly different between patients and control subjects. Compared with the C/C genotype, the C/T genotype carriers had a 2.17-fold increased cryptorchidism risk (p Z 6e04, 95% CI 1.28e3.70), while T/T genotype carriers had a fourfold increased cryptorchidism risk (p Z 6e04, 95% CI 1.79e9.09) in the codominant model. Compared with the C/C genotype, C/TeT/T genotypes carriers had a 2.44-fold increased cryptorchidism risk (p Z 4e04, 95% CI 1.47e4.00) in the dominant model. Moreover, compared with the C/CeC/T genotype, T/T genotype carriers had a 2.56-fold increased cryptorchidism risk (p Z 0.012, 95% CI Z 1.22e5.26). Moreover, significant differences were observed for the genotype of rs1805105 polymorphisms. Compared with the T/T genotype, C/TeC/C genotypes carriers had a 1.64-fold increased cryptorchidism risk (p Z 0.041, 95% CI Z 1.02e2.63). Furthermore, compared with the T/TeC/ C genotype, C/T genotype carriers had a 1.72-fold increased cryptorchidism risk (p Z 0.032, 95% CI 1.05e2.86). Finally, no statistically significantly association was observed in the genetic models of the rs12921862 polymorphisms with a cryptorchidism risk.
Discussion Cryptorchidism, that is, undescended testis, is one of the most common urogenital abnormalities in newborn boys
Table 2 Allele frequencies of tag SNPs in AXIN1 among patients and controls and their association with cryptorchidism risk. SNP
Allele
Patients N Z 113 (%)
Controls N Z 179 (%)
p
rs370681
C T T C C A
124 102 160 66 214 12
251 107 275 83 329 29
2e4
rs1805105 rs12921862
(55) (45) (71) (29) (95) (5)
(70) (30) (77) (23) (92) (8)
0.119 0.245
Note. N corresponds to the number of individuals; values in bold indicate a significant difference at the 5% level.
[14], and it is a well-established risk factor for testicular neoplasia. In a recent meta-analysis of 21 caseecontrol studies of the epidemiology of germ cell tumors, increased ORs for having testicular cancer in patients with a history of cryptorchidism ranged from 3.5 to 17.1; the overall relative risk was 4.8 (4.0e5.7) [15]. Although several pathogenetic mechanisms for cryptorchidism have been described, the cause of cryptorchidism remains unknown in most cases [16]. Some scholars have revealed the disease has family aggregation and that a family history for cryptorchidism represents a risk factor for undescended testes, initial studies suggested that 6.2% of the brothers and 1.5e4.0% of the fathers of patients with cryptorchidism have undescended testes with a heritability value of 0.67 0.16 [17e19]. All the above indicate a critical role genetic factors may play in the development of cryptorchidism. The Wnt signaling pathway regulates cellular proliferation, differentiation, morphology, and motility in vertebrates and invertebrates [8]. The importance of Wnt signaling in mouse embryonic and postnatal development and in diseases has been reported by several authors [5,12,20e22]. Activation of Wnt signaling has been revealed as the underlying etiology of some cryptorchidisms [9]. AXIN1, the wild-type AXIN gene, a negative regulator of this pathway, has been suggested to play an important role during embryogenesis. Ubiquitously expressed AXIN1 has been involved in the formation of the embryonic neural axis [23e26]. Taken together, there may be an important role for AXIN1 to play in the development of cryptorchidism. Among the three tag SNPs we have chosen in AXIN1, two SNPs are located in the intron region, and the other SNP is located in the synonymous codon region. Evidential research has indicated that introns and other non-protein-coding RNAs may have evolved to function as network control molecules in higher organisms, freeing such organisms from the constraints of a simple single-output protein-based genetic operating system [27]. Therefore, we suspected that the tag SNPs may work as controls influencing the conduct of other genes rather than affecting the structure of the protein by influencing the coding of amino acid. In summary, we assessed the impact of the genetic variability of the AXIN1 gene on cryptorchidism, and we observed a significant difference in the frequency of alleles and genotypes of the AXIN1 tag SNPs between the patients with cryptorchidism and controls. We have offered primary evidence that the T allele and the T/T genotype of rs370681 polymorphisms and C/T genotype of rs1805105 polymorphisms in AXIN1 gene are more frequent in patients with cryptorchidism. It implies that these allele and genotypes may be risk factors for the development of cryptorchidism.
Please cite this article in press as: Zhou B, et al., The variations in the AXIN1 gene and susceptibility to cryptorchidism, Journal of Pediatric Urology (2015), http://dx.doi.org/10.1016/j.jpurol.2015.02.007
+
MODEL
1.e4 Table 3 risk.
B. Zhou et al. Genotype frequencies of tag SNPs in AXIN1 among patients and controls and their association with cryptorchidism
Genetic model
rs370681 Codominant
Dominant Recessive Overdominant Log-additive rs1805105 Codominant
Dominant Recessive Overdominant Log-additive rs12921862 Codominant
Dominant Recessive Overdominant
Genotype
C/C C/T T/T C/C C/TeT/T C/CeC/T T/T C/CeT/T C/T
T/T C/T C/C T/T C/TeC/C T/TeC/T C/C T/TeC/C C/T
C/C A/C A/A C/C A/CeA/A C/CeA/C A/A C/CeA/A A/C
Patients
Controls
Logistic regression
n Z 113 (%)
n Z 179 (%)
OR (95%CI)
p
86 79 14 86 93 165 14 100 79
1.00 2.17 (1.28e3.70) 4.00 (1.79e9.09) 1.00 2.44 (1.47e4.00) 1.00 2.56 (1.22e5.26) 1.00 1.54 (0.96e2.50) 2.04 (1.41e2.94)
6e04
31 62 20 31 82 93 20 51 62
57 46 10 57 56 103 10 67 46
102 10 1 102 11 112 1 103 10
(27.4%) (54.9%) (17.7%) (27.4%) (72.6%) (82.3%) (17.7%) (45.1%) (54.9%)
(50.4%) (40.7%) (8.8%) (50.4%) (49.6%) (91.2%) (8.8%) (59.3%) (40.7%)
(90.7%) (8.5%) (0.8%) (90.7%) (9.3%) (99.2%) (0.8%) (91.5%) (8.5%)
112 51 16 112 67 163 16 128 51
155 19 5 155 24 174 5 160 19
(48%) (44.1%) (7.8%) (48%) (52%) (92.2%) (7.8%) (55.9%) (44.1%)
(62.6%) (28.5%) (8.9%) (62.6%) (37.4%) (91.1%) (8.9%) (71.5%) (28.5%)
(86.6%) (10.6%) (2.8%) (86.6%) (13.4%) (97.2%) (2.8%) (89.4%) (10.6%)
Log-additive
4e04 0.012 0.074 1e04
1.00 1.78 (1.06e2.94) 0.81 (0.35e1.91) 1.00 1.64 (1.02e2.63) 1.00 1.01 (0.44e2.31) 1.00 1.72 (1.05e2.86) 1.32 (0.93e1.89)
0.089
1.00 1.25 3.29 1.00 1.44 1.00 3.22 1.00 1.22 1.45
0.42
0.041 0.98 0.032 0.13
(0.56e2.80) (0.38e28.58) 0.34 (0.67e3.06) 0.23 (0.37e27.91) 0.62 (0.55e2.74) (0.77e2.72)
0.24
Note. N corresponds to the number of individuals. Values in bold indicate a significant difference at the 5% level.
Limitations
Conflict of interest
Although we detected the association between the SNPs in AXIN1 and cryptorchidism, there were limitations to our study. One is that we did not test the expression level of Axin1, which restricted further research on whether the SNPs have effect on the Axin1 expression level. Secondly, the number of study subjects is limited. Further large-scale studies in diverse ethnic populations still need to be done. Finally, the molecular mechanisms by which AXIN1 is involved in susceptibility to cryptorchidism should be characterized.
None.
Funding This work was supported by the National Natural Science Foundation of China (No. 81172440, No. 81000246 and No. 81272821); and the primary business fund of Chongqing Key Laboratory of Birth Defects and Reproductive Health (No. 1202).
References [1] Barthold JS, Gonzalez R. The epidemiology of congenital cryptorchidism, testicular ascent and orchiopexy. J Urol 2003; 170:2396e401. [2] Foresta C, Zuccarello D, Garolla A, Ferlin A. Role of hormones, genes, and environment in human cryptorchidism. Endocr Rev 2008;29:560e80. [3] Nef S, Parada LF. Cryptorchidism in mice mutant for Insl3. Nat Genet 1999;22:295e9. [4] Zimmermann S, Steding G, Emmen JM, Brinkmann AO, Nayernia K, Holstein AF, et al. Targeted disruption of the Insl3 gene causes bilateral cryptorchidism. Mol Endocrinol (Baltimore) 1999;13:681e91. [5] Zeng L, Fagotto F, Zhang T, Hsu W, Vasicek TJ, Perry 3rd WL, et al. The mouse fused locus encodes Axin, an inhibitor of the
Please cite this article in press as: Zhou B, et al., The variations in the AXIN1 gene and susceptibility to cryptorchidism, Journal of Pediatric Urology (2015), http://dx.doi.org/10.1016/j.jpurol.2015.02.007
+
MODEL
AXIN1 gene variations
[6]
[7]
[8] [9]
[10]
[11]
[12] [13] [14] [15] [16]
Wnt signaling pathway that regulates embryonic axis formation. Cell 1997;90:181e92. Chen P, Zhang K, Zhou B, Zhang Z, Song Y, Pu Y, et al. The variations in the IL1RL1 gene and susceptibility to preeclampsia. Immunol Invest 2014;43:424e35. Pu Y, Zhang Z, Zhou B, Chen P, Zhang K, Song Y, et al. Association of an insertion/deletion polymorphism in IL1A 3’-UTR with risk for cervical carcinoma in Chinese Han Women. Hum Immunol 2014;75:740e4. Logan CY, Nusse R. The Wnt signaling pathway in development and disease. Ann Rev Cell Dev Biol 2004;20:781e810. Harisis GN, Chen N, Farmer PJ, Bodemer D, Li R, Sourial M, et al. Wnt signalling in testicular descent: a candidate mechanism for cryptorchidism in Robinow syndrome. J Pediatr Surg 2013;48:1573e7. Liu C, Li Y, Semenov M, Han C, Baeg GH, Tan Y, et al. Control of beta-catenin phosphorylation/degradation by a dual-kinase mechanism. Cell 2002;108:837e47. L’Esperance S, Popa I, Bachvarova M, Plante M, Patten N, Wu L, et al. Gene expression profiling of paired ovarian tumors obtained prior to and following adjuvant chemotherapy: molecular signatures of chemoresistant tumors. Int J Oncol 2006; 29:5e24. Xie R, Jiang R, Chen D. Generation of Axin1 conditional mutant mice. Genesis (New York) 2011;49:98e102. Scorer C. The descent of the testis. Arch Dis Child 1964;39: 605. Huyghe E, Matsuda T, Thonneau P. Increasing incidence of testicular cancer worldwide: a review. J Urol 2003;170:5e11. Dieckmann KP, Pichlmeier U. Clinical epidemiology of testicular germ cell tumors. World J Urol 2004;22:2e14. Toppari J, Kaleva M, Virtanen HE. Trends in the incidence of cryptorchidism and hypospadias, and methodological limitations of registry-based data. Hum Reprod Update 2001;7: 282e6.
1.e5 [17] Czeizel A, Erodi E, Toth J. Genetics of undescended testis. J Urol 1981;126:528e9. [18] Weidner IS, Moller H, Jensen TK, Skakkebaek NE. Risk factors for cryptorchidism and hypospadias. J Urol 1999;161:1606e9. [19] Elert A, Jahn K, Heidenreich A, Hofmann R. The familial undescended testis. Klin Padiatr 2003;215:40e5. [20] Chia IV, Costantini F. Mouse axin and axin2/conductin proteins are functionally equivalent in vivo. Mol Cell Biol 2005;25: 4371e6. [21] Chia IV, Kim MJ, Itoh K, Sokol SY, Costantini F. Both the RGS domain and the six C-terminal amino acids of mouse Axin are required for normal embryogenesis. Genetics 2009;181: 1359e68. [22] Perry 3rd WL, Vasicek TJ, Lee JJ, Rossi JM, Zeng L, Zhang T, et al. Phenotypic and molecular analysis of a transgenic insertional allele of the mouse fused locus. Genetics 1995; 141:321e32. [23] Jin LH, Shao QJ, Luo W, Ye ZY, Li Q, Lin SC. Detection of point mutations of the Axin1 gene in colorectal cancers. Int J Cancer 2003;107:696e9. [24] Park JY, Park WS, Nam SW, Kim SY, Lee SH, Yoo NJ, et al. Mutations of beta-catenin and AXIN I genes are a late event in human hepatocellular carcinogenesis. Liver Int 2005;25:70e6. [25] Wu R, Zhai Y, Fearon ER, Cho KR. Diverse mechanisms of betacatenin deregulation in ovarian endometrioid adenocarcinomas. Cancer Res 2001;61:8247e55. [26] Dahmen RP, Koch A, Denkhaus D, Tonn JC, Sorensen N, Berthold F, et al. Deletions of AXIN1, a component of the WNT/wingless pathway, in sporadic medulloblastomas. Cancer Res 2001;61:7039e43. [27] Mattick JS, Gagen MJ. The evolution of controlled multitasked gene networks: the role of introns and other noncoding RNAs in the development of complex organisms. Mol Biol Evol 2001; 18:1611e30.
Please cite this article in press as: Zhou B, et al., The variations in the AXIN1 gene and susceptibility to cryptorchidism, Journal of Pediatric Urology (2015), http://dx.doi.org/10.1016/j.jpurol.2015.02.007
MODEL
Journal of Pediatric Urology (2015) xx, 1.e1e1.e5
The variations in the AXIN1 gene and susceptibility to cryptorchidism Bin Zhou a,1, Tielong Tang b,1, Peng Chen c, Yan Pu c, Mingfu Ma d,e, Danyan Zhang d,e, Lianbing Li d,e, Peng Zhang f, Yaping Song a, Lin Zhang a,c a
Laboratory of Molecular Translational Medicine, West China Institute of Women and Children’s Health, Key Laboratory of Obstetric & Gynecologic and Pediatric Diseases and Birth Defects of Ministry of Education, West China Second University Hospital, Sichuan University, Chengdu, PR China
b
Department of Urology, Affiliated Hospital of North Sichuan Medical College, Nanchong, PR China
c Department of Forensic Biology, West China School of Preclinical and Forensic Medicine, Sichuan University, Chengdu, PR China
Summary Background Cryptorchidism is one of the most common congenital anomalies in newborn boys. Although the mechanism responsible for the pathophysiology of cryptorchidism has not yet been well addressed, the Wnt signaling pathway has been involved in the development of cryptorchidism. Axin1 is a central component of the Wnt signaling pathway and may play a critical role in the development of cryptorchidism. Objective We assumed that cryptorchidism risk and the AXIN1 gene may have an association. Thus we picked out three tag SNPs (single nucleotide polymorphisms) in the AXIN1 gene and aimed to investigate whether cryptorchidism risk is associated with polymorphisms in the AXIN1 gene.
d
Key Laboratory of Birth Defects and Reproductive Health of National Health and Family Planning Commission, Chongqing 400020, PR China
e
Chongqing Population and Family Planning Science and Technology Research Institute, Chongqing 400020, PR China
f
Department of Urology, West China Hospital, Sichuan University, Chengdu, PR China Correspondence to: Lin Zhang, Department of Forensic Biology, West China School of Preclinical and Forensic Medicine, Sichuan University, Chengdu 610041, PR China [email protected] (L. Zhang)
Study design The variants were discriminated using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) methods. A total of 113 cases and 179 controls were recruited to participate in this study, including 92 unilateral cryptorchidism and 21 bilateral cases. In bilateral cases, the position of the testis was decided by the higher one. Results A significantly increased cryptorchidism risk was found to be associated with both the T allele
Table Tag SNP
(p Z 2e4, OR 1.96, 95% CI 1.37e2.78) and T/T genotype (p Z 6e4, OR 4.00, 95% CI 1.79e9.09) of rs370681 polymorphism, and, compared with the C/C genotype, a significantly increased cryptorchidism risk was associated with the C/TeT/T genotype (p Z 4e4, OR 2.44, 95% CI 1.47e4.00) of rs370681 polymorphisms. Discussion Among the three tag SNPs we have chosen in AXIN1, two SNPs are located in the intron region, the other SNP is located in the synonymous codon region. Evidential research has indicated that introns and other non-protein-coding RNAs may have evolved to function as network control molecules in higher organisms. Therefore, we suspected that the tag SNPs may work as controls influencing the conduct of other genes rather than affecting the structure of the protein by influencing the coding of amino acid. There were limitations in our study. One is that we did not test the expression level of Axin1. Secondly, the number of the study subjects is limited. Finally, the molecular mechanisms by which AXIN1 is involved in susceptibility to cryptorchidism should be characterized. Conclusions We assessed the impact of the genetic variability of the AXIN1 gene on cryptorchidism. We have offered primary evidence that the T allele and T/T genotype of rs370681 polymorphisms and C/T genotype of rs1805105 polymorphisms in AXIN1 gene are more frequent in patients with cryptorchidism.
Three tag SNPs in AXIN1 gene and cryptorchidism risk. Genetic model Dominant OR (95% CI)
Recessive p
OR (95% CI) 04
Overdominant P-value OR (95% CI)
p
Keywords AXIN1; Cryptorchidism; Polymorphisms; Association
rs370681 2.44 (1.47e4.00) 4e 2.56 (1.22e5.26) 0.012 rs1805105 1.64 (1.02e2.63) 0.041 1.01 (0.44e2.31) 0.98 rs12921862 1.44 (0.67e3.06) 0.34 3.22 (0.37e27.91) 0.23
Received 6 August 2014 Accepted 15 February 2015 Available online xxx
Note. Values in bold indicate a significant difference at the 5% level. OR Z odds ration; SNP Z single nucleotide polymorphism.
1
1.54 (0.96e2.50) 0.074 1.72 (1.05e2.86) 0.032 1.22 (0.55e2.74) 0.62
These authors contributed equally to this work.
http://dx.doi.org/10.1016/j.jpurol.2015.02.007 1477-5131/ª 2015 Published by Elsevier Ltd on behalf of Journal of Pediatric Urology Company.
Please cite this article in press as: Zhou B, et al., The variations in the AXIN1 gene and susceptibility to cryptorchidism, Journal of Pediatric Urology (2015), http://dx.doi.org/10.1016/j.jpurol.2015.02.007
+
MODEL
1.e2
Introduction Cryptorchidism is one of the most common genital anomalies in newborn boys, affecting 3e5% of male full-term neonates [1], and it has the potential to impact the health of the human male. In fact, although it is often considered as a mild malformation, it represents the best-characterized risk factor for reduced fertility and testicular cancer. The etiology of cryptorchidism is considered to be multifactorial, and it occurs most often as an isolated disorder with no obvious cause [2]. However, research on possible genetic causes of cryptorchidism has increased recently. Abundant animal evidence supports a genetic cause [3,4]. AXIN1, the encoding gene for Axin1, which was initially identified from analysis of the mouse Fused locus, plays a critical role during embryonic development. Axin1 is a multidomain scaffolding protein that interacts with multiple proteins and serves as a key negative regulator of Wnt signaling by the b-catenin destruction complex. Interestingly, evidential research has revealed that Wnt signaling pathway could play a critical role in development of cryptorchidism [5e9]. Furthermore, in the absence of a Wnt signaling pathway, Axin1 is also involved in regulation of TGF-b, SAPK/ JNK, and P53 signaling pathways [10,11]. Studies on mouse have shown that complete inactivation of AXIN1 function leads to early embryonic lethality at day 9.5, with forebrain truncation, neural tube defects, and embryonic axis duplications. In other words, Axin1 may participate in embryonic and postnatal development and diseases [12]. Thus, we assumed that cryptorchidism risk and the AXIN1 gene may have an association and we aimed to provide more data. The AXIN1 gene is located within a 65-kb region on chromosome 16p13.3. To find out if AXIN1 is involved in the development of cryptorchidism, we investigated the association between these three tag SNPs and cryptorchidism risk in a caseecontrol study of 113 unrelated cryptorchidism patients and 179 healthy control subjects in a Han Chinese population.
Material and methods Subjects This study was performed with the approval of the ethics committee of the West China Hospital and all the participants’ parents provided written informed consent. A hospital-based caseecontrol study was conducted, including 113 patients with cryptorchidism and 179 unrelated healthy volunteers. Patients participating in the study attended the West China Hospital between September 2008 and June 2012. The boys were examined shortly after birth and at 3 months of age. The examination technique and definition of cryptorchidism developed by Scorer [13] were applied. All examinations were done in warm conditions with the child supine. Testicular position was recorded after manipulation of the testis to the most distal position along the pathway of normal descent using firm, but not forced, traction. Re-confirmation of the diagnosis was performed before the orchidopexy, when the patient is around 1 year old. Ninety-two cases were unilateral cryptorchidism and 21 cases were bilateral. Among the
B. Zhou et al. patients, 32 cases were located in the superficial inguinal pouch, 28 cases in the prescrotal region, 27 cases in the external ring, 17 cases in the inguinal canal, and nine cases in the internal ring. A group of control subjects (mean age 3.8 1.2 years, range 1 monthe10 years) presented for resection for foreskin. Infant of premature or low birthweight and subjects with any personal or family history of cryptorchidism or other serious disease were intentionally excluded from the whole groups (including patients and control subjects). All subjects were from the Han Chinese population living in Sichuan Province, southwest China.
SNP selection and genotyping A tag SNP is a representative SNP in a region of the genome with high linkage disequilibrium (the non-random association of alleles at two or more loci). We have selected tag SNPs according to data from tag SNPs genotyped in the CHB population sample of the HapMap Project (Data Release 24/ phaseⅡ, NCBI build 36 assembly, dpSNPb126). Tag SNPs of the AXIN1 gene, rs370681, and rs12921862, located in the intron region, and rs1805105, located in the synonymous codon region, were picked out for population Han Chinese in Beijing, China (CHB) using the algorithm Tagger pairwiseTagging from the international HapMap project (http:// www.hapmap.org/index.html.zh). Genomic DNA for each individual was extracted from 200 mL of EDTA-anticoagulated peripheral blood samples by a DNA isolation kit from Bioteke (Peking, China). The procedure was performed according to the instruction manual. Primers were established with online software (http:// frodo.wi.mit.edu/primer3/). The primer sequences and specific restriction enzymes for DNA sequencing analysis are shown in Table 1. About 10% of the samples were randomly selected to perform repeated assays and the results were 100% concordant.
Statistical analysis All data were analyzed using SPSS 13.0 (SPSS Inc, Chicago, IL, USA). Genotype frequencies of these three SNPs were obtained by directed computing and the HardyeWeinberg equilibrium was evaluated by the chi-square test. Genotypic association tests in a caseecontrol pattern assuming codominant, dominant, recessive, overdominant, or logadditive genetic models were performed using SNPstats. Odds ratio (OR) and corresponding 95% confidence intervals (CIs) were reported to evaluate the effects of any difference between alleles and genotypes. A p value 0.05 or less was regarded as statistically significant in patients with cryptorchidism compared with healthy controls.
Results Three tag SNPs in our study were successfully genotyped in 113 cryptorchidism patients and 179 control subjects. Genotype distributions of these three polymorphisms were consistent with the HardyeWeinberg equilibrium. Allele frequencies of the AXIN1 tag SNPs in the cryptorchidism and control individuals are shown in Table 2. The frequency of the T allele of the rs370681 locus is significantly higher in patients
Please cite this article in press as: Zhou B, et al., The variations in the AXIN1 gene and susceptibility to cryptorchidism, Journal of Pediatric Urology (2015), http://dx.doi.org/10.1016/j.jpurol.2015.02.007
+
MODEL
AXIN1 gene variations Table 1
1.e3
Primer sequences and enzymes.
SNPs
Primer (50 e30 )
Annealing temperature ( C)
Enzyme
Product length
rs370681
F: gaggcctaagctccaggcact R: aaggaaagtgggttctccaccca F: ctggatacctgccgacctta R: acctttccctggcttgttct F: ctcacgccagtgcctctact R: atgccatccatgtggaaact
56
BtsI
213
64
FokI
158
64
ScrFI
158
rs1805105 rs12921862
with cryptorchidism (p Z 2e4, OR 1.96, 95% CI 1.37e2.78), but allele frequencies of rs1805105 and rs12921862 polymorphisms have no differences between cryptorchidism patients and control subjects (p Z 0.119, OR 0.732, 95% CI 0.502e1.067; p Z 0.245, OR 1.572, 95% CI 0.785e3.148). As shown in Table 3, distributions of rs370681 polymorphisms were significantly different between patients and control subjects. Compared with the C/C genotype, the C/T genotype carriers had a 2.17-fold increased cryptorchidism risk (p Z 6e04, 95% CI 1.28e3.70), while T/T genotype carriers had a fourfold increased cryptorchidism risk (p Z 6e04, 95% CI 1.79e9.09) in the codominant model. Compared with the C/C genotype, C/TeT/T genotypes carriers had a 2.44-fold increased cryptorchidism risk (p Z 4e04, 95% CI 1.47e4.00) in the dominant model. Moreover, compared with the C/CeC/T genotype, T/T genotype carriers had a 2.56-fold increased cryptorchidism risk (p Z 0.012, 95% CI Z 1.22e5.26). Moreover, significant differences were observed for the genotype of rs1805105 polymorphisms. Compared with the T/T genotype, C/TeC/C genotypes carriers had a 1.64-fold increased cryptorchidism risk (p Z 0.041, 95% CI Z 1.02e2.63). Furthermore, compared with the T/TeC/ C genotype, C/T genotype carriers had a 1.72-fold increased cryptorchidism risk (p Z 0.032, 95% CI 1.05e2.86). Finally, no statistically significantly association was observed in the genetic models of the rs12921862 polymorphisms with a cryptorchidism risk.
Discussion Cryptorchidism, that is, undescended testis, is one of the most common urogenital abnormalities in newborn boys
Table 2 Allele frequencies of tag SNPs in AXIN1 among patients and controls and their association with cryptorchidism risk. SNP
Allele
Patients N Z 113 (%)
Controls N Z 179 (%)
p
rs370681
C T T C C A
124 102 160 66 214 12
251 107 275 83 329 29
2e4
rs1805105 rs12921862
(55) (45) (71) (29) (95) (5)
(70) (30) (77) (23) (92) (8)
0.119 0.245
Note. N corresponds to the number of individuals; values in bold indicate a significant difference at the 5% level.
[14], and it is a well-established risk factor for testicular neoplasia. In a recent meta-analysis of 21 caseecontrol studies of the epidemiology of germ cell tumors, increased ORs for having testicular cancer in patients with a history of cryptorchidism ranged from 3.5 to 17.1; the overall relative risk was 4.8 (4.0e5.7) [15]. Although several pathogenetic mechanisms for cryptorchidism have been described, the cause of cryptorchidism remains unknown in most cases [16]. Some scholars have revealed the disease has family aggregation and that a family history for cryptorchidism represents a risk factor for undescended testes, initial studies suggested that 6.2% of the brothers and 1.5e4.0% of the fathers of patients with cryptorchidism have undescended testes with a heritability value of 0.67 0.16 [17e19]. All the above indicate a critical role genetic factors may play in the development of cryptorchidism. The Wnt signaling pathway regulates cellular proliferation, differentiation, morphology, and motility in vertebrates and invertebrates [8]. The importance of Wnt signaling in mouse embryonic and postnatal development and in diseases has been reported by several authors [5,12,20e22]. Activation of Wnt signaling has been revealed as the underlying etiology of some cryptorchidisms [9]. AXIN1, the wild-type AXIN gene, a negative regulator of this pathway, has been suggested to play an important role during embryogenesis. Ubiquitously expressed AXIN1 has been involved in the formation of the embryonic neural axis [23e26]. Taken together, there may be an important role for AXIN1 to play in the development of cryptorchidism. Among the three tag SNPs we have chosen in AXIN1, two SNPs are located in the intron region, and the other SNP is located in the synonymous codon region. Evidential research has indicated that introns and other non-protein-coding RNAs may have evolved to function as network control molecules in higher organisms, freeing such organisms from the constraints of a simple single-output protein-based genetic operating system [27]. Therefore, we suspected that the tag SNPs may work as controls influencing the conduct of other genes rather than affecting the structure of the protein by influencing the coding of amino acid. In summary, we assessed the impact of the genetic variability of the AXIN1 gene on cryptorchidism, and we observed a significant difference in the frequency of alleles and genotypes of the AXIN1 tag SNPs between the patients with cryptorchidism and controls. We have offered primary evidence that the T allele and the T/T genotype of rs370681 polymorphisms and C/T genotype of rs1805105 polymorphisms in AXIN1 gene are more frequent in patients with cryptorchidism. It implies that these allele and genotypes may be risk factors for the development of cryptorchidism.
Please cite this article in press as: Zhou B, et al., The variations in the AXIN1 gene and susceptibility to cryptorchidism, Journal of Pediatric Urology (2015), http://dx.doi.org/10.1016/j.jpurol.2015.02.007
+
MODEL
1.e4 Table 3 risk.
B. Zhou et al. Genotype frequencies of tag SNPs in AXIN1 among patients and controls and their association with cryptorchidism
Genetic model
rs370681 Codominant
Dominant Recessive Overdominant Log-additive rs1805105 Codominant
Dominant Recessive Overdominant Log-additive rs12921862 Codominant
Dominant Recessive Overdominant
Genotype
C/C C/T T/T C/C C/TeT/T C/CeC/T T/T C/CeT/T C/T
T/T C/T C/C T/T C/TeC/C T/TeC/T C/C T/TeC/C C/T
C/C A/C A/A C/C A/CeA/A C/CeA/C A/A C/CeA/A A/C
Patients
Controls
Logistic regression
n Z 113 (%)
n Z 179 (%)
OR (95%CI)
p
86 79 14 86 93 165 14 100 79
1.00 2.17 (1.28e3.70) 4.00 (1.79e9.09) 1.00 2.44 (1.47e4.00) 1.00 2.56 (1.22e5.26) 1.00 1.54 (0.96e2.50) 2.04 (1.41e2.94)
6e04
31 62 20 31 82 93 20 51 62
57 46 10 57 56 103 10 67 46
102 10 1 102 11 112 1 103 10
(27.4%) (54.9%) (17.7%) (27.4%) (72.6%) (82.3%) (17.7%) (45.1%) (54.9%)
(50.4%) (40.7%) (8.8%) (50.4%) (49.6%) (91.2%) (8.8%) (59.3%) (40.7%)
(90.7%) (8.5%) (0.8%) (90.7%) (9.3%) (99.2%) (0.8%) (91.5%) (8.5%)
112 51 16 112 67 163 16 128 51
155 19 5 155 24 174 5 160 19
(48%) (44.1%) (7.8%) (48%) (52%) (92.2%) (7.8%) (55.9%) (44.1%)
(62.6%) (28.5%) (8.9%) (62.6%) (37.4%) (91.1%) (8.9%) (71.5%) (28.5%)
(86.6%) (10.6%) (2.8%) (86.6%) (13.4%) (97.2%) (2.8%) (89.4%) (10.6%)
Log-additive
4e04 0.012 0.074 1e04
1.00 1.78 (1.06e2.94) 0.81 (0.35e1.91) 1.00 1.64 (1.02e2.63) 1.00 1.01 (0.44e2.31) 1.00 1.72 (1.05e2.86) 1.32 (0.93e1.89)
0.089
1.00 1.25 3.29 1.00 1.44 1.00 3.22 1.00 1.22 1.45
0.42
0.041 0.98 0.032 0.13
(0.56e2.80) (0.38e28.58) 0.34 (0.67e3.06) 0.23 (0.37e27.91) 0.62 (0.55e2.74) (0.77e2.72)
0.24
Note. N corresponds to the number of individuals. Values in bold indicate a significant difference at the 5% level.
Limitations
Conflict of interest
Although we detected the association between the SNPs in AXIN1 and cryptorchidism, there were limitations to our study. One is that we did not test the expression level of Axin1, which restricted further research on whether the SNPs have effect on the Axin1 expression level. Secondly, the number of study subjects is limited. Further large-scale studies in diverse ethnic populations still need to be done. Finally, the molecular mechanisms by which AXIN1 is involved in susceptibility to cryptorchidism should be characterized.
None.
Funding This work was supported by the National Natural Science Foundation of China (No. 81172440, No. 81000246 and No. 81272821); and the primary business fund of Chongqing Key Laboratory of Birth Defects and Reproductive Health (No. 1202).
References [1] Barthold JS, Gonzalez R. The epidemiology of congenital cryptorchidism, testicular ascent and orchiopexy. J Urol 2003; 170:2396e401. [2] Foresta C, Zuccarello D, Garolla A, Ferlin A. Role of hormones, genes, and environment in human cryptorchidism. Endocr Rev 2008;29:560e80. [3] Nef S, Parada LF. Cryptorchidism in mice mutant for Insl3. Nat Genet 1999;22:295e9. [4] Zimmermann S, Steding G, Emmen JM, Brinkmann AO, Nayernia K, Holstein AF, et al. Targeted disruption of the Insl3 gene causes bilateral cryptorchidism. Mol Endocrinol (Baltimore) 1999;13:681e91. [5] Zeng L, Fagotto F, Zhang T, Hsu W, Vasicek TJ, Perry 3rd WL, et al. The mouse fused locus encodes Axin, an inhibitor of the
Please cite this article in press as: Zhou B, et al., The variations in the AXIN1 gene and susceptibility to cryptorchidism, Journal of Pediatric Urology (2015), http://dx.doi.org/10.1016/j.jpurol.2015.02.007
+
MODEL
AXIN1 gene variations
[6]
[7]
[8] [9]
[10]
[11]
[12] [13] [14] [15] [16]
Wnt signaling pathway that regulates embryonic axis formation. Cell 1997;90:181e92. Chen P, Zhang K, Zhou B, Zhang Z, Song Y, Pu Y, et al. The variations in the IL1RL1 gene and susceptibility to preeclampsia. Immunol Invest 2014;43:424e35. Pu Y, Zhang Z, Zhou B, Chen P, Zhang K, Song Y, et al. Association of an insertion/deletion polymorphism in IL1A 3’-UTR with risk for cervical carcinoma in Chinese Han Women. Hum Immunol 2014;75:740e4. Logan CY, Nusse R. The Wnt signaling pathway in development and disease. Ann Rev Cell Dev Biol 2004;20:781e810. Harisis GN, Chen N, Farmer PJ, Bodemer D, Li R, Sourial M, et al. Wnt signalling in testicular descent: a candidate mechanism for cryptorchidism in Robinow syndrome. J Pediatr Surg 2013;48:1573e7. Liu C, Li Y, Semenov M, Han C, Baeg GH, Tan Y, et al. Control of beta-catenin phosphorylation/degradation by a dual-kinase mechanism. Cell 2002;108:837e47. L’Esperance S, Popa I, Bachvarova M, Plante M, Patten N, Wu L, et al. Gene expression profiling of paired ovarian tumors obtained prior to and following adjuvant chemotherapy: molecular signatures of chemoresistant tumors. Int J Oncol 2006; 29:5e24. Xie R, Jiang R, Chen D. Generation of Axin1 conditional mutant mice. Genesis (New York) 2011;49:98e102. Scorer C. The descent of the testis. Arch Dis Child 1964;39: 605. Huyghe E, Matsuda T, Thonneau P. Increasing incidence of testicular cancer worldwide: a review. J Urol 2003;170:5e11. Dieckmann KP, Pichlmeier U. Clinical epidemiology of testicular germ cell tumors. World J Urol 2004;22:2e14. Toppari J, Kaleva M, Virtanen HE. Trends in the incidence of cryptorchidism and hypospadias, and methodological limitations of registry-based data. Hum Reprod Update 2001;7: 282e6.
1.e5 [17] Czeizel A, Erodi E, Toth J. Genetics of undescended testis. J Urol 1981;126:528e9. [18] Weidner IS, Moller H, Jensen TK, Skakkebaek NE. Risk factors for cryptorchidism and hypospadias. J Urol 1999;161:1606e9. [19] Elert A, Jahn K, Heidenreich A, Hofmann R. The familial undescended testis. Klin Padiatr 2003;215:40e5. [20] Chia IV, Costantini F. Mouse axin and axin2/conductin proteins are functionally equivalent in vivo. Mol Cell Biol 2005;25: 4371e6. [21] Chia IV, Kim MJ, Itoh K, Sokol SY, Costantini F. Both the RGS domain and the six C-terminal amino acids of mouse Axin are required for normal embryogenesis. Genetics 2009;181: 1359e68. [22] Perry 3rd WL, Vasicek TJ, Lee JJ, Rossi JM, Zeng L, Zhang T, et al. Phenotypic and molecular analysis of a transgenic insertional allele of the mouse fused locus. Genetics 1995; 141:321e32. [23] Jin LH, Shao QJ, Luo W, Ye ZY, Li Q, Lin SC. Detection of point mutations of the Axin1 gene in colorectal cancers. Int J Cancer 2003;107:696e9. [24] Park JY, Park WS, Nam SW, Kim SY, Lee SH, Yoo NJ, et al. Mutations of beta-catenin and AXIN I genes are a late event in human hepatocellular carcinogenesis. Liver Int 2005;25:70e6. [25] Wu R, Zhai Y, Fearon ER, Cho KR. Diverse mechanisms of betacatenin deregulation in ovarian endometrioid adenocarcinomas. Cancer Res 2001;61:8247e55. [26] Dahmen RP, Koch A, Denkhaus D, Tonn JC, Sorensen N, Berthold F, et al. Deletions of AXIN1, a component of the WNT/wingless pathway, in sporadic medulloblastomas. Cancer Res 2001;61:7039e43. [27] Mattick JS, Gagen MJ. The evolution of controlled multitasked gene networks: the role of introns and other noncoding RNAs in the development of complex organisms. Mol Biol Evol 2001; 18:1611e30.
Please cite this article in press as: Zhou B, et al., The variations in the AXIN1 gene and susceptibility to cryptorchidism, Journal of Pediatric Urology (2015), http://dx.doi.org/10.1016/j.jpurol.2015.02.007
