Proc. Natl. Acad. Sci. USA Vol. 89, pp. 8180-8184, September 1992 Biochemistry
Thermodynamics of Cro protein-DNA interactions (enthalpy/entropy/heat capacity chang/calormtry/DNA sequence reco
n)
YOSHINORI TAKEDA*, PHILIP D. Rosst, AND COURTNEY P. MUDDt *Laboratory of Molecular Biology, National Cancer Institute-Frederick Cancer Research Facility, Program Resources Inc., Frederick, MD 21701; tLaboratory of Molecular Biology, National Institute of Diabetes and Digestive and Kidney Diseases; and tBiomedical Engineering and Instnrmentation Program, National Center for Research Resources, National Institutes of Health, Bethesda, MD 20892
Communicated by William A. Hagins, May 5, 1992 (received for review February 15, 1991)
structure because the specificity of DNA association is ultimately determined by the free energy. Takeda et al. (13) have reported the effects of systematic
ABSTRACT Using a highly sensitive pulsed-flow microcalorimeter, we have measured the changes In enthalpy and determined the thermodynamic parameters AH, AS°, AG°, and ACp for Cro protein-DNA asoation reactions. The reactions studied include sequeno ific DNA asiation and sequence-specific DNA asciations involving single- and multiple-base alterations and/or single-amino acid alt i muof Cro protein with nonspecific DNA tants. (i) The a i at 150C is characterized by AH = +4.4 kcal-not' (1 cal = 4.18J), ASO = 49 cal'mol-l K'1, AGO = -9.7 kcalomd-l, and ACp 0; the atin with specific high-affnity operator OR3 DNA is characterized by AH = +0.8 kcalimol-1, ASO = 59 cal mol-l'K'1, AGO = -16.1 kcal mol-1, and AC, = -360 cal moll K-', respectively,. Both nonspecific and specific CroDNA asoiations are entropy-driven. (ii) Plots of AH vs. ACp and AS vs. ACp for the 20 sin reactions studied fag into two correlation groups with linear slopes of +9.4 K and -20.5 n lines K and of -0.03 and -0.14, respectively. These r have common intercepts, at the AH and ASO values of nonspecific assocation (where ACp 0). The results suggest that there are, at least, two distinct conformational subclasses in specific Cro-DNA complexes, stbized by different combinations of enthalpic and entropic contributions. The AGO and AC, values form an approximately single linear correlation group as a consequence of compensatory contributions from AH and AS" to AGO and to ACp. Cro protein-DNA asiatis share some similar thermodynamic properties with protein folding, but their overall energetics are quite different. Although the nonspecific complex is stabli predominantiy by electrostatic forces, it appears that H bonds, van der Waals contacts, hydrophobic effects, and charge interactions all contribute to the stability (AGO and ACp) of the specific complex. (Mi) The variations in the values of the thermodynamic parameters are in general accord with our knowledge of the structLre of the Cro-DNA complex.
base substitutions upon the free energy of Cro-DNA associations. Examination of these data in relation to the structure of the Cro-DNA complex revealed that the locations of the changes in the free energy of binding coincided with the locations of the specific amino acid-nucleic acid base contacts. This result suggested that the sequence recognition by Cro repressor is mediated primarily by these direct amino acid-base contacts-e.g., specific H bonds and van der Waals contacts. However, when base substitution was clearly breaking a H bond or van der Waals contact between protein and DNA, the amount ofobserved free energy change attributable to that perturbation was unclear because significant contributions to AG0 might come from other sourcese.g., changes in phosphate interactions and local or global
hydrophobic effects. Thus, to gain insight into the origins of AG' in Cro-DNA association and understand the forces stabilizing the complex, we have measured AH values and determined the thermodynamic parameters, AG', AH, A S0, and ACp, for the associations of Cro protein with nonspecific DNA, associations with specific operator DNA, and the associations involving a variety of defined single-base and/or singleamino acid alteration mutants. These studies suggest, although it is not obvious from AG', at least two thermodynamically distinct types of specific Cro-DNA associations: one proceeding with a more favorable AH, and the other proceeding with a less favorable AH than that accompanying nonspecific-DNA association. We discuss the significance of these findings in terms of protein-DNA recognition. MATERIALS AND METHODS DNAs and Proteins. All DNAs used were 21-base-pair (bp) synthetic DNAs (13). Cro protein binds to 17-bp DNA, located in the middle of the following sequences: OR3, TTTATCCCTTGCGGTGATAAA; OR1, TTTACCTCTGGCGGTGATAAA; #4, TAAAACACCTCACGAGTTAAT; #5, TAAATCACTCCCGGGTATATT; #10, TGGAACCCACCGAGTGAAAGT; and #11, TCCGTCACCGCCAGTTAATCT. Operator DNAs OR3 and OR1 have the highest- and the third-highest-affinity for Cro, respectively. DNAs #4 and #5 are nonoperator DNA with intermediate affinity. DNAs #10 and #11 are nonspecific DNA. Singlebase substitution mutant DNAs are all derivatives of OR3 and are listed in Table 1 below. These DNAs were 70-100%6 active in DNA binding (the purification procedure will be published elsewhere). Purified Cro protein was 100% active. Measurement of Enthalpy Change. The pulsed-flow microcalorimeter described by Mudd and Berger (14) was used with better than 1-pJ resolution. In each experiment, 80 pI of Cro protein (7 x 10-10 mol) in 0.1 M KCl plus 0.01 M KPO4 buffer at pH 7 was mixed with an equal volume of the same solution containing a 30%o molar excess of DNA. Twenty such runs were averaged, and the thermal-mixing artifact was
=
Cro protein represents a prototype of DNA-binding proteins with a helix-turn-helix structure as a specific DNArecognition motif (1-4). Recent determination of the threedimensional structure of a Cro protein-DNA complex (5) shows that the pertinent helix-turn-helix. structure is, in fact, used for DNA binding, as has been demonstrated for other DNA-binding proteins, such as 434 repressor (6), 434 Cro (7), A repressor (8), trp repressor (9), and CAP protein (10). Analyses of these structures (1-12) suggest that the important features in DNA-sequence recognition are a snug fit between protein and DNA structures, resulting H bonds and van der Waals contacts between amino acids and edges of DNA bases, and phosphate interactions. To understand how protein recognizes specific DNA sequences, however, we must understand the energetics of DNA binding along with the The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. 8180
Biochemistry: Takeda et al.
subtracted. The enthalpies of dilution of both Cro and DNA were zero within experimental error. The molar enthalpy change, AH, of the Cro-DNA association was calculated on the basis of added protein and had an estimated uncertainty of ±300 cal mol-1.
0
~1
-20 #5
OR3
-30
ltv
10
30
20 T (OC)
FIG. 1. AH values of Cro-DNA association function of temperature. Solvent was 0.1 M KCl/0.01 buffer, pH 7. Nonspecific DNA #11; A, specific #5;o, specific operator DNAOR3.
reactions
KPO4
M
nonoperator
n,
denaturation is completely reversible (Fig. 2). DNA complex melts above 70TC (Fig. 2). Thus, denatured Cro is mixed with DNA, it would probably ture exothermically to form a heat-stable Cro-DNA (ii) The amino acid substitution mutant of Crova27, has 10TC greater thermo-stability Cro protein. The increasingly exothermicAH associations of Cro,.127 with DNAs are accordingly
The Cro-0R3 if partially rena-
complex.
Cro
protein,
than wild-type changes
in
the
shifted
o10TC higher temperatures (data
not shown).
to
Because
impossible to account quantitatively for contributions observed AH from partial unfolding, we use AH determinations only in the region below 20TC intrinsic association reaction between Cro protein Comparison of AG', AH, and TAS' for Nonspecific Specific Association. AlthoughACp varies with temperature, below 20TC the temperature-dependent variation very small (Fig. 1), and the thermodynamic parameters temperature T(s20TC) can be expressed by to
and
the
ACp
to measure
the
and DNA.
and
in
ACp
at
AHT AHO + A Cp(T=
AST
=
AS
AG;
=
AGO + ACp[(T
+
)
ACpln(T/0) 6)
T
ln(T/0)],
0.2
0.0 0 0
cific DNA #11, specific high-affinity operator DNAOR3, and specific nonoperator DNA #5 with an intermediate affinity. Another set of DNAs of similar respective affinities (13) gave nearly identical values of AH from 40C to 37°Ci.e., #10 #11, #4 = #5, and OR1 OR3 (data not shown, but all thermodynamic parameters at 15°C for these DNAs
#11
E -10
RESULTS
Calorimetric Determination of Enthalpy and Heat Capacity Changes. Fig. 1 shows measured A H values as a function of temperature for the association of Cro protein with nonspe-
8181
0
CrogIn27
°).A
USA 89 (1992)
+ 1L
Table 1. Thermodynamic parameters of Cro-DNA association reactions at 15'C Protein DNA -AG'5* AH15t A S1st -ACp,15§ (wild type) Exp. 1 #11 9.7 4400 49 10 Exp. 2 #10 9.8 4300 49 10 Exp. 3 #5 13.0 2800 55 150 Exp. 4 #4 13.5 3000 57 210 Exp. 5 OR1 15.4 1200 58 330 Exp. 6 OR3 16.1 800 59 360 Exp. 7 OR3.2AU 16.0 1200 60 350 Exp. 8 OR3.2TA 12.3 7900 70 150 Exp. 9 OR3.2UA 10.3 5700 55 40 Exp. 10 OR3.2GC 10.5 4200 51 120 Exp. 11 OR3.2CG 10.2 4300 51 10 Exp. 12 OR3.4GC 13.1 3100 56 260 Exp. 13 OR3.4AT 12.2 5800 63 120 Exp. 14 OR3.SAU 14.5 2100 58 260 Croval27 Exp. 15 OR3 11.7 5700 60 130 Exp. 16 OR3.2AU 11.6 4700 57 60 Exp. 17 OR3.2TA 14.0 8900 79 190 Exp. 18 OR3.2UA 12.2 7300 68 90 Exp. 19 OR3.2GC 10.3 5000 53 50 Exp. 20 OR3.2CG 10.3 4900 53 0 Solvent was 0.1 M KCI/0.01 M KPO4 buffer, pH 7. AH15 and A Cp,15 were determined from repeated measurements of AH (± 300 cal-1-mol-1) at two to four temperatures between 40 and 200C. AG'1s was calculated by Eq. 1 from AGo (± 0.1 kcal mol-1) determined by the fiter-binding assay (13), which defines the standard-state conditions (superscript A Sl was obtained form AGl5 and AH15. The operatorOR3 sequence is pseudo palindromic, to which the Cro dimer binds by fitting the 2-fold symmetry element of the protein (refs. 1-5, 13). To study effects of essentially identical interactions occurring at two 2-fold related positions simultaneously, all basesubstitution mutants carry two alterations at 2-fold related positions, exceptOR3.5AU. Because the 17-bp operator sequence is located in the middle of the 21-bp DNA used, base-pair positions are numbered from the third base. Thus, mutantOR3.2TA,OR3.4AT, and OR3.5AU, respectively, have the sequences TTTTTCCCTTGCGGTGAAAAA, TTTATACCTTGCGGTTATAAA, and TTTATCCCTTGCGGUGATAAA (base alterations fromOR3 are underlined). Nomenclature and base alterations for the other DNAs follow the samerule. *Units for AG' are kcal mol-1. tUnits for AH are cal mol-1. *Units forAS° are cal mol-l K-1. §Units for ACp are cal mol-l K-1.
Natl. Acad. Sci.
Proc.
-.2
-
(0
nn I)
n
-.4-
0
-.6x w
*0
20
0
T
60
80
100
(CO)
=
are reported in Table 1). Several lines of evidence suggest that the curvature and increasingly exothermicAH values observed with all the DNAs above 250C (Fig. 1) arise primarily from the renaturation of partially unfolded Cro protein. (i) Wild-type Cro protein starts melting at -250C, and its
FIG. 2. Thermal denaturation of Cro protein and the Cro-0R3 DNA complex monitored by differential scanning calorimetry. Top and middle curves represent first and fourth heating, respectively, of
Cro protein (2.2 mg/mi in 0.1 M KCI/0.01 M KPO4 buffer, pH 7). Bottom
curve
represents Cro-0R3 DNA complex at
10-fold lower
concentration. Data were obtained with a Microcal (Amherst, MA) MC-2 calorimeter at a scan rate of 60 K/hr.
Biochemistry: Takeda et al.
8182
~+
Proc. Nadl. Acad. Sci. USA 89 (1992)
where 0 denotes a reference temperature. The standard free energy change, AG', is calculated from the equilibrium association constant Ka by AG0 = -RT In Ka. With the AH and A Cp values of Fig. 1 and the Ka values of 1.4 x 107 M-1 and 1.0 x 1012 M-1 determined previously by filter-binding assay at 00C for association of Cro with #11 and OR3 DNA (13), respectively, values of thermodynamic parameters at 50 intervals were calculated. These values were used to illustrate the temperature-dependent changes in A G, AH, and TA 50 for the nonspecific and specific DNA association (Fig. 3). For binding of Cro to nonspecific DNA #11 between 40C and 200C, AH +4 kcalmol-1 and ACp 0 cal-mol-lK-1. In contrast, AH for the specific Cro-0R3 DNA association decreases with increased temperature with ACp = -360 cal-mol'lK-1. AG0 is nearly temperatureinvariant in both cases. Both the nonspecific and specific DNA associations are entropy-driven., Effects of Single Base and/or Single Amino Acid Alteration Mutants on the Thermodynamic Parameters of Specific Associations. Although these results provide a general picture of the overall thermodynamic behavior of Cro-DNA associations, the DNAs used contain too many base alterations for detailed analysis. To gain insight into the energetics of specific Cro-DNA association, we studied the effects of various single-base and/or single-amino acid alteration mutants on AG0, AH, TAS0, and ACp. Mutant DNAs are all derivatives of OR3 (Table 1). A mutant protein, Cro*,U7, is a product of a specificity mutant that changes base-recognition specificity (Y.T., unpublished work). These DNA and protein mutants disrupt a few H bonds or a van der Waals contact at specific locations in the binding region within the complex, thereby reducing binding affinity (see Fig. 4). Values of the thermodynamic parameters at 150C are reported in Table 1. Examination of Table 1 reveals that AH, A S', and AG0 all correlate with ACp (Fig. 5). Plots of AH and AS0 vs. ACp (Fig. 5 a and b) show that the 20 Cro-DNA associations studied fall into two correlation groups: the associations of wild-type Cro with OR3, OR3.2AU, OR1, OR3.5AU, OR3.4GC, #4, #5, 0R3.2GC, and OR3.2CG make up one group (group I), whereas the associations of Crovl27 with all the DNAs tested (OR3, OR3.2AU, 0R3.2TA, OR3.2UA, OR3.2GC, and OR3.2CG) and the associations of wild-type Cro with OR3.2TA, OR3.2UA, and OR3.4AT make up another group (group II). The linear correlations between AH and A Cp (Fig. 5a) or between A S0 and ACp (Fig. Sb) for the two groups are given by: +20
0
+
AH
J9
U
z
wU
10o
_ AG
AG
-20
0
10
20
0
10
0
-o
AH
_
20
T (OC) FIG. 3. Comparison of calculated AG', AH, and TA S0 between associations of Cro with nonspecific DNA #11 (Left) and with specific operator DNA OR3 (Right). Thermodynamic parameters are calculated from AG' and measured AH by Eq. 1.
3' A
Ni
C *9
06 N4
I- G +8
I-
-8 C *
-7 G-A-C *7
N.2 fyH2Arg 38 -6 G
I
I
A-
C +6
*
Q j A 4 -A .5 Lys 32 rCH2 c 4NH3
-5 T
-4 G
C Lys 32
AI+-I--6
-3 A
T +3 c Asn 31
HO Ser 28
-2 T {3 I
A
O
-I
A
- la
N6
A +2
I
NH Gin 27
T 'I
la
Ni
,
04
Thr 17 -CH3
FIG. 4. Illustration of the sequence-specific H bonds ( ) and van der Waals contacts (III) between amino acid side chains of Cro and functional groups exposed within the DNA major groove of the consensus half-operator of OR3 (refs. 2, 3, 5, 13). I, H-bond acceptor; h, H-bond donor; o, thymine methyl group. Only one-half site is presented because the other half-site interacts similarly.
AH1= 4600 + 9.4 K X ACp
AHII=4300-20.5 K X ACP ASo= 49.4-0.03 x ACE ASO
[2]
=49.0-0.14xACP,
where AH is expressed in callmol-, and A 50 and ACp are expressed by cal mol-l-K-1, respectively. The lines intercept close to the values characteristic of the Cro-nonspecific DNA association; AH = +4.4 kcal-mol-1 and ASo = 49 cal mol-l K-l, where ACp 0O. All AG' and ACp values form a more or less single correlation group with a slope of 17.1 K (Fig. 5c); this relationship is as follows:
-20
TAS
TAS
10l
5' -9 G
AG0
=
-9700 + 17.1 K
x
ACp,
[3]
where AG0 is expressed by cal-moli1. This relationship exists because the slopes of correlation in the AG0 - ACp plots are very close, 17.6 K and 19.7 K for groups I and II, respectively, due to compensatory contributions from AH and A S5 to AG0 and to ACp. Pairwise comparisons show that the variations in the values of the thermodynamic parameters are in general accord with our knowledge of the structure of the Cro-DNA complex (Table 1 and Fig. 4). For instance, (i) The removal of the
methyl
group of -2 T
(2 AT
(OR3) -*2 AU) has very
little effect on all thermodynamic parameters (Table 1, experiments 6 and 7; experiments 15 and 16), being consistent with the structural studies (2, 5), which suggest that this methyl group is not involved in any contact. (ii) Substitution of 2 TA for 2 AT (OR3) (Table 1, experiments 6 and 8) results in the changes: AAH = +7.1 kcal mol', -TAAS = -3.3 kcal mol-1, AAG' = +3.8 kcal mol-1, and AACp = +210 cal mol-l-K-1. Substitution of
Proc. Natl. Acad. Sci. USA 89 (1992)
Biochemistry: Takeda et A
= +5.0 kcal mohl1 (TAA So0 0). Binding of Cro,.m7 to DNA is improved when thymine is placed at the +2 position because this change creates a van der Waals contact. This association proceeds with an even more unfavorable enthalpy change, AAH = +3.2 kcal mol1, which is overcome by a large entropy change -TAAS' = -5.7 kcal-mol-1, resulting in AAG0 = -2.3 kcal'mol-1 and AACp = -60 cal mohl K-1 (experiments 15 and 17). The removal of this methyl group (experiments 17 and 18) reverses these effects, weakening the interaction by AAG0 = +1.8 kcal mol1 with AAH = -1.6 kcal mol-1 and -TAAS5 = +3.3 kcal mol1. (iv) Substitution of 4 GC for 4 CG (OR3) (experiments 6 and 12) breaks H bonds between -4 G and Lys-32, resulting in AAH = +2.3 kcal-mol-1, -TAA S = +0.9 kcal-mol-1, AAG' = +3.0 kcal mol-1, and AACp = +100 cal mol-lhK-1. The 4 AT substitution, while breaking H bonds, probably creates a van der Waals contact between the thymine methyl and the hydrophobic part of Lys-32, resulting in the changes of AAH = +5.0 kcal molh, -TAA S = -1.1 kcal mol1, and AAG' = +3.9 kcal-mol-1. (v) Removal of the single -5 thymine methyl group (experiments 6 and 14) eliminates a van der Waals contact, which results in AAGO = +1.6 kcal-mol-1, AAH = +1.3 kcal mol1, and TAAS'0 0.
101 -a 8F 0
E
6
0 co Jv
%foI
4 A
2
0
.-M
0 v
0
CD I
E #11
c 2UA
-10
V27-2GC0 0 2G
2GC
0
#1C
V27-2CG
V27
-12
0
* #4 4GC
I
V27-2AU *02-2UA 4AT
2TA
14p
#5
0 V27-2TA
OR1 0 161 0R3
A
-400
-300
8183
/5AU
-200
-100
0
ACp (cal/mol deg) FIG. 5. Correlations between AHand ACp (a), between AS0 and ACp (b), and between AG' and ACp (c) seen for Cro-DNA associ-
ation reactions. Data are from Table 1. Closed symbols denote associations with wild-type Cro, and open symbols denote associations with mutant Cro,.j27.
2 UA for 2 AT (OR3) (experiments 6 and 9) results in AAH = +4.9 kcal moli1, -TAAS0 = +1.1 kcal mol-1, AAlG' = +5.8 kcal'mol-1, and AACp = +320 cal-molhlK-1. All of these changes in the thermodynamic values are consistent with the picture that the 2 TA substitution, while removing H bonds between Gln-27 and + 2 adenine, creates van der Waals contacts between the +2 thymine methyl group and Asn-31 and/or Gln-27. Removal of this methyl group decreases the stability by 2 kcal mol-1. Associations of Cro with OR3.2GC and OR3.2CG are weak (experiments 10 and 11) because, like the Cro-0R3.2UA association, they lack the H bonds and van der Waals contacts. (iii) The specificity mutant protein, CrovW27, cannot form H bonds to the + 2 adenine and binds poorly to OR3. The reduction of A A G° = +4.4 kcal mol-' (experiments 6 and 15) is due primarily to the more positive enthalpy change AAH
DISCUSSION The results of Fig. 3 Left show that the nonspecific Cro-DNA association is entropy-driven. This result confirms previous conclusions (15-22), drawn from measurements of the van't Hoff AH, that many protein-DNA associations are entropydriven. In protein-DNA association long-range electrostatic forces bring protein and DNA into proximity, and charged groups of the protein displace cations and water molecules from DNA. This process is accompanied by a large positive entropy change (15-17, 21, 22). Analysis of the ionic-strength dependence of nonspecific Cro-DNA association (23) by an electrostatic model (21, 22) suggests the release of about nine univalent cations, and chemical protection studies (24) indicate 10 lysine residues interacting with DNA, 8 of them with the phosphate backbone. Because of marked ionic strength dependency, it has been postulated that nonspecific DNA association is primarily electrostatic in nature (15-17, 21-27). This view is supported because we have found that the ratio A S0/A G' = 0.005 for nonspecific Cro-DNA association at 150C is very close to the value of (d In D/dT) = 0.0046 (where D is the dielectric constant of water) predicted for A S0/AG' by the simple electrostatic theories of ion hydration (Born) and Bjerrum's theory of ion association (28). The observed A Cp 0 for the nonspecific association indicates very little perturbation of the enthalpic states of the system (29) and is consonant with a very "loose" complex held together by long-range electrostatic forces. The specific Cro-DNA complex is formed with the further displacement of water molecules from the protein-DNA interface and the formation of the specific amino acid-nucleic acid base contacts. This process is accompanied by further positive changes in entropy and negative values of A Cp (Fig. 3 Right). The negative ACp indicates a narrowing of the enthalpic states of the system (29). In common with many ligand binding and association processes of proteins (29-32), a part of the observed negative A Cp would be contributed by the "tightening" of the structure as a result of constraints in the motion of DNA and protein in the specific complex. Changes in A Cp are characteristic of hydrophobic effects (29-37). We asked whether the negative A Cp values seen for the specific Cro-DNA associations originate mainly from =
hydrophobic effects. Before examining this hypothesis, we recall a few key observations concerning ACp and hydrophobic effects. For dissolution of a variety of hydrophobic
8184
Biochemistry: Takeda et al.
compounds in water, Sturtevant (30) observed that ACp values are accompanied by commensurate AS' values, and the ratio A S/ACp has a constant value of -0.26 at 250C. More recently, Murphy et al. (35) showed that the ratio A S0/ACp for denaturation of proteins has a similar constant value. Then, Spolar et al. (36) showed that the ratio between ACp and the change in water-accessible nonpolar surface area (AAnp) is identical for the transfer of nonpolar solutes from water to the pure liquid phase and for the folding of small globular proteins. Our current results (Fig. Sb) show that the thermodynamic behavior of Cro-DNA associations is somewhat similar to these well-studied cases in that the ratio A S/A Cp is constant but quite different in that there are two values of this ratio in Cro-DNA associations and that the values are much smaller and more positive-i.e., -0.03 and -0.14 at 150C (estimates at 250C are +0.02 and -0.08, respectively). These results suggest that Cro protein-DNA associations share some similar thermodynamic properties with protein folding, but their overall energetics are quite different. This conclusion is further supported by the fact that, whereas AG0 correlates to ACp with a coefficient of 80 K in protein folding (36), AG' correlates to ACp with a coefficient of 17 K in the specific Cro-DNA association (see above and Fig. Sc). A likely reason for these differences is that the protein-DNA interface is more polar and more hydrated than the interior of a folded protein. By analogy with hydrocarbon transfer and protein folding, Ha et al. (20) recently proposed that protein-DNA associations are stabilized by the large hydrophobic free energy. Thermodynamic data on Cro-DNA associations do not support this proposal. As described above, only limited similarity exists between protein-DNA association and protein folding, and their overall energetics are quite different. In Cro-DNA association ACp is tightly coupled with AG' of specific binding (see Fig. Sc), and H bonds, van der Waals contacts, and hydrophobic effects appear to all contribute directly to ACp, such that breakage of any of these interactions markedly affects both ACp and AG0 (see Results and Table 1). The AH-ACp and A S°-ACp plots revealed two types of thermodynamic behavior for the specific Cro-DNA associations that were not evident from the values of AG0 and A Cp (Fig. 5). One group of association, which includes most wild-type Cro associations, is characterized by more favorable AH and A S0 than for nonspecific DNA association. The second group of association, which includes three wild-type Cro associations and all CrowJ27 associations examined, is characterized by less favorable AH than in the nonspecific association that is offset by a positive A S°. Thus group I and group II associations are stabilized by different enthalpic and entropic contributions, and our results indicate that specific complexes with given affinity can be created by two different combinations ofHand S contributions. We suggest that these thermodynamically distinct binding modes reflect two distinct conformational subclasses in the structures of specific Cro-DNA complexes. It is noted that a single-base-pair or a single-amino acid change can switch the thermodynamic behavior from one group to the other. Takeda et al. (13) reported that the AG0 values are mostly additive for specific Cro-DNA association. Additivity of AG depends on uniformity of conformation. In retrospect, the experiments that led to this conclusion included only mutants that give rise to group I associations and none that give rise to group II associations. It will be interesting to test whether AG values are additive or not when the mutations that give rise to group I and II associations are combined. Comparison of the three-dimensional structures of group I and II associations will also
be very
interesting.
Proc. Nail. Acad. Sci. USA 89 (1992) We are deeply indebted to Dr. Robert L. Berger for use of the calorimeter (now available from Commonwealth Technology, Alexandria, VA). We thank Miss Nancy Seaton for technical assistance. This research has been supported, at least in part, by the National Cancer Institute, Department of Health and Human Services, under Contract NO1-CO-74102 with Program Resources, Inc.
1. Anderson, W. F., Ohlendorf, D. H., Takeda, Y. & Matthews, B. W. (1981) Nature (London) 290, 754-758. 2. Ohlendorf, D. H., Anderson, W. F., Fisher, R. G., Takeda, Y. & Matthews, B. W. (1982) Nature (London) 298, 718-723. 3. Takeda, Y., Ohlendorf, D. H., Anderson, W. F. & Matthews, B. W. (1983) Science 221, 1020-1026. 4. Brennan, R. G. & Matthews, B. W. (1989) J. Biol. Chem. 264, 1903-1906. 5. Brennan, R. G., Roderick, S. L., Takeda, Y. & Matthews, B. W. (1990) Proc. Natl. Acad. Sci. USA 87, 8165-8169. 6. Aggarwal, A. K., Rodgers, D., Drottar, M., Ptashne, M. & Harrison, S. C. (1988) Science 242, 899-907. 7. Mondragon, A. & Harrison, S. C. (1991) J. Mol. Biol. 219, 321-334. 8. Jordan, S. R. & Pabo, C. 0. (1988) Science 242, 893-899. 9. Otwinowski, R. W., Schevitz, R. W., Zhang, R.-G., Joachnk, A., Marmorstein, R. Q., Luisi, B. F. & Sigler, P. B. (1988) Nature (London) 335, 321-329. 10. Steitz, T. A. (1990) Q. Rev. Biophys. 23, 205-280. 11. Pabo, C. 0. & Sauer, R. T. (1984) Annu. Rev. Biochem. 53, 293-321. 12. Harrison, S. C. & Aggarwal, A. K. (1990) Annu. Rev. Biochem. 59, 933-969. 13. Takeda, Y., Sarai, A. & Rivera, V. M. (1989) Proc. Natl. Acad. Sci. USA 86, 439-443. 14. Mudd, C. P. & Berger, R. L. (1988) J. Biochem. Biophys. Methods 17, 171-192. 15. Riggs, A. D., Bourgeois, S. & Cohn, M. (1970) J. Mol. Biol. 53, 401-417. 16. Revzin, A. & von Hippel, P. H. (1977) Biochemistry 16, 47694776. 17. deHaseth, P. L., Lohman, T. M. & Record, M. T., Jr. (1977) Biochemistry 16, 4783-4790. 18. Whitson, P. A., Olson, J. S. & Matthews, K. S. (1986) Biochemistry 25, 3852-3858. 19. Vershon, A. K., Liao, S.-M., McClure, W. R. & Sauer, R. T. (1987) J. Mol. Biol. 195, 311-322. 20. Ha, J.-H., Spolar, R. S. & Record, M. T., Jr. (1989) J. Mol. Biol. 209, 801-816. 21. Manning, G. S. (1978) Q. Rev. Biophys. 11, 179-246. 22. Record, M. T., Jr., Anderson, C. F. & Lohman, T. M. (1978) Q. Rev. Biophys. 11, 103-178. 23. Boschelli, F. (1982) J. Mol. Biol. 162, 267-287. 24. Takeda, Y., Kim, J. G., Caday, C. G., Steers, E., Jr., Ohlendorf, D. H., Anderson, W. F. & Matthews, B. W. (1986) J. Biol. Chem. 261, 8608-8616. 25. Lin, S. Y. & Riggs, A. D. (1975) Cell 4, 107-111. 26. von Hippel, P. H. (1979) in Biological Regulation and Development, ed. Goldberger, R. F. (Plenum, New York), pp. 279347. 27. Matthews, J. B. & Ohlendorf, D. H. (1985) J. Biol. Chem. 260, 5860-5862. 28. King, E. J. (1965) Acid-Base Equilibria (Macmillan, New York), pp. 137-217. 29. Eftink, M. & Biltonen, R. L. (1980) in Biological Microcalorimetry, ed. Beezer, A. E. (Academic, London), pp. 343-412. 30. Sturtevant, J. M. (1977) Proc. Natl. Acad. Sci. USA 74, 2236-2240. 31. Ross, P. D. & Subramanian, S. (1981) Biochemistry 20, 30963102. 32. Hinz, H.-J. (1983) Annu. Rev. Biophys. Bioeng. 12, 285-317. 33. Edsall, J. T. (1935) J. Am. Chem. Soc. 57, 1506-1507. 34. Kauzmann, W. (1959) Adv. Protein Chem. 14, 1-63. 35. Murphy, K. P., Privalov, P. L. & Gill, S. J. (1990) Science 247, 559-561. 36. Spolar, R. S., Ha, J.-H. & Record, M. T., Jr. (1989) Proc. Natl. Acad. Sci. USA 86, 8382-8385. 37. Privalov, P. L. & Gill, S. J. (1988) Adv. Protein Chem. 39, 191-234.
Thermodynamics of Cro protein-DNA interactions (enthalpy/entropy/heat capacity chang/calormtry/DNA sequence reco
n)
YOSHINORI TAKEDA*, PHILIP D. Rosst, AND COURTNEY P. MUDDt *Laboratory of Molecular Biology, National Cancer Institute-Frederick Cancer Research Facility, Program Resources Inc., Frederick, MD 21701; tLaboratory of Molecular Biology, National Institute of Diabetes and Digestive and Kidney Diseases; and tBiomedical Engineering and Instnrmentation Program, National Center for Research Resources, National Institutes of Health, Bethesda, MD 20892
Communicated by William A. Hagins, May 5, 1992 (received for review February 15, 1991)
structure because the specificity of DNA association is ultimately determined by the free energy. Takeda et al. (13) have reported the effects of systematic
ABSTRACT Using a highly sensitive pulsed-flow microcalorimeter, we have measured the changes In enthalpy and determined the thermodynamic parameters AH, AS°, AG°, and ACp for Cro protein-DNA asoation reactions. The reactions studied include sequeno ific DNA asiation and sequence-specific DNA asciations involving single- and multiple-base alterations and/or single-amino acid alt i muof Cro protein with nonspecific DNA tants. (i) The a i at 150C is characterized by AH = +4.4 kcal-not' (1 cal = 4.18J), ASO = 49 cal'mol-l K'1, AGO = -9.7 kcalomd-l, and ACp 0; the atin with specific high-affnity operator OR3 DNA is characterized by AH = +0.8 kcalimol-1, ASO = 59 cal mol-l'K'1, AGO = -16.1 kcal mol-1, and AC, = -360 cal moll K-', respectively,. Both nonspecific and specific CroDNA asoiations are entropy-driven. (ii) Plots of AH vs. ACp and AS vs. ACp for the 20 sin reactions studied fag into two correlation groups with linear slopes of +9.4 K and -20.5 n lines K and of -0.03 and -0.14, respectively. These r have common intercepts, at the AH and ASO values of nonspecific assocation (where ACp 0). The results suggest that there are, at least, two distinct conformational subclasses in specific Cro-DNA complexes, stbized by different combinations of enthalpic and entropic contributions. The AGO and AC, values form an approximately single linear correlation group as a consequence of compensatory contributions from AH and AS" to AGO and to ACp. Cro protein-DNA asiatis share some similar thermodynamic properties with protein folding, but their overall energetics are quite different. Although the nonspecific complex is stabli predominantiy by electrostatic forces, it appears that H bonds, van der Waals contacts, hydrophobic effects, and charge interactions all contribute to the stability (AGO and ACp) of the specific complex. (Mi) The variations in the values of the thermodynamic parameters are in general accord with our knowledge of the structLre of the Cro-DNA complex.
base substitutions upon the free energy of Cro-DNA associations. Examination of these data in relation to the structure of the Cro-DNA complex revealed that the locations of the changes in the free energy of binding coincided with the locations of the specific amino acid-nucleic acid base contacts. This result suggested that the sequence recognition by Cro repressor is mediated primarily by these direct amino acid-base contacts-e.g., specific H bonds and van der Waals contacts. However, when base substitution was clearly breaking a H bond or van der Waals contact between protein and DNA, the amount ofobserved free energy change attributable to that perturbation was unclear because significant contributions to AG0 might come from other sourcese.g., changes in phosphate interactions and local or global
hydrophobic effects. Thus, to gain insight into the origins of AG' in Cro-DNA association and understand the forces stabilizing the complex, we have measured AH values and determined the thermodynamic parameters, AG', AH, A S0, and ACp, for the associations of Cro protein with nonspecific DNA, associations with specific operator DNA, and the associations involving a variety of defined single-base and/or singleamino acid alteration mutants. These studies suggest, although it is not obvious from AG', at least two thermodynamically distinct types of specific Cro-DNA associations: one proceeding with a more favorable AH, and the other proceeding with a less favorable AH than that accompanying nonspecific-DNA association. We discuss the significance of these findings in terms of protein-DNA recognition. MATERIALS AND METHODS DNAs and Proteins. All DNAs used were 21-base-pair (bp) synthetic DNAs (13). Cro protein binds to 17-bp DNA, located in the middle of the following sequences: OR3, TTTATCCCTTGCGGTGATAAA; OR1, TTTACCTCTGGCGGTGATAAA; #4, TAAAACACCTCACGAGTTAAT; #5, TAAATCACTCCCGGGTATATT; #10, TGGAACCCACCGAGTGAAAGT; and #11, TCCGTCACCGCCAGTTAATCT. Operator DNAs OR3 and OR1 have the highest- and the third-highest-affinity for Cro, respectively. DNAs #4 and #5 are nonoperator DNA with intermediate affinity. DNAs #10 and #11 are nonspecific DNA. Singlebase substitution mutant DNAs are all derivatives of OR3 and are listed in Table 1 below. These DNAs were 70-100%6 active in DNA binding (the purification procedure will be published elsewhere). Purified Cro protein was 100% active. Measurement of Enthalpy Change. The pulsed-flow microcalorimeter described by Mudd and Berger (14) was used with better than 1-pJ resolution. In each experiment, 80 pI of Cro protein (7 x 10-10 mol) in 0.1 M KCl plus 0.01 M KPO4 buffer at pH 7 was mixed with an equal volume of the same solution containing a 30%o molar excess of DNA. Twenty such runs were averaged, and the thermal-mixing artifact was
=
Cro protein represents a prototype of DNA-binding proteins with a helix-turn-helix structure as a specific DNArecognition motif (1-4). Recent determination of the threedimensional structure of a Cro protein-DNA complex (5) shows that the pertinent helix-turn-helix. structure is, in fact, used for DNA binding, as has been demonstrated for other DNA-binding proteins, such as 434 repressor (6), 434 Cro (7), A repressor (8), trp repressor (9), and CAP protein (10). Analyses of these structures (1-12) suggest that the important features in DNA-sequence recognition are a snug fit between protein and DNA structures, resulting H bonds and van der Waals contacts between amino acids and edges of DNA bases, and phosphate interactions. To understand how protein recognizes specific DNA sequences, however, we must understand the energetics of DNA binding along with the The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. 8180
Biochemistry: Takeda et al.
subtracted. The enthalpies of dilution of both Cro and DNA were zero within experimental error. The molar enthalpy change, AH, of the Cro-DNA association was calculated on the basis of added protein and had an estimated uncertainty of ±300 cal mol-1.
0
~1
-20 #5
OR3
-30
ltv
10
30
20 T (OC)
FIG. 1. AH values of Cro-DNA association function of temperature. Solvent was 0.1 M KCl/0.01 buffer, pH 7. Nonspecific DNA #11; A, specific #5;o, specific operator DNAOR3.
reactions
KPO4
M
nonoperator
n,
denaturation is completely reversible (Fig. 2). DNA complex melts above 70TC (Fig. 2). Thus, denatured Cro is mixed with DNA, it would probably ture exothermically to form a heat-stable Cro-DNA (ii) The amino acid substitution mutant of Crova27, has 10TC greater thermo-stability Cro protein. The increasingly exothermicAH associations of Cro,.127 with DNAs are accordingly
The Cro-0R3 if partially rena-
complex.
Cro
protein,
than wild-type changes
in
the
shifted
o10TC higher temperatures (data
not shown).
to
Because
impossible to account quantitatively for contributions observed AH from partial unfolding, we use AH determinations only in the region below 20TC intrinsic association reaction between Cro protein Comparison of AG', AH, and TAS' for Nonspecific Specific Association. AlthoughACp varies with temperature, below 20TC the temperature-dependent variation very small (Fig. 1), and the thermodynamic parameters temperature T(s20TC) can be expressed by to
and
the
ACp
to measure
the
and DNA.
and
in
ACp
at
AHT AHO + A Cp(T=
AST
=
AS
AG;
=
AGO + ACp[(T
+
)
ACpln(T/0) 6)
T
ln(T/0)],
0.2
0.0 0 0
cific DNA #11, specific high-affinity operator DNAOR3, and specific nonoperator DNA #5 with an intermediate affinity. Another set of DNAs of similar respective affinities (13) gave nearly identical values of AH from 40C to 37°Ci.e., #10 #11, #4 = #5, and OR1 OR3 (data not shown, but all thermodynamic parameters at 15°C for these DNAs
#11
E -10
RESULTS
Calorimetric Determination of Enthalpy and Heat Capacity Changes. Fig. 1 shows measured A H values as a function of temperature for the association of Cro protein with nonspe-
8181
0
CrogIn27
°).A
USA 89 (1992)
+ 1L
Table 1. Thermodynamic parameters of Cro-DNA association reactions at 15'C Protein DNA -AG'5* AH15t A S1st -ACp,15§ (wild type) Exp. 1 #11 9.7 4400 49 10 Exp. 2 #10 9.8 4300 49 10 Exp. 3 #5 13.0 2800 55 150 Exp. 4 #4 13.5 3000 57 210 Exp. 5 OR1 15.4 1200 58 330 Exp. 6 OR3 16.1 800 59 360 Exp. 7 OR3.2AU 16.0 1200 60 350 Exp. 8 OR3.2TA 12.3 7900 70 150 Exp. 9 OR3.2UA 10.3 5700 55 40 Exp. 10 OR3.2GC 10.5 4200 51 120 Exp. 11 OR3.2CG 10.2 4300 51 10 Exp. 12 OR3.4GC 13.1 3100 56 260 Exp. 13 OR3.4AT 12.2 5800 63 120 Exp. 14 OR3.SAU 14.5 2100 58 260 Croval27 Exp. 15 OR3 11.7 5700 60 130 Exp. 16 OR3.2AU 11.6 4700 57 60 Exp. 17 OR3.2TA 14.0 8900 79 190 Exp. 18 OR3.2UA 12.2 7300 68 90 Exp. 19 OR3.2GC 10.3 5000 53 50 Exp. 20 OR3.2CG 10.3 4900 53 0 Solvent was 0.1 M KCI/0.01 M KPO4 buffer, pH 7. AH15 and A Cp,15 were determined from repeated measurements of AH (± 300 cal-1-mol-1) at two to four temperatures between 40 and 200C. AG'1s was calculated by Eq. 1 from AGo (± 0.1 kcal mol-1) determined by the fiter-binding assay (13), which defines the standard-state conditions (superscript A Sl was obtained form AGl5 and AH15. The operatorOR3 sequence is pseudo palindromic, to which the Cro dimer binds by fitting the 2-fold symmetry element of the protein (refs. 1-5, 13). To study effects of essentially identical interactions occurring at two 2-fold related positions simultaneously, all basesubstitution mutants carry two alterations at 2-fold related positions, exceptOR3.5AU. Because the 17-bp operator sequence is located in the middle of the 21-bp DNA used, base-pair positions are numbered from the third base. Thus, mutantOR3.2TA,OR3.4AT, and OR3.5AU, respectively, have the sequences TTTTTCCCTTGCGGTGAAAAA, TTTATACCTTGCGGTTATAAA, and TTTATCCCTTGCGGUGATAAA (base alterations fromOR3 are underlined). Nomenclature and base alterations for the other DNAs follow the samerule. *Units for AG' are kcal mol-1. tUnits for AH are cal mol-1. *Units forAS° are cal mol-l K-1. §Units for ACp are cal mol-l K-1.
Natl. Acad. Sci.
Proc.
-.2
-
(0
nn I)
n
-.4-
0
-.6x w
*0
20
0
T
60
80
100
(CO)
=
are reported in Table 1). Several lines of evidence suggest that the curvature and increasingly exothermicAH values observed with all the DNAs above 250C (Fig. 1) arise primarily from the renaturation of partially unfolded Cro protein. (i) Wild-type Cro protein starts melting at -250C, and its
FIG. 2. Thermal denaturation of Cro protein and the Cro-0R3 DNA complex monitored by differential scanning calorimetry. Top and middle curves represent first and fourth heating, respectively, of
Cro protein (2.2 mg/mi in 0.1 M KCI/0.01 M KPO4 buffer, pH 7). Bottom
curve
represents Cro-0R3 DNA complex at
10-fold lower
concentration. Data were obtained with a Microcal (Amherst, MA) MC-2 calorimeter at a scan rate of 60 K/hr.
Biochemistry: Takeda et al.
8182
~+
Proc. Nadl. Acad. Sci. USA 89 (1992)
where 0 denotes a reference temperature. The standard free energy change, AG', is calculated from the equilibrium association constant Ka by AG0 = -RT In Ka. With the AH and A Cp values of Fig. 1 and the Ka values of 1.4 x 107 M-1 and 1.0 x 1012 M-1 determined previously by filter-binding assay at 00C for association of Cro with #11 and OR3 DNA (13), respectively, values of thermodynamic parameters at 50 intervals were calculated. These values were used to illustrate the temperature-dependent changes in A G, AH, and TA 50 for the nonspecific and specific DNA association (Fig. 3). For binding of Cro to nonspecific DNA #11 between 40C and 200C, AH +4 kcalmol-1 and ACp 0 cal-mol-lK-1. In contrast, AH for the specific Cro-0R3 DNA association decreases with increased temperature with ACp = -360 cal-mol'lK-1. AG0 is nearly temperatureinvariant in both cases. Both the nonspecific and specific DNA associations are entropy-driven., Effects of Single Base and/or Single Amino Acid Alteration Mutants on the Thermodynamic Parameters of Specific Associations. Although these results provide a general picture of the overall thermodynamic behavior of Cro-DNA associations, the DNAs used contain too many base alterations for detailed analysis. To gain insight into the energetics of specific Cro-DNA association, we studied the effects of various single-base and/or single-amino acid alteration mutants on AG0, AH, TAS0, and ACp. Mutant DNAs are all derivatives of OR3 (Table 1). A mutant protein, Cro*,U7, is a product of a specificity mutant that changes base-recognition specificity (Y.T., unpublished work). These DNA and protein mutants disrupt a few H bonds or a van der Waals contact at specific locations in the binding region within the complex, thereby reducing binding affinity (see Fig. 4). Values of the thermodynamic parameters at 150C are reported in Table 1. Examination of Table 1 reveals that AH, A S', and AG0 all correlate with ACp (Fig. 5). Plots of AH and AS0 vs. ACp (Fig. 5 a and b) show that the 20 Cro-DNA associations studied fall into two correlation groups: the associations of wild-type Cro with OR3, OR3.2AU, OR1, OR3.5AU, OR3.4GC, #4, #5, 0R3.2GC, and OR3.2CG make up one group (group I), whereas the associations of Crovl27 with all the DNAs tested (OR3, OR3.2AU, 0R3.2TA, OR3.2UA, OR3.2GC, and OR3.2CG) and the associations of wild-type Cro with OR3.2TA, OR3.2UA, and OR3.4AT make up another group (group II). The linear correlations between AH and A Cp (Fig. 5a) or between A S0 and ACp (Fig. Sb) for the two groups are given by: +20
0
+
AH
J9
U
z
wU
10o
_ AG
AG
-20
0
10
20
0
10
0
-o
AH
_
20
T (OC) FIG. 3. Comparison of calculated AG', AH, and TA S0 between associations of Cro with nonspecific DNA #11 (Left) and with specific operator DNA OR3 (Right). Thermodynamic parameters are calculated from AG' and measured AH by Eq. 1.
3' A
Ni
C *9
06 N4
I- G +8
I-
-8 C *
-7 G-A-C *7
N.2 fyH2Arg 38 -6 G
I
I
A-
C +6
*
Q j A 4 -A .5 Lys 32 rCH2 c 4NH3
-5 T
-4 G
C Lys 32
AI+-I--6
-3 A
T +3 c Asn 31
HO Ser 28
-2 T {3 I
A
O
-I
A
- la
N6
A +2
I
NH Gin 27
T 'I
la
Ni
,
04
Thr 17 -CH3
FIG. 4. Illustration of the sequence-specific H bonds ( ) and van der Waals contacts (III) between amino acid side chains of Cro and functional groups exposed within the DNA major groove of the consensus half-operator of OR3 (refs. 2, 3, 5, 13). I, H-bond acceptor; h, H-bond donor; o, thymine methyl group. Only one-half site is presented because the other half-site interacts similarly.
AH1= 4600 + 9.4 K X ACp
AHII=4300-20.5 K X ACP ASo= 49.4-0.03 x ACE ASO
[2]
=49.0-0.14xACP,
where AH is expressed in callmol-, and A 50 and ACp are expressed by cal mol-l-K-1, respectively. The lines intercept close to the values characteristic of the Cro-nonspecific DNA association; AH = +4.4 kcal-mol-1 and ASo = 49 cal mol-l K-l, where ACp 0O. All AG' and ACp values form a more or less single correlation group with a slope of 17.1 K (Fig. 5c); this relationship is as follows:
-20
TAS
TAS
10l
5' -9 G
AG0
=
-9700 + 17.1 K
x
ACp,
[3]
where AG0 is expressed by cal-moli1. This relationship exists because the slopes of correlation in the AG0 - ACp plots are very close, 17.6 K and 19.7 K for groups I and II, respectively, due to compensatory contributions from AH and A S5 to AG0 and to ACp. Pairwise comparisons show that the variations in the values of the thermodynamic parameters are in general accord with our knowledge of the structure of the Cro-DNA complex (Table 1 and Fig. 4). For instance, (i) The removal of the
methyl
group of -2 T
(2 AT
(OR3) -*2 AU) has very
little effect on all thermodynamic parameters (Table 1, experiments 6 and 7; experiments 15 and 16), being consistent with the structural studies (2, 5), which suggest that this methyl group is not involved in any contact. (ii) Substitution of 2 TA for 2 AT (OR3) (Table 1, experiments 6 and 8) results in the changes: AAH = +7.1 kcal mol', -TAAS = -3.3 kcal mol-1, AAG' = +3.8 kcal mol-1, and AACp = +210 cal mol-l-K-1. Substitution of
Proc. Natl. Acad. Sci. USA 89 (1992)
Biochemistry: Takeda et A
= +5.0 kcal mohl1 (TAA So0 0). Binding of Cro,.m7 to DNA is improved when thymine is placed at the +2 position because this change creates a van der Waals contact. This association proceeds with an even more unfavorable enthalpy change, AAH = +3.2 kcal mol1, which is overcome by a large entropy change -TAAS' = -5.7 kcal-mol-1, resulting in AAG0 = -2.3 kcal'mol-1 and AACp = -60 cal mohl K-1 (experiments 15 and 17). The removal of this methyl group (experiments 17 and 18) reverses these effects, weakening the interaction by AAG0 = +1.8 kcal mol1 with AAH = -1.6 kcal mol-1 and -TAAS5 = +3.3 kcal mol1. (iv) Substitution of 4 GC for 4 CG (OR3) (experiments 6 and 12) breaks H bonds between -4 G and Lys-32, resulting in AAH = +2.3 kcal-mol-1, -TAA S = +0.9 kcal-mol-1, AAG' = +3.0 kcal mol-1, and AACp = +100 cal mol-lhK-1. The 4 AT substitution, while breaking H bonds, probably creates a van der Waals contact between the thymine methyl and the hydrophobic part of Lys-32, resulting in the changes of AAH = +5.0 kcal molh, -TAA S = -1.1 kcal mol1, and AAG' = +3.9 kcal-mol-1. (v) Removal of the single -5 thymine methyl group (experiments 6 and 14) eliminates a van der Waals contact, which results in AAGO = +1.6 kcal-mol-1, AAH = +1.3 kcal mol1, and TAAS'0 0.
101 -a 8F 0
E
6
0 co Jv
%foI
4 A
2
0
.-M
0 v
0
CD I
E #11
c 2UA
-10
V27-2GC0 0 2G
2GC
0
#1C
V27-2CG
V27
-12
0
* #4 4GC
I
V27-2AU *02-2UA 4AT
2TA
14p
#5
0 V27-2TA
OR1 0 161 0R3
A
-400
-300
8183
/5AU
-200
-100
0
ACp (cal/mol deg) FIG. 5. Correlations between AHand ACp (a), between AS0 and ACp (b), and between AG' and ACp (c) seen for Cro-DNA associ-
ation reactions. Data are from Table 1. Closed symbols denote associations with wild-type Cro, and open symbols denote associations with mutant Cro,.j27.
2 UA for 2 AT (OR3) (experiments 6 and 9) results in AAH = +4.9 kcal moli1, -TAAS0 = +1.1 kcal mol-1, AAlG' = +5.8 kcal'mol-1, and AACp = +320 cal-molhlK-1. All of these changes in the thermodynamic values are consistent with the picture that the 2 TA substitution, while removing H bonds between Gln-27 and + 2 adenine, creates van der Waals contacts between the +2 thymine methyl group and Asn-31 and/or Gln-27. Removal of this methyl group decreases the stability by 2 kcal mol-1. Associations of Cro with OR3.2GC and OR3.2CG are weak (experiments 10 and 11) because, like the Cro-0R3.2UA association, they lack the H bonds and van der Waals contacts. (iii) The specificity mutant protein, CrovW27, cannot form H bonds to the + 2 adenine and binds poorly to OR3. The reduction of A A G° = +4.4 kcal mol-' (experiments 6 and 15) is due primarily to the more positive enthalpy change AAH
DISCUSSION The results of Fig. 3 Left show that the nonspecific Cro-DNA association is entropy-driven. This result confirms previous conclusions (15-22), drawn from measurements of the van't Hoff AH, that many protein-DNA associations are entropydriven. In protein-DNA association long-range electrostatic forces bring protein and DNA into proximity, and charged groups of the protein displace cations and water molecules from DNA. This process is accompanied by a large positive entropy change (15-17, 21, 22). Analysis of the ionic-strength dependence of nonspecific Cro-DNA association (23) by an electrostatic model (21, 22) suggests the release of about nine univalent cations, and chemical protection studies (24) indicate 10 lysine residues interacting with DNA, 8 of them with the phosphate backbone. Because of marked ionic strength dependency, it has been postulated that nonspecific DNA association is primarily electrostatic in nature (15-17, 21-27). This view is supported because we have found that the ratio A S0/A G' = 0.005 for nonspecific Cro-DNA association at 150C is very close to the value of (d In D/dT) = 0.0046 (where D is the dielectric constant of water) predicted for A S0/AG' by the simple electrostatic theories of ion hydration (Born) and Bjerrum's theory of ion association (28). The observed A Cp 0 for the nonspecific association indicates very little perturbation of the enthalpic states of the system (29) and is consonant with a very "loose" complex held together by long-range electrostatic forces. The specific Cro-DNA complex is formed with the further displacement of water molecules from the protein-DNA interface and the formation of the specific amino acid-nucleic acid base contacts. This process is accompanied by further positive changes in entropy and negative values of A Cp (Fig. 3 Right). The negative ACp indicates a narrowing of the enthalpic states of the system (29). In common with many ligand binding and association processes of proteins (29-32), a part of the observed negative A Cp would be contributed by the "tightening" of the structure as a result of constraints in the motion of DNA and protein in the specific complex. Changes in A Cp are characteristic of hydrophobic effects (29-37). We asked whether the negative A Cp values seen for the specific Cro-DNA associations originate mainly from =
hydrophobic effects. Before examining this hypothesis, we recall a few key observations concerning ACp and hydrophobic effects. For dissolution of a variety of hydrophobic
8184
Biochemistry: Takeda et al.
compounds in water, Sturtevant (30) observed that ACp values are accompanied by commensurate AS' values, and the ratio A S/ACp has a constant value of -0.26 at 250C. More recently, Murphy et al. (35) showed that the ratio A S0/ACp for denaturation of proteins has a similar constant value. Then, Spolar et al. (36) showed that the ratio between ACp and the change in water-accessible nonpolar surface area (AAnp) is identical for the transfer of nonpolar solutes from water to the pure liquid phase and for the folding of small globular proteins. Our current results (Fig. Sb) show that the thermodynamic behavior of Cro-DNA associations is somewhat similar to these well-studied cases in that the ratio A S/A Cp is constant but quite different in that there are two values of this ratio in Cro-DNA associations and that the values are much smaller and more positive-i.e., -0.03 and -0.14 at 150C (estimates at 250C are +0.02 and -0.08, respectively). These results suggest that Cro protein-DNA associations share some similar thermodynamic properties with protein folding, but their overall energetics are quite different. This conclusion is further supported by the fact that, whereas AG0 correlates to ACp with a coefficient of 80 K in protein folding (36), AG' correlates to ACp with a coefficient of 17 K in the specific Cro-DNA association (see above and Fig. Sc). A likely reason for these differences is that the protein-DNA interface is more polar and more hydrated than the interior of a folded protein. By analogy with hydrocarbon transfer and protein folding, Ha et al. (20) recently proposed that protein-DNA associations are stabilized by the large hydrophobic free energy. Thermodynamic data on Cro-DNA associations do not support this proposal. As described above, only limited similarity exists between protein-DNA association and protein folding, and their overall energetics are quite different. In Cro-DNA association ACp is tightly coupled with AG' of specific binding (see Fig. Sc), and H bonds, van der Waals contacts, and hydrophobic effects appear to all contribute directly to ACp, such that breakage of any of these interactions markedly affects both ACp and AG0 (see Results and Table 1). The AH-ACp and A S°-ACp plots revealed two types of thermodynamic behavior for the specific Cro-DNA associations that were not evident from the values of AG0 and A Cp (Fig. 5). One group of association, which includes most wild-type Cro associations, is characterized by more favorable AH and A S0 than for nonspecific DNA association. The second group of association, which includes three wild-type Cro associations and all CrowJ27 associations examined, is characterized by less favorable AH than in the nonspecific association that is offset by a positive A S°. Thus group I and group II associations are stabilized by different enthalpic and entropic contributions, and our results indicate that specific complexes with given affinity can be created by two different combinations ofHand S contributions. We suggest that these thermodynamically distinct binding modes reflect two distinct conformational subclasses in the structures of specific Cro-DNA complexes. It is noted that a single-base-pair or a single-amino acid change can switch the thermodynamic behavior from one group to the other. Takeda et al. (13) reported that the AG0 values are mostly additive for specific Cro-DNA association. Additivity of AG depends on uniformity of conformation. In retrospect, the experiments that led to this conclusion included only mutants that give rise to group I associations and none that give rise to group II associations. It will be interesting to test whether AG values are additive or not when the mutations that give rise to group I and II associations are combined. Comparison of the three-dimensional structures of group I and II associations will also
be very
interesting.
Proc. Nail. Acad. Sci. USA 89 (1992) We are deeply indebted to Dr. Robert L. Berger for use of the calorimeter (now available from Commonwealth Technology, Alexandria, VA). We thank Miss Nancy Seaton for technical assistance. This research has been supported, at least in part, by the National Cancer Institute, Department of Health and Human Services, under Contract NO1-CO-74102 with Program Resources, Inc.
1. Anderson, W. F., Ohlendorf, D. H., Takeda, Y. & Matthews, B. W. (1981) Nature (London) 290, 754-758. 2. Ohlendorf, D. H., Anderson, W. F., Fisher, R. G., Takeda, Y. & Matthews, B. W. (1982) Nature (London) 298, 718-723. 3. Takeda, Y., Ohlendorf, D. H., Anderson, W. F. & Matthews, B. W. (1983) Science 221, 1020-1026. 4. Brennan, R. G. & Matthews, B. W. (1989) J. Biol. Chem. 264, 1903-1906. 5. Brennan, R. G., Roderick, S. L., Takeda, Y. & Matthews, B. W. (1990) Proc. Natl. Acad. Sci. USA 87, 8165-8169. 6. Aggarwal, A. K., Rodgers, D., Drottar, M., Ptashne, M. & Harrison, S. C. (1988) Science 242, 899-907. 7. Mondragon, A. & Harrison, S. C. (1991) J. Mol. Biol. 219, 321-334. 8. Jordan, S. R. & Pabo, C. 0. (1988) Science 242, 893-899. 9. Otwinowski, R. W., Schevitz, R. W., Zhang, R.-G., Joachnk, A., Marmorstein, R. Q., Luisi, B. F. & Sigler, P. B. (1988) Nature (London) 335, 321-329. 10. Steitz, T. A. (1990) Q. Rev. Biophys. 23, 205-280. 11. Pabo, C. 0. & Sauer, R. T. (1984) Annu. Rev. Biochem. 53, 293-321. 12. Harrison, S. C. & Aggarwal, A. K. (1990) Annu. Rev. Biochem. 59, 933-969. 13. Takeda, Y., Sarai, A. & Rivera, V. M. (1989) Proc. Natl. Acad. Sci. USA 86, 439-443. 14. Mudd, C. P. & Berger, R. L. (1988) J. Biochem. Biophys. Methods 17, 171-192. 15. Riggs, A. D., Bourgeois, S. & Cohn, M. (1970) J. Mol. Biol. 53, 401-417. 16. Revzin, A. & von Hippel, P. H. (1977) Biochemistry 16, 47694776. 17. deHaseth, P. L., Lohman, T. M. & Record, M. T., Jr. (1977) Biochemistry 16, 4783-4790. 18. Whitson, P. A., Olson, J. S. & Matthews, K. S. (1986) Biochemistry 25, 3852-3858. 19. Vershon, A. K., Liao, S.-M., McClure, W. R. & Sauer, R. T. (1987) J. Mol. Biol. 195, 311-322. 20. Ha, J.-H., Spolar, R. S. & Record, M. T., Jr. (1989) J. Mol. Biol. 209, 801-816. 21. Manning, G. S. (1978) Q. Rev. Biophys. 11, 179-246. 22. Record, M. T., Jr., Anderson, C. F. & Lohman, T. M. (1978) Q. Rev. Biophys. 11, 103-178. 23. Boschelli, F. (1982) J. Mol. Biol. 162, 267-287. 24. Takeda, Y., Kim, J. G., Caday, C. G., Steers, E., Jr., Ohlendorf, D. H., Anderson, W. F. & Matthews, B. W. (1986) J. Biol. Chem. 261, 8608-8616. 25. Lin, S. Y. & Riggs, A. D. (1975) Cell 4, 107-111. 26. von Hippel, P. H. (1979) in Biological Regulation and Development, ed. Goldberger, R. F. (Plenum, New York), pp. 279347. 27. Matthews, J. B. & Ohlendorf, D. H. (1985) J. Biol. Chem. 260, 5860-5862. 28. King, E. J. (1965) Acid-Base Equilibria (Macmillan, New York), pp. 137-217. 29. Eftink, M. & Biltonen, R. L. (1980) in Biological Microcalorimetry, ed. Beezer, A. E. (Academic, London), pp. 343-412. 30. Sturtevant, J. M. (1977) Proc. Natl. Acad. Sci. USA 74, 2236-2240. 31. Ross, P. D. & Subramanian, S. (1981) Biochemistry 20, 30963102. 32. Hinz, H.-J. (1983) Annu. Rev. Biophys. Bioeng. 12, 285-317. 33. Edsall, J. T. (1935) J. Am. Chem. Soc. 57, 1506-1507. 34. Kauzmann, W. (1959) Adv. Protein Chem. 14, 1-63. 35. Murphy, K. P., Privalov, P. L. & Gill, S. J. (1990) Science 247, 559-561. 36. Spolar, R. S., Ha, J.-H. & Record, M. T., Jr. (1989) Proc. Natl. Acad. Sci. USA 86, 8382-8385. 37. Privalov, P. L. & Gill, S. J. (1988) Adv. Protein Chem. 39, 191-234.
