Theriogenology 83 (2015) 86–94

Contents lists available at ScienceDirect

Theriogenology journal homepage: www.theriojournal.com

Thyroid hormone inhibits the proliferation of piglet Sertoli cell via PI3K signaling pathway Yan Sun a, b, WeiRong Yang a, HongLin Luo c, XianZhong Wang a, ZhongQiong Chen a, b, JiaoJiao Zhang a, Yi Wang a, XiaoMin Li a, * a

College of Animal Science and Technology, Southwest University, Beibei, Chongqing, PR China ChongQing Animal Disease Prevention and Control Center, YuBei, ChongQing, PR China Guanxi Key Laboratory for Aquatic Genetic Breeding and Healthy Aquaculture, Guangxi Institute of Fisheries, Nanning, Guangxi, PR China

b c

a r t i c l e i n f o

a b s t r a c t

Article history: Received 8 January 2014 Received in revised form 5 August 2014 Accepted 5 August 2014

Accumulating researches show that thyroid hormone (TH) inhibits Sertoli cells (SCs) proliferation and stimulates their functional maturation in prepubertal rat testis, confirming that TH plays a key role in testicular development. However, the mechanism under the T3 regulation of piglet SC proliferation remains unclear. In the present study, in order to investigate the possible mechanism of T3 on the suppression of SC proliferation, the expression pattern of TRa1 and cell cycle–related molecules, effect of T3 on SC proliferation, and the role of phosphoinositide 3-kinase (PI3K)/Akt signaling pathway on the T3mediated SC proliferation in piglet testis were explored. Our results demonstrated that TRa1 was expressed in all tested stages of SCs and decreased along with the ages. T3 inhibited the proliferation of SCs in a time- and dose-dependent manner, and T3 treatment downregulated the expressions of cell cycling molecules, such as cyclinA2, cyclinD1, cyclinE1, PCNA, and Skp2, but upregulated the p27 expression in SCs. Most importantly, the suppressive effects of T3 on SC proliferation seemed dependent on the inhibition of PI3K/ Akt signaling pathway, and pre-stimulation of PI3K could enhance such suppressive effects. Together, our findings demonstrate that TH inhibits the proliferation of piglet SCs via the suppression of PI3K/Akt signaling pathway. Ó 2015 Elsevier Inc. All rights reserved.

Keywords: Piglet Thyroid hormone Sertoli cell PI3K pathway

1. Introduction Sertoli cells (SCs) are important in spermatogenesis [1,2]. They also establish cytoplasmic crypts around germ cells and supply nutrients, growth factors, and a stable microenvironment. Besides, SCs play an essential role on immunological responses by the establishment of the blood–testis barrier. It is known that the number of SCs affects the efficiency of spermatogenesis, because one SC can only support a limited number of germ cells. In Yan S, WeiRong Y, and Honglin LUO have contributed equally to the work presented. * Corresponding author. Tel.: þ86 15823987891; fax: þ86 2368251196. E-mail address: [email protected] (X. Li). 0093-691X/$ – see front matter Ó 2015 Elsevier Inc. All rights reserved. http://dx.doi.org/10.1016/j.theriogenology.2014.08.003

addition, the number of SCs determines the size of testis and rate of sperm production in adult male, and hence the reproductive capacity [3–9]. It is believed that SCs proliferate at birth, decrease rapidly during the neonatal period, and stop completely at about 15 and 20 days after birth in mice and rat [5,10–13]. However, in pigs, SCs exert distinct proliferation phases. They first proliferate between birth and 1 month old and their numbers increase up to about sixfolds. Then they proliferate once again at 3 or 4 month old with double numbers to the first proliferation, and this process ceases before puberty [14]. When SCs cease proliferation and enter into differentiation, the establishment of the blood–testis barrier develops [15]. However, researches showed that proliferation and differentiation of SCs may overlap in time [16,17], suggesting that early

Y. Sun et al. / Theriogenology 83 (2015) 86–94

perturbation of SC proliferation and/or differentiation may have long-term effects on male reproduction. Besides, prepubertal SC proliferation was shown to be closely related to FSH in several species [18], but some researches showed that the duration of SC proliferation may be strongly affected by thyroid hormones (THs) [19–21]. For example, during the neonatal period in rodents, high levels of serum 3, 30 ,5-triiodothyronine (T3) result in fewer adult SCs and smaller testes [21,22]. In contrast, in adulthood, low levels of T3 lead to an increase in SC numbers, testicular size, and sperm production [12,23]. Similar effects of TH have been observed in humans. For instance, neonatal hypothyroidism leads to larger testes in prepubertal boys, whereas hyperthyroidism is associated with smaller testicular size [24,25]. Similar results to those in rodents and humans were also obtained in bull calves [26]. However, in pigs, hypothyroidism has no effect on the initiation of spermatogenesis or pubertal maturation [6]. Further researches exhibited that T3 can directly inhibit proliferation and induce neonatal rat SC differentiation [22], which upregulate cyclin-dependent kinase inhibitors [27], resulting in the elimination of mitogenic effects of FSH [19]. The effects of THs are mainly mediated by T3. T3 binds the specific intracellular thyroid hormone receptors (THRs or TRs), which function as a ligand-dependent transcription factor and control the expression of target genes [28]. Thyroid receptors are encoded by two genes, Thra and Thrb. Till date, nine peptide isoforms alternatively spliced from both genes have been isolated. Three of them have been proved to be functional: TRa1, TRb1, and TRb2. Researches showed that TRa1 mRNA and protein are abundant in SCs [29,30]. Although both TRa2 and TRa3 mRNA are expressed in SCs, they do not mediate T3 signaling [31,32]. Literatures also indicate that TRb1 could be involved in SC development, but this area still keeps controversial [31,33–35]. Therefore, signaling through TRa1 may be the normal mechanism by which T3 promotes normal SC maturation [27]. A mount of T3-responsive genes have been uncovered [36,37], and evidences have been found that the biological effects of THs are mediated not only by direct transcriptional control but also by the regulation of cell signaling cascades [38]. Previous research has been shown that THs activate extracellular signal–regulated kinase-1/2 via the integrin aVb3 receptor, resulting in the regulation of various cellular events, such as protein trafficking and proliferation. In addition, research has been reported that TH-mediated actin polymerization via phosphorylation plays an essential role in the migration of astrocytes and granular neurons [39]. None of these actions were considered to involve classical TRs. However, Cao et al. [40] reported that TR-mediated nongenomic action of T3, through which the phosphoinositide 3-kinase (PI3K)/Akt pathway was activated in primary cultured human skin fibroblasts. This action of T3 has also been found in various cell types and mouse models [41–46]. Further study showed that T3 activates PI3K/Akt through Src in neuronal cells [47]. Therefore, TRa1 may mediate T3-induced PI3K activation. However, this has not yet been investigated in piglet SCs. Although a number of studies demonstrated that THs can regulate the SC proliferation, the mechanisms involved in this process in piglet SCs remain unclear. In the present

87

study, we aimed to investigate the role of TH in the regulation of piglet SC proliferation and the possible role of PI3K/Akt signaling pathway during such biological process. 2. Materials and methods 2.1. Antibodies and reagents The cell culture media DMEM/F-12 (cat no. C113305008), fetal bovine serum (cat no. 10099141), newborn bovine serum (cat no. 16010159), and trypsin (cat no. 25200056) were purchased from Gibco BRL Company. The 3, 30 , 5triiodothyronine (synthetic T3, cat no. T2877) and porcine FSH (cat no. F2293) were acquired from Sigma–Aldrich. The anti-PCNA (cat no. bs-0754R), anti-Skp2 (cat no. bs-1096R), anti-PI3K (p85a subunit, cat no. bs-0128R), anti-phosphoPI3K (Tyr467, cat no. bs-3332R), anti-CDKN1B/p27kip1 (cat no. bs-0742R), anti-phospho-CDKN1B/p27kip1 (cat no. bs5227R), anti-TRa1(cat no. bs-6221R), and anti-b-actin antibodies were provided by Bioss Biotech. The HRP-labeled goat anti-rabbit IgG (H þ L, cat no. A0208), cell counting kit-8 (CCK-8, cat no. C0038), and Akt and phosphor-Akt (Ser473, cat no. AA326) were obtained from Beyotime Institute Biotech. The 740 Y-P (cell permeable phosphopeptide activator of PI3K, cat no. 1983) was supplied by Tocris Bioscience. RNAprep pure cell kit (cat no. DP430) was obtained from Tiangen Biotech. The cDNA synthesis kit (cat no. 170-8891) and SYBR green supermix (cat no. 1725261) were supplied by Bio-Rad Laboratories. 2.2. Animals Three-weeks-old native healthy boar was used for SCs isolations and cell cultures. All animal studies were conducted in accordance with the guidelines for the care and use of laboratory animals issued by the Institution Committee on Animal Care and Use of the Ministry of Health of China. All the protocols had the approval of the Institutional Committee on Animal Care and Use (number: 2012-08-11). 2.3. Primary SC isolation and in vitro culture Sertoli cells from 3-week-old native healthy boar were isolated as previously described protocol with modifications [48,49]. Briefly, each time, five boars were used to obtain the testes, and the testes were isolated from the piglet scrotum in a sterile condition after the anesthetization with 1% sodium pentobarbital for 35 to 40 mg/kg via intravenous injection. Then the individual testis was washed three times with precold (4  C) PBS (with 20,000 IU/mL mycillin). The testis was cut into small pieces and homogenized after the removal of its out membrane. The tissue was then suspended in PBS and centrifuged (1000 g for 5 minutes) to remove the red blood cells. The sediment was then digested by incubation with 10-folds volume of collagenase IV (0.03 g/mL) in a thermostatic shaker (32  C, 70 vibrations/minute) for 40 minutes. The suspensions were then centrifuged (1000 g for 5 minutes) and the sediment was incubated with 10-folds volume of trypsin (0.0025 g/mL) for the second digestion (32  C, 70 vibrations/minute). The newborn bovine serum was added into

88

Y. Sun et al. / Theriogenology 83 (2015) 86–94

the sediment to end the digestion followed by centrifuge of 1000 g for 5 minutes. Then the mixture was filtered through 80 and 400 mesh stainless steel sieve successively. Cells were suspended in DMEM/F-12 with 10% fetal bovine serum after a centrifuge of 1000 g for 5 minutes and cultured at 32  C in a 5% CO2 incubator. Twenty-four hours later, the unattached germ cells were removed by replacement of the identical medium and the attached cells were treated with hypotonic solution (20 mM Tris-HCl, pH 7.0) for 3 minutes at room temperature for the elimination of residual germ cells. 2.4. Sertoli cell proliferation assay The proliferative activity of SC was measured as previously described with modifications [50]. Briefly, 1  106 cells per well were cultured in triplicate with FSH (1 mg/mL), diluted T3 (0.1, 1, 10, 100, and 1000 nM), and DMEM/F-12 for 12, 24, 36, and 48 hours. Meanwhile, to determine the time affects on the proliferation of SCs, both T3 (100 nM) and FSH (1 mg/mL) were added into medium and cultured for 12, 24, 36, and 48 hours, respectively. To further investigate whether PI3K/Akt signaling pathway was involved in the process that T3 regulates SC proliferation, 740Y-P (25 mg/mL), a cellpermeable phosphopeptide activator of PI3K, was added into the medium and cultured for 1 hour followed by the addition of T3 (100 nM). Cell proliferation was analyzed by using CCK-8 kit according to the manufacturer’s instructions. Briefly, 1  105 SCs with 100 mL DMEM/F-12 per well were added into 96-wells plate and incubated at 32  C, 5% CO2 for 24 hours followed by the addition of 10 mL CCK-8 dye to each well for additional 2 hours incubation. Plates were read at 450 nm for proliferation. 2.5. Western blotting Western blotting was performed as previously described with modifications [50]. Sertoli cells with treatment of FSH, T3, and 740 Y-P were separately harvested and centrifuged at 10,000 g for 5 minutes. Sediments were lysed with 200 mL cold lysis buffer (1% Triton-100, Tris-HCl (pH 8.0) 50 mmol/L, NaCl 150 mmol/L, PMSF 0.1 mmol/L (100 mg/mL), Pepstatin 1 mmol/L (0.7 mg/mL), Leupeptin 0.5 mg/mL, Aprotinin 0.3 mmol/L (1 mg/mL)) for 40 minutes. Cells were centrifuged at 10,000 g for 10 minutes and the supernatant protein was harvested for Western blotting. The protein concentration was measured by using BCA protein assay kit (Pierce, FL, USA). The proteins were separated on 12% SDS-PAGE and transferred onto polyvinylidene difluoride membrane. Then the membranes were washed two times with 15 mL 1  TBS and then blocked in 27 mL 5% skimmed milk TBS for 2 hours followed by two times wash for 20 minutes with 20 mL 1  TBSTT (4 mL Triton, 1 mL Tween into 1 L TBS). The membranes were incubated for 1 hour in 10 mL anti-PCNA (1:300), anti-Skp2 (1:300), anti-PI3K (p85a subunit) (1:300), anti-phosphoPI3K (Tyr467) (1:300), anti-CDKN1B/p27kip1 (1:300), anti-phospho-CDKN1B/p27kip1 (1:300), anti-TRa1 (1:300), anti-Akt (1:1000), phosphor-Akt (1:1000), and anti-b-actin antibody (1:1000) separately followed by two times wash with 20 mL 1  TBSTT for 20 minutes. Then the membranes were incubated for 1 hour with 8 mL goat anti-pig IgG HRP

(1:1000) at room temperature for 2 hours followed by five times wash with 20 mL 1  TBSTT. The enhanced chemiluminescence detection kit (PromoCell, Germany) was used to obtain the image on the gel image system (Bio-Rad). 2.6. Relative quantification of genes To measure the capacity of T3 on modulation of gene expression, the Skp2, p27, cyclinA2, PCNA, cyclinD1, and cyclinE1 were quantified by real-time polymerase chain reaction (PCR) method as previously described with modifications [51]. Sertoli cells were treated as in Section 2.4 and were harvested at the end of treatment, respectively. Total RNA was extracted by using RNAprep pure cell kit according to manufacturer’s instructions. Approximate 1 mg of total RNA was used to synthesize cDNA by using M-MLV reverse transcriptase (Sigma–Aldrich, cat no. M1302) under the following conditions: 5 minutes at 25  C, 30 minutes at 42  C, 5 minutes at 85  C, hold at 4  C (optional). Then, relative quantification of the genes was determined by using the Light Cycler (Roche Molecular Biochemicals). b-Actin was used to normalize the expression of test genes. A reaction of 20 mL containing 1 mL cDNA, 0.5 mM primers, 10 mL SYBR green supermix, and RNase/DNase-free water 8 mL was carried out under the following conditions: denaturation at 95  C for 2 minutes, annealing at 54 C to 56  C for 30 seconds, 40 to 45 cycles. Primers used for light cycler PCR analysis are listed in Table 1. 2.7. Statistical analysis To evaluate the statistical differences between groups, one-way ANOVA test method and Tukey’s post hoc test were applied by using SPSS 16.0 software. P value less than 0.05/0.01 refers the significant difference. The mean  SD is shown, unless otherwise stated. 3. Results 3.1. Effects of TH (T3) on proliferation of piglet SCs To address the time effects of T3 on proliferation of SCs, cells were incubated with T3 (100 nM) and FSH Table 1 Primers used for real-time PCR analysis. Primers

Sequence (50 –30 )

Annealing temperature ( C)

b-Actin

F: ACTGCCGAGCGTGAGATT R: TGAAGGAGGGCTGGAACA F: CTTCTGTCCCAGTGCTCC R: CCAGTAAAGTTTCGGGTATT F: TGCCTTTAATTGGGTCTCAG R: GTGCTTTATACGGGTTGTCC F: TCCTTCTTTCTTCCACCTGTA R: CCCTTAGCGTAATGATGTCTT F: CAGAAGTAGCGGAGTTT R: AAGCGTTTCCAGCGTAT F: AACACGGCTCACGCTTAC R: CCAGACCCTCAGACTTGC F: CACAGTATCCCCAGCAAATCTT R: TACAAGGCAGAAGCAGCAAGTA

54

Skp2 p27 PCNA cyclinA2 cyclinD1 cyclinE1

Abbreviation: PCR, polymerase chain reaction.

54 55 56 54 55 55

Y. Sun et al. / Theriogenology 83 (2015) 86–94

89

Fig. 1. Proliferation of Sertoli cells (SCs) with treatment of T3 in vitro. To determine the time affects on the proliferation of SCs, both T3 (100 nM) and FSH (1 mg/ mL) were added to the medium and cultured for 12, 24, 36, and 48 h, respectively. Sertoli cells were cultured in triplicate with FSH (1 mg/mL), 10-fold diluted T3 (0.1, 1, 10, 100, and 1000 nM) and DMEM/F-12 for 12, 24, 36, and 48 h. (A) Time-dependent effects of FSH and T3 on the proliferation of SCs. Proliferation of SCs after 24 h treatment with both FSH (1 mg/mL) and T3 (100 nM) exhibited weaker proliferative activity compared with that at 12, 36, and 48 h, respectively. (B) Percentage of SCs treated with FSH (1 mg/mL) and T3 (0.1, 1, 10, 100, and 1000 nM) in vitro. Data showed the proliferation of SCs with treatment of FSH was the most strongest one compared with T3 and the combination of T3 and FSH. T3 alone inhibited the proliferation of SCs compared with control. Statistical significances were determined by one-way ANOVA together with Tukey’s post hoc test. P < 0.05/0.01 refers the significant difference and is marked as asterisk. P values were not reported otherwise.

(1 mg/mL) for 12, 24, 36, and 48 hours, respectively. Then, to measure the impacts of T3 on the proliferation of piglet SCs, cells were treated with 10-fold diluted T3 (0.1, 1, 10, 100, and 1000 nM) and FSH (1 mg/mL) for 12, 24, 36, and 48 hours in vitro. Proliferation analysis showed that when SCs were incubated with T3 (100 nM) and FSH (1 mg/mL) at different time points in vitro, the treatment showed great impacts on SC proliferation at time points of 12, 36, and 48 hours after treatment, showing significantly augments of proliferation compared with the control. While the treatment showed no impact on the proliferation at the point of 24 hours after treatment (Fig. 1A). Sertoli cells with treatment of FSH demonstrated significant increase of proliferation compared with the SCs cultured in medium (the control group). In contrast, SCs with treatment of 100 nM T3 showed suppressive activity, with significant lower percentage of proliferation in comparison to the control. However, this suppression was conversed by the additional treatment of FSH on the basis of T3 incubation (with 10 times increased concentration, respectively), and these combined treatments made the percentages of SC proliferations significantly increased compared with the control (Fig. 1B).

3.3. Role of T3 on cell cycle development of SCs Next to determine the role of T3 on cell cycle development of SCs, the protein levels of PCNA, p27, and Skp2 and the mRNA levels of PCNA, p27, Skp2, and cyclins (cyclinA2, cyclinD1, and cyclinE1, which are involved in the transition of G0/G1 to S phase of cell development) were measured by Western blotting and real-time PCR after treatment of FSH (1 mg/mL) and/or T3 (100 nM) for 24 hours. Data showed that the protein and mRNA levels of PCNA and Skp2 were upregulated by treatment of FSH, whereas the levels were downregulated by treatment of T3. The protein and mRNA levels of p27 exhibited different patterns to that of PCNA and Skp2, showing suppressive effects with the treatment of FSH and active effects with treatment of T3. When SCs were treated with both FSH and T3, no changes were found on the expression of PCNA and p27 with comparison to the control, whereas the protein level of Skp2 was downregulated compared with the control (Fig. 3A–C). The mRNA expressions of cyclins displayed that treatment of T3 resulted in a significant downregulation of cyclinA2, cyclinD1, and cyclinE1, whereas treatment of FSH led to a significant upregulation of these cyclins. The combined treatment of FSH and T3 demonstrated upregulation effects on cyclinA2 and cyclinE1, but not cyclinD1 (Fig. 3C).

3.2. Expression pattern of THR (TRa1) in pig testis To evaluate the developmental expression pattern of TRa1 in piglet testis, Western blotting and real-time quantitative RCR were applied to analyze the levels of TRa1 protein and mRNA during the tested stages. Data showed TRa1 expressed in all tested developmental stages in the testis of piglet younger than 1 year old (Fig. 2A). Along with the development of testis, the TRa1 protein levels on 3 weeks, 5 weeks, and 12 months were significantly declined compared with the stage of newborn (0 week), and the mRNA levels of TRa1 in all tested stages showed similar trend to the levels of TRa1 protein (Fig. 2B, C).

3.4. Regulative role of T3 on the PI3K/Akt signaling in SC proliferation process In order to determine the putative mechanism of PI3K/ Akt signaling in the SC proliferation in response to T3 treatment, we analyzed the phosphorylation of PI3K and Akt by Western blotting method. As shown (Fig. 4A, B), the phosphorylation levels of PI3K and Akt were significantly downregulated in response to T3 treatment. FSH alone and combination of FSH and T3 resulted in significant upregulation of PI3K/Akt phosphorylation compared with the control. In order to confirm that if PI3K/Akt signaling was involved in the process of T3-mediated SC proliferation, SCs

90

Y. Sun et al. / Theriogenology 83 (2015) 86–94

Fig. 2. Expression pattern of TRa1 in different developmental stages of pig testis. To determine the protein and mRNA levels of TRa1 in newborn (0 weeks), postnatal (3 and 5 week old), and adult (12 month old) in pig testis, the Western blotting and real-time PCR were carried out after the extractions of protein and mRNA from the testis in newborn, postnatal, and adult pig, respectively. Both protein and mRNA levels in the pig testis younger than 12 months decreased with ages. (A) Western blotting pattern of TRa1 protein on different developmental stages of pig testis. (B) Gray value of the results of Western blotting. (C) The mRNA levels of TRa1 on different developmental stages of pig testis. Each group was compared with control. Statistical significances were determined by one-way ANOVA together with Tukey’s post hoc test. P < 0.05/0.01 refers the significant difference and is marked as asterisk. P values were not reported otherwise.

were treated with 740Y-P followed by addition of T3 1 hour later, then the proliferation of SCs, phosphorylation of Akt, and protein and mRNA levels of PCNA, Skp2, and p27 were measured. We found that 740Y-P alone significantly elicited the proliferation of SCs compared with the control,

whereas T3 and combination of T3 and 740Y-P significantly suppressed the proliferation of SCs, although significance of proliferations was also found between treatment of T3 and combination of T3 and 740Y-P (Fig. 4C). Both protein and mRNA levels of PCNA and Skp2 were upregulated by the

Fig. 3. Expression pattern of p27, PCNA, Skp2, cyclinA2, cyclinD1, and cyclinE1 in SCs with treatment of FSH and/or T3. To determine the protein and mRNA levels of p27, PCNA, Skp2, cyclinA2, cyclinD1, and cyclinE1 (the mRNA level was oly detected in the last three proteins) were measured in the SCs with treatment of FSH (1 mg/mL) and/or T3 (100 nM) for 24 h in vitro. Data showed that T3 treatment resulted in a significant decrease of PCNA, Skp2, cyclinA2, cyclinD1, and cyclinE1 on both protein and mRNA levels, whereas it upregulated the mRNA and protein levels of p27. (A) Western blotting pattern of p27, PCNA, and Skp2 in the SCs with treatment of FSH (1 mg/mL) and/or T3 (100 nM) for 24 hours in vitro. (B) Gray value of the results of Western blotting. (C) The mRNA levels of p27, PCNA, Skp2, cyclinA2, cyclinD1, and cyclinE1 in the SCs with treatment of FSH (1 mg/mL) and/or T3 (100 nM) for 24 h in vitro. Each group was compared with control. Statistical significances were determined by one-way ANOVA together with Tukey’s post hoc test. P < 0.05/0.01 refers the significant difference and is marked as asterisk. P values were not reported otherwise. SC, Sertoli cell.

Y. Sun et al. / Theriogenology 83 (2015) 86–94

91

Fig. 4. T3 inhibits the proliferation of piglet SCs via PI3K signaling pathway. To determine whether T3 plays a role on the PI3K signaling pathway in the SCs, the SCs were treated with FSH (1 mg/mL) and/or T3 (100 nM), or the PI3K activator of 740 Y-P (25 mg/mL) alone, or combination of T3 and 740 Y-P for 24 h in vitro. Western blotting and real-time PCR were carried out after the extractions of protein and mRNA. (A, B) Phosphorylation levels of PI3K and Akt in the SCs with treatment of T3 decreased. (C) Proliferative activity of SCs with treatment of 740Y-P increased significantly compared with T3 treatment. (D–F) Protein and mRNA levels of cyclinA2, cyclinD1, cyclinE1, PCNA, and Skp2 in the SCs treated with 740Y-P upregulated, whereas that of p27 downregulated significantly compared with control. Data suggest that T3 inhibited the proliferation of SCs via PI3K/Akt signaling pathway. Each group was compared with control. Statistical significances were determined by one-way ANOVA together with Tukey’s post hoc test. P < 0.05/0.01 refers the significant difference and is marked as asterisk. P values were not reported otherwise. SC, Sertoli cell.

treatment of 740Y-P, whereas p27 was downregulated when SCs were exposed to 740Y-P. Besides, 740Y-P treatment increased the level of Akt phosphorylation (Fig. 4D). We also found that protein expressions of p27, PCNA, and Skp2 were significantly suppressed with treatment of either T3 or combination of T3 and 740Y-P. However, this inhibition was reversed by the treatment of 740Y-P, the activator of PI3K signaling pathway. Similar trend was found in p-Akt and Akt proteins. The mRNA levels of cyclinA2, cyclinD1, cyclinE1, p27, PCNA, and Skp2 also showed similar pattern to the protein expression of p27, PCNA, and Skp2, highlighting the suppressive role of T3 on the regulation of PI3K signaling pathway (Fig. 4D–F). 4. Discussion In the current study, we demonstrate a critical role of T3 on the inhibition of piglet SC proliferation in vitro. Our researches highlight the suppressive activity of T3 on SC proliferation via PI3K signaling pathway. It is known that TH executes its function via its specific receptors. A number of researches have shown that the THRs TRa and TRb are generally expressed in testis, especially TRa1 is involved with SC development [30,52]. As a marker, the change of TRA mRNA level may reflect the maturation of testis. In rat, TRa1 is abundantly expressed in neonatal period. During this stage, the SCs proliferate greatly and then fall to a basal level after differentiation of SCs. In addition, researches have shown that TH can limit the proliferation of postnatal SCs by activation of TRa1 in vivo [53]. In the current study, the TRa1 was found to be

expressed in piglet testis between newborn and 1 year old on protein and mRNA levels, demonstrating higher levels during the neonatal period, but gradually decreased to minimal level in the adulthood. This finding is consistent with the researches of Franca et al. [14], who first reported the longitudinal pattern of SC proliferative activity in pigs from birth to adulthood. Thyroid hormone is a crucial factor that regulates the development of organs, affecting the metabolism and other processes of adult animals. Previous studies demonstrated that TH can inhibit the proliferation of SCs but promote the differentiation of SCs in rat and mice [53–55]. In this study, potential roles of T3, alone or in combination with FSH, on the proliferation of SCs were investigated. Results demonstrated that T3 alone suppressed the proliferation of SCs, whereas FSH alone increased the proliferation of SCs. However, the proliferation of SCs was upregulated by combination of T3 and FSH treatment, suggesting opposite role of T3 and FSH on SCs proliferation in piglet. This finding is consistent with the previously reported researches in rat [56], humans [25], roosters [57], bull [26], and even zebrafish [58], suggesting the T3 effect on the developing testis is a critical process in mammalian and even nonmammalian species. Cell cycle process is regulated by cyclins and cyclindependent kinase (CDKs), which are regulated by cyclindependent kinase inhibitors (CDKIs). p27Kip1 is one of the CDKIs that control the G1/S transition in the cell cycle process. Previous studies indicated that p27Kip1 was involved in the T3-mediated SC proliferation in mice [59]. Knockout of p27Kip1 resulted in a double-sized testis in

92

Y. Sun et al. / Theriogenology 83 (2015) 86–94

mice compared with the wild mice [60]. Besides, number of SCs and daily sperm production were found increased in p27KO mice in comparison to control [19]. In the present study, we found that high levels of p27Kip1 in both mRNA and protein expressions were induced in the SCs with treatment of T3. This indicates that TH might force SCs to step out the cell cycle and further to cease the proliferation via the interaction with p27Kip1. However, this assumption was not investigated in the current study. Cyclins are activators of specific serine/threonine protein kinases, which can promote the cell cycle process. cyclinA2, one of the cyclins, is considered as S/G2-phase–specific gene. It has been reported to start the cells into G2 phase [61–63]. cyclinD1, which can bind to Cdc4-related kinase (CDK4), has been found to shorten G1 phase when overexpressed in rodent fibroblasts [64]. cyclinE1 is expressed during the G1 late phase and the whole S phase. It has been shown that cyclinE–CDK2 complex can initiate the transformation of G1 into S phase in cell development [65]. In the present study, we found that T3 treatment resulted in a significant downregulation of cyclinA2, cyclinD1, and cyclinE1, whereas treatment of FSH led to a significant upregulation of these cyclins. The combined treatment of FSH and T3 demonstrated upregulation effects on cyclinA2 and cyclinE1, but not cyclinD1. The mRNA levels of cyclinA2, cyclinD1, and cyclinE1 were significantly suppressed with treatment of T3. However, this inhibition was reversed by the treatment of 740YP, the activator of PI3K signaling pathway. These results suggested that T3 actually inhibited the expression of cyclins during SC proliferation; this indicate that T3 can make SCs to escape from cell cycling via the downregulation of cyclins in cells. Although this was out of the main concern in the present study, it is still an interesting academic point in the future work. Accumulating researches show that TH inhibits SCs proliferation and stimulates their functional maturation in prepubertal rat testis. The efficiency of spermatogenesis correlates with the total number of functional SCs that is established during prepubertal life [3]. These studies, together with the findings that TRs are present in human and rat testes from neonatal to adult life [52], confirm that TH plays a key role in testicular development. However, the mechanism under the T3 regulation of piglet SC proliferation remains unclear. Recent studies have suggested that this might be mediated by increased levels of expression of cyclin-dependent kinase inhibitors and/or connexin 43 [59,66]. However, other academic viewpoint considered that the PI3K/Akt signaling pathway might be involved in the development of SCs. For example, Cao et al. [40] have reported a novel TR-mediated nongenomic action of T3, through which the PI3K/Akt pathway was activated in primary cultured human skin fibroblasts. This action of T3 has also been reported by other groups in various cell types and mouse models [41–46]. However, it has not been reported in piglet SCs yet. In the present study, we indeed found that T3 regulates SC proliferation via the PI3K/Akt signaling pathway, showing that 740Y-P (the activator of PI3K signaling pathway) alone significantly elicited the proliferation of SCs, whereas T3 and combination of T3 and 740 Y-P significantly suppressed the proliferation of SCs.

Furthermore, protein expressions of p27, PCNA, and Skp2 were significantly suppressed with treatment of either T3 or combination of T3 and 740Y-P. However, this inhibition was reversed by the treatment of 740Y-P. Similar trend was found in p-Akt and Akt proteins. These findings highlight the suppressive role of T3 on the regulation of PI3K signaling pathway in SCs. We proposed that the mechanism under it might be as follows: T3 binds to its receptors in piglet SCs and results in the suppression of PI3K, which transfers signals to the downstream pathways via the signaling cascades. These process results in the upregulation of p27 and downregulation of the molecules that involved in cell cycling, such as cyclinA2, cyclinD1, cyclinE1, PCNA, and Skp2. As a consequence, SCs are elicited to step out of the cell cycling and initiate the follow-up differentiation process. However, this assumption was not yet proved in the present study. We considered it as an academic point, which is going to be studied in our future work. 4.1. Conclusion Taken together, our data demonstrated that TH inhibits the proliferation of piglet SCs via the suppression of PI3K/ Akt signaling pathway. Acknowledgments This work was supported by the National Natural Science Foundation of China (NSFC, grant number: 31101872) and the Fundamental Research Funds for the Central Universities special (FRFCU, China, grant number: XDJK2009Br036). We are grateful to Guangquan Yang and Lihui Tan for piglet testis sample collection. Competing interests The authors declare that there are no competing interests. Authors’ contributions: XML conceived, designed, and coordinated the study. YS participated in experiment design and performed the main experimental work. WRY performed part of the experimental work and drafted the article. LHL analyzed data, made graphs, provided crucial advice, and rewrote the article. XZW participated in data collection and analysis. ZQC collected testis materials and developed methodologies for the Western blotting. JJZ developed methodologies for cell proliferation and provided crucial reagents. YW performed part of the experimental work. All authors read and approved the article. References [1] Riera MF, Regueira M, Galardo MN, Pellizzari EH, Meroni SB, Cigorraga SB. Signal transduction pathways in FSH regulation of rat Sertoli cell proliferation. Am J Physiol Endocrinol Metab 2012;302: E914–23. [2] Luca G, Calvitti M, Mancuso F, Falabella G, Arato I, Bellucci C, et al. Reversal of experimental Laron syndrome by xenotransplantation of microencapsulated porcine Sertoli cells. J Control Release 2013;165: 75–81. [3] Orth JM, Gunsalus GL, Lamperti AA. Evidence from Sertoli celldepleted rats indicates that spermatid number in adults depends

Y. Sun et al. / Theriogenology 83 (2015) 86–94

[4]

[5] [6]

[7]

[8]

[9] [10]

[11]

[12]

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23]

[24]

[25] [26]

on numbers of Sertoli cells produced during perinatal development. Endocrinology 1988;122:787–94. Oluwole OA, Bartlewski PM, Hahnel A. Relationships of serum thyroid hormones and follicle-stimulating hormone concentrations to Sertoli cell differentiation during the first wave of spermatogenesis in euthyroid ram lambs. Reprod Biol 2013;13:150–60. Orth JM. Proliferation of Sertoli cells in fetal and postnatal rats: a quantitative autoradiographic study. Anat Rec 1982;203:485–92. Klobucar I, Kosec M, Cebulj-Kadunc N, Majdic G. Postnatal hypothyroidism does not affect prepubertal testis development in boars. Reprod Domest Anim 2003;38:193–8. Sharpe RM, McKinnell C, Kivlin C, Fisher JS. Proliferation and functional maturation of Sertoli cells, and their relevance to disorders of testis function in adulthood. Reproduction 2003;125:769–84. Johnston H, Baker PJ, Abel M, Charlton HM, Jackson G, Fleming L, et al. Regulation of Sertoli cell number and activity by folliclestimulating hormone and androgen during postnatal development in the mouse. Endocrinology 2004;145:318–29. Aponte PM, de Rooij DG, Bastidas P. Testicular development in Brahman bulls. Theriogenology 2005;64:1440–55. Steinberger A, Steinberger E. Replication pattern of Sertoli cells in maturing rat testis in vivo and in organ culture. Biol Reprod 1971;4: 84–7. Nagy F. An autoradiographic study of the post-natal changes in (3H) leucine incorporation by Sertoli cell nuclei in rat testes. J Reprod Fertil 1974;37:353–9. Joyce KL, Porcelli J, Cooke PS. Neonatal goitrogen treatment increases adult testis size and sperm production in the mouse. J Androl 1993;14:448–55. Vergouwen RP, Jacobs SG, Huiskamp R, Davids JA, de Rooij DG. Proliferative activity of gonocytes, Sertoli cells and interstitial cells during testicular development in mice. J Reprod Fertil 1991;93: 233–43. Franca LR, Silva Jr VA, Chiarini-Garcia H, Garcia SK, Debeljuk L. Cell proliferation and hormonal changes during postnatal development of the testis in the pig. Biol Reprod 2000;63:1629–36. Vitale R, Fawcett DW, Dym M. The normal development of the blood-testis barrier and the effects of clomiphene and estrogen treatment. Anat Rec 1973;176:331–44. Ahmed EA, Barten-van Rijbroek AD, Kal HB, Sadri-Ardekani H, Mizrak SC, van Pelt AM, et al. Proliferative activity in vitro and DNA repair indicate that adult mouse and human Sertoli cells are not terminally differentiated, quiescent cells. Biol Reprod 2009;80: 1084–91. Mazaud-Guittot S, Meugnier E, Pesenti S, Wu X, Vidal H, Gow A, et al. Claudin 11 deficiency in mice results in loss of the Sertoli cell epithelial phenotype in the testis. Biol Reprod 2010; 82:202–13. Means AR, Huckins C. Coupled events in the early biochemical actions of FSH on the Sertoli cells of the testis. Curr Top Mol Endocrinol 1974;1:145–65. Holsberger DR, Cooke PS. Understanding the role of thyroid hormone in Sertoli cell development: a mechanistic hypothesis. Cell Tissue Res 2005;322:133–40. Van Haaster LH, De Jong FH, Docter R, De Rooij DG. The effect of hypothyroidism on Sertoli cell proliferation and differentiation and hormone levels during testicular development in the rat. Endocrinology 1992;131:1574–6. Jannini EA, Ulisse S, Piersanti D, Carosa E, Muzi P, Lazar J, et al. Early thyroid hormone treatment in rats increases testis size and germ cell number. Endocrinology 1993;132:2726–8. Cooke PS, Zhao YD, Bunick D. Triiodothyronine inhibits proliferation and stimulates differentiation of cultured neonatal Sertoli cells: possible mechanism for increased adult testis weight and sperm production induced by neonatal goitrogen treatment. Biol Reprod 1994;51:1000–5. Cooke PS, Kirby JD, Porcelli J. Increased testis growth and sperm production in adult rats following transient neonatal goitrogen treatment: optimization of the propylthiouracil dose and effects of methimazole. J Reprod Fertil 1993;97:493–9. van Haaster LH, de Jong FH, Docter R, de Rooij DG. High neonatal triiodothyronine levels reduce the period of Sertoli cell proliferation and accelerate tubular lumen formation in the rat testis, and increase serum inhibin levels. Endocrinology 1993;133:755–60. Jannini EA, Ulisse S, D’Armiento M. Thyroid hormone and male gonadal function. Endocr Rev 1995;16:443–59. Majdic G, Snoj T, Horvat A, Mrkun J, Kosec M, Cestnik V. Higher thyroid hormone levels in neonatal life result in reduced testis volume in postpubertal bulls. Int J Androl 1998;21:352–7.

93

[27] Holsberger DR, Kiesewetter SE, Cooke PS. Regulation of neonatal Sertoli cell development by thyroid hormone receptor alpha1. Biol Reprod 2005;73:396–403. [28] Flamant F, Gauthier K, Samarut J. Thyroid hormones signaling is getting more complex: STORMs are coming. Mol Endocrinol 2007; 21:321–33. [29] Jannini EA, Dolci S, Ulisse S, Nikodem VM. Developmental regulation of the thyroid hormone receptor alpha 1 mRNA expression in the rat testis. Mol Endocrinol 1994;8:89–96. [30] Arambepola NK, Bunick D, Cooke PS. Thyroid hormone effects on androgen receptor messenger RNA expression in rat Sertoli and peritubular cells. J Endocrinol 1998;156:43–50. [31] Jannini EA, Crescenzi A, Rucci N, Screponi E, Carosa E, de Matteis A, et al. Ontogenetic pattern of thyroid hormone receptor expression in the human testis. J Clin Endocrinol Metab 2000;85:3453–7. [32] O’Shea PJ, Williams GR. Insight into the physiological actions of thyroid hormone receptors from genetically modified mice. J Endocrinol 2002;175:553–70. [33] Tagami T, Nakamura H, Sasaki S, Miyoshi Y, Imura H. Estimation of the protein content of thyroid hormone receptor alpha 1 and beta 1 in rat tissues by Western blotting. Endocrinology 1993;132:275–9. [34] Rao JN, Liang JY, Chakraborti P, Feng P. Effect of thyroid hormone on the development and gene expression of hormone receptors in rat testes in vivo. J Endocrinol Invest 2003;26:435–43. [35] Canale D, Agostini M, Giorgilli G, Caglieresi C, Scartabelli G, Nardini V, et al. Thyroid hormone receptors in neonatal, prepubertal, and adult rat testis. J Androl 2001;22:284–8. [36] Thompson CC, Potter GB. Thyroid hormone action in neural development. Cereb Cortex 2000;10:939–45. [37] Bradley DJ, Towle HC, Young 3rd WS. Spatial and temporal expression of alpha- and beta-thyroid hormone receptor mRNAs, including the beta 2-subtype, in the developing mammalian nervous system. J Neurosci 1992;12:2288–302. [38] Davis PJ, Leonard JL, Davis FB. Mechanisms of nongenomic actions of thyroid hormone. Front Neuroendocrinol 2008;29:211–8. [39] Leonard JL. Non-genomic actions of thyroid hormone in brain development. Steroids 2008;73:1008–12. [40] Cao X, Kambe F, Moeller LC, Refetoff S, Seo H. Thyroid hormone induces rapid activation of Akt/protein kinase B-mammalian target of rapamycin-p70S6K cascade through phosphatidylinositol 3kinase in human fibroblasts. Mol Endocrinol 2005;19:102–12. [41] Storey NM, Gentile S, Ullah H, Russo A, Muessel M, Erxleben C, et al. Rapid signaling at the plasma membrane by a nuclear receptor for thyroid hormone. Proc Natl Acad Sci U S A 2006;103:5197–201. [42] Hiroi Y, Kim HH, Ying H, Furuya F, Huang Z, Simoncini T, et al. Rapid nongenomic actions of thyroid hormone. Proc Natl Acad Sci U S A 2006;103:14104–9. [43] Kenessey A, Ojamaa K. Thyroid hormone stimulates protein synthesis in the cardiomyocyte by activating the Akt-mTOR and p70S6K pathways. J Biol Chem 2006;281:20666–72. [44] Verga Falzacappa C, Panacchia L, Bucci B, Stigliano A, Cavallo MG, Brunetti E, et al. 3,5,30 -Triiodothyronine (T3) is a survival factor for pancreatic beta-cells undergoing apoptosis. J Cell Physiol 2006;206: 309–21. [45] Verga Falzacappa C, Petrucci E, Patriarca V, Michienzi S, Stigliano A, Brunetti E, et al. Thyroid hormone receptor TRbeta1 mediates Akt activation by T3 in pancreatic beta cells. J Mol Endocrinol 2007;38: 221–33. [46] Furuya F, Hanover JA, Cheng SY. Activation of phosphatidylinositol 3-kinase signaling by a mutant thyroid hormone beta receptor. Proc Natl Acad Sci U S A 2006;103:1780–5. [47] Cao X, Kambe F, Yamauchi M, Seo H. Thyroid-hormone-dependent activation of the phosphoinositide 3-kinase/Akt cascade requires Src and enhances neuronal survival. Biochem J 2009;424:201–9. [48] Meroni SB, Riera MF, Pellizzari EH, Cigorraga SB. Regulation of rat Sertoli cell function by FSH: possible role of phosphatidylinositol 3-kinase/protein kinase B pathway. J Endocrinol 2002;174:195– 204. [49] Meroni SB, Riera MF, Pellizzari EH, Galardo MN, Cigorraga SB. FSH activates phosphatidylinositol 3-kinase/protein kinase B signaling pathway in 20-day-old Sertoli cells independently of IGF-I. J Endocrinol 2004;180:257–65. [50] Lucas TF, Amaral LS, Porto CS, Quintas LE. Naþ/Kþ-ATPase alpha1 isoform mediates ouabain-induced expression of cyclin D1 and proliferation of rat Sertoli cells. Reproduction 2012;144:737–45. [51] Chaillou T, Koulmann N, Simler N, Meunier A, Serrurier B, Chapot R, et al. Hypoxia transiently affects skeletal muscle hypertrophy in a functional overload model. Am J Physiol Regul Integr Comp Physiol 2012;302:R643–54.

94

Y. Sun et al. / Theriogenology 83 (2015) 86–94

[52] Buzzard JJ, Morrison JR, O’Bryan MK, Song Q, Wreford NG. Developmental expression of thyroid hormone receptors in the rat testis. Biol Reprod 2000;62:664–9. [53] Fumel B, Guerquin MJ, Livera G, Staub C, Magistrini M, Gauthier C, et al. Thyroid hormone limits postnatal Sertoli cell proliferation in vivo by activation of its alpha1 isoform receptor (TRalpha1) present in these cells and by regulation of Cdk4/JunD/c-myc mRNA levels in mice. Biol Reprod 2012;87:1–9. [54] Palmero S, Prati M, Bolla F, Fugassa E. Tri-iodothyronine directly affects rat Sertoli cell proliferation and differentiation. J Endocrinol 1995;145:355–62. [55] Palmero S, de Marchis M, Gallo G, Fugassa E. Thyroid hormone affects the development of Sertoli cell function in the rat. J Endocrinol 1989;123:105–11. [56] Marchlewska K, Kula K, Walczak-Jedrzejowska R, Oszukowska E, Filipiak E, Slowikowska-Hilczer J. Role of FSH and triiodothyronine in Sertoli cell development expressed by formation of connexin 43based gap junctions. J Exp Zool A Ecol Genet Physiol 2011;315: 329–36. [57] Kirby JD, Mankar MV, Hardesty D, Kreider DL. Effects of transient prepubertal 6-N-propyl-2-thiouracil treatment on testis development and function in the domestic fowl. Biol Reprod 1996;55:910–6. [58] Morais RD, Nobrega RH, Gomez-Gonzalez NE, Schmidt R, Bogerd J, Franca LR, et al. Thyroid hormone stimulates the proliferation of Sertoli cells and single type A spermatogonia in adult zebrafish (Danio rerio) testis. Endocrinology 2013;154:4365–76.

[59] Holsberger DR, Jirawatnotai S, Kiyokawa H, Cooke PS. Thyroid hormone regulates the cell cycle inhibitor p27Kip1 in postnatal murine Sertoli cells. Endocrinology 2003;144:3732–8. [60] Nakayama K, Ishida N, Shirane M, Inomata A, Inoue T, Shishido N, et al. Mice lacking p27(Kip1) display increased body size, multiple organ hyperplasia, retinal dysplasia, and pituitary tumors. Cell 1996;85: 707–20. [61] Rosenblatt J, Gu Y, Morgan DO. Human cyclin-dependent kinase 2 is activated during the S and G2 phases of the cell cycle and associates with cyclin A. Proc Natl Acad Sci U S A 1992;89:2824–8. [62] Elledge SJ, Richman R, Hall FL, Williams RT, Lodgson N, Harper JW. CDK2 encodes a 33-kDa cyclin A-associated protein kinase and is expressed before CDC2 in the cell cycle. Proc Natl Acad Sci U S A 1992;89:2907–11. [63] Bandara LR, Adamczewski JP, Hunt T, La Thangue NB. Cyclin A and the retinoblastoma gene product complex with a common transcription factor. Nature 1991;352:249–51. [64] Quelle DE, Ashmun RA, Shurtleff SA, Kato JY, Bar-Sagi D, Roussel MF, et al. Overexpression of mouse D-type cyclins accelerates G1 phase in rodent fibroblasts. Genes Dev 1993;7:1559–71. [65] Moroy T, Geisen C. Cyclin E. Int J Biochem Cell Biol 2004;36: 1424–39. [66] Gilleron J, Nebout M, Scarabelli L, Senegas-Balas F, Palmero S, Segretain D, et al. A potential novel mechanism involving connexin 43 gap junction for control of sertoli cell proliferation by thyroid hormones. J Cell Physiol 2006;209:153–61.