Cellular Signalling 27 (2015) 315–325

Contents lists available at ScienceDirect

Cellular Signalling journal homepage: www.elsevier.com/locate/cellsig

Thyronamine induces TRPM8 channel activation in human conjunctival epithelial cells Noushafarin Khajavi a, Peter S. Reinach b,c, Nefeli Slavi b, Marek Skrzypski d, Alexander Lucius a, Olaf Strauß a, Josef Köhrle e, Stefan Mergler a,⁎ a

Charité—Universitätsmedizin Berlin, Campus Virchow-Klinikum, Klinik für Augenheilkunde, Augustenburger Platz 1, D-13353 Berlin, Germany Biological Sciences, SUNY College of Optometry, New York, NY 10036, USA School of Ophthalmology and Optometry, Wenzhou Medical University, Wenzhou 325027, PR China d Department of Animal Physiology and Biochemistry, Poznań University of Life Sciences, 60-637 Poznań, Poland e Institut für Experimentelle Endokrinologie, Charité—Universitätsmedizin Berlin, Augustenburger Platz 1, D-13353 Berlin, Germany b c

a r t i c l e

i n f o

Article history: Received 16 September 2014 Received in revised form 31 October 2014 Accepted 12 November 2014 Available online 21 November 2014 Keywords: Human conjunctival epithelium Calcium, transient receptor potential melastatin 8 channel Intracellular Ca2 +, thyronamine, interleukin (IL)-6, dry eye syndrome, planar patch-clamp technique

a b s t r a c t 3-Iodothyronamine (T1AM), an endogenous thyroid hormone (TH) metabolite, induces numerous responses including a spontaneously reversible body temperature decline. As such an effect is associated in the eye with increases in basal tear flow and thermosensitive transient receptor potential melastatin 8 (TRPM8) channel activation, we determined in human conjunctival epithelial cells (IOBA-NHC) if T1AM also acts as a cooling agent to directly affect TRPM8 activation at a constant temperature. RT-PCR and quantitative real-time PCR (qPCR) along with immunocytochemistry probed for TRPM8 gene and protein expression whereas functional activity was evaluated by comparing the effects of T1AM with those of TRPM8 mediators on intracellular Ca2+ ([Ca2+]i) and whole-cell currents. TRPM8 gene and protein expression was evident and icilin (20 μM), a TRPM8 agonist, increased Ca2+ influx as well as whole-cell currents whereas BCTC (10 μM), a TRPM8 antagonist, suppressed these effects. Similarly, either temperature lowering below 23 °C or T1AM (1 μM) induced Ca2+ transients that were blocked by this antagonist. TRPM8 activation by both 1 µM T1AM and 20 μM icilin prevented capsaicin (CAP) (20 μM) from inducing increases in Ca2+ influx through TRP vanilloid 1 (TRPV1) activation, whereas BCTC did not block this response. CAP (20 μM) induced a 2.5-fold increase in IL-6 release whereas during exposure to 20 μM capsazepine this rise was completely blocked. Similarly, T1AM (1 μM) prevented this response. Taken together, T1AM like icilin is a cooling agent since they both directly elicit TRPM8 activation at a constant temperature. Moreover, there is an inverse association between changes in TRPM8 and TRPV1 activity since these cooling agents blocked both CAP-induced TRPV1 activation and downstream rises in IL-6 release. © 2014 Elsevier Inc. All rights reserved.

1. Introduction Dry eye (DE) disease is a multifactorial syndrome in which patients experience inflammation, hyperemia and chronic pain [1]. These individuals also can experience cold-induced allodynia and increased tear fluid secretion, which has been suggested to be associated with chronic exposure to hyperosmolar tears leading to transient receptor potential (TRP) melastatin 8 (TRPM8) nociceptor upregulation on the nerve endings of the ophthalmic branch of the trigeminal nerves [2]. Abbreviations: HCjE, human conjunctival epithelium; TAM, thyronamine; T1AM, 3-iodothyronamine; TRPV, transient receptor potential vanilloid; TRPM, transient receptor potential melastatin; CAP, capsaicin; CPZ, capsazepine; BCTC, N-(4-tert.butyl-phenyl)-4(3-chloropyridin-2-yl) tetrahydropyrazine-1(2H)-carboxamide; TAAR, trace amineassociated receptors; TH, thyroid hormone. ⁎ Corresponding author at: Charité—Universitätsmedizin Berlin, Campus VirchowClinic, Department of Ophthalmology, Augustenburger Platz 1, 13353 Berlin, Germany. Tel./fax: +49 30 450 559648. E-mail address: [email protected] (S. Mergler).

http://dx.doi.org/10.1016/j.cellsig.2014.11.015 0898-6568/© 2014 Elsevier Inc. All rights reserved.

This realization that heightened TRPM8 sensitivity to a decline in temperature could underlie DE associated pain has prompted interest in identifying compounds that reduce thermoreceptor TRPM8 activity [3]. The conjunctival epithelial layer comprises most of the ocular surface exposed to the environment. It provides an essential barrier function to prevent ocular pathogenic infiltration and elicits along with the lacrimal gland osmotically coupled net fluid transport to the ocular surface. Both of these functions are critical for sustaining ocular surface hydration and visual function [4,5]. Initially, most of the studies delineating TRP functional roles in the eye dealt with their presence on neuronal elements. However, it is now evident that there is also TRP superfamily expression on non-neuronal ocular cells [6]. Specifically, TRPM8 activity was identified on corneal endothelial cells along with other thermosensitive TRP isoforms on cultured corneal epithelial cells, corneal stromal fibroblasts, conjunctival epithelial cells (IOBA-NHC), uveal melanoma cells (92.1) and retinoblastoma cells (WERI-Rb1) as well as retinal pigment epithelial cells (ARPE-19) [7–12]. One other thermosensitive TRP isoform that we identified in IOBA-NHC is TRP

316

N. Khajavi et al. / Cellular Signalling 27 (2015) 315–325

vanilloid 1 (TRPV1) [9] but heretofore there are no reports describing in these cells functional TRPM8 expression. There is accumulating evidence that TRP channel-elicited responses are modulated by their interactions with other receptors. For example, a number of studies showed that ligand-induced TRPM8 activation leads to suppression of TRPV1 activation [8,13–15]. Such an interaction could provide a therapeutic option in a clinical setting to reduce TRPV1induced inflammation and fibrosis subsequent to a severe ocular surface injury. In this context, it is known that a variety of stimuli including capsaicin (CAP) TRPV1 elicit increases in proinflammatory release through various downstream signaling pathways [16,17]. These pathways include intracellular Ca2+ transients leading to c-Jun N-terminal kinase/ stress activated protein kinase (JNK/SAPK) and extracellular regulated kinase (ERK) activation leading to increases in interleukin (IL)-1β, IL-6 and IL-8 [18,19] release. In a mouse corneal wound healing model, a severe injury caused by an alkali burn results in inflammation and fibrosis. Such an undesirable wound healing outcome was markedly attenuated in homozygous TRPV1−/− knockout mice showing that this receptor channel is a viable drug target for improving healing by reducing inflammation and scarring [11,20–22]. TRPM8 is a cold receptor involved in acute thermal nociception. Its temperature threshold for activation is within the noxious range and ranges between 23 and 28 °C depending on the expression system. However, the mechanism that endows this channel with temperature sensitivity is unknown [3]. TRPM8 is gated by voltage although its voltage dependence is weak [23]. The chemical compounds that directly activate TRPM8 at constant temperature are cooling agents and they include menthol and icilin [24,25]. Even though this channel is directly activated by cooling agents, temperature lowering can also have a similar effect. Temperature lowering in vivo can be the result of ligand-induced receptor activation causing formation of a metabolite that causes this response. This temperature lowering effect inducing TRPM8 activation is indirect since this response occurs subsequent to a receptor mediated event eliciting formation of a metabolite that promotes this response by systemic cooling. Direct and indirect TRPM8 stimulation stems from interactions with temperature sensing and ligand binding regions within the N-terminal domain of TRPM8 [26]. More specifically, residues located in the transmembrane domain 2 and the TRP consensus box are involved in sensitivity to icilin and menthol, but not in sensitivity to cold [27]. These compounds shift the activation threshold of the channel to higher temperatures and shift the voltage threshold for channel activation to more negative membrane voltages. Since TRPM8 has been identified as the channel whose activation by ligands induces cold anesthesia, there remains a need to identify novel endogenous TRPM8 cooling compounds (i.e. agonists). This effort is relevant since the currently available compounds have some drawbacks, which limit their use as effective anesthetics [3]. Thyronamines are decarboxylated thyroid hormone derivatives. One of them is 3-iodothyronamine (T1AM), which contains only one iodine atom and was detected in rodent and human serum [28]. T1AM acts as a potent agonist of trace amine associated receptor 1 (TAAR1), a member of an orphan G-protein coupled receptor family [29]. Thyronamine (T1AM) serum concentrations in humans are in the nanomolar range [30]. Only two of these endogenous thyronergic TH metabolites, namely, 3-iodothyronamine (T1AM) and T0AM were detected [31–34]. In human tissues, endogenous T1AM concentrations in serum were reported to be ~60 nM [35]. This metabolite caused a reversible 10 °C decline in mice body temperature [33,34,36]. Its nadir was reached about 1 h after injection and dose-dependently disappeared after 4–6 h. On the other hand, in a working heart preparation, introduction of T1AM into the perfusion bath at constant temperature reduced cardiac performance suggesting that T1AM had a direct effect through an unknown mechanism independent of T1AM-elicited hypothermia [37]. In another study, it was shown that the temperature lowering effect of T1AM protects against brain damage induced by ischemia caused by stroke injury [38]. These different studies suggest that the numerous responses

caused by T1AM may be accounted for by both indirect effects elicited by temperature lowering as well as a direct interaction with a target. The aim of this study was to investigate in a human conjunctival epithelial cell line (IOBA-NHC) whether: a) there is functional TRPM8 expression; b) T1AM can act as a cooling agent to directly activate TRPM8. Furthermore, we determined if an increase in TRPM8 activity affects changes in TRPV1 channel activity induced by capsaicin since such an interaction has been identified in some other tissues co-expressing these two different TRP isoforms [27]; and c) T1AM suppresses CAPinduced rises in interleukin (IL)-6 release. 2. Materials and methods 2.1. Materials BCTC and fura-2/AM were purchased from TOCRIS Bioscience (Bristol, United Kingdom). Capsazepine (CPZ) and icilin were obtained from Cayman Chemical Company (Ann Arbor, Michigan, USA). Medium and supplements for cell culture were bought from Life Technologies Invitrogen (Karlsruhe, Germany) or Biochrom AG (Berlin, Germany). T1AM was commercially synthetized by Dr. R. Smits (ABX advanced biochemical compounds, Radeberg, Germany) and purified by Dr. R. Thoma (Formula GmbH Pharmaceutical and Chemical Development Company, Berlin, Germany). Accutase was ordered from PAA Laboratories (Pasching, Austria). All other reagents were obtained from Sigma (Deisenhofen, Germany). Human IL-6 ELISA reagent kit was purchased from Thermo Scientific (Rockford, IL, USA). 2.2. Cell culture IOBA-NHC cell line (normal human conjunctiva) was used as a cell model for human conjunctival epithelial (HCjE) cells, a generous gift from Yolanda Diebold's lab (University Institute of Applied Ophthalmobiology, University of Valladolid, Valladolid, Spain). IOBANHC cells were grown in Dulbecco modified Eagle medium DMEM/ HAMs F12 1:1 supplemented with 10% fetal calf serum (FCS), 1 μg/ml insulin, 5 μg/ml hydrocortisone and 100 IU/ml penicillin/streptomycin in a humidified 5% CO2 incubator at 37 °C [9]. 2.3. RNA isolation and reverse transcription polymerase chain reaction (RT-PCR) Total RNA was extracted using TRIzol® Reagent RT (Ambion, Austin, TX) according to the manufacturer's instructions. The isolated RNA (2 μg) was transcribed into cDNA using the high capacity cDNA reverse transcription kit (Applied Biosystems, Darmstadt, Germany). For reverse transcription PCR, 2 μl cDNA mixture was used as a template in subsequent amplification reactions in a 30 μl total volume containing specific primers for TRPM8 (fwd CCTGTTCCTCTTTGCGGTGTGGAT; rev TCCTCT GAGGTGTCGTTGGCTTT) generating 621 bp and glyceraldehyde-3phosphate dehydrogenase (GAPDH) as template control (fwd TCAACG ACCACTTTGTCAAGCTCA; rev GCTGGTGGTCCAGGGGTCTTACT) generating an anticipated 119 bp product. Each reaction also contained red PCR Master Mix (Srtatec, Germany). PCR reaction underwent an initial cycle at 95 °C for 5 min followed by 35 cycles at 95 °C for 15 s. Primer specific annealing temperatures used were: a) TRPM8 58 °C, b) GAPDH 60 °C for 30 s, followed by 72 °C for 45 s, and elongation at 72 °C for 7 min and finally temperature holding at 4 °C. 8 μl of the PCR products were loaded on a 1.5 % agarose gel and after electrophoresis visualized via ethidium bromide staining under UV light. Omission of cDNA synthase from control PCR reaction excluded genomic contamination. 2.4. Quantitative real-time PCR Quantitative RT-PCR was performed as previously described [7] with the Mx 3000P qPCR system real-time cycler (Stratagene, Waldbronn,

N. Khajavi et al. / Cellular Signalling 27 (2015) 315–325

Germany). Specific primers for TRPM8 (fwdATGGCCGGGACGAGATG GACA, rev AGCCCCTGGTCTGCTCCCAAA) generating a 138 bp product and LightCycler® 480 SYBR Green I Master (Roche, Germany) were used for detection. Amplification was carried out for 45 cycles of 15 s (95 °C), 30 s (60 °C) and was followed by TBE-buffered gel electrophoresis in a 1 % agarose gel. GAPDH was used to generate a housekeeping mRNA for normalizing TRPM8 gene expression. 2.5. Immunocytochemistry Cells seeded on glass coverslips were cultured at 37 °C in a humidified 5 % CO2 incubator until they were 50–70 % confluent. The cells were fixed on ice for 30 min in 4 % (w/v) paraformaldehyde for 20 min and rinsed twice with PBS. For cell permeabilization 0.1 % Triton X-100 solution and for blocking 1 % BSA was used. Cells were incubated overnight at 4 °C with anti-TRPM8 rabbit monoclonal [clone number EPR4196(2)] antibody (Abcam plc, Cambridge, United Kingdom) and after washing with PBS exposed to the anti-rabbit secondary antibody for 1 h and mounted with 4′,6-diamidino-2-phenylindole (DAPI) for 5 min. Fluorescence was visualized with a Zeiss AxioImager M2 inverted microscope (Zeiss Oberkochen, Germany). 2.6. Intracellular calcium imaging Cytosolic free Ca2 + ([Ca2 +]i) was measured in cells loaded with fura-2/AM. First, cells were preincubated in a culture medium containing 1–4 μM fura-2/AM for 30–40 min at 37 °C. The extracellular Ringer-like solution contained (mM): 150 NaCl, 6 CsCl, 1.5 CaCl2, 1 MgCl2, 10 HEPES acid and 10 glucose (pH ≈ 7.4) (osmolarity ≈ 300 mOsM). After rinsing the cells with this solution, fluorescence measurements were performed at room temperature (≈21–23 °C) onstage of an inverted microscope (Olympus BW50WI) in conjunction with a digital imaging system (TILL Photonics, Munich, Germany). For evaluation, TIDA software was used (HEKA electronics, Lamprecht, Germany). Fura-2 fluorescence was alternately excited at 340 and 380 nm wavelength and emission was detected from cell clusters every 500 ms at 510 nm. The fluorescence ratio (f340nm/f380nm) is a relative index of changes in [Ca2 +]i [39]. Results are mean traces of the fluorescence ratio f340nm/f380nm ± SEM with values indicating the number of experiments per data point. The measurements lasted between 8 and 30 min depending on the experimental design. TRP channel activators and inhibitors were dissolved in a stock dimethyl sulfoxide (DMSO) solvent whose final concentration did not exceed 0.1 %. 2.7. Planar patch-clamp recordings Whole-cell currents were evaluated in conjunction with an EPC10 amplifier and PatchMaster acquisition software (HEKA, Lambrecht, Germany) as well as PatchControl software (Nanion, Munich, Germany) was used [40,41]. The resistances of the microchips for planar patchclamp recordings corresponded to those of a patch-pipette with a resistance of 2.5–3 MΩ. For recording, first of all, 5 μl of an internal-like solution was applied to the microchip. The internal solution (Nanion) contained in mM: (50 CsCl, 10 NaCl, 2 MgCl2, 60 CsF, 20 EGTA and 10 HEPES, pH ≈ 7.2 and osmolarity ≈ 288 mOsM). Cs in the internal solution blocks potassium channel activity. The internal solution contained fluoride since omitting it after seal formation it can cause loss of seal quality and patch-clamp stability. Inclusion of fluoride improved patch-clamp sealing and stabilized the cell membrane, resulting in longer, more stable patch-clamp recordings [42,43]. For planar patchclamping, a single cell suspension was added to an external solution (Nanion) whose composition was (in mM): 140 NaCl, 4 KCl, 1 MgCl2, 2 CaCl2F, 5 D-glucose monohydrate and 10 HEPES, pH ≈ 7.4 and osmolarity ≈ 298 mOsM). Suction was applied to move a cell onto the aperture of the microchip. During the cell-attached mode, additional suction pulses were used to break open the cell membrane allowing

317

the formation of the whole-cell configuration. The holding potential (HP) was set to 0 mV to eliminate any possible contributions by voltage-dependent Ca2+ channel activity. HP was corrected for liquid junction potentials (≈6 mV [44]) and voltage offsets before the measurements. The mean access resistance of the cells was 29 ± 5.6 MΩ (n = 25) and the mean cell membrane capacitance was 14 ± 2 pF (n = 25). Whole-cell currents were recorded using a step protocol at voltage steps of 10 mV ranging between − 60 and + 130 mV for 400 ms. The resulting currents were normalized by dividing the current (pA) amplitude by the cell membrane capacitance (pF) to obtain current density ([pA/pF]). Current recordings were all leak-subtracted and cells with leak currents above 100 pA were excluded from analysis. Voltage changes without steps (voltage ramps) were also used. In some cases, time courses of currents were recorded using a ramp protocol every 5 s (− 60 to 130 mV within 500 ms). All plots were generated with SigmaPlot software version 12.5 (Systat, San Jose, California, USA) and an electrophysiology module (Systat, Bruxton). 2.8. Enzyme-linked immunosorbent assay (ELISA) IOBA-NHC cells were plated in a 12-well plate and grown in DMEM/ HAMF12 serum-free medium. After 24 h of serum starvation, cells were washed twice with PBS and then exposed to 20 μM CPZ and 1 μM T1AM for 30 min before stimulating them with 20 μM CAP for 24 h. After 24 h, medium was collected and centrifuged at 4000 rpm for 3 min to remove cell debris. ELISA for IL-6 was performed using a human IL-6 ELISA reagent kit according to the manufacturer's instructions. The amount of IL-6 in the culture medium was normalized to the total amount of protein. The total amount of protein was obtained by dissolving the washed cells in RIPA buffer [45]. Protein concentration of each cell lysate was determined using a BCA protein assay kit (Thermos Scientific). Each experiment was performed in triplicate with three replicates. 2.9. Data analyses and statistics For non-paired observations, unpaired Student's t-test was used if the values passed the normality test (normality test according to Kolmogorov–Smirnov). If this test failed, the non-parametric Mann– Whitney test was used. In case of too different variances, unpaired t-test with Welch's correction was used. P values b 0.05 (*) were considered as significant. For paired observations, statistical significance was determined with parametric paired Student's t-test (p-values: twotailed) if the values were normally distributed according to Gaussian distribution (normality test). If this test failed, the non-parametric Wilcoxon matched pairs were used. Asterisks (*) indicate significant differences using paired Student's t-test. Hashtags (#) indicate significant differences using unpaired Student's t-test. Statistical analysis was performed with GraphPad Prism version 5.0 (GraphPad software Inc, La Jolla, CA, USA) and SigmaPlot software version 12.5 and the values are reported as means ± SEM. 3. Results 3.1. TRPM8 gene and protein expression RT-PCR (Fig. 1A) and quantitative real-time PCR analysis evaluated TRPM8 gene expression (Fig. 1B). The anticipated PCR products for TRPM8 (621 bp) were detected in IOBA-NHC and were identical to those found in two different cell lines used as positive controls. Namely, our controls were human corneal endothelial cells (HCEC-12) and the prostate carcinoma cell line LNCaP [46]. Moreover, quantitative real-time PCR (qPCR) confirmed TRPM8 expression in all aforementioned cell types. Specifically, the TRPM8 gene expression in LNCaP is at a higher level compared to that in human conjunctival epithelial cells (IOBA) and human corneal endothelial cells (HCEC-12) (± SEM; n = 6; p b 0.01) (Fig. 1B). TRPM8 protein expression in LNCaP cells

318

N. Khajavi et al. / Cellular Signalling 27 (2015) 315–325

HCEC-12

IOBA

LNCaP

Fig. 1. TRPVM8 gene and protein expression in IOBA-NHC cells. A: Conventional RT-PCR indicate mRNA signal of TRPM8 (621 bp) in HCEC-12 (human corneal endothelial cells), LNCaP (lymph node carcinoma of prostate) and IOBA-NHC (human conjunctival epithelial cells). B: Quantitative analysis. The data were normalized to LNCaP with the positive mRNA signal. GAPDH was used as a housekeeping gene for normalization. The error bars are representative of SEM. The asterisks (***) indicate statistically significant differences of TRPM8 gene expression between LNCaP and HCEC-12 and IOBA respectively (unpaired Student t-test). C–E: Immunocytochemistry shows TRPM8 localization. C: Nuclear staining with DAPI (blue). D: TRPV1 positive cells (violet). E: merged.

was detected by immunofluorescence using the same protocol as in similar studies [47]. Anti TRPM8 antibody selectivity was established based on the absence of immunostaining upon omission of the primary antibody (data not shown).This precaution was taken to validate absence of any erroneous signals emanating from an interaction with the secondary antibody. DAPI (blue) was used to stain fixed cells (Fig. 1C–E). The immunostaining pattern indicates that TRPM8 expression is detectable in both the endoplasmic reticulum compartment as well as in the plasma membrane. 3.2. Functional TRPM8 expression ThermosensitiveTRPM8 activity was evaluated based on the effect of moderate bath solution temperature cooling from 21.91 ± 0.12 °C to 18.69 ± 0.35 °C (n = 10) on the f340nm/f380nm ratio. This slight temperature decline caused [Ca2+]i to rapidly rise. Within 1 min, this ratio rose from 1.200 ± 0.0.001 to 1.217 ± 0.007 (n = 10; ***p b 0.001) followed by full recovery to its baseline level upon temperature reversal (Fig. 2A). During exposure to a TRPM8 blocker, BCTC (10 μM), this coolinginduced Ca2+ increase was eliminated since the ratio was unchanged (f340nm/f380nm ratio = 1.200 ± 0.004; n = 5; *p = 0.05) (Fig. 2B), which is suggestive of selective TRPM8 suppression by this antagonist. On the other hand, icilin (20 μM), a TRPM8 cooling agonist, increased the f340nm/f380nm ratio from 1.200 ± 0.005 to 1.224 ± 0.003 (n = 9; ***p b 0.001) (Fig. 2C). During exposure to BCTC (10 μM), the icilin-induced rise was obviated. Instead, the f340nm/f380nm ratio decreased from 1.200 ± 0.003 at 120 s to 1.194 ± 0.005 at 450 s (n = 6; ***p b 0.001) (Fig. 2D). To assess if this decline below the baseline level was attributable to a non-selective effect involving inhibition of TRPV1 activity, we determined if it blocked an increase in TRPV1 activity induced by CAP, a relatively selective TRPV1 agonist. As shown previously in these cells, 20 μM CAP after 10 min, increased the f340nm/f380nm ratio to 1.229 ± 0.001 (n = 7). Indicative of its selectivity as a TRPM8 antagonist, this response to CAP was unchanged in the presence of 10 μM BCTC (1.228 ± 0.006; n = 7; p N 0.05; unpaired tested) (Fig. 2E–F). Taken together, there is functional TRPM8 expression in IOBA-NHC cells. 3.3. Icilin activates whole-cell channel currents Fig. 3A–C shows increases in whole-cell current following a step voltage change of 10 mV lasting 400 ms from −60 mV to 130 mV. The

holding potential was set to 0 mV to exclude voltage-dependent Ca2+ channel activity. In general, from a potential of +70 mV, 60 μM icilin activated large outward rectifying currents that were larger than those at negative voltages. Small leak currents (b100 pA) occurred in some measurements were subtracted by the software so that the in- and outward current patterns could be better analyzed. The icilin effects summarized in Fig. 3E show that at −60 mV, 60 μM icilin increased inward currents from −2.81 ± 0.67 pA/pF to −24.77 ± 7.34 pA/pF (n = 6; * p b 0.05). At + 130 mV, outward rectifying currents increased from 8.57 ± 2.04 pA/pF to 85.01 ± 19.44 pA/pF in the presence of icilin (n = 6; ** p b 0.01) (Fig. 3E). In contrast, in the presence of 10 μM BCTC in the external solution, inward currents corresponding to the Ca2+ influx decreased to −11.34 ± 3.53 pA/pF (n = 6; * p b 0.05) (Fig. 3C–E) and outward currents decreased to 15.02 ± 1.59 pA/pF. In summary, these icilin and BCTC-sensitive whole-cell currents reflect TRPM8 channel activity. 3.4. T1AM induces Ca2+ influx T1AM exposure increased the f340nm/f380nm ratio from 1.200 ± 0.003 to 1.222 ± 0.007; (n = 6; **p b 0.001) (Fig. 4A; filled circles). While in another group of untreated controls, this ratio remained constant at 1.200 ± 0.001 after the same period (n = 4) (Fig. 4A; open circles). To validate that this rise stems from an increase in TRPM8 channel activity, other cells were exposed for 20 min to BCTC followed by bath supplementation with 1 μM T1AM. Under this condition, the T1AMinduced Ca2+ rise was abolished and this ratio instead even decreased to 1.962 ± 0.005; (n = 6; **p b 0.001) (Fig. 4B) suggesting that T1AM exposure leads to TRPM8 activation. 3.5. Correspondence between T1AM and icilin activated whole-cell channel currents We assessed if there is a correspondence between the effects of T1AM and icilin on the whole-cell currents Fig. 4C–D shows that 1 μM T1AM augmented in- and outward currents, induced by a voltage ramp protocol. Time course measurements along with plots of the corresponding current–voltage relationships at the indicated time points 1, 2 and 3 are shown in Fig. 4C and D. Similar results were obtained with a voltage step protocol (Fig. 5). Specifically, the inward currents at − 60 mV increased from − 9.30 ± 1.57 pA/pF to − 22.00 ± 2.18 pA/pF (Fig. 5A–G) (n = 12; *** p b 0.001). At + 130 mV, outwardly

N. Khajavi et al. / Cellular Signalling 27 (2015) 315–325

319

Fig. 2. Moderate cooling and icilin increased Ca2+ influx in IOBA-NHC cells and BCTC blocks this effect. A: Moderate cooling (≈23 °C to 18 °C; n = 10; filled circles) induced a Ca2+ increase. Recovery of the room temperature (≈23 °C) led to a reduction of the Ca2+ trace near the initial baseline level. Without cooling, no changes in Ca2+ influx could be observed (n = 8; open circles). B: 10 μM BCTC suppressed the cold-induced Ca2+ influx (n = 5). C: 20 μM icilin induced an irreversible Ca2+ entry (n = 9; filled circles). Without icilin application, no changes in Ca2+ influx could be observed (n = 5; open circles). D: 10 μM BCTC suppressed the icilin-induced Ca2+ influx (n = 6).

rectifying currents increased markedly from 77.30 ± 14.65 pA/pF to 160.58 ± 18.87 pA/pF in the presence of T1AM (n = 12; * p b 0.05) (Fig. 5A–G). These effects of T1AM on the whole cell currents closely correspond to those described for icilin suggesting that they both arise from interactions with TRPM8.

3.6. T1AM-mediates rises in whole-cell currents through TRPM8 activation Figs. 4C–D and 5A–C show that T1AM application led to increases in intracellular Ca2+ levels as well as in- and outward currents that were fully blocked during exposure to 10 μM BCTC. The mean current voltage traces generated by the current responses to step voltage changes are shown in Fig. 5D. Maximal negative current amplitudes induced by a voltage step from 0 mV to − 60 mV (% of control) and corresponding maximal positive current amplitudes induced by a voltage step from 0 mV to +130 mV are shown in Fig. 5E and F. Fig. 5G provides a summary of the results obtained with T1AM and BCTC. BCTC decreased inward currents underlying cation influx to − 9.71 ± 3.07 pA/pF (n = 7). Outwardly rectifying currents also decreased to 68.42 ± 13.84 pA/pF

(n = 7; * p b 0.05; Fig. 5G). Therefore, T1AM-induces increases in whole-cell currents through an interaction with TRPM8. 3.7. Icilin and T1AM suppress capsaicin-induced Ca2+ influx TRPV1 and TRPM8 are co-expressed in HCjE cells and TRPM8 activation is reported in various other tissues to suppress TRPV1 activation [8,13–15]. Accordingly, we determined if such an interaction can occur in IOBA-NHC cells. Selective TRPV1 activation by capsaicin (CAP) elicited an irreversible and large increase in f340nm/f380nm from 1.207 ± 0.006 (baseline value, t = 1200 s) to 1.291 ± 0.008 and 1.303 ± 0.009 (n = 6; t = 1400 s) (Fig. 6A and B open circles). Similarly, 1 μM T1AM caused f340nm/f380nm to rise from 1.200 ± 0.002 to 1.224 ± 0.005 (n = 9) similar to that shown in Fig. 4A. Fig. 6A filled circles shows that icilin (20 μM) increased this ratio from 1.200 ± 0.001 (150 s) to 1.225 ± 0.003 (600 s; n = 7). On the other hand, 20 μM capsaicin (CAP) supplementation suppressed the icilin-induced [Ca2 +]i rise at 1400 s (1.224 ± 0.002; n = 5) (Fig. 6A, filled circles). Similarly, no further increase in [Ca2+]i was detected after addition of 20 μM CAP when cells were pre-incubated with 1 μM T1AM (1.221 ± 0.007; n = 6)

320

N. Khajavi et al. / Cellular Signalling 27 (2015) 315–325

Fig. 3. Effect of icilin and BCTC on whole-cell currents. A–B: Whole-cell currents following voltage stimulation from −60 to +130 mV in 10 mV steps for 400 ms each. 60 μM icilin strongly increased inward and outward whole-cell channel currents. C: 10 μM BCTC suppressed both inward and outward currents (B). D: Effects of icilin and BCTC are shown in a current/voltage plot (I/V plot). For the current/voltage relation, maximal peak current amplitudes were plotted against the voltage (mV). The upper trace (filled circles) was obtained in the presence of 20 μM icilin and the lower trace (filled quadrangles) in the presence of 10 μM BCTC. Controls without application of drugs had no effect on whole-cell currents (open circles). E: Summary of the experiments with icilin and BCTC (n = 8–12). The hash marks (#) indicate statistically significant differences of in- and outward currents with and without BCTC (n = 8–12; p b 0.05; unpaired tested).

(Fig. 6B, filled circles). In summary, there is a negative relationship between TRPM8 and TRPV1 activation since T1AM or icilin suppressed CAP-induced increases in Ca2+ and conversely CAP blocked activation of TRPM8 by these two cooling agents.

3.8. T1AM-mediated whole-cell currents insensitive to CAP As T1AM suppressed CAP-induced Ca2 + transients, we validated this effect by determining if T1AM influenced underlying whole-cell

Fig. 4. T1AM increased Ca2+ influx and whole-cell currents in IOBA-NHC cells and BCTC blocks this effect. A: 1 μM T1AM induced a Ca2+ entry (n = 6; filled circles). Without T1AM application, no changes in Ca2+ influx could be observed (n = 4; open circles). The asterisks (**) indicate statistically significant differences of Ca2+ level with and without T1AM at 600 sec (n = 4–6; p b 0.01; unpaired tested). B: 10 μM BCTC suppressed the T1AM-induced Ca2+ influx (n = 6). Moreover, a slight decrease below the baseline could be observed. C: Time course of whole-cell currents at −60 mV (lower trace) and 130 mV (upper trace) showing the current activation by 1 μM T1AM in IOBA-NHC. The currents were normalized to capacitance to obtain current density (pA/pF). D: Original traces of T1AM activated current responses to voltage ramps from −60 mV up to +130 mV (500 ms, with leak current subtraction) in the whole-cell configuration of the planar patch-clamp technique. Currents are shown before application (labeled as 1) and during application of 1 μM T1AM (labeled as 2) and in the presence of 10 μM BCTC (labeled as 3).

N. Khajavi et al. / Cellular Signalling 27 (2015) 315–325

321

Fig. 5. Effect of T1AM and BCTC on whole-cell currents. A–B: Whole-cell currents following voltage stimulation from −60 to +130 mV in 10 mV steps for 400 ms each. 1 μM T1AM strongly increased inward and outward whole-cell channel currents. C: 10 μM BCTC suppressed both inward and outward currents. D: Effects of T1AM and BCTC are summarized in a current/ voltage plot (I/V plot) (n = 4–5). The upper trace (filled circles; n = 5) was obtained in the presence of 1 μM T1AM and the lower trace (filled quadrangles; n = 5) in the presence of 10 μM BCTC. Controls without application of T1AM had no effect on whole-cell currents (open circles; n = 4). E: Maximal negative current amplitudes induced by a voltage step from 0 mV to −60 mV are depicted in percent of control values before application of 1 μM T1AM. T1AM-induced inward currents could be suppressed in the presence of 10 μM BCTC. F: Same analyses as in panel E, but of steps from 0 mV to 130 mV. G: Summary of the experiments with T1AM and BCTC (n = 7–12). The asterisks (*) indicate statistically significant differences of in- and outward currents with and without BCTC (n = 7–12; p b 0.05 at the minimum; paired tested). The hash mark (#) indicate statistically significant differences of outward currents with and without BCTC (n = 7–12; p b 0.05; unpaired tested).

currents. Fig. 7A–C shows whole-cell current responses elicited by a step voltage stimulation protocol. Mean current voltage traces generated by the current responses to step voltage changes are shown in Fig. 7D. Fig. 7E provides a summary of the effects of T1AM and CAP. At −60 mV, the inward currents in the presence of T1AM increased from −10.50 ± 2.33 pA/pF to −23.50 ± 5.16 pA/pF (n = 12–14; ***p b 0.001). At 130 mV, the outwardly rectifying currents increased from 85.83 ± 21.49 pA/pF to 167.91 ± 19.52 pA/pF (n = 12–14; p b 0.05, Fig. 7E). Notably, no augmentation of in- and outward currents was detected after replacing T1AM with 20 μM CAP (Fig. 7E). Maximal negative current amplitudes induced by a voltage step from 0 mV to −60 mV (% of control) and corresponding maximal positive current amplitudes induced by a voltage step from 0 mV to +130 mV are shown in Fig. 7F and G. In summary, a direct interaction between TRPM8 and T1AM leads to suppression of TRPV1 activation by CAP (Fig. 7A–G).

3.9. T1AM suppresses TRPV1-induced IL-6 release To determine if there is evidence for crosstalk between TRPM8 and TRPV1 interaction, we assessed if changes in a physiological response mediated by TRPV1 activation would indicate such an effect. This was done by evaluating if exposure to 1 μM T 1 AM could blunt TRPV1-induced rises in IL-6 release. Fig. 8 shows that exposure to 20 μM CAP elicited a 2.5-fold increase in IL-6 release above its basal value (± SEM; n = 9; *p b 0.05). On the other hand, 30 min pre-incubation with 20 μM CPZ or 1 μM T1AM both fully suppressed the CAP effect on IL-6 release (± SEM; n = 9; #p b 0.05). Such suppression shows that TRPM8-induced suppression of TRPV1 activation elicits a downstream physiological effect through linked signaling pathways that is reflective of the crosstalk between TRPM8 and TRPV1.

Fig. 6. Icilin and T1AM suppressed CAP-induced Ca2+ influx. A: 20 μM icilin induced an irreversible Ca2+ entry (n = 5; filled circles). Additional application of 20 μM CAP (≈1400 s) did not change the Ca2+ level. Without icilin, a strong Ca2+ influx was observed (n = 6; open circles). B: 1 μM T1AM induced an irreversible Ca2+ entry (n = 6; filled circles). Additional application of 20 μM CAP (≈1400 s) did not change the Ca2+ level. Without T1AM, a strong Ca2+ influx could be observed (n = 8; open circles).

322

N. Khajavi et al. / Cellular Signalling 27 (2015) 315–325

Fig. 7. Effect of T1AM and CAP on whole-cell currents. A–B: Whole-cell currents following voltage stimulation from −60 to +130 mV in 10 mV steps for 400 ms each. 1 μM T1AM strongly increased inward and outward whole-cell channel currents. C: 20 μM CAP did not further increase in- and outward currents. D: Effects of T1AM and CAP are summarized in a current/ voltage plot (I/V plot) (n = 5–6). The upper trace (filled circles; n = 6) was obtained in the presence of 1 μM T1AM and the lower trace (filled quadrangles; n = 5) in the presence of 20 μM CAP. Controls without application of T1AM had no effect on whole-cell currents (open circles; n = 5). E: Summary of the experiments with T1AM and CAP (n = 10–14). The asterisks (*) indicate statistically significant differences of in- and outward currents with and without T1AM (n = 10–14; p b 0.05 at the minimum; paired tested). CAP had no effect on T1AM-induced increase of whole-cell currents. F: Maximal negative current amplitudes induced by a voltage step from 0 mV to −60 mV are depicted in percent of control values before application of 1 μM T1AM. T1AM-induced inward currents were not augmented in the presence of 20 μM CAP. G: Same analyses as in panel F, but of steps from 0 mV to 130 mV. T1AM-induced outwardly rectifying currents were not augmented in the presence of 20 μM CAP.

4. Discussion The non-transfected, spontaneously immortalized human conjunctival IOBA-NHC cell line was used as a relevant model of ocular surface cell biology [48]. In these cells, we identified TRPM8 gene and protein expression which has functional activity based on changes in intracellular Ca2+ levels and whole-cell currents after application of documented TRPM8 modulators. Drug effects included showing that the cooling agent, icilin, increased [Ca2+]i as well as whole-cell currents whereas the TRPM8 antagonist BCTC blocked these increases. These TRPM8mediated Ca2 + responses correspond to those described in various cell types including tumor cells [7,49]. An additional indication of such activity is that moderate cooling within the described range for inducing TRPM8 activation caused an increased Ca2+ influx, which was blocked by BCTC. Having established that there is functional TRPM8 expression in this cell line, we initially hypothesized that T1AM interacts with TRPM8 since its reported systemic temperature lowering effect lies within the range adequate for eliciting TRPM8 activation. However, we found

instead that T1AM elicits rapid TRPM8 activation at a constant temperature suggesting that this TH metabolite directly interacts with TRPM8 to activate this channel (Fig. 9A). This in vitro T1AM effect is novel and suggests that in vivo T1AM may activate TRPM8 through an indirect effect subsequent to temperature lowering as well as by a direct interaction with TRPM8 independent of a temperature change. As T1AM induces responses similar to those mediated by menthol and icilin, it also acts as a cooling agent by interacting with this channel at a ligand binding site rather than a temperature sensitive site. Our previous studies indicated that TRP isoform expression in nonneural cells of the anterior ocular surface has different functional roles that modulate tissue integrity during exposure to environmental stresses [6]. For example, in IOBA-NHC, there is functional TRPV1 expression as well as in conjunctiva cells isolated from patients [9]. Co-expression of TRPM8 and TRPV1 has been documented for many different cell types including rat hippocampal neurons, intralobar pulmonary arteries, aorta [13,50], neuroendocrine tumor cells, retinoblastoma cells, uveal melanoma cells and corneal nerve fibers [8,15,49,51]. As in some other tissue types, TRPM8 activation leads to suppression of TRPV1 stimulation.

N. Khajavi et al. / Cellular Signalling 27 (2015) 315–325

323

A

Fig. 8. T1AM suppresses TRPV1 induced IL-6 release. After 24 h incubation, ELISA reveals a clear increase by CAP (20 μM) on IL-6 release. Following pre-incubation either with 20 μM CPZ or 1 μM T1AM 30 min suppressed the CAP effect on IL-6 release Results were shown in (pg/μg protein). The error bars are representative of SEM. The asterisk (*) indicates statistically significant differences between basal level (control) and CAP-induced increase in IL-6 (unpaired Student t-test). The hash mark (#) indicates statistically significant differences between CAP-induced increase in IL-6 and with CPZ and T1AM respectively (unpaired Student t-test).

B

Such a possibility was evaluated in this study. We found that such an interaction also exists in IOBA-NHC cells because during exposure to either T1AM or icilin CAP-induced increases in Ca2+ influx were blocked (Fig. 9B). The effects of either T1AM or icilin were not attributable to non-selective blockade of TRPV1 since BCTC blocked their effects on TRPM8 activation. The suppression instead of CAP-induced TRPV1 activation may involve generation by TRPM8 of a second messenger intermediate(s) whose interaction with TRPV1 prevents activation by CAP. 4.1. Functional TRPM8 expression RT-PCR and qPCR along with immunochemistry identified TRPM8 transcripts and cellular TRPM8 protein expression, respectively. Whether TRPM8 localization is diffuse or plasma membrane delimited was not investigated in this study. At ≈18 °C to 20 °C (moderate cooling), a Ca2 + rise occurred which could also be induced by either icilin or T1AM despite raising the temperature above this level. In both cases, increases of in- and outward whole-cell currents were blocked by the TRPM8 antagonist BCTC. Furthermore, this Ca2 + rise elicited by the aforementioned temperature lowering was not confounded by contributions from TRPA1 activation since temperatures were maintained above 17 °C to avoid TRPA1 activation [52]. Icilin is a more efficacious and potent TRPM8 agonist than menthol [25,53] and irreversibly increased Ca2 + influx and whole-cell currents in HCjE cells. However, there are drug selectivity limitations because icilin may also act as a TRPA1 agonist [54]. Nevertheless, as the icilin-induced Ca2 + rises in our study correspond to those described in other cell types, including the corneal epithelium and endothelium, functional TRPM8 expression is indicated [7,49,55]. These Ca2+ rises and whole-cell current increases were all comparable since the extracellular physiological Ca2 + levels were invariant (1.5 mM). In contrast, an internal Ca2 + free solution was used in the patch-clamp recordings. This configuration establishes an electrochemical gradient from the exterior to the cell interior. Accordingly, it is suggested that the inward cation channel currents are mainly carried by Ca2+ as the charge carrier since TRPs are mainly Ca2 + permeable channels. Notably, these current response patterns

Fig. 9. Suggested Ca2+ signal transduction pathways activated by T1AM. A: Ca2+ channels such as TRPs of the TRPM8 subtype (menthol receptor) can be selectively activated by cold (b23–28 °C) or icilin and blocked by BCTC whereas a G-protein coupled receptor (GPCR) coupled to Gi/o proteins could also be activated by T1AM. T1AM may also directly activate TRPM8 by a GPCR-independent mechanism (↑[Ca2+]i]). B: TRPs of the TRPV1 subtype (capsaicin receptor) can be selectively activated by heat (N43 °C) or CAP and blocked by CPZ. If TRPM8 is activated by T1AM, T1AM blocks TRPV1. Notably, T1AM may also directly suppress TRPV1 by a GPCR-independent mechanism (↓[Ca2+]i]).

are similar to those shown in TRPM8-transfected human embryotic kidney (HEK) cells and human corneal endothelial (HCEC-12) cells [7,23]. However, contributions by Ca2+-activated chloride currents cannot be excluded since this type of activity can be a component of the outward currents. In a similar study using human corneal epithelial cells, it was suggested that the activity of non-selective cation channel currents probably contributed to the whole-cell currents since these currents were persistent even though chloride was replaced by gluconate [56]. 4.2. Thyronamines interact with TRPM8 T1AM and T0AM activate cognate G-protein coupled receptors (GPCRs) such as TAAR1 [36,57]. In addition, T1AM activates GPCRs such as beta adrenergic receptors (ADRBs) (Dinter, Kleinau, Biebermann et al. unpublished observation 2014). This would point to a “MULTI-Target” property of T1AM, which mimics what has been described for other ligands like dopamine interacting with a GPCR. In addition, T1AM is

324

N. Khajavi et al. / Cellular Signalling 27 (2015) 315–325

reported to be a substrate for a transporter [36,58]. GPCR activation can lead to hypothermia through unknown downstream signaling pathway(s). There is a recent report in a mouse model of human inflammatory colitis showing that TRPM8-induced suppression of TRPV1 activation accounts for declines in inflammation during the course of this disease [59]. These data can be explained by the fact that there is a desensitization of CAP/TRPV1 binding which has been previously described. However, it is very likely that there will be probably no Ca2+ responses after repeated application of CAP. In our study, we cannot exclude that T1AM-induced Ca2+ increases could be due to intracellular store depletion since the T1AM-induced Ca2+ increase could also be detected under extracellular Ca2+ free conditions (1 mM EGTA) (data not shown). 4.3. T1AM-induced TRPM8 activation and TRPV1 inhibition Although we used a pharmacological approach to show that T1AM mediates TRPM8 activation and blocks TRPV1 stimulation by CAP, a strict reliance on drug effects can be problematic. This is a concern because drug selectivity may not be sufficient and results may also be confounded by time dependent drug-induced desensitization. Nevertheless, all of the drugs used in this study have been used for the same purpose in other studies whose conclusions were also based solely on drug effects. However, in some other studies using both pharmacological and genetic approaches, each of these drugs had non-selective effects [60]. BCTC acted also as a TRPV1 antagonist [61,62]. Such an effect does not appear to be relevant in the current study since the CAP-induced Ca2+ increase was not suppressed after at least 5–8 min if cells were pre-incubated in BCTC (Fig. 2E–F). Therefore, it is suggested that BCTC is rather selective for TRPM8 in IOBA-NHC cells. Nevertheless, drug desensitization is a possibility since in these cells TRPV1 undergoes pronounced desensitization through an unknown mechanism during exposure to either CAP or CPZ [11].

setting in the treatment of cold-induced allodynia thought to be associated with chronic exposure to hypertonic tears [64].

Acknowledgments The human, spontaneously immortalized epithelial cell line from normal human conjunctiva (HCjE; IOBA-NHC) was initially provided by Yolanda Diebold, University Institute of Applied Ophthalmobiology [IOBA], University of Valladolid, Valladolid, Spain). The authors thank Gabriele Fels for the technical assistance (Charité, Dept. of Ophthalmology). Furthermore, the authors appreciate very much the collaboration of Friedrich Paulsen (MD), Fabian Garreis (PhD) and Antje Schröder (MSc) (University of Erlangen, Institute of Anatomy) for providing the IOBA-NHC cell line. We additionally thank Mathias Strowski (MD) and Carsten Grötzinger (PhD) from the Gastroenterology Department as well as Juliane Dinter (PhD), Gunnar Kleinau (PhD) and Heike Biebermann (PhD) from the Institute of Pediatric Experimental Endocrinology (all Charité University Berlin) for their support and helpful discussions. Finally, we appreciate very much the technical assistance provided by the fellow students Stefanie Zoll, Martin Straßenburg, and Anja Lude during their lab rotation projects. Funding Stefan Mergler is supported by DFG (Me 1706/14-1) about a TRP channel related research project and received a grant from the DFG priority program ThyroidTransAct (Me 1706/13-1). Noushafarin Khajavi is supported by the DFG project of Stefan Mergler (ThyroidTransAct) (Me 1706/13-1). The planar patch-clamp equipment was partially supported by Sonnenfeld-Stiftung (Berlin, Germany). Josef Köhrle received grants from the DFG priority program ThyroidTransAct (Ko 922/16-1 and 922/17-1). Author contribution statement

4.4. T1AM inhibits IL-6 release induced by TRPV1 activation In HCEC, TRPV1 activation with CAP leads to the release of IL-6, a pro-inflammatory cytokine as well as IL-8, a chemo-attractant [19,22,63]. In human corneal stromal fibroblasts, CAP-also induces increases in IL-6 release through Ca2+ transient mediated p38 MAPK pathway activation [11]. In this study, we also showed that CAP-induced Ca2+ influx leads to increases in IL-6 release in IOBA-NHC cells (Fig. 8). The blunting effects of either CPZ or T1AM on CAP-induced increases in IL-6 release mirror the effects of blocking TRPV1-induced signaling with either of two these agents. This correspondence indicates that declines in TRPV1 channel activation elicit through a downstream signaling pathway on IL-6 release. 4.5. Potential clinical relevance Dry eye disease is one of the most common world-wide ocular health problems for which there are no therapeutic options that selectively target its pathogenesis. Its treatment for the most part is limited to providing only palliative relief. It is a multi-factorial autoimmune mediated syndrome in which patients experience decreases in ocular surface hydration making them vulnerable to infection by infiltrating pathogens, which can result in ocular surface ulceration, tissue opacification and inflammation as well as even blindness. Identification of functional TRPM8 in conjunctival epithelial (IOBA-NHC) cells provides potential novel therapeutic options to treat this disease since TRPV1 antagonist elicited suppression of injury-induced stromal TRPV1 activation which reduces inflammation and fibrosis [19]. Our finding that TRPM8 activation also reduces TRPV1 activation suggests that cooling agents may have therapeutic value in reducing inflammation and fibrosis. On the other hand, TRPM8 antagonists may prove to be effective in a clinical

SM, NK, and PSR designed the study, analyzed the data, wrote and edited the manuscript. OS and JK contributed with their expertise in physiology and endocrinology, respectively, discussed data and edited the manuscript. NK performed PCR analysis and immunohistochemistry. NK and NS performed calcium measurements. NK, AL, and NS performed planar patch-clamp recordings and plot analyses. MS carried out the ELISA.

References [1] M.A. Lemp, G.N. Foulks, Ocul. Surf. 5 (2) (2007) 75–92. [2] A. Parra, R. Madrid, D. Echevarria, S. del Olmo, C. Morenilla-Palao, M.C. Acosta, et al., Nat. Med. 16 (12) (2010) 1396–1399. [3] S.S. Bharate, S.B. Bharate, ACS Chem. Neurosci. 3 (4) (2012) 248–267. [4] I.K. Gipson, P. Argüeso, Int. Rev. Cytol. 231 (2003) 1–49. [5] O.A. Candia, L.J. Alvarez, Prog. Retin. Eye Res. 27 (2) (2008) 197–212. [6] S. Mergler, M. Valtink, S. Takayoshi, Y. Okada, M. Miyajima, S. Saika, et al., Ophthalmic Res. 52 (3) (2014) 151–159. [7] S. Mergler, C. Mertens, M. Valtink, P.S. Reinach, V. Castelo Székely, N. Slavi, et al., Exp. Eye Res. 116 (2013) 337–349. [8] S. Mergler, Y. Cheng, S. Skosyrski, F. Garreis, P. Pietrzak, N. Kociok, et al., Exp. Eye Res. 94 (1) (2012) 157–173. [9] S. Mergler, F. Garreis, M. Sahlmüller, E.-M. Lyras, P.S. Reinach, A. Dwarakanath, et al., Histochem. Cell Biol. 137 (6) (2012) 743–761. [10] S. Mergler, M. Valtink, V.J. Coulson-Thomas, D. Lindemann, P.S. Reinach, K. Engelmann, et al., Exp. Eye Res. 90 (6) (2010) 758–770. [11] Y. Yang, H. Yang, Z. Wang, S. Mergler, J.M. Wolosin, P.S. Reinach, Exp. Eye Res. 107 (2013) 121–129. [12] S. Cordeiro, S. Seyler, J. Stindl, V.M. Milenkovic, O. Strauss, Invest. Ophthalmol. Vis. Sci. 51 (11) (2010) 6001–6008. [13] D.C. Crawford, K.L. Moulder, R.W. Gereau IV, G.M. Story, S. Mennerick, PLoS One 4 (12) (2009) e8166. [14] K. Kobayashi, T. Fukuoka, K. Obata, H. Yamanaka, Y. Dai, A. Tokunaga, et al., J. Comp. Neurol. 493 (4) (2005) 596–606. [15] S. Mergler, R. Derckx, P.S. Reinach, F. Garreis, A. Böhm, L. Schmelzer, et al., Cell. Signal. 26 (1) (2014) 56–69.

N. Khajavi et al. / Cellular Signalling 27 (2015) 315–325 [16] M. Tominaga, M. Numazaki, T. Iida, T. Moriyama, K. Togashi, T. Higashi, et al., Regulation Mechanisms of Vanilloid Receptors, Pathological Pain: From Molecular to Clinical Aspects. 2004. 4. [17] S. Ciura, C.W. Bourque, J. Neurosci. 26 (35) (2006) 9069–9075. [18] D.-Q. Li, L. Luo, Z. Chen, H.-S. Kim, X.J. Song, S.C. Pflugfelder, Exp. Eye Res. 82 (4) (2006) 588–596. [19] F. Zhang, H. Yang, Z. Wang, S. Mergler, H. Liu, T. Kawakita, et al., J. Cell. Physiol. 213 (3) (2007) 730–739. [20] T. Sumioka, Y. Okada, P.S. Reinach, K. Shirai, M. Miyajima, O. Yamanaka, et al., Invest. Ophthalmol. Vis. Sci. 55 (5) (2014) 3295–3302. [21] Y. Yang, H. Yang, Z. Wang, K. Varadaraj, S. Kumari, S. Mergler, et al., Cell. Signal. 25 (2) (2013) 501–511. [22] H. Yang, Z. Wang, J. Capo-Aponte, F. Zhang, Z. Pan, P. Reinach, Exp. Eye Res. 91 (3) (2010) 462–471. [23] T. Voets, G. Droogmans, U. Wissenbach, A. Janssens, V. Flockerzi, B. Nilius, Nature 430 (7001) (2004) 748–754. [24] Y. Yudin, T. Rohacs, Mol. Cell. Endocrinol. 353 (1) (2012) 68–74. [25] D.D. McKemy, W.M. Neuhausser, D. Julius, Nature 416 (6876) (2002) 52–58. [26] M. Pertusa, A. González, P. Hardy, R. Madrid, F. Viana, J. Biol. Chem. 289 (32) (2014) 21828–21843. [27] M. Bandell, A.E. Dubin, M.J. Petrus, A. Orth, J. Mathur, S.W. Hwang, et al., Nat. Neurosci. 9 (4) (2006) 493–500. [28] C.S. Hoefig, J. Köhrle, G. Brabant, K. Dixit, B. Yap, C.J. Strasburger, et al., J. Clin. Endocrinol. Metab. 96 (6) (2011) 1864–1872. [29] E. Cichero, S. Espinoza, R.R. Gainetdinov, L. Brasili, P. Fossa, Chem. Biol. Drug Des. 81 (4) (2013) 509–516. [30] C.S. Hoefig, K. Renko, S. Piehl, T.S. Scanlan, M. Bertoldi, T. Opladen, et al., Mol. Cell. Endocrinol. 349 (2) (2012) 195–201. [31] A. Saba, G. Chiellini, S. Frascarelli, M. Marchini, S. Ghelardoni, A. Raffaelli, et al., Endocrinology 151 (10) (2010) 5063–5073. [32] T.S. Scanlan, J. Clin. Endocrinol. Metab. 96 (6) (2011) 1674–1676. [33] T.S. Scanlan, K.L. Suchland, M.E. Hart, G. Chiellini, Y. Huang, P.J. Kruzich, et al., Nat. Med. 10 (6) (2004) 638–642. [34] L. Braulke, M. Klingenspor, A. DeBarber, S. Tobias, D. Grandy, T. Scanlan, et al., J. Comp. Physiol. B. 178 (2) (2008) 167–177. [35] A.E. DeBarber, T. Geraci, V.P. Colasurdo, S.A. Hackenmueller, T.S. Scanlan, J. Chromatogr. A 1210 (1) (2008) 55–59. [36] H.N. Panas, L.J. Lynch, E.J. Vallender, Z. Xie, Gl Chen, S.K. Lynn, et al., J. Neurosci. Res. 88 (9) (2010) 1962–1969. [37] R. Senese, F. Cioffi, P. De Lange, F. Goglia, A. Lanni, J. Endocrinol. 221 (2) (2014) R1–R12. [38] H.-Y. Lin, F.B. Davis, M.K. Luidens, S.A. Mousa, J.H. Cao, M. Zhou, et al., Front. Mol. Neurosci. 4 (2011). [39] G. Grynkiewicz, M. Poenie, R.Y. Tsien, J. Biol. Chem. 260 (6) (1985) 3440–3450.

325

[40] A. Brüggemann, S. Stoelzle, M. George, J.C. Behrends, N. Fertig, Small 2 (7) (2006) 840–846. [41] C.J. Milligan, J. Li, P. Sukumar, Y. Majeed, M.L. Dallas, A. English, et al., Nat. Protoc. 4 (2) (2009) 244–255. [42] M. Schieder, K. Rotzer, A. Bruggemann, M. Biel, C. Wahl-Schott, Sci. Signal. 3 (151) (2010) l3. [43] P.G. Kostyuk, O. Krishtal, V. Pidoplichko, Effect of Internal Fluoride and Phosphate on Membrane Currents During Intracellular Dialysis of Nerve Cells, 1975. [44] P.H. Barry, J. Neurosci. Methods 51 (1) (1994) 107–116. [45] N. Khajavi, P. Reinach, M. Skrzypski, A. Lude, S. Mergler, Cell. Physiol. Biochem. 34 (3) (2014) 790–803. [46] M. Valero, C. Morenilla-Palao, C. Belmonte, F. Viana, Arch. Eur. J. Physiol. 461 (1) (2011) 99–114. [47] L. Zhang, G.J. Barritt, Cancer Res. 64 (22) (2004) 8365–8373. [48] Y. Diebold, M. Calonge, A.E. de Salamanca, S. Callejo, R.M. Corrales, V. Sáez, et al., Invest. Ophthalmol. Vis. Sci. 44 (10) (2003) 4263–4274. [49] S. Mergler, M.Z. Strowski, S. Kaiser, T. Plath, Y. Giesecke, M. Neumann, et al., Neuroendocrinology 85 (2) (2007) 81–92. [50] X.-R. Yang, M.-J. Lin, L.S. McIntosh, J.S. Sham, Am. J. Physiol. Lung Cell. Mol. Physiol. 290 (6) (2006) L1267–L1276. [51] S. Mergler, M. Skrzypski, M. Sassek, P. Pietrzak, C. Pucci, B. Wiedenmann, et al., Cell. Signal. 24 (1) (2012) 233–246. [52] M. Tominaga, M.J. Caterina, J. Neurobiol. 61 (1) (2004) 3–12. [53] Chuang H-h, W.M. Neuhausser, D. Julius, Neuron 43 (6) (2004) 859–869. [54] S.M. Rawls, T. Gomez, Z. Ding, R.B. Raffa, Eur. J. Pharmacol. 575 (1) (2007) 103–104. [55] M.Y. Kochukov, T.A. McNearney, Y. Fu, K.N. Westlund, Am. J. Physiol. Cell Physiol. 291 (3) (2006) C424–C432. [56] S. Mergler, F. Garreis, M. Sahlmüller, P.S. Reinach, F. Paulsen, U. Pleyer, J. Cell. Physiol. 226 (7) (2011) 1828–1842. [57] G. Chiellini, S. Frascarelli, S. Ghelardoni, V. Carnicelli, S.C. Tobias, A. DeBarber, et al., FASEB J. 21 (7) (2007) 1597–1608. [58] A.G. Ianculescu, K.M. Giacomini, T.S. Scanlan, Endocrinology 150 (4) (2009) 1991–1999. [59] R. Ramachandran, E. Hyun, L. Zhao, T.K. Lapointe, K. Chapman, C.L. Hirota, et al., Proc. Natl. Acad. Sci. 110 (18) (2013) 7476–7481. [60] O. Grubisha, A.J. Mogg, J.L. Sorge, L.J. Ball, H. Sanger, C.L. Ruble, et al., Br. J. Pharmacol. 171 (10) (2014) 2631–2644. [61] V. Tékus, K. Bölcskei, Á. Kis-Varga, L. Dézsi, É. Szentirmay, A. Visegrády, et al., Eur. J. Pharmacol. 641 (2) (2010) 135–141. [62] R. Benko, L. Illényi, D. Kelemen, R. Papp, A. Papp, L. Bartho, Eur. J. Pharmacol. 674 (1) (2012) 44–50. [63] Z. Pan, Z. Wang, H. Yang, F. Zhang, P.S. Reinach, Invest. Ophthalmol. Vis. Sci. 52 (1) (2011) 485–493. [64] Y. Okada, P.S. Reinach, K. Shirai, A. Kitano, W.W.-Y. Kao, K.C. Flanders, et al., Am. J. Pathol. 178 (6) (2011) 2654–2664.