Exp Appl Acarol DOI 10.1007/s10493-015-9891-6
Ticks (Acari: Argasidae, Ixodidae) parasitizing bats in the central Balkans ´ akic´ • D. Mihaljica J. Burazerovic´ • S. C ´ • R. Sukara D. Cirovic´ • S. Tomanovic´
•
Received: 2 December 2014 / Accepted: 17 February 2015 Ó Springer International Publishing Switzerland 2015
Abstract Ticks parasitizing bats have been largely understudied, especially in the central part of the Balkan Peninsula, where the last data from the field research date from almost 25 years ago. Bats are hosts to a large number of ectoparasites, including ticks, which can act as vectors of zoonotic agents. For this reason, it is important to identify the distribution of ticks and their relationship to different hosts, including wild animals, bats in particular. The present research was conducted at 16 localities throughout Serbia, Montenegro, Bosnia and Herzegovina, and Former Yugoslav Republic of Macedonia (FYROM). We examined 475 individuals of bats belonging to 13 species. A total of three tick species were identified, I. simplex being the most numerous and widespread, followed by I. vespertilionis and A. vespertilionis. To the best of our knowledge, the presented data include the first records of I. simplex in Serbia and Montenegro, I. vespertilionis for Montenegro and A. vespertilionis in FYROM. Also, we identify a new possible host/parasite association between I. simplex and Rhinolophus euryale. Keywords
Bats Ticks Balkan Peninsula Ixodes sp. Argas sp.
Introduction Bats, with over 1116 species described (Simmons 2005) represent around a quarter of all mammalian species on Earth. They are increasingly recognized as reservoirs of emerging, mostly zoonotic, viral (Calisher et al. 2006) and bacterial (Mu¨hldorfer 2013) pathogens. Bats are hosts to a large number of ectoparasites, including ticks, which can act as vectors ´ irovic´ J. Burazerovic´ D. C Chair of Animal Ecology and Zoogeography, Faculty of Biology, University of Belgrade, Belgrade, Serbia S. C´akic´ D. Mihaljica R. Sukara S. Tomanovic´ (&) Laboratory for Medical Entomology, Department of Parasitology, Institute for Medical Research, University of Belgrade, Belgrade, Serbia e-mail: [email protected]
123
Exp Appl Acarol
of zoonotic agents. Due to their specific migrating behaviour (Hutterer et al. 2005; Flaquer et al. 2009), bats can cross barriers and move long distances in a short time, transmitting ticks and tick-borne pathogens. Three, possibly four, hard tick species have adapted to live exclusively on bats. All of them belong to the genus Ixodes. Ixodes simplex Neumann, 1906 is found mainly on Miniopterus schreibersii, I. kopsteini Oudemans, 1926 lives on mastiff bats (Tadarida sp.), and I. vespertilionis Koch 1844 parasitizes different bat species. All three species are found in the Old World and Australia, while in Europe I. simplex and I. vespertilionis are recorded (Kolonin 2007), together with the recently described species I. ariadnae Hornok et al. 2014, collected from caves and bats in Hungary (Hornok et al. 2014). Accidental findings of non-specific I. ricinus and I. trianguliceps have been recorded on bats in Poland and Slovakia (Siuda et al. 2009; Sˇevcˇik et al. 2010). In the family Argasidae, Argas vespertilionis Latreille, 1796 is a common tick recorded as a parasite of Old World bats (Hoogstraal 1985; Siuda et al. 2009; Manzano-Roma´n et al. 2012; Petney et al. 2012). Data on bat ticks from countries geographically situated in the central part of the Balkan Peninsula—Bosnia and Herzegovina, FYROM, Montenegro and Serbia—are very scarce and fragmented, and only a few published records are available in the literature. Most of the country-specific data actually derive from the time when these countries were united in the former Yugoslavian federation (Oswald 1940; Tovornik 1990). Furthermore, borders in this part of Europe have changed frequently in the past, which makes identification of exact locations even harder, especially if data derive before the time of the former Yugoslavian federation (Karaman 1937; Vrenozi and Dunlop 2013). The aim of this study is to fill in the gaps in knowledge about distribution of bat ticks in the Central Balkans as well as to provide more information about host-parasite interactions between cave-dwelling bats and ticks. Here we present new records of bat tick species, as well as a new parasite/host association, from the central Balkan Peninsula. Along with morphological identification of tick species, the research included applied molecular analysis of the cytochrome oxidase subunit I (COI) gene as a complementary method to the rather vague and incomplete available taxonomic keys and descriptions of bat tick species.
Materials and methods Collection of data The field work was conducted during the period April–October 2013, extensive study being suspended in late May through June until late July during the period of advanced pregnancy, delivery, and the first phase of nursing the young bats. Bats were caught using a mist net placed at cave entrances, while bats in their roosts (attics, cellars, caves) were taken by hand or with hand net, and released at the same site where caught. All bats caught were identified to the species level (Dietz et al. 2009). The whole body of the host was carefully examined, and any ticks found were removed with tweezers and placed in tubes with 70 % ethanol, and labelled appropriately. Ticks were separated by developmental stage and gender (adults) and identified to the species level using morphological keys (Pomerancev 1950; Arthur 1956). The preserved parasites are deposited in collections of the Laboratory of Medical Entomology, Institute for Medical Research, University of Belgrade.
123
Exp Appl Acarol
DNA isolation, amplification, sequencing, and sequence analysis In order to confirm morphological identification of Ixodes species which was based on the rather vague and incomplete available taxonomic keys, randomly selected tick samples were chosen for further molecular analysis. DNA was extracted from whole ticks or legs, using Kapa Express Extract Kit (Kapa Biosystems) according to manufacturer’s instructions. DNA extracts were stored at -80 °C until PCR amplification. For amplification of cytochrome oxidase subunit I gene (COI) universal primers LCO1490 (forward: 50 GGTCAACAAATCATAAAGATA TTGG 30 ) and HCO2198 (reverse: 50 TAAACTTCAGGGTGACCAAAAAATCA 30 ) were used (Folmer et al. 1994). PCR reaction was performed with 2 ll of extracted DNA as template. Each 50 ll reaction consisted of 17 ll H2O, 25 ll of Kapa 2G Robust Hot Start Ready Mix (Kapa Biosystems) and 3 ll of each of the two primers. An initial denaturation at 94 °C for 3 min was followed by ten cycles (denaturation at 95 °C of 15 s., annealing at 49 °C for 15 s and extended at 72 °C for 15 s.), additional 35 cycles (denaturation at 95 °C of 15 s., annealing at 53 °C for 15 s and extended at 72 °C for 15 s.) and final extension at 72 °C for 10 min. To confirm the efficiency of amplification, products were analysed by 2 % agarose gel electrophoresis. Products proven to be positive after agarose gel electrophoresis underwent sequencing. DNA sequencing, including primer walking was performed by Macrogen Inc. Amsterdam Netherlands. The representative sequences were deposited in the GenBank database under accession numbers (I. simplex KJ997948, KM062041; I. vespertilionis KM062042, KM062043)
Fig. 1 Map with visited localities: open circle locality with no recording of any tick species, closed circle locality with Ixodes vespertilionis present, closed triangle locality with I. simplex present, closed square locality with I. vespertilionis and I. simplex present, closed star locality with Argas vespertilionis present
123
Exp Appl Acarol
The standard nucleotide blast tool (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was used to align obtained sequences with mtDNA sequences available in GenBank. Additional alignment was performed using Clustal W Multiple Alignment (Thompson et al. 1994). For phylogenetic analysis, additional mtDNA COI sequences of I. vespertilionis and I. simplex originating from the geographically closest locations (Hungary) were included, together with taxonomically related Ixodes species (I. ariadnae, I. lividus, I. redikorzevi and I. ricinus) available in GenBank. Preliminary phylogenetic analyses were performed with MEGA 5.2 (Tamura et al. 2011) using both the Neighbor-joining and maximum likelihood tree reconstruction methods. Genetic distances between sequences were calculated by Kimura’s twoparameter method (K2P) of base substitution. In phylogenetic analyses, the Rhipicephalus sanguineus mtDNA COI sequence was used as an out group (GenBank KF437543).
Results Data were gathered at 16 localities in four countries of the central part of the Balkan Peninsula: Serbia, Montenegro, Bosnia and Herzegovina, and FYROM (Fig. 1). A total of 475 individuals belonging to 13 bat species were collected and examined: Rhinolophus
Fig. 2 Relationship between bat and tick species with corresponding number of samples recorded in this research. The size of the circles correlates with the number of bat/tick samples. The thickness of the arrows indicate number of ticks parasitizing on the specific bat species
123
2/3
1/1
1/4
Myotis mystacinus
1/4
1/2
1/2
1/23
1/11
1/21
3/21
1/19
Pipistrellus pipistrellus
Rhinolophus ferrumequinum
Rhinolophus euryale
67/165
Miniopterus schreibersii
14/35
No. of infested bats/No of examined bats
Host species
Table 1 Ticks parasitizing bats on analyzed localities
Orchard in village Selce
Petnicˇka pec´ina cave Lazareva pec´ina cave
Petnicˇka pec´ina cave Zacˇirska pec´ina cave Jama Sˇutonjic´a cave
Former Yugoslav Republic of Macedonia
Serbia
Montenegro
Serbia
Serbia
Deguric´ka pec´ina cave Petnicˇka pec´ina cave Ogorelicˇka pec´ina cave Hadzˇi-Prodanova pec´ina cave Sˇalitrena pec´ina cave
Country
Locality
Argas vespertilionis
I. vespertilionis
I. vespertilionis
I. simplex
I. vespertilionis
I. vespertilionis
I. vespertilionis
Ixodes vespertilionis
I. simplex
I. simplex
I. simplex
I. simplex
Ixodes simplex
Tick species
1
1
10
7
Adults
1
1
1
2
12
78
Nymphs
1
1
2
1
4
2
8
32
Larvae
Exp Appl Acarol
123
Exp Appl Acarol
euryale, R. ferrumequinum, R. hipposideros, M. blythii, Myotis capaccinii, M. daubentonii, M. emarginatus, M. myotis, M. mystacinus, Nyctalus noctula, Pipistrellus pipistrellus, Plecotus austriacus, Miniopterus schreibersii. The highest diversity of bats was found in western Serbia (Petnicˇka pec´ina cave—eight species, Deguric´ka pec´ina cave—five species and Sˇalitrena pec´ina cave—five species) and Montenegro (Zacˇirska pec´ina cave—five species and Jama Sˇutonjic´a cave—five species). Ticks were found on five species of bats: R. euryale, R. ferrumequinum, M. schreibersii, M. mystacinus and P. pipistrellus. Out of 16 visited localities, bats with ticks were found at nine. Ticks were found at six out of seven localities in Serbia, two out of three localities in Montenegro, and one out of three localities in FYROM. No ticks were recorded on bats caught in Bosnia and Herzegovina. Overall, 94 individuals (19.79 %) of the total number of examined bats were parasitized by one or more tick individuals. The usual predilection sites of ticks on bats were: around the mouth, around the eyes, on and around the ears, and on the dorsal and ventral side of the body close to the patagium. A total of 165 ticks were collected: 158 specimens of Ixodes simplex (18 females, 92 nymphs, and 48 larvae); six specimens of Ixodes vespertilionis (one female, two nymphs and three larvae) and one larva of Argas vespertilionis. Ixodes simplex was found on two bat species—M. schreibersii (156/158 ticks) and R. euryale (2/ 158); I. vespertilionis was recorded on four bat species—R. euryale (3/6 ticks), R. ferrumequinum (1/6), M. schreibersii (1/6) and M. mystacinus (1/6); while a single specimen of A. vespertilionis was found on P. pipistrellus (Fig. 2). The prevalence of animals infested with I. simplex was the highest among bats of the species M. schreibersii (87/281–30.96 %), while we found only one larva on one R. euryale (1/39–2.56 %). The bat species most frequently infested with I. vespertilionis was
Fig. 3 Phylogenetic relationship of Ixodes simplex and I. vespertilionis COI gene sequences obtained in the present study (bold) in comparison with representative Ixodes spp. and Rhipicephalus sanguineus sequences available in the GenBank
123
Exp Appl Acarol
M. mystacinus (1/6–16.66 %), followed by R. euryale (3/39–7.69 %), R. ferrumequinum (1/21–4.76 %) and M. schreibersii (1/281–0.36 %) (Table 1). Molecular analysis was successful for three specimens of I. simplex and two specimens of I. vespertilionis. Sequencing yielded four different genotypes (two genotypes of I. simplex and two genotypes of I. vespertilionis). Molecular and phylogenetic analysis confirmed the standard morphological identification and taxonomic status of the analyzed ticks (Fig. 3).
Discussion and conclusion The findings presented in this paper reveal new aspects of the distribution and host range of ticks parasitizing bats from the central part of the Balkan Peninsula. Our data include the first records of I. simplex in Serbia and Montenegro, I. vespertilionis in Montenegro, and A. vespertilionis in FYROM. The most widespread tick species collected during this study was I. simplex (six out of 16 localities), I. vespertilionis was collected at five out of 16 localities, while A. vespertilionis was recorded only at one location in the western part of FYROM, in a habitat that was not a cave – it was found on a common pipistrelle bat caught in a mist net in an old orchard. All other ticks were collected from bats caught in caves. Previous data on bats of the families Vespertilionidae and Rhinolophidae in Europe indicated that I. vespertilionis is the dominant species (Arthur 1956, 1963; Walter and Kock 1985), while information about I. simplex remained mostly fragmented and scarce. In our research I. simplex is both the most widespread and the most numerous species. Starting from the beginning of the twentieth century, in the territory of former Yugoslavia, I. vespertilionis was reported in all republics except Montenegro (Neumann 1916; Oswald 1940; Arthur 1956; Tovornik 1990). The presence of the species was documented in the following surrounding countries as well: Hungary (Neumann 1916; Arthur 1956; Siuda et al. 2009; Hornok et al. 2012), Bulgaria (Arthur 1956; Beron et al. 2011), and Romania (Mihalca et al. 2012). Our records of this species for Montenegro confirmed assumptions of its presence there based on its previously observed wide distribution in the region. As hosts of I. vespertilionis, we recorded M. schreibersii (Sˇalitrena pec´ina cave), R. euryale (Petnicˇka and Zacˇirska pec´ina caves, Jama Sˇutonjic´a cave), Rhinolophus ferrumequinum (Petnicˇka pec´ina cave) and M. mystacinus (Lazareva pec´ina cave) - all species previously identified as hosts. In Europe most records of I. vespertilionis are from bats belonging to the genus Rhinolophus (R. ferrumequinum, R. hipposideros, R. euryale), but it is also recorded from other species (M. myotis, M. blythii, M. mystacinus, M. alcathoe, M. daubentonii, M. schreibersii, Plecotus auritus, Nyctalus noctula and Pipistrellus pygmeus). Thus it appears to be less host-specific than I. simplex (Arthur 1956; Danko et al. 2010; Sˇevcˇik et al. 2010; Mihalca et al. 2012; Petney et al. 2012). Previous data for Serbia (Tovornik 1990) reported two locations in the eastern part of the country, where specimens were collected only from cave walls. During our research the ticks were collected for the first time directly from bats, confirming suspected host species. Concerning I. simplex, up to our research there was no reliable published information indicating its presence in this part of the Balkan Peninsula. Confusion is caused by the inconstancy of borders between the former Yugoslav republics. Karaman (1937) refers to findings of I. simplex in ‘‘southern Serbia’’, but this locality most likely belongs to the recent FYROM.
123
Exp Appl Acarol
Ixodes simplex is known to inhabit caves and feeds exclusively on bats, especially M. schreibersii. Beaucornu (1967) and Haitlinger and Rupert (1985) cited M. schreibersii as the main host of this tick species. However, several authors reported the given tick from other host taxa as well, e.g., R. ferrumequinum (Nuttall et al. 1908), M. myotis (Walter and Kock 1985) and Rhinolophus affinis (Kolonin 2003). According to Sˇevcˇik et al. (2010), I. simplex was found on M. myotis in Poland, which is an area outside the range of its main host, M. schreibersii (Haitlinger and Rupert 1985). They also report I. simplex on Rhinolophus hipposideros, but assume it to be an occasional host species. The specimens collected in the present study were mainly parasitizing M. schreibersii in Serbia. At one locality in Montenegro (Jama Sˇutonjic´a cave), we collected a specimen of I. simplex from R. euryale, indicating a possible new host/parasite association. To the best of our knowledge, the presence of I. simplex on this particular bat species has not been recorded to date and could be explained by a transfer from its main bat host, M. schreibersii, whose presence was recorded in the same roost where the affected individual of R. euryale was found. The absence of ticks on bats collected at three localities in Bosnia and Herzegovina can be attributed to the small number of bats caught for tick collection and the fact that they belonged to species not identified as hosts of any ticks in this study (R. hipposideros and M. blythii). The majority of collected samples were nymphal and larval ticks, so we performed molecular analysis of barcoding mtCOI sequences from representative I. simplex and I. vespertilionis specimens in order to confirm morphological identification based on keys of Pomerancev (1950) and Arthur (1956) lacking data on subadult stages or presenting only free-hand drawings. The sequencing results confirmed morphological identification and taxonomic status, but since we noticed a certain level of heterogeneity (five sequences yielded four different genotypes) in the analyzed sequences, further phylogeographic study is planned. The present paper also represents the first reliable finding of A. vespertilionis for FYROM, as in the literature only vague information exists in a work giving the Regional disease vector ecology profile for Central Europe (www.afpmb.org/sites/default/files/pubs/ dveps/CentralEurope.pdf) with no reference to any paper, author, locality, or date of finding this tick species. Argas vespertilionis is a widely distributed tick species mainly specialized for feeding on bats as hosts and occurs throughout Europe, Asia, and Africa, ranging from the British Isles in the west to Japan, Korea, and India in Asia (Siuda et al. 2009; Petney et al. 2012). Hosts are predominantly bats (Siuda et al. 2009), the genus Pipistrellus having been identified as the preferred one. It is found on 14 of 25 Poland’s bat species and on five of 28 Slovak bat species (Siuda et al. 2009), including both cavedwelling and forest bats. According to Siuda et al. (2009), A. vespertilionis occurs in breeding and transient colonies, attics, burrows, tree holes, and caves. Due to this wide scope of habitats, it can be expected to occur on a large number of bat species. It also parasitizes bats in synanthropic and semi-synanthropic habitats, where it hides in the cracks of walls of buildings and caves, as well as under piles of guano (Nowak-Chmura and Siuda 2012). Argas vespertilionis is known to attack humans and domestic animals and has been reported to be ‘‘highly aggressive’’ (Hoogstraal 1985; Estrada-Pen˜a and Jongejan 1999). Another important feature of this tick species is that it has been associated with several pathogens of human and animal importance: Issyk Kul virus and Sokuluk virus (Hoogstraal 1985; Gavrilovskaya 2001; de la Fuente et al. 2008), Borrelia burgdoferi sensu lato (Hubbard et al. 1998),Coxiella burnetii and Wolbachia sp. (Nowak-Chmura and Siuda
123
Exp Appl Acarol
2012). Evans et al. (2009) reported a fatal case of relapsing fever in a pipistrelle bat (Pipistrellus sp.) in the United Kingdom caused by a new and unknown Borrelia species, assumed to be transferred to the bat by a tick of the species A. vespertilionis found attached to the bat. Socolovschi et al. (2012) analyzed five specimens of this tick species and found a new genotype of Rickettsia sp., new species of the Ehrlichia canis group and Borrelia sp. CPB1, a relapsing fever agent of the Borrelia group that caused the fatal borreliosis in a bat in the United Kingdom previously reported by Evans et al. (2009). To judge from the scarce data available, the medical importance of the recorded Ixodes species appears to be minor. However, Hornok et al. (2012) isolated for the first time Bartonella sp. from a female I. vespertilionis, implying an association of bartonellae with Rhinolophus sp. and M. myotis. Although known to be specialized for feeding on bats, the recently reported first case of human infestation by I. vespertilionis indicates the potential medical importance of this tick species (Piksa et al. 2013). As for I. simplex, no data indicating any medical significance have been found so far. From the viewpoints of public health and conservation medicine, it is necessary to emphasize the importance of wildlife species known to be tick hosts and potential tickborne pathogen reservoirs as sentinel species ideal for monitoring the presence of tickborne diseases in specific ecosystems. The role of bats with their specific biology and behaviour as potential reservoirs of vector-borne pathogens, especially viruses, is coming into focus. Further systematic studies are required to discern the enzootic cycles of tickborne pathogens involving bats as host and reservoir species. An awareness on the part of professionals and recreationists visiting specific bat habitats, as well as residents, veterinarians, and health professionals in areas where synanthropic bat species occur—would be of great importance for efficient monitoring of these zoonotic diseases. Acknowledgments This work was supported by a grant from the Ministry of Education, Science and Technological Development of the Republic of Serbia (Project No. 173006). The work of ST was done under the frame of EurNegVec COST Action TD1303. The authors wish to express their gratitude to all collaborators in the field who helped in identification of bat roosts and field work for this study: Milosˇ Pavic´evic´, Marina Ðurovic´ and Veso Mijusˇkovic´ from Montenegro, Dejan Radosˇevic´, Mladen Samardzˇic´ and Jelena Golijanin from Bosnia and Herzegovina, Darko Dragulovic´, Petar Petrovic´, Nina Bosˇkovic´ and students of the Faculty of Biology at the University of Belgrade from Serbia.
References Arthur DR (1956) The Ixodes ticks of Chiroptera (Ixodoidea, Ixodidae). J Parasitol 7:180–196 Arthur DR (1963) British ticks. Butterworth, London Beaucornu JC (1967) Contribution a` la connaissance de la biologie d’Ixodes(Eschatocephalus) vespertilionis Koch 1844 et d’Ixodes (Pomerantzerella) simplex Neumann 1906 (Acarina, Ixododidea) parasites des Chiropte`res. Ann Spe´le´ol 22:543–580 (in French) Beron P, Petrov B, Stoev P (2011) The invertebrate cave fauna of the Western Rhodopes (Bulgaria and Greece). In: Beron P (ed) Biodiversity of Bulgaria 4. Biodiversity of Western Rhodopes (Bulgaria and Greece) II. Pensoft & National Museum of Natural History, Sofia, pp 583–660 Calisher CH, Childs JE, Field HE, Holmes KV, Schountz T (2006) Bats: important reservoir host of emerging viruses. Clin Microbiol Rev 19:531–545 Danko Sˇ, Krisˇtin A, Krisˇtofik J (2010) Myotis alcathoe in eastern Slovakia: occurrence, diet, ectoparasites and notes on its identification in the field. Vespertilio 13–14:77–91 De la Fuente J, Estrada-Pen˜a A, Venzal JM, Kocan KM, Sonenshine DE (2008) Overview: ticks as vectors of pathogens that cause disease in humans and animals. Front Biosci 1:6938–6946 Dietz C, von Helversen O, Nill D (2009) Bats of Britain, Europe & Northwest Africa. A & C Black Publishers Ltd., London
123
Exp Appl Acarol Estrada-Pen˜a A, Jongejan F (1999) Ticks feeding on humans: a review of records on human-biting Ixodoidea with special reference to pathogen transmission. Exp Appl Acarol 23:685–715 Evans NJ, Bown K, Timofte D, Simpson VR, Birtles RJ (2009) Fatal borreliosis in bat caused by relapsing fever spirochete, United Kingdom. Emerg Infect Dis 15:1331–1333 Flaquer C, Puig-Montserrat X, Goiti U, Vidal F, Curco´ A, Russo D (2009) Habitat selection in Nathusius’ pipistrelle (Pipistrellus nathusii): the importance of wetland. Acta Chiropterol 11:149–155 Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol 3:294–299 Gavrilovskaya IN (2001) Issyk-Kul virus disease. In: Service MW (ed) The encyclopedia of arthropodtransmitted infections of man and domesticated animals. CABI Publishing, Wallingford, pp 231–234 Haitlinger R, Rupert AL (1985) Stawonogi zebrane na nietoperzach z Kujaw (Acari, Siphonaptera) [Arthropods collected from bats in Kujawy (Acari, Siphonaptera)]. PJE 55:615–618 (in Polish, with a summary in English) Hoogstraal H (1985) Argasid and Nuttalliellid ticks as parasites and vectors. Adv Parasitol 24:135–238 Hornok S, Kovacs R, Meli ML, Gonczi E, Hofmann-Lehmann R, Kontschan J, Gyuranecz M, Dan A, Molnar V (2012) First detection of bartonellae in a broad range of bat ectoparasites. Vet Microbiol 159:541–543 Hornok S, Kontscha´n J, Kova´ts D, Kova´cs R, Angyal D, Go¨rfo¨l T, Polacsek Z, Kalma´r Z, Mihalca AD (2014) Bat ticks revisited: Ixodes ariadnae sp. nov. and allopatric genotypes of I. vespertilionis in caves of Hungary. Parasites Vectors 7:202 Hubbard MJ, Baker AS, Cann KJ (1998) Distribution of Borrelia burgdorferi s.l. spirochaete DNA in British ticks (Argasidae and Ixodidae) since the 19th century, assessed by PCR. Med Vet Entomol 12:89–97 Hutterer R, Ivanova T, Meyer-Cords C, Rodrigues L (2005) Bat migration in Europe. A review of banding data and literature. Federal Agency of Nature Conservation, Bonn Karaman S (1937) Fauna Juzˇne Srbije, Spomenica dvadesetpetogodisˇnjice oslobodenja Juzˇne Srbije, Jovanovic A (Ed) Spomenica, Skoplje, pp 161–179 (in Serbian) Kolonin GV (2003) New data on ixodid tick fauna of Vietnam. Entomol Rev (Engl Transl) 83:190–192 Kolonin GV (2007) Mammals as hosts of Ixodid ticks (Acarina, Ixodidae). Entomol Rev 87:401–412 Manzano-Roma´n R, Dı´az-Martı´n V, de la Fuente J, and Pe´rez-Sa´nchez R (2012) Soft ticks as pathogen vectors: distribution, surveillance and control, Parasitology, Shah MM (Ed), ISBN: 978-953-51-01499, InTech, Available from http://www.intechopen.com/books/parasitology/softticks-as-pathogenvectors-distribution-surveillance-and-control Mihalca AD, Dumitrache MO, Magdas¸ C, Gherman CM, Doms¸ a C, Mircean V, Ghira IV, Pocora V, Ionescu DT, Siko´ Baraba´si S, Cozma V, Sa´ndor AD (2012) Synopsis of the hard ticks (Acari: Ixodidae) of Romania with update on host associations and geographical distribution. Exp Appl Acarol 58:183–206 Mu¨hldorfer K (2013) Bats and bacterial pathogens: a review. Zoonoses Public Health 60:93–103 Neumann LG (1916) Ixodide´s (acariens). Premie`re se´rie. Arch Zool Expkr et Gen Paris 55:517–527 Nowak-Chmura M, Siuda K (2012) Ticks of Poland. Review of contemporary issues and latest research. Ann Parasitol 58:125–155 Nuttall GHF, Cooper WF, Robinson LE (1908) On the structure of the spiracles of a tick—Haemaphysalis punctata, Canestrini and Fanzago. Parasitol 1:347–351 Oswald B (1940) Determination of Yugoslavian (Balkan) ticks (Ixodoidea). Vet Arch 6:297–304 Petney TN, Pfa¨ffle PM, Skuballa JD (2012) An annotated checklist of the ticks (Acari: ixodida) of Germany. Syst Appl Acarol 17:115–170 Piksa K, Nowak-Chmura M, Siuda K (2013) First case of human infestation by the tick Ixodes vespertilionis (Acari: Ixodidae). Int J Acarol 39:1–2 Pomerancev BL (1950) Fauna SSSR. Paukoobrazovanie Ixodovie klesˇc´ei (Ixodidae). Izd Akadem Nauk SSSR 4(2):2–15 (In Russian) Regional disease vector ecology profile for Central Europe, group of authors, 2001, http://www.afpmb.org/ sites/default/files/pubs/dveps/CentralEurope.pdf Sˇevcˇik M, Krisˇtofik J, Uhrin M, Benda P (2010) New records of ticks (Acari: Ixodidae) parasitizing on bats in Slovakia. Vespertilio 13–14:139–147 Simmons NB (2005) Order Chiroptera. In: Wilson DE, Reeder DM (eds) Mammal species of the world, vol 1, 3rd edn. Johns Hopkins University Press, Baltimore, pp 312–529 Siuda K, Stanko M, Piksa K, Go´rz A (2009) Ticks (Acari: Ixodida) parasitizing on bats in Poland and Slovakia. Wiad Parazit 55:39–45 Socolovschi C, Kernif T, Raoult D, Parola P (2012) Borrelia, Rickettsia, and Ehrlichia species in bat ticks, France, 2010. Emerg Infect Dis 18:1966–1975
123
Exp Appl Acarol Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28:2731–2739 Thompson JD, Higgins DG, Gibson TJ (1994) Clustal W: improving the sensitivity of progressive multiple sequence alignment through weighting, position-specific gap penalties and weight matrix. Nucleic Acids Res 22:4673–4680 Tovornik D (1990) Ixodes (Eschatocephalus) vespertilionis Koch, 1844 (Arachn., Ixodidae) regarding its specific hosts and natural habitats (Slovenia, Yugoslavia). Acta entomol Jug 23:15–28 Vrenozi B, Dunlop J (2013) Albanian arachnids in the Museum fu¨r Naturkunde, Berlin. Arachnol 16:10–15 Walter G, Kock D (1985) Records of Ixodes vespertilionis, I. simplex and Argas vespertlionis (Ixodoidea: Ixodidae, Argasidae) from German bats (Chiroptera). Z Parasit 71:07–111
123
Ticks (Acari: Argasidae, Ixodidae) parasitizing bats in the central Balkans ´ akic´ • D. Mihaljica J. Burazerovic´ • S. C ´ • R. Sukara D. Cirovic´ • S. Tomanovic´
•
Received: 2 December 2014 / Accepted: 17 February 2015 Ó Springer International Publishing Switzerland 2015
Abstract Ticks parasitizing bats have been largely understudied, especially in the central part of the Balkan Peninsula, where the last data from the field research date from almost 25 years ago. Bats are hosts to a large number of ectoparasites, including ticks, which can act as vectors of zoonotic agents. For this reason, it is important to identify the distribution of ticks and their relationship to different hosts, including wild animals, bats in particular. The present research was conducted at 16 localities throughout Serbia, Montenegro, Bosnia and Herzegovina, and Former Yugoslav Republic of Macedonia (FYROM). We examined 475 individuals of bats belonging to 13 species. A total of three tick species were identified, I. simplex being the most numerous and widespread, followed by I. vespertilionis and A. vespertilionis. To the best of our knowledge, the presented data include the first records of I. simplex in Serbia and Montenegro, I. vespertilionis for Montenegro and A. vespertilionis in FYROM. Also, we identify a new possible host/parasite association between I. simplex and Rhinolophus euryale. Keywords
Bats Ticks Balkan Peninsula Ixodes sp. Argas sp.
Introduction Bats, with over 1116 species described (Simmons 2005) represent around a quarter of all mammalian species on Earth. They are increasingly recognized as reservoirs of emerging, mostly zoonotic, viral (Calisher et al. 2006) and bacterial (Mu¨hldorfer 2013) pathogens. Bats are hosts to a large number of ectoparasites, including ticks, which can act as vectors ´ irovic´ J. Burazerovic´ D. C Chair of Animal Ecology and Zoogeography, Faculty of Biology, University of Belgrade, Belgrade, Serbia S. C´akic´ D. Mihaljica R. Sukara S. Tomanovic´ (&) Laboratory for Medical Entomology, Department of Parasitology, Institute for Medical Research, University of Belgrade, Belgrade, Serbia e-mail: [email protected]
123
Exp Appl Acarol
of zoonotic agents. Due to their specific migrating behaviour (Hutterer et al. 2005; Flaquer et al. 2009), bats can cross barriers and move long distances in a short time, transmitting ticks and tick-borne pathogens. Three, possibly four, hard tick species have adapted to live exclusively on bats. All of them belong to the genus Ixodes. Ixodes simplex Neumann, 1906 is found mainly on Miniopterus schreibersii, I. kopsteini Oudemans, 1926 lives on mastiff bats (Tadarida sp.), and I. vespertilionis Koch 1844 parasitizes different bat species. All three species are found in the Old World and Australia, while in Europe I. simplex and I. vespertilionis are recorded (Kolonin 2007), together with the recently described species I. ariadnae Hornok et al. 2014, collected from caves and bats in Hungary (Hornok et al. 2014). Accidental findings of non-specific I. ricinus and I. trianguliceps have been recorded on bats in Poland and Slovakia (Siuda et al. 2009; Sˇevcˇik et al. 2010). In the family Argasidae, Argas vespertilionis Latreille, 1796 is a common tick recorded as a parasite of Old World bats (Hoogstraal 1985; Siuda et al. 2009; Manzano-Roma´n et al. 2012; Petney et al. 2012). Data on bat ticks from countries geographically situated in the central part of the Balkan Peninsula—Bosnia and Herzegovina, FYROM, Montenegro and Serbia—are very scarce and fragmented, and only a few published records are available in the literature. Most of the country-specific data actually derive from the time when these countries were united in the former Yugoslavian federation (Oswald 1940; Tovornik 1990). Furthermore, borders in this part of Europe have changed frequently in the past, which makes identification of exact locations even harder, especially if data derive before the time of the former Yugoslavian federation (Karaman 1937; Vrenozi and Dunlop 2013). The aim of this study is to fill in the gaps in knowledge about distribution of bat ticks in the Central Balkans as well as to provide more information about host-parasite interactions between cave-dwelling bats and ticks. Here we present new records of bat tick species, as well as a new parasite/host association, from the central Balkan Peninsula. Along with morphological identification of tick species, the research included applied molecular analysis of the cytochrome oxidase subunit I (COI) gene as a complementary method to the rather vague and incomplete available taxonomic keys and descriptions of bat tick species.
Materials and methods Collection of data The field work was conducted during the period April–October 2013, extensive study being suspended in late May through June until late July during the period of advanced pregnancy, delivery, and the first phase of nursing the young bats. Bats were caught using a mist net placed at cave entrances, while bats in their roosts (attics, cellars, caves) were taken by hand or with hand net, and released at the same site where caught. All bats caught were identified to the species level (Dietz et al. 2009). The whole body of the host was carefully examined, and any ticks found were removed with tweezers and placed in tubes with 70 % ethanol, and labelled appropriately. Ticks were separated by developmental stage and gender (adults) and identified to the species level using morphological keys (Pomerancev 1950; Arthur 1956). The preserved parasites are deposited in collections of the Laboratory of Medical Entomology, Institute for Medical Research, University of Belgrade.
123
Exp Appl Acarol
DNA isolation, amplification, sequencing, and sequence analysis In order to confirm morphological identification of Ixodes species which was based on the rather vague and incomplete available taxonomic keys, randomly selected tick samples were chosen for further molecular analysis. DNA was extracted from whole ticks or legs, using Kapa Express Extract Kit (Kapa Biosystems) according to manufacturer’s instructions. DNA extracts were stored at -80 °C until PCR amplification. For amplification of cytochrome oxidase subunit I gene (COI) universal primers LCO1490 (forward: 50 GGTCAACAAATCATAAAGATA TTGG 30 ) and HCO2198 (reverse: 50 TAAACTTCAGGGTGACCAAAAAATCA 30 ) were used (Folmer et al. 1994). PCR reaction was performed with 2 ll of extracted DNA as template. Each 50 ll reaction consisted of 17 ll H2O, 25 ll of Kapa 2G Robust Hot Start Ready Mix (Kapa Biosystems) and 3 ll of each of the two primers. An initial denaturation at 94 °C for 3 min was followed by ten cycles (denaturation at 95 °C of 15 s., annealing at 49 °C for 15 s and extended at 72 °C for 15 s.), additional 35 cycles (denaturation at 95 °C of 15 s., annealing at 53 °C for 15 s and extended at 72 °C for 15 s.) and final extension at 72 °C for 10 min. To confirm the efficiency of amplification, products were analysed by 2 % agarose gel electrophoresis. Products proven to be positive after agarose gel electrophoresis underwent sequencing. DNA sequencing, including primer walking was performed by Macrogen Inc. Amsterdam Netherlands. The representative sequences were deposited in the GenBank database under accession numbers (I. simplex KJ997948, KM062041; I. vespertilionis KM062042, KM062043)
Fig. 1 Map with visited localities: open circle locality with no recording of any tick species, closed circle locality with Ixodes vespertilionis present, closed triangle locality with I. simplex present, closed square locality with I. vespertilionis and I. simplex present, closed star locality with Argas vespertilionis present
123
Exp Appl Acarol
The standard nucleotide blast tool (http://blast.ncbi.nlm.nih.gov/Blast.cgi) was used to align obtained sequences with mtDNA sequences available in GenBank. Additional alignment was performed using Clustal W Multiple Alignment (Thompson et al. 1994). For phylogenetic analysis, additional mtDNA COI sequences of I. vespertilionis and I. simplex originating from the geographically closest locations (Hungary) were included, together with taxonomically related Ixodes species (I. ariadnae, I. lividus, I. redikorzevi and I. ricinus) available in GenBank. Preliminary phylogenetic analyses were performed with MEGA 5.2 (Tamura et al. 2011) using both the Neighbor-joining and maximum likelihood tree reconstruction methods. Genetic distances between sequences were calculated by Kimura’s twoparameter method (K2P) of base substitution. In phylogenetic analyses, the Rhipicephalus sanguineus mtDNA COI sequence was used as an out group (GenBank KF437543).
Results Data were gathered at 16 localities in four countries of the central part of the Balkan Peninsula: Serbia, Montenegro, Bosnia and Herzegovina, and FYROM (Fig. 1). A total of 475 individuals belonging to 13 bat species were collected and examined: Rhinolophus
Fig. 2 Relationship between bat and tick species with corresponding number of samples recorded in this research. The size of the circles correlates with the number of bat/tick samples. The thickness of the arrows indicate number of ticks parasitizing on the specific bat species
123
2/3
1/1
1/4
Myotis mystacinus
1/4
1/2
1/2
1/23
1/11
1/21
3/21
1/19
Pipistrellus pipistrellus
Rhinolophus ferrumequinum
Rhinolophus euryale
67/165
Miniopterus schreibersii
14/35
No. of infested bats/No of examined bats
Host species
Table 1 Ticks parasitizing bats on analyzed localities
Orchard in village Selce
Petnicˇka pec´ina cave Lazareva pec´ina cave
Petnicˇka pec´ina cave Zacˇirska pec´ina cave Jama Sˇutonjic´a cave
Former Yugoslav Republic of Macedonia
Serbia
Montenegro
Serbia
Serbia
Deguric´ka pec´ina cave Petnicˇka pec´ina cave Ogorelicˇka pec´ina cave Hadzˇi-Prodanova pec´ina cave Sˇalitrena pec´ina cave
Country
Locality
Argas vespertilionis
I. vespertilionis
I. vespertilionis
I. simplex
I. vespertilionis
I. vespertilionis
I. vespertilionis
Ixodes vespertilionis
I. simplex
I. simplex
I. simplex
I. simplex
Ixodes simplex
Tick species
1
1
10
7
Adults
1
1
1
2
12
78
Nymphs
1
1
2
1
4
2
8
32
Larvae
Exp Appl Acarol
123
Exp Appl Acarol
euryale, R. ferrumequinum, R. hipposideros, M. blythii, Myotis capaccinii, M. daubentonii, M. emarginatus, M. myotis, M. mystacinus, Nyctalus noctula, Pipistrellus pipistrellus, Plecotus austriacus, Miniopterus schreibersii. The highest diversity of bats was found in western Serbia (Petnicˇka pec´ina cave—eight species, Deguric´ka pec´ina cave—five species and Sˇalitrena pec´ina cave—five species) and Montenegro (Zacˇirska pec´ina cave—five species and Jama Sˇutonjic´a cave—five species). Ticks were found on five species of bats: R. euryale, R. ferrumequinum, M. schreibersii, M. mystacinus and P. pipistrellus. Out of 16 visited localities, bats with ticks were found at nine. Ticks were found at six out of seven localities in Serbia, two out of three localities in Montenegro, and one out of three localities in FYROM. No ticks were recorded on bats caught in Bosnia and Herzegovina. Overall, 94 individuals (19.79 %) of the total number of examined bats were parasitized by one or more tick individuals. The usual predilection sites of ticks on bats were: around the mouth, around the eyes, on and around the ears, and on the dorsal and ventral side of the body close to the patagium. A total of 165 ticks were collected: 158 specimens of Ixodes simplex (18 females, 92 nymphs, and 48 larvae); six specimens of Ixodes vespertilionis (one female, two nymphs and three larvae) and one larva of Argas vespertilionis. Ixodes simplex was found on two bat species—M. schreibersii (156/158 ticks) and R. euryale (2/ 158); I. vespertilionis was recorded on four bat species—R. euryale (3/6 ticks), R. ferrumequinum (1/6), M. schreibersii (1/6) and M. mystacinus (1/6); while a single specimen of A. vespertilionis was found on P. pipistrellus (Fig. 2). The prevalence of animals infested with I. simplex was the highest among bats of the species M. schreibersii (87/281–30.96 %), while we found only one larva on one R. euryale (1/39–2.56 %). The bat species most frequently infested with I. vespertilionis was
Fig. 3 Phylogenetic relationship of Ixodes simplex and I. vespertilionis COI gene sequences obtained in the present study (bold) in comparison with representative Ixodes spp. and Rhipicephalus sanguineus sequences available in the GenBank
123
Exp Appl Acarol
M. mystacinus (1/6–16.66 %), followed by R. euryale (3/39–7.69 %), R. ferrumequinum (1/21–4.76 %) and M. schreibersii (1/281–0.36 %) (Table 1). Molecular analysis was successful for three specimens of I. simplex and two specimens of I. vespertilionis. Sequencing yielded four different genotypes (two genotypes of I. simplex and two genotypes of I. vespertilionis). Molecular and phylogenetic analysis confirmed the standard morphological identification and taxonomic status of the analyzed ticks (Fig. 3).
Discussion and conclusion The findings presented in this paper reveal new aspects of the distribution and host range of ticks parasitizing bats from the central part of the Balkan Peninsula. Our data include the first records of I. simplex in Serbia and Montenegro, I. vespertilionis in Montenegro, and A. vespertilionis in FYROM. The most widespread tick species collected during this study was I. simplex (six out of 16 localities), I. vespertilionis was collected at five out of 16 localities, while A. vespertilionis was recorded only at one location in the western part of FYROM, in a habitat that was not a cave – it was found on a common pipistrelle bat caught in a mist net in an old orchard. All other ticks were collected from bats caught in caves. Previous data on bats of the families Vespertilionidae and Rhinolophidae in Europe indicated that I. vespertilionis is the dominant species (Arthur 1956, 1963; Walter and Kock 1985), while information about I. simplex remained mostly fragmented and scarce. In our research I. simplex is both the most widespread and the most numerous species. Starting from the beginning of the twentieth century, in the territory of former Yugoslavia, I. vespertilionis was reported in all republics except Montenegro (Neumann 1916; Oswald 1940; Arthur 1956; Tovornik 1990). The presence of the species was documented in the following surrounding countries as well: Hungary (Neumann 1916; Arthur 1956; Siuda et al. 2009; Hornok et al. 2012), Bulgaria (Arthur 1956; Beron et al. 2011), and Romania (Mihalca et al. 2012). Our records of this species for Montenegro confirmed assumptions of its presence there based on its previously observed wide distribution in the region. As hosts of I. vespertilionis, we recorded M. schreibersii (Sˇalitrena pec´ina cave), R. euryale (Petnicˇka and Zacˇirska pec´ina caves, Jama Sˇutonjic´a cave), Rhinolophus ferrumequinum (Petnicˇka pec´ina cave) and M. mystacinus (Lazareva pec´ina cave) - all species previously identified as hosts. In Europe most records of I. vespertilionis are from bats belonging to the genus Rhinolophus (R. ferrumequinum, R. hipposideros, R. euryale), but it is also recorded from other species (M. myotis, M. blythii, M. mystacinus, M. alcathoe, M. daubentonii, M. schreibersii, Plecotus auritus, Nyctalus noctula and Pipistrellus pygmeus). Thus it appears to be less host-specific than I. simplex (Arthur 1956; Danko et al. 2010; Sˇevcˇik et al. 2010; Mihalca et al. 2012; Petney et al. 2012). Previous data for Serbia (Tovornik 1990) reported two locations in the eastern part of the country, where specimens were collected only from cave walls. During our research the ticks were collected for the first time directly from bats, confirming suspected host species. Concerning I. simplex, up to our research there was no reliable published information indicating its presence in this part of the Balkan Peninsula. Confusion is caused by the inconstancy of borders between the former Yugoslav republics. Karaman (1937) refers to findings of I. simplex in ‘‘southern Serbia’’, but this locality most likely belongs to the recent FYROM.
123
Exp Appl Acarol
Ixodes simplex is known to inhabit caves and feeds exclusively on bats, especially M. schreibersii. Beaucornu (1967) and Haitlinger and Rupert (1985) cited M. schreibersii as the main host of this tick species. However, several authors reported the given tick from other host taxa as well, e.g., R. ferrumequinum (Nuttall et al. 1908), M. myotis (Walter and Kock 1985) and Rhinolophus affinis (Kolonin 2003). According to Sˇevcˇik et al. (2010), I. simplex was found on M. myotis in Poland, which is an area outside the range of its main host, M. schreibersii (Haitlinger and Rupert 1985). They also report I. simplex on Rhinolophus hipposideros, but assume it to be an occasional host species. The specimens collected in the present study were mainly parasitizing M. schreibersii in Serbia. At one locality in Montenegro (Jama Sˇutonjic´a cave), we collected a specimen of I. simplex from R. euryale, indicating a possible new host/parasite association. To the best of our knowledge, the presence of I. simplex on this particular bat species has not been recorded to date and could be explained by a transfer from its main bat host, M. schreibersii, whose presence was recorded in the same roost where the affected individual of R. euryale was found. The absence of ticks on bats collected at three localities in Bosnia and Herzegovina can be attributed to the small number of bats caught for tick collection and the fact that they belonged to species not identified as hosts of any ticks in this study (R. hipposideros and M. blythii). The majority of collected samples were nymphal and larval ticks, so we performed molecular analysis of barcoding mtCOI sequences from representative I. simplex and I. vespertilionis specimens in order to confirm morphological identification based on keys of Pomerancev (1950) and Arthur (1956) lacking data on subadult stages or presenting only free-hand drawings. The sequencing results confirmed morphological identification and taxonomic status, but since we noticed a certain level of heterogeneity (five sequences yielded four different genotypes) in the analyzed sequences, further phylogeographic study is planned. The present paper also represents the first reliable finding of A. vespertilionis for FYROM, as in the literature only vague information exists in a work giving the Regional disease vector ecology profile for Central Europe (www.afpmb.org/sites/default/files/pubs/ dveps/CentralEurope.pdf) with no reference to any paper, author, locality, or date of finding this tick species. Argas vespertilionis is a widely distributed tick species mainly specialized for feeding on bats as hosts and occurs throughout Europe, Asia, and Africa, ranging from the British Isles in the west to Japan, Korea, and India in Asia (Siuda et al. 2009; Petney et al. 2012). Hosts are predominantly bats (Siuda et al. 2009), the genus Pipistrellus having been identified as the preferred one. It is found on 14 of 25 Poland’s bat species and on five of 28 Slovak bat species (Siuda et al. 2009), including both cavedwelling and forest bats. According to Siuda et al. (2009), A. vespertilionis occurs in breeding and transient colonies, attics, burrows, tree holes, and caves. Due to this wide scope of habitats, it can be expected to occur on a large number of bat species. It also parasitizes bats in synanthropic and semi-synanthropic habitats, where it hides in the cracks of walls of buildings and caves, as well as under piles of guano (Nowak-Chmura and Siuda 2012). Argas vespertilionis is known to attack humans and domestic animals and has been reported to be ‘‘highly aggressive’’ (Hoogstraal 1985; Estrada-Pen˜a and Jongejan 1999). Another important feature of this tick species is that it has been associated with several pathogens of human and animal importance: Issyk Kul virus and Sokuluk virus (Hoogstraal 1985; Gavrilovskaya 2001; de la Fuente et al. 2008), Borrelia burgdoferi sensu lato (Hubbard et al. 1998),Coxiella burnetii and Wolbachia sp. (Nowak-Chmura and Siuda
123
Exp Appl Acarol
2012). Evans et al. (2009) reported a fatal case of relapsing fever in a pipistrelle bat (Pipistrellus sp.) in the United Kingdom caused by a new and unknown Borrelia species, assumed to be transferred to the bat by a tick of the species A. vespertilionis found attached to the bat. Socolovschi et al. (2012) analyzed five specimens of this tick species and found a new genotype of Rickettsia sp., new species of the Ehrlichia canis group and Borrelia sp. CPB1, a relapsing fever agent of the Borrelia group that caused the fatal borreliosis in a bat in the United Kingdom previously reported by Evans et al. (2009). To judge from the scarce data available, the medical importance of the recorded Ixodes species appears to be minor. However, Hornok et al. (2012) isolated for the first time Bartonella sp. from a female I. vespertilionis, implying an association of bartonellae with Rhinolophus sp. and M. myotis. Although known to be specialized for feeding on bats, the recently reported first case of human infestation by I. vespertilionis indicates the potential medical importance of this tick species (Piksa et al. 2013). As for I. simplex, no data indicating any medical significance have been found so far. From the viewpoints of public health and conservation medicine, it is necessary to emphasize the importance of wildlife species known to be tick hosts and potential tickborne pathogen reservoirs as sentinel species ideal for monitoring the presence of tickborne diseases in specific ecosystems. The role of bats with their specific biology and behaviour as potential reservoirs of vector-borne pathogens, especially viruses, is coming into focus. Further systematic studies are required to discern the enzootic cycles of tickborne pathogens involving bats as host and reservoir species. An awareness on the part of professionals and recreationists visiting specific bat habitats, as well as residents, veterinarians, and health professionals in areas where synanthropic bat species occur—would be of great importance for efficient monitoring of these zoonotic diseases. Acknowledgments This work was supported by a grant from the Ministry of Education, Science and Technological Development of the Republic of Serbia (Project No. 173006). The work of ST was done under the frame of EurNegVec COST Action TD1303. The authors wish to express their gratitude to all collaborators in the field who helped in identification of bat roosts and field work for this study: Milosˇ Pavic´evic´, Marina Ðurovic´ and Veso Mijusˇkovic´ from Montenegro, Dejan Radosˇevic´, Mladen Samardzˇic´ and Jelena Golijanin from Bosnia and Herzegovina, Darko Dragulovic´, Petar Petrovic´, Nina Bosˇkovic´ and students of the Faculty of Biology at the University of Belgrade from Serbia.
References Arthur DR (1956) The Ixodes ticks of Chiroptera (Ixodoidea, Ixodidae). J Parasitol 7:180–196 Arthur DR (1963) British ticks. Butterworth, London Beaucornu JC (1967) Contribution a` la connaissance de la biologie d’Ixodes(Eschatocephalus) vespertilionis Koch 1844 et d’Ixodes (Pomerantzerella) simplex Neumann 1906 (Acarina, Ixododidea) parasites des Chiropte`res. Ann Spe´le´ol 22:543–580 (in French) Beron P, Petrov B, Stoev P (2011) The invertebrate cave fauna of the Western Rhodopes (Bulgaria and Greece). In: Beron P (ed) Biodiversity of Bulgaria 4. Biodiversity of Western Rhodopes (Bulgaria and Greece) II. Pensoft & National Museum of Natural History, Sofia, pp 583–660 Calisher CH, Childs JE, Field HE, Holmes KV, Schountz T (2006) Bats: important reservoir host of emerging viruses. Clin Microbiol Rev 19:531–545 Danko Sˇ, Krisˇtin A, Krisˇtofik J (2010) Myotis alcathoe in eastern Slovakia: occurrence, diet, ectoparasites and notes on its identification in the field. Vespertilio 13–14:77–91 De la Fuente J, Estrada-Pen˜a A, Venzal JM, Kocan KM, Sonenshine DE (2008) Overview: ticks as vectors of pathogens that cause disease in humans and animals. Front Biosci 1:6938–6946 Dietz C, von Helversen O, Nill D (2009) Bats of Britain, Europe & Northwest Africa. A & C Black Publishers Ltd., London
123
Exp Appl Acarol Estrada-Pen˜a A, Jongejan F (1999) Ticks feeding on humans: a review of records on human-biting Ixodoidea with special reference to pathogen transmission. Exp Appl Acarol 23:685–715 Evans NJ, Bown K, Timofte D, Simpson VR, Birtles RJ (2009) Fatal borreliosis in bat caused by relapsing fever spirochete, United Kingdom. Emerg Infect Dis 15:1331–1333 Flaquer C, Puig-Montserrat X, Goiti U, Vidal F, Curco´ A, Russo D (2009) Habitat selection in Nathusius’ pipistrelle (Pipistrellus nathusii): the importance of wetland. Acta Chiropterol 11:149–155 Folmer O, Black M, Hoeh W, Lutz R, Vrijenhoek R (1994) DNA primers for amplification of mitochondrial cytochrome c oxidase subunit I from diverse metazoan invertebrates. Mol Mar Biol Biotechnol 3:294–299 Gavrilovskaya IN (2001) Issyk-Kul virus disease. In: Service MW (ed) The encyclopedia of arthropodtransmitted infections of man and domesticated animals. CABI Publishing, Wallingford, pp 231–234 Haitlinger R, Rupert AL (1985) Stawonogi zebrane na nietoperzach z Kujaw (Acari, Siphonaptera) [Arthropods collected from bats in Kujawy (Acari, Siphonaptera)]. PJE 55:615–618 (in Polish, with a summary in English) Hoogstraal H (1985) Argasid and Nuttalliellid ticks as parasites and vectors. Adv Parasitol 24:135–238 Hornok S, Kovacs R, Meli ML, Gonczi E, Hofmann-Lehmann R, Kontschan J, Gyuranecz M, Dan A, Molnar V (2012) First detection of bartonellae in a broad range of bat ectoparasites. Vet Microbiol 159:541–543 Hornok S, Kontscha´n J, Kova´ts D, Kova´cs R, Angyal D, Go¨rfo¨l T, Polacsek Z, Kalma´r Z, Mihalca AD (2014) Bat ticks revisited: Ixodes ariadnae sp. nov. and allopatric genotypes of I. vespertilionis in caves of Hungary. Parasites Vectors 7:202 Hubbard MJ, Baker AS, Cann KJ (1998) Distribution of Borrelia burgdorferi s.l. spirochaete DNA in British ticks (Argasidae and Ixodidae) since the 19th century, assessed by PCR. Med Vet Entomol 12:89–97 Hutterer R, Ivanova T, Meyer-Cords C, Rodrigues L (2005) Bat migration in Europe. A review of banding data and literature. Federal Agency of Nature Conservation, Bonn Karaman S (1937) Fauna Juzˇne Srbije, Spomenica dvadesetpetogodisˇnjice oslobodenja Juzˇne Srbije, Jovanovic A (Ed) Spomenica, Skoplje, pp 161–179 (in Serbian) Kolonin GV (2003) New data on ixodid tick fauna of Vietnam. Entomol Rev (Engl Transl) 83:190–192 Kolonin GV (2007) Mammals as hosts of Ixodid ticks (Acarina, Ixodidae). Entomol Rev 87:401–412 Manzano-Roma´n R, Dı´az-Martı´n V, de la Fuente J, and Pe´rez-Sa´nchez R (2012) Soft ticks as pathogen vectors: distribution, surveillance and control, Parasitology, Shah MM (Ed), ISBN: 978-953-51-01499, InTech, Available from http://www.intechopen.com/books/parasitology/softticks-as-pathogenvectors-distribution-surveillance-and-control Mihalca AD, Dumitrache MO, Magdas¸ C, Gherman CM, Doms¸ a C, Mircean V, Ghira IV, Pocora V, Ionescu DT, Siko´ Baraba´si S, Cozma V, Sa´ndor AD (2012) Synopsis of the hard ticks (Acari: Ixodidae) of Romania with update on host associations and geographical distribution. Exp Appl Acarol 58:183–206 Mu¨hldorfer K (2013) Bats and bacterial pathogens: a review. Zoonoses Public Health 60:93–103 Neumann LG (1916) Ixodide´s (acariens). Premie`re se´rie. Arch Zool Expkr et Gen Paris 55:517–527 Nowak-Chmura M, Siuda K (2012) Ticks of Poland. Review of contemporary issues and latest research. Ann Parasitol 58:125–155 Nuttall GHF, Cooper WF, Robinson LE (1908) On the structure of the spiracles of a tick—Haemaphysalis punctata, Canestrini and Fanzago. Parasitol 1:347–351 Oswald B (1940) Determination of Yugoslavian (Balkan) ticks (Ixodoidea). Vet Arch 6:297–304 Petney TN, Pfa¨ffle PM, Skuballa JD (2012) An annotated checklist of the ticks (Acari: ixodida) of Germany. Syst Appl Acarol 17:115–170 Piksa K, Nowak-Chmura M, Siuda K (2013) First case of human infestation by the tick Ixodes vespertilionis (Acari: Ixodidae). Int J Acarol 39:1–2 Pomerancev BL (1950) Fauna SSSR. Paukoobrazovanie Ixodovie klesˇc´ei (Ixodidae). Izd Akadem Nauk SSSR 4(2):2–15 (In Russian) Regional disease vector ecology profile for Central Europe, group of authors, 2001, http://www.afpmb.org/ sites/default/files/pubs/dveps/CentralEurope.pdf Sˇevcˇik M, Krisˇtofik J, Uhrin M, Benda P (2010) New records of ticks (Acari: Ixodidae) parasitizing on bats in Slovakia. Vespertilio 13–14:139–147 Simmons NB (2005) Order Chiroptera. In: Wilson DE, Reeder DM (eds) Mammal species of the world, vol 1, 3rd edn. Johns Hopkins University Press, Baltimore, pp 312–529 Siuda K, Stanko M, Piksa K, Go´rz A (2009) Ticks (Acari: Ixodida) parasitizing on bats in Poland and Slovakia. Wiad Parazit 55:39–45 Socolovschi C, Kernif T, Raoult D, Parola P (2012) Borrelia, Rickettsia, and Ehrlichia species in bat ticks, France, 2010. Emerg Infect Dis 18:1966–1975
123
Exp Appl Acarol Tamura K, Peterson D, Peterson N, Stecher G, Nei M, Kumar S (2011) MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol Biol Evol 28:2731–2739 Thompson JD, Higgins DG, Gibson TJ (1994) Clustal W: improving the sensitivity of progressive multiple sequence alignment through weighting, position-specific gap penalties and weight matrix. Nucleic Acids Res 22:4673–4680 Tovornik D (1990) Ixodes (Eschatocephalus) vespertilionis Koch, 1844 (Arachn., Ixodidae) regarding its specific hosts and natural habitats (Slovenia, Yugoslavia). Acta entomol Jug 23:15–28 Vrenozi B, Dunlop J (2013) Albanian arachnids in the Museum fu¨r Naturkunde, Berlin. Arachnol 16:10–15 Walter G, Kock D (1985) Records of Ixodes vespertilionis, I. simplex and Argas vespertlionis (Ixodoidea: Ixodidae, Argasidae) from German bats (Chiroptera). Z Parasit 71:07–111
123
