Original Research Paper
Time-sensitive effects of hypoxia on differentiation of neural stem cells derived from mouse embryonic stem cells in vitro Nguyen Huy Binh1, Hitomi Aoki2, Manabu Takamatsu1, Yuichiro Hatano1, Akihiro Hirata1,3, Hiroyuki Tomita1, Akira Hara1 1
Department of Tumor Pathology, Gifu University Graduate School of Medicine, Japan, 2Department of Tissue and Organ Development, Gifu University Graduate School of Medicine, Japan, 3Division of Animal Experiment, Life Science Research Center, Gifu University, Japan Objectives: Oxygen tension is an important component of microenvironment for the differentiation of embryonic stem cells including neural lineage. However, the comprehensive influence of hypoxia on neural differentiation during embryonic neural development has not yet been examined. Methods: In this study, we investigated the effect of low oxygen levels (5% O2), or hypoxia, in two stages of neural differentiation in vitro: (1) inducing mouse embryonic stem cells into neural stem cells (NSCs); and then (2) inducing NSCs into neural progenitor cells in neurospheres. Results: In the first stage, NSCs generation was reduced under hypoxia. Less mature morphological changes (including neural marker) of NSCs were observed, suggesting the prevention of early differentiation under hypoxic conditions. Thus undifferentiated stem cells were maintained in this stage. However, in the second stage, hypoxia induced neural differentiation in neurospheres. Nevertheless, nonneural progenitor cell formation, such as mesoderm progenitor cell lines or epithelial cell lines, was restricted by low oxygen tension. Discussions: Our results demonstrate that hypoxia is essential for regulating neural differentiation and show the different effects on NSC differentiation dependent on the time-course of NSC development. In the early stage of NSCs induction, hypoxia inhibits neural differentiation and maintains the undifferentiated state; in the later stage of NSCs induction, hypoxia induces neural differentiation. Our study may contribute to the development of new insights for expansion and control of neural differentiation.
Keywords: Embryonic stem cells, Neural stem cells, Neural progenitor cells, Hypoxia, Neuronal development
Introduction In aerobic organisms, oxygen regulates various intracellular pathways involved in cellular metabolism, proliferation, survival, and fate, so that it is a critical factor in tissue and organ morphogenesis during mammalian embryonic development and throughout post-natal life.1 Oxygen plays an important role in regulating the growth and differentiation state of neural stem cells (NSCs) in the developing embryo stage of the mammalian central nervous system.1,2 Neural stem cells, which are multipotent precursor cells that reside in specialized regions of the fetus, have long life, self-renewable, and generate neurons, astrocytes, and oligodendrocytes.3 This makes them attractive entities for study to gain a better understanding of the
Correspondence to: Akira Hara, Department of Tumor Pathology, Gifu University Graduate School of Medicine, Yanagido 1-1, Gifu City, Gifu 501-1194, Japan. Email: [email protected]
804
ß W. S. Maney & Son Ltd 2014 DOI 10.1179/1743132814Y.0000000338
effects of oxygen levels on embryonic neural development, as well as for possible therapeutic applications. It is known that, in the early stage of embryonic development, mammalian blastocysts are exposed to a low concentration of O2 ranging from 1.5 to 5.3% in the reproductive tract.4–6 Several studies have revealed that hypoxia might profoundly influence stem cells microenvironment and can promote the differentiation of certain types of stem or progenitor cells, while inhibiting the differentiation of others.7 Thus hypoxia may be regarded as driving the regulation of stem/ progenitor cell differentiation, especially the regulation of neural differentiation. In vivo, neural differentiation during embryonic development includes two stages: early stage and later stage of NSCs induction. In the early stage of NSCs induction, the first NSCs to arise are primitive NSCs, which can be isolated from the anterior embryo from embryonic day E5.5 epiblast until E8.5 neuroectoderm. In the later stage of NSCs
Neurological Research
2014
VOL .
36
NO .
9
Binh et al.
induction, the transition of primitive NSCs to definitive NSCs in the embryo at approximately E8.5 occurs and definitive NSCs are present in the brain throughout the life of the organism.8 In the early stage of neural induction from embryonic stem cells, the transcription of stem cell pluripotency genes such as Pou5f1 (Oct4), Nanog, and Sox2 is not completely suppressed and researchers have reported that NSCs are less likely to be generated in low oxygen conditions.9,10 Furthermore, during the later stages of neural induction, low oxygen tension may activate molecular pathways that regulate Wnt/beta-catenin, Oct4, and Notch signaling and exert a positive effect on neural differentiation of ES cells, resulting in a faster commitment toward neural progenitors.1 Consequently, understanding the effects of hypoxia during neural commitment is important for scientific and therapeutic purposes and may provide new insights into ES cell proliferation and differentiation. However, studies on the influence of hypoxia in the early and later stages of differentiation of NSC derived from ES cells have not been conducted. In this study, we demonstrate that hypoxia is essential for regulating neural differentiation and that hypoxia has various effects on the NSC differentiation dependent on the time-course of NSC development. We expect essential findings for the improvement of current therapeutic strategies for the differentiation of NSCs.
Materials and Methods Low-oxygen culture In the normoxic condition, mouse embryonic stem (mES) cells and neurospheres were placed in a 37uC incubator supplemented with 20% O2 and 5% CO2. In the hypoxic condition, 5% O2, 5% CO2, and N2 gas were mixed using compressed air and supplied into a sealed container with a small outtake valve placed inside a 37uC incubator (Wakenyaku CO2 incubator 9000E series, Kyoto, Japan).
ES cell culture Green fluorescent protein (GFP)-expressing ES cells11 were maintained on gelatin-coated dishes in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, CA, USA) supplemented with 10% Hyclone Fetal Bovine Serum (Thermo Scientific, Massachusetts, USA), 1024 M 2-mercaptoethanol, non-essential amino acid solution (Invitrogen, California, USA), and human leukemia inhibitory factor (LIF, 20 ng/ml ESGROH, Millipore, Massachusetts, USA). For differentiation, 2000 trypsinized mES cells were placed in six-well plates seeded with mitomycinC treated mouse embryonic fibroblasts PA6 cells in advance and differentiated in a minimal essential medium (alphaMEM, Invitrogen, California, USA) supplemented with 10% fetal calf serum (FBS,
Time-sensitive effects of hypoxia on stem cells
Thermo Scientific, USA). Unless otherwise mentioned, 20 pM fibroblast growth factor (FGF), 10 pM cholera toxin, and 100 nM dexamethasone were added from days 0 to 6, days 0 to 3, and days 3 to 6 of the culture, respectively. The medium was changed twice per week.
Induction of neurospheres To induce neurospheres, after washing the dish with phosphate-buffered saline (PBS, Invitrogen, CA, USA) to remove floating cells in the medium, only differentiated mES colonies on PA6 were treated with 0.2% trypsin and dissociated into single cells and then transferred to a growth medium in culture flasks (Nunclon, Thermo Scientific) at a concentration of 150 000 cells/ml. The detached mES colonies were mechanically dissociated in serum-free medium consisting of DMEM and F-12 nutrient (1:1, Invitrogen, La Jolla, CA, USA). The cells were grown in growth medium (DMEM) and F-12 nutrient, epidermal growth factor (EGF), FGF (20 ng/ml each; R&D Systems, Minneapolis, MN, USA), and 2% B27H supplement (Invitrogen, CA, USA). Half of the medium was replaced every 2 days with fresh medium containing the same concentrations of growth factors.
Analysis of neural differentiation in early stage (experiment-1) and later stage (experiment-2) of NSCs induction under hypoxia Experiment-1: Undifferentiated mES cells were cocultured with PA6 stromal cells for 6 days to induce NSCs. In the normoxia group, mES was incubated in 20% oxygen from days 0 to 6. In the hypoxia group, mES cells were incubated in 20% oxygen from days 0 to 1, then incubated in 5% oxygen from days 1 to 6.1,12 An outline of the experiment-1 is shown in Fig. 1A. Experiment-2: undifferentiated mES cells were cocultured with PA6 stromal cells for 6 days to induce NSCs. Then these cells were enzymatically digested into single cells and transferred to a growth medium with EGF, FGF, and B27 supplement in culture flasks for 6 days to induce neurospheres containing NSCs and neural progenitor cells. In the normoxia group, neurospheres were incubated in 20% oxygen from days 0 to 12. In the hypoxia group, neurospheres were incubated in 20% oxygen from days 0 to 7, then incubated in 5% oxygen from days 7 to 12.1,12 An outline of the experiment-2 is shown in Fig. 1B.
Immunocytochemistry for NSCs in six-well plates (for experiment-1) Cells grown on six-well plates were fixed with 4% paraformaldehyde (4% PFA) for 20 minutes, then washed in 0.01 M PBS and incubated in blocking solution (2% bovine serum albumin – 2% BSA) for 30 minutes. The cells were incubated with anti-Tuj-1 (mouse IgG, 1:1000, Covance, Princeton, NJ, USA) in 2% BSA/PBS overnight at 4uC. The secondary
Neurological Research
2014
VOL .
36
NO .
9
805
Binh et al.
Time-sensitive effects of hypoxia on stem cells
Figure 1 (A) Experiment-1: undifferentiated mouse embryonic stem (mES) cells were co-cultured with PA6 stromal cells for 6 days to induce neural stem cells (NSCs). Normoxia group: from days 0 to 6, incubated in 20% O2 Hypoxia group: from days 0 to 1, incubated in 20% O2; from days 1 to 6, incubated in 5% O2. (B) Experiment-2: undifferentiated mES cells were co-cultured with PA6 stromal cells for 6 days to induce NSCs. Then these cells were enzymatically digested into single cells and transferred to a growth medium with fibroblast growth factor (FGF), epidermal growth factor (EGF), and B27 supplement in culture flasks for 6 days to induce neurospheres containing NSCs and neural progenitor cells. Normoxia group: from days 0 to 12, incubated in 20% O2. Hypoxia group: from days 0 to 7, incubated in 20% O2; from days 7 to 12, incubated in 5% O2.
antibody Alexa Fluor 568 (red) goat anti-mouse IgG (1:1,000, Invitrogen, Eugene, OR, USA) was used to visualize the signal for 60 minutes at room temperature. After washing with PBS, the cell nuclei were stained with 49,6-diamino-2-phenylindole (DAPI, 1:1000, Wako Pure Chemical, Osaka, Japan) for 5 minutes at room temperature.
Immunohistochemistry for NSCs in neurospheres (for experiment-2) Neurospheres were collected and fixed overnight in 10% phosphate-buffered formalin (pH 7.0), embedded in paraffin, and then sectioned. The deparaffinized sections were blocked to endogenous peroxidase activity by incubation in distilled water containing 3% hydrogen peroxide for 5 minutes. Antigen retrieval was performed using 0.01 M citrate buffer (pH 6.0) by the Pascal heat-induced target retrieval system (DAKO, Glostrup, Denmark). Non-specific binding sites were blocked in 0.01 M PBS containing 2% BSA (Wako Pure Chemical, Osaka, Japan) for 60 minutes.
806
Neurological Research
2014
VOL .
36
NO .
9
Anti-Desmin (mouse IgG, 1:100; DAKO, Glostrup, Denmark), anti-Cytokeratin AE1/3 (mouse IgG, 1:100; DAKO, Glostrup, Denmark), anti-Ki-67 (rat IgG, clone TEC-3, 1:100, DAKO, Glostrup, Denmark), and anti-hypoxia-inducible factor-1alpha (anti-HIF1alpha) (mouse IgG, 1:500; Millipore, Massachusetts, USA) in 2% BSA/PBS were added to the slides and incubated overnight at 4uC. Primary antibodies were detected with biotinylated anti-mouse IgG (Elite PK 6102 Mouse IgG Vestastain ABC kit Vector Laboratories, Burlingame, CA, USA) and biotinylated anti-rat IgG (1:200, DAKO, Glostrup, Denmark) for 30 minutes, respectively, followed by incubation with avidin-coupled peroxidase (Vectastain ABC kit, Vector Laboratories, Burlingame, CA, USA) for 30 minutes. The peroxidase binding sites were detected by staining with 3,39-diaminobenzidine (DAB) in 50 mM Tris– EDTA buffer (pH 7.6). Finally, counterstaining was performed using Mayer’s hematoxylin. For negative controls, the primary antibody was substituted with
Binh et al.
Time-sensitive effects of hypoxia on stem cells
the buffer (PBS) or with non-immune immunoglobulin G.
Results The hypoxic condition inhibited generation of NSC from mES cells co-cultured with PA6
Immunofluorescence chemistry for NSCs in neurospheres (for experiment-2)
To investigate the effect of hypoxia on generation of NSCs from mES cells, we incubated mES cells cocultured with PA6 for 5 days under the hypoxic or normoxic condition (Fig. 1A). This culture technique is known as an efficient method for induction of NSCs from mES cells under the normoxic condition.6 Morphological differences of the outgrowth cells were easily recognizable between the two conditions as prominent neurite outgrowth emerging from the colonies was observed in the normoxic culture whereas less frequent neurite outgrowth was seen in the hypoxic culture (Fig. 2D and E). Neurite outgrowths from NSC colonies on PA6 feeder were assessed by the immunocytochemical method. Tuj-1 (early NSC marker) positive cells appeared prominently in normoxic cell culture, while a limited number of Tuj-1-positive cells were observed in hypoxic cell culture (Fig. 2C). The results from RT-PCR (Fig. 3) showed the expressions of Nestin (NSC marker) were most remarkable in normoxic culture and suppressed in a hypoxic culture (P , 0.001). These results suggested that hypoxia inhibited the generation of NSCs from mES cells.
The first antibodies, anti-Nestin (rabbit IgG, 1:200; Immuno-Biological Laboratory, Gunma, Japan), antimicrotubule associated protein-2 (anti-MAP2) (mouse IgG, 1:500; Sigma-Aldrich, St. Louis, MO, USA), and anti-glial fibrillary acidic protein (anti-GFAP) (rabbit IgG, 1:500; DAKO, Glostrup, Denmark) in 2% BSA/ PBS were added to the slides and incubated overnight at 4uC. The second antibodies, Alexa Fluor 568 (red) goat anti-mouse IgG (1:1,000, Invitrogen, Eugene, OR, USA) and Alexa Fluor 488 (green) goat antirabbit IgG (1:1,000, Invitrogen, Eugene, OR, USA) were used to visualize the signal for 60 minutes at room temperature. After washing with PBS, the cell nuclei were stained with 4,6-diamino-2-phenylindole (DAPI, 1:1,000, Wako Pure Chemical, Osaka, Japan) for 5 minutes at room temperature.
Cell counts and statistical analysis Photographs for immunohistochemistry staining were taken under a microscope with a high-resolution digital camera (Olympus, Tokyo, Japan). Fluorescence was also photographed under a fluorescence microscope with a high-resolution digital camera (Olympus, Tokyo, Japan). The number of immunoreactive cells in five visual fields (50–100 cells per field) in each sample was counted in a randomized fashion. All results are expressed as mean¡standard error (SE).
Reverse Transcription Polymerase Chain Reaction (RT-PCR) Total RNA was extracted from cells using the RNeasy Mini kit (Qiagen, Valencia, CA, USA). Total RNA (0.5 mg each) was reverse transcribed using Superscript III Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). Quantitative real-time PCR was carried out with the Thermal Cycler Dice Real Time System Single (Takara, Kyoto, Japan) using the SYBR Green (Takara, Kyoto, Japan) method. The primers were as follows: MAP2 (ATGACAGGCAAGTCGGTGAAG and TTGAGTCCACTGGTCGAGGTT) GFAP (CGGAGACGCATCACCTCTG and TGGAGGAGTCATTCGAGACAA) Nestin (GTGCCTCTGGATGATG and TTGACCTTCCTCCCCCTC) Oct4 (ACCAGTTGCCATTGGTGGAAA and CATGAGGAGAGTCCGGTACTT) HIF-1alpha (GTCCCAGCTACGAAGTTACAGC and CAGTGCAGGATACACAAGGTTT) Beta-actin (ATGGAGCCACCGATCCACA and CATCCGTAAAGACCTCTATGCCAAC) For evaluation of gene expression, beta-actin was used as internal control.
Hypoxic condition promoted the generation of neural progenitor cells from NSCs contained in neurospheres Next, to determine the effect of hypoxia on generation of neural progenitor cells from NSCs in neurospheres, we generated neurospheres composed of free-floating clusters of NSCs supplied with EGF, FGF, and B27 in hypoxic or normoxic conditions (Fig. 1B). This culture technique is known as an efficient method for induction of neural progenitor cells from NSCs.13 Immunohistochemical staining examinations showed that neurospheres in hypoxic culture were composed of more MAP2 (neural progenitor cells marker) positive cells and GFAP (glial progenitor cells marker) positive cells as compared with those in normoxic culture (Fig. 4A, B, D, and E). The frequencies of MAP2-positive cells in hypoxic culture and normoxic culture were approximately 28.6 and 15.2%, respectively (Fig. 4C). Similarly, the frequencies of GFAP-positive cells in hypoxic culture and normoxic culture were approximately 7.4 and 3.2%, respectively (Fig. 4F). There was a significant difference in the percentages of GFAP and MAP2 expressing cells between the two culture conditions (P , 0.05). In addition, over 50% of the cells in the neurospheres in normoxic culture were ki-67 (proliferating cell marker) positive, whereas only about 20% positive cells were found in hypoxic culture (Fig. 5A–C). Furthermore, Nestin (primitive NSC marker) immunopositive cells
Neurological Research
2014
VOL .
36
NO .
9
807
Binh et al.
Time-sensitive effects of hypoxia on stem cells
Figure 2 Neural differentiation of mES cells co-cultured with PA6 was inhibited by hypoxia (experiment-1). (A, B) Tuj-1 immunofluorescence staining (early neural stem cells (NSCs) marker in red) was expressed in the outgrowth cells in two cultures conditions. (C) Percentage of Tuj-1-positive cells in hypoxic and normoxic culture condition; there was a significantly different between two culture conditions (P , 0.05). (D, E) Prominent neurite outgrowth emerging from the colonies was observed in the normoxic culture, whereas less frequent neurite outgrowth was seen in the hypoxic culture. These results were shown by the percentage of neurite-bearing cells and neurite length. The bar chart represents mean and SE. * P , 0.05; ** P , 0.01; *** P , 0.001. Bar 5 100 mM.
appeared frequently in normoxic culture but rarely in hypoxic culture (Fig. 5D–F). The presence of many cells positive for Ki-67 and Nestin means that the primitive proliferating NSCs exist in neurospheres under the hypoxic condition. The mRNA expressions of MAP2, GFAP, Nestin, and hypoxia-inducible factor-1alpha (HIF-1alpha) were checked in days 8, 10, and 12 according to our protocol for experiment-2 (Fig. 1B). In the neurospheres, mRNA expressions of MAP2, GFAP, and Nestin were found and the existence of neural
progenitor cells, glia progenitor cells, and NSCs in the neurospheres was confirmed (Fig. 6A–C). The expression of GFAP and MAP2 increased during neurosphere formation in both culture conditions. However, the expression of GFAP and MAP2 was most remarkable in hypoxic culture but was suppressed in normoxic culture (P , 0.05) (Fig. 6A and B). Contrary to GFAP and MAP2, we found the expression of Nestin was maintained in normoxic culture and decreased in hypoxic culture (Fig. 6C). After 5 days of culture in the hypoxic condition, there was a significant difference in Nestin expression between hypoxic culture and normoxic culture (P , 0.01).
The time-course of HIF-1alpha up-regulation under hypoxic stimulation and effects on generation of non-neural cell lines in the neurospheres
Figure 3 RT-PCR was used for analyzing the expression of Oct4 (maker for pluripotent mouse embryonic stem (mES)) and Nestin (marker for primitive NSCs) in day 6 (experiment1). The bar chart represents mean and standard error (SE). NS not significant; *** P , 0.001.
808
Neurological Research
2014
VOL .
36
NO .
9
To follow the time-course of HIF-1alpha up-regulation under hypoxic stimulation we used RT-PCR to check the HIF-1alpha expression in days 8, 10, and 12 in both conditions (Fig. 6). Significantly higher expression of HIF-1alpha was found at days 8, 10, and 12 in hypoxic culture as compared with normoxic culture (Fig. 6D). In particular, a much higher
Binh et al.
Time-sensitive effects of hypoxia on stem cells
Figure 4 Neurospheres were incubated for 5 days under hypoxic condition or normoxic condition (experiment-2). (A, B) MAP2 immunofluorescence staining (neural progenitor cells marker in red) and (D, E) GFAP immunofluorescence staining (glial progenitor cells marker in green) were examined. (C, F) There were significantly different percentages of MAP2 and GFAPpositive cells between two culture conditions. The bar chart represents mean and standard error (SE). * P , 0.05. Bar 5 100 mM.
expression of HIF-1alpha was observed at day 8. The up-regulation of HIF-1alpha under hypoxic condition was confirmed by immunocytochemistry of neurospheres shown in Fig. 8. It was clearly observed that HIF-1alpha showed significantly strong expression in hypoxic culture condition (P , 0.001). The expression of non-neural markers in neurospheres was evaluated in both culture conditions. Immunohistochemical analysis demonstrated that frequencies of immunopositive cells for both Desmin (marker of mesoderm progenitor cells) and Cytokeratin AE1/AE3 (marker for cells of epithelial origin including skin and hair progenitor cells) decreased significantly in hypoxic culture (Fig. 7). These results suggest that HIF-1alpha is more upregulated under hypoxia and may inhibit the expression of non-neural markers in neurospheres.
Discussion The present study addressed the effects of hypoxic condition in two stages of neural differentiation in vitro: (1) inducing mES cells into NSCs; and then (2) inducing NSCs into neural progenitor cells in neurospheres. It was found that (i) in the early stage of NSC induction, hypoxia inhibited neural lineage differentiation from mES cells; (ii) in the later stage of NSC induction, hypoxia induced neural differentiation.
It is known that oxygen levels in developing tissue are regulated, and thus it is no surprise that oxygen levels have specific effects in neural differentiation in vitro as well as in vivo.14 Other studies which have manipulated the oxygen concentration in NSC studies both in vitro and in vivo and their findings suggest that a mild hypoxic microenvironment has an important influence on stem cells because mammalian blastocysts are exposed to a low concentration of O2 ranging from 1.5 to 5.3% during embryonic development.1,12 In most studies, hypoxia was considered to have driver-effects in regulating stem/ progenitor cell differentiation, especially in the regulation of neural differentiation.1,15 However, there is no comprehensive study on the influence of hypoxia on this regulation for neural differentiation associated with the time-course of embryonic neural development, especially in the early stage and later stage of NSC differentiation. In our study, we applied 5% of oxygen as the hypoxic condition for the analysis of neural differentiation in vitro. Our study confirmed that a hypoxic microenvironment is one of the important regulators of neural stem/progenitor differentiation in vitro. Whether the hypoxic condition is required for neural differentiation of mES cell-derived NSCs is controversial.15 In the early stage of NSC induction,
Neurological Research
2014
VOL .
36
NO .
9
809
Binh et al.
Time-sensitive effects of hypoxia on stem cells
Figure 5 Expression of neural stem cells (NSC) markers in neurospheres were inhibited in hypoxic culture condition (experiment-2). (A, B) Immunochemistry staining of Ki-67 (proliferating cell marker) and (D, E) immunofluorescence staining of Nestin (primitive NSCs marker in green) were examined. (C, F) There were significantly different percentages of Ki-67 and Nestin-positive cells between two culture conditions. The bar chart represents mean and standard error (SE). ** P , 0.01. Bar in Ki-67 staining 5 100 mM; bar in Nestin staining 5 50 mM.
our immunocytochemistry and morphological analysis showed less Tuj-1- (early NSCs marker) positive cells and less matured neural morphology (percentage of neurite-bearing cells and the length of neurite) in hypoxic condition compared with those in normoxic condition. It has been shown that hypoxia inhibited neural differentiation during the early stage of NSCs induction. Gustafsson et al.16 found that hypoxia in the early stage of NSC development blocked the differentiation of myogenic satellite cells and primary NSCs. In particular, NSCs were also reported to be less generated from human parthenogenetic stem cells at low oxygen tension in the early stage of NSC development.9 A number of studies have shown that culturing under hypoxic conditions prevents the differentiation of human ES cell colonies and maintains them in a fully pluripotent state.10 These findings support our present study. Thus, hypoxia during the early stage of NSCs induction probably maintains pluripotency of ES cells and consequently inhibits too early neural differentiation in development of the fetal nervous system. Next, our study also confirmed the effect of a hypoxic microenvironment on regulating neural stem/progenitor differentiation in the later stage of
810
Neurological Research
2014
VOL .
36
NO .
9
NSC induction. We found that a hypoxic microenvironment induced more neural progenitor cells (MAP2 -positive cells) and glial progenitor cells (GFAP-positive cells) but reduced the expression of primitive NSC markers (Nestin) and non-neural markers (Desmin and Cytokeratin AE1/3) in the neurospheres. The Ki-67-positive-proliferating cells in neurosphere were also reduced in the hypoxic condition. Our observations regarding the effects of hypoxia on neurospheres were opposite to those seen in the early stage of NCS induction. Recent studies have shown that more neural progenitor cells were produced under the hypoxic conditions.17 Moreover, the differentiation potential of human fetal neural progenitor cells were also explored under lowered oxygen levels.18 Studer et al. and Morrison et al. reported that when oxygen was lowered to more physiological levels (3% oxygen) there were marked trophic and proliferative effects on neural precursors and significantly changed developmental kinetics and outcome as compared with traditional culture conditions (20% oxygen).19,20 These findings about neural differentiation of neural progenitor cells accord with our result of neural differentiation in the later stage of NSC induction under hypoxic conditions. In the
Binh et al.
Time-sensitive effects of hypoxia on stem cells
Figure 6 RT-PCR was used for analyzing the expression of MAP2, GFAP, Nestin, and HIF-1alpha of in days 8, 10, and 12 in two culture conditions (experiment-2). The chart represents mean and standard error (SE). * P , 0.05; ** P , 0.01; *** P , 0.001; NS not significant.
present study, the expression of mRNA showed that MAP2 and GFAP up-regulated during neurosphere formation in both culture conditions, but the expression of MAP2 and GFAP were significantly higher in hypoxic culture than in normoxic culture (Fig. 6A and B). Conversely, mRNA expression of NSC marker such as Nestin decreased after 5 days of hypoxia. These results suggest that a hypoxic microenvironment promotes NSCs to neural and glial progenitor cells and then differentiates them into neurons and glia cells in the later stage of NSCs induction. Neural differentiation is a result of the sum of all signals impinging on the cells and the biochemical state of the cell.14 The potential mechanism of the hypoxia on NSC differentiation remains to be elucidated, but there are several studies showing that HIF-1alpha stabilization under hypoxia is considered to directly or indirectly regulate many genes, which control neural differentiation. Clarke found that low oxygen concentrations may be involved in neural differentiation through different pathways in the early stage of NSCs and later stage of NSCs.21 Consequently, the response of the ES cells and NSCs to a hypoxic microenvironment at different times of NSCs induction might cause different effects on neural differentiation: (i) in the early stage of NSC induction, hypoxia inhibits neural lineage differentiation from mES cells and maintains undifferentiated
property; (ii) in the later stage of NSC induction, hypoxia induces neural differentiation including neural and glial lineages. In the early stage of NSC differentiation, Mazumdar showed that HIF-1alpha modulates Wnt/beta-catenin signaling in hypoxic ES cells by enhancing beta-catenin activation.22 Moreover, enhanced HIF-1alpha expression by hypoxia may affect the transcription of stem cell pluripotency genes such as Pou5f1 (Oct4), Nanog, and Sox2, and then prevent neural differentiation.9 In the later stage of NCS induction, low oxygen tension may activate molecular pathways that regulate Wnt/beta-catenin, Oct4, and Notch signaling and exert a positive effect on early differentiation of NSCs, resulting in a faster commitment toward neural progenitors.1 In the later stage of NSC induction of the present study, HIF1alpha expression up-regulated in hypoxic condition, which was confirmed by RT-PCR in days 8, 10, and 12 (Fig. 6D) and immunocytochemistry staining (Fig. 8), may induce proliferation and neural differentiation of NSCs in neurospheres. Although growing neural progenitor cells under low oxygen concentration depends on the culture conditions and on the cell mode,15 our findings demonstrated that hypoxia is essential for regulating neural differentiation and its effects depend on the timecourse of NSCs differentiation. These results taken together suggest that mild hypoxic microenvironment
Neurological Research
2014
VOL .
36
NO .
9
811
Binh et al.
Time-sensitive effects of hypoxia on stem cells
Figure 7 Expression of non-neural markers in neurospheres was inhibited in hypoxic culture condition (experiment-2). (A, B) Immunohistochemistry staining of Desmin (marker of mesoderm progenitor cells); and (D, E) immunohistochemistry staining of Cytokeratin AE1/3 (marker for cells of epithelial origin including skin and hair progenitor cells) were examined. (C, F) There were significantly different percentages of Desmin and Cytokeratin AE1/3-positive cells between two culture conditions. The bar chart represents mean and standard error (SE). * P , 0.05; ** P , 0.01. Bar 5 100 mM.
might be an important factor in neural differentiation outcome, especially in the later stage of NSCs induction.1,12 In future, NSCs are promising candidates for use as donor cells in transplantation therapy for repairing tissue damage and replacing organs. However, NSCs
derived from pluripotent stem cells have long-life multipotent ability and possess possible risk of teratoma formation when applied in cell replacement therapies in the future. Some studies have identified better protocols for generating neurons with lower teratoma formation risk.23 Our study suggested that
Figure 8 Immunocytochemistry of HIF-1alpha in neurospheres in hypoxic and normoxic culture conditions (experiment-2). (A, B) Immunocytochemistry staining of HIF-1alpha was examined. (C) There was significantly different percentages of HIF-1alphapositive cells between two culture conditions. The bar chart represents mean and standard error (SE). *** P , 0.001. Bar 5 100 mM.
812
Neurological Research
2014
VOL .
36
NO .
9
Binh et al.
hypoxia could be considered as a potential element for controlling proliferation and differentiation of NSCs possessing multipotent ability. In conclusion, we showed that hypoxia is essential for regulating neural differentiation and we demonstrated the different effects on the NSC differentiation occurring during development. These results highlight the importance of oxygen homeostasis in regulating neural differentiation in cell fate commitment and maturation. It is suggested that oxygen tension control may be crucial for neural embryonic development and neural generation in vitro. The hypoxic culture of the present study expanded ES cells into neuron progenitor cells with low risk of teratoma formation and also provided a useful and effective tool for future cell therapy.
Disclaimer statements Contributors None. Funding None. Conflicts of interest No competing financial interests exist. Ethics approval We fully complied with the ‘Guidelines Concerning Experimental Animals’ issued by the Japanese Association for Laboratory Animal Science and exercised due consideration so as not to cause any ethical problems.
Acknowledgements The authors are indebted to Ms. Kyoko Takahashi for her excellent technical assistance. This work was supported by grants from the Ministry of Education, Culture, Sports, Science and Technology of Japan.
References 1 De Filippis L, Delia D. Hypoxia in the regulation of neural stem cells. Cell Mol Life Sci. 2011;68:2831–44. 2 Panchision DM. The role of oxygen in regulating neural stem cells in development and disease. J Cell Physiol. 2009;220:562–8. 3 Breunig JJ, Haydar TF, Rakic P. Neural stem cells: historical perspective and future prospects. Neuron. 2011;70:614–25. 4 Burton G.J. Oxygen, the Janus gas; its effects on human placental development and function. J Anat. 2009;215:27–35. 5 Fischer B, Bavister BD. Oxygen tension in the oviduct and uterus of rhesus monkeys, hamsters and rabbits. J Reprod Fertil. 1993;99:673–9.
Time-sensitive effects of hypoxia on stem cells
6 Jauniaux E, Watson A, Ozturk O, et al. In-vivo measurement of intrauterine gases and acid-base values in early human pregnancy. Hum Reprod. 1999;14:2901–4. 7 Simon MC, Keith B. The role of oxygen availability in embryonic development and stem cell function. Nat Rev Mol Cell Biol. 2008;9:285–96. 8 Hitoshi S, Seaberg R, Koscik C et al. Primitive neural stem cells from the mammalian epiblast differentiate to definitive neural stem cells under the control of Notch signaling. Genes Dev. 2004;18:1806–11. 9 Abramihina TV, Isaev DA, Semechkin RA. Effect of hypoxia on neural induction in colonies of human parthenogenetic stem cells. Bull Exp Biol Med. 2012;154:130–2. 10 Ezashi T, Das P, Roberts RM. Low O2 tensions and the prevention of differentiation of hES cells. Proc Natl Acad Sci USA. 2005;102:4783–8. 11 Hirano M, Yamamoto A, Yoshimura N, et al. Generation of structures formed by lens and retinal cells differentiating from embryonic stem cells. Dev Dyn. 2003;228:664–71. 12 Santilli G, Lamorte G, Carlessi L. Mild hypoxia enhances proliferation and multipotency of human neural stem cells. PLoS One.. 2010;5(1):e8575. 13 Kitajima H, Yoshimura S, Kokuzawa J, et al. (2005). Culture method for the induction of neurospheres from mouse embryonic stem cells by coculture with PA6 stromal cells. J Neurosci Res. 2005;80:467–74. 14 Prithi R, Evan S. Neuronal stem cells and their manipulation. In: Robert L and Irina K. Essential Stem Cell Methods: Elsevier, 2009: pp. 23–51. 15 Vieira HL, Alves PM, Vercelli A. Modulation of neuronal stem cell differentiation by hypoxia and reactive oxygen species. Prog Neurobiol. 2011;93(3):444–55. 16 Zheng X, Pereira T, et al. Hypoxia requires notch signaling to maintain the undifferentiated cell state. Dev Cell. 2005;9:617–28. 17 Zhang CP, Zhu LL, Zhao T, et al. Characteristics of Neural Stem Cells Expanded in Lowered Oxygen and the Potential Role of Hypoxia-Inducible Factor-1Alpha. Neurosignals. 2007;15:259–65. 18 Giese AK, Frahm J, Hu¨bner R, et al. Erythropoietin and the effect of oxygen during proliferation and differentiation of human neural progenitor cells. BMC Cell Biology. 2010;11:94. 19 Morrison SJ, Csete M, Groves AK, et al. Culture in reduced levels of oxygen promotes clonogenic sympathoadrenal differentiation by isolated neural crest stem cells. J Neurosci. 2000;20:7370–6. 20 Studer L, Csete M, Lee SH, et al. Enhanced proliferation, survival, and dopaminergic differentiation of CNS precursors in lowered oxygen. J Neurosci. 2000;20:7377–83. 21 Clarke L, van der Kooy D. Low Oxygen Enhances Primitive and Definitive Neural Stem Cell Colony Formation by Inhibiting Distinct Cell Death Pathways. Stem Cells. 2009;27:1879–86. 22 Mazumdar J, O’Brien WT, Johnson RS, et al. (2010). O2 regulates stem cells through Wnt/b-catenin signalling. Nat Cell Biol. 2010;12:1007–13. 23 Hara A, Taguchi A, Aoki H, et al. Folate antagonist, methotrexate induces neuronal differentiation of human embryonic stem cells transplanted into nude mouse retina. Neurosci Lett. 2010;477(3):138–43.
Neurological Research
2014
VOL .
36
NO .
9
813
Time-sensitive effects of hypoxia on differentiation of neural stem cells derived from mouse embryonic stem cells in vitro Nguyen Huy Binh1, Hitomi Aoki2, Manabu Takamatsu1, Yuichiro Hatano1, Akihiro Hirata1,3, Hiroyuki Tomita1, Akira Hara1 1
Department of Tumor Pathology, Gifu University Graduate School of Medicine, Japan, 2Department of Tissue and Organ Development, Gifu University Graduate School of Medicine, Japan, 3Division of Animal Experiment, Life Science Research Center, Gifu University, Japan Objectives: Oxygen tension is an important component of microenvironment for the differentiation of embryonic stem cells including neural lineage. However, the comprehensive influence of hypoxia on neural differentiation during embryonic neural development has not yet been examined. Methods: In this study, we investigated the effect of low oxygen levels (5% O2), or hypoxia, in two stages of neural differentiation in vitro: (1) inducing mouse embryonic stem cells into neural stem cells (NSCs); and then (2) inducing NSCs into neural progenitor cells in neurospheres. Results: In the first stage, NSCs generation was reduced under hypoxia. Less mature morphological changes (including neural marker) of NSCs were observed, suggesting the prevention of early differentiation under hypoxic conditions. Thus undifferentiated stem cells were maintained in this stage. However, in the second stage, hypoxia induced neural differentiation in neurospheres. Nevertheless, nonneural progenitor cell formation, such as mesoderm progenitor cell lines or epithelial cell lines, was restricted by low oxygen tension. Discussions: Our results demonstrate that hypoxia is essential for regulating neural differentiation and show the different effects on NSC differentiation dependent on the time-course of NSC development. In the early stage of NSCs induction, hypoxia inhibits neural differentiation and maintains the undifferentiated state; in the later stage of NSCs induction, hypoxia induces neural differentiation. Our study may contribute to the development of new insights for expansion and control of neural differentiation.
Keywords: Embryonic stem cells, Neural stem cells, Neural progenitor cells, Hypoxia, Neuronal development
Introduction In aerobic organisms, oxygen regulates various intracellular pathways involved in cellular metabolism, proliferation, survival, and fate, so that it is a critical factor in tissue and organ morphogenesis during mammalian embryonic development and throughout post-natal life.1 Oxygen plays an important role in regulating the growth and differentiation state of neural stem cells (NSCs) in the developing embryo stage of the mammalian central nervous system.1,2 Neural stem cells, which are multipotent precursor cells that reside in specialized regions of the fetus, have long life, self-renewable, and generate neurons, astrocytes, and oligodendrocytes.3 This makes them attractive entities for study to gain a better understanding of the
Correspondence to: Akira Hara, Department of Tumor Pathology, Gifu University Graduate School of Medicine, Yanagido 1-1, Gifu City, Gifu 501-1194, Japan. Email: [email protected]
804
ß W. S. Maney & Son Ltd 2014 DOI 10.1179/1743132814Y.0000000338
effects of oxygen levels on embryonic neural development, as well as for possible therapeutic applications. It is known that, in the early stage of embryonic development, mammalian blastocysts are exposed to a low concentration of O2 ranging from 1.5 to 5.3% in the reproductive tract.4–6 Several studies have revealed that hypoxia might profoundly influence stem cells microenvironment and can promote the differentiation of certain types of stem or progenitor cells, while inhibiting the differentiation of others.7 Thus hypoxia may be regarded as driving the regulation of stem/ progenitor cell differentiation, especially the regulation of neural differentiation. In vivo, neural differentiation during embryonic development includes two stages: early stage and later stage of NSCs induction. In the early stage of NSCs induction, the first NSCs to arise are primitive NSCs, which can be isolated from the anterior embryo from embryonic day E5.5 epiblast until E8.5 neuroectoderm. In the later stage of NSCs
Neurological Research
2014
VOL .
36
NO .
9
Binh et al.
induction, the transition of primitive NSCs to definitive NSCs in the embryo at approximately E8.5 occurs and definitive NSCs are present in the brain throughout the life of the organism.8 In the early stage of neural induction from embryonic stem cells, the transcription of stem cell pluripotency genes such as Pou5f1 (Oct4), Nanog, and Sox2 is not completely suppressed and researchers have reported that NSCs are less likely to be generated in low oxygen conditions.9,10 Furthermore, during the later stages of neural induction, low oxygen tension may activate molecular pathways that regulate Wnt/beta-catenin, Oct4, and Notch signaling and exert a positive effect on neural differentiation of ES cells, resulting in a faster commitment toward neural progenitors.1 Consequently, understanding the effects of hypoxia during neural commitment is important for scientific and therapeutic purposes and may provide new insights into ES cell proliferation and differentiation. However, studies on the influence of hypoxia in the early and later stages of differentiation of NSC derived from ES cells have not been conducted. In this study, we demonstrate that hypoxia is essential for regulating neural differentiation and that hypoxia has various effects on the NSC differentiation dependent on the time-course of NSC development. We expect essential findings for the improvement of current therapeutic strategies for the differentiation of NSCs.
Materials and Methods Low-oxygen culture In the normoxic condition, mouse embryonic stem (mES) cells and neurospheres were placed in a 37uC incubator supplemented with 20% O2 and 5% CO2. In the hypoxic condition, 5% O2, 5% CO2, and N2 gas were mixed using compressed air and supplied into a sealed container with a small outtake valve placed inside a 37uC incubator (Wakenyaku CO2 incubator 9000E series, Kyoto, Japan).
ES cell culture Green fluorescent protein (GFP)-expressing ES cells11 were maintained on gelatin-coated dishes in Dulbecco’s modified Eagle’s medium (DMEM, Invitrogen, CA, USA) supplemented with 10% Hyclone Fetal Bovine Serum (Thermo Scientific, Massachusetts, USA), 1024 M 2-mercaptoethanol, non-essential amino acid solution (Invitrogen, California, USA), and human leukemia inhibitory factor (LIF, 20 ng/ml ESGROH, Millipore, Massachusetts, USA). For differentiation, 2000 trypsinized mES cells were placed in six-well plates seeded with mitomycinC treated mouse embryonic fibroblasts PA6 cells in advance and differentiated in a minimal essential medium (alphaMEM, Invitrogen, California, USA) supplemented with 10% fetal calf serum (FBS,
Time-sensitive effects of hypoxia on stem cells
Thermo Scientific, USA). Unless otherwise mentioned, 20 pM fibroblast growth factor (FGF), 10 pM cholera toxin, and 100 nM dexamethasone were added from days 0 to 6, days 0 to 3, and days 3 to 6 of the culture, respectively. The medium was changed twice per week.
Induction of neurospheres To induce neurospheres, after washing the dish with phosphate-buffered saline (PBS, Invitrogen, CA, USA) to remove floating cells in the medium, only differentiated mES colonies on PA6 were treated with 0.2% trypsin and dissociated into single cells and then transferred to a growth medium in culture flasks (Nunclon, Thermo Scientific) at a concentration of 150 000 cells/ml. The detached mES colonies were mechanically dissociated in serum-free medium consisting of DMEM and F-12 nutrient (1:1, Invitrogen, La Jolla, CA, USA). The cells were grown in growth medium (DMEM) and F-12 nutrient, epidermal growth factor (EGF), FGF (20 ng/ml each; R&D Systems, Minneapolis, MN, USA), and 2% B27H supplement (Invitrogen, CA, USA). Half of the medium was replaced every 2 days with fresh medium containing the same concentrations of growth factors.
Analysis of neural differentiation in early stage (experiment-1) and later stage (experiment-2) of NSCs induction under hypoxia Experiment-1: Undifferentiated mES cells were cocultured with PA6 stromal cells for 6 days to induce NSCs. In the normoxia group, mES was incubated in 20% oxygen from days 0 to 6. In the hypoxia group, mES cells were incubated in 20% oxygen from days 0 to 1, then incubated in 5% oxygen from days 1 to 6.1,12 An outline of the experiment-1 is shown in Fig. 1A. Experiment-2: undifferentiated mES cells were cocultured with PA6 stromal cells for 6 days to induce NSCs. Then these cells were enzymatically digested into single cells and transferred to a growth medium with EGF, FGF, and B27 supplement in culture flasks for 6 days to induce neurospheres containing NSCs and neural progenitor cells. In the normoxia group, neurospheres were incubated in 20% oxygen from days 0 to 12. In the hypoxia group, neurospheres were incubated in 20% oxygen from days 0 to 7, then incubated in 5% oxygen from days 7 to 12.1,12 An outline of the experiment-2 is shown in Fig. 1B.
Immunocytochemistry for NSCs in six-well plates (for experiment-1) Cells grown on six-well plates were fixed with 4% paraformaldehyde (4% PFA) for 20 minutes, then washed in 0.01 M PBS and incubated in blocking solution (2% bovine serum albumin – 2% BSA) for 30 minutes. The cells were incubated with anti-Tuj-1 (mouse IgG, 1:1000, Covance, Princeton, NJ, USA) in 2% BSA/PBS overnight at 4uC. The secondary
Neurological Research
2014
VOL .
36
NO .
9
805
Binh et al.
Time-sensitive effects of hypoxia on stem cells
Figure 1 (A) Experiment-1: undifferentiated mouse embryonic stem (mES) cells were co-cultured with PA6 stromal cells for 6 days to induce neural stem cells (NSCs). Normoxia group: from days 0 to 6, incubated in 20% O2 Hypoxia group: from days 0 to 1, incubated in 20% O2; from days 1 to 6, incubated in 5% O2. (B) Experiment-2: undifferentiated mES cells were co-cultured with PA6 stromal cells for 6 days to induce NSCs. Then these cells were enzymatically digested into single cells and transferred to a growth medium with fibroblast growth factor (FGF), epidermal growth factor (EGF), and B27 supplement in culture flasks for 6 days to induce neurospheres containing NSCs and neural progenitor cells. Normoxia group: from days 0 to 12, incubated in 20% O2. Hypoxia group: from days 0 to 7, incubated in 20% O2; from days 7 to 12, incubated in 5% O2.
antibody Alexa Fluor 568 (red) goat anti-mouse IgG (1:1,000, Invitrogen, Eugene, OR, USA) was used to visualize the signal for 60 minutes at room temperature. After washing with PBS, the cell nuclei were stained with 49,6-diamino-2-phenylindole (DAPI, 1:1000, Wako Pure Chemical, Osaka, Japan) for 5 minutes at room temperature.
Immunohistochemistry for NSCs in neurospheres (for experiment-2) Neurospheres were collected and fixed overnight in 10% phosphate-buffered formalin (pH 7.0), embedded in paraffin, and then sectioned. The deparaffinized sections were blocked to endogenous peroxidase activity by incubation in distilled water containing 3% hydrogen peroxide for 5 minutes. Antigen retrieval was performed using 0.01 M citrate buffer (pH 6.0) by the Pascal heat-induced target retrieval system (DAKO, Glostrup, Denmark). Non-specific binding sites were blocked in 0.01 M PBS containing 2% BSA (Wako Pure Chemical, Osaka, Japan) for 60 minutes.
806
Neurological Research
2014
VOL .
36
NO .
9
Anti-Desmin (mouse IgG, 1:100; DAKO, Glostrup, Denmark), anti-Cytokeratin AE1/3 (mouse IgG, 1:100; DAKO, Glostrup, Denmark), anti-Ki-67 (rat IgG, clone TEC-3, 1:100, DAKO, Glostrup, Denmark), and anti-hypoxia-inducible factor-1alpha (anti-HIF1alpha) (mouse IgG, 1:500; Millipore, Massachusetts, USA) in 2% BSA/PBS were added to the slides and incubated overnight at 4uC. Primary antibodies were detected with biotinylated anti-mouse IgG (Elite PK 6102 Mouse IgG Vestastain ABC kit Vector Laboratories, Burlingame, CA, USA) and biotinylated anti-rat IgG (1:200, DAKO, Glostrup, Denmark) for 30 minutes, respectively, followed by incubation with avidin-coupled peroxidase (Vectastain ABC kit, Vector Laboratories, Burlingame, CA, USA) for 30 minutes. The peroxidase binding sites were detected by staining with 3,39-diaminobenzidine (DAB) in 50 mM Tris– EDTA buffer (pH 7.6). Finally, counterstaining was performed using Mayer’s hematoxylin. For negative controls, the primary antibody was substituted with
Binh et al.
Time-sensitive effects of hypoxia on stem cells
the buffer (PBS) or with non-immune immunoglobulin G.
Results The hypoxic condition inhibited generation of NSC from mES cells co-cultured with PA6
Immunofluorescence chemistry for NSCs in neurospheres (for experiment-2)
To investigate the effect of hypoxia on generation of NSCs from mES cells, we incubated mES cells cocultured with PA6 for 5 days under the hypoxic or normoxic condition (Fig. 1A). This culture technique is known as an efficient method for induction of NSCs from mES cells under the normoxic condition.6 Morphological differences of the outgrowth cells were easily recognizable between the two conditions as prominent neurite outgrowth emerging from the colonies was observed in the normoxic culture whereas less frequent neurite outgrowth was seen in the hypoxic culture (Fig. 2D and E). Neurite outgrowths from NSC colonies on PA6 feeder were assessed by the immunocytochemical method. Tuj-1 (early NSC marker) positive cells appeared prominently in normoxic cell culture, while a limited number of Tuj-1-positive cells were observed in hypoxic cell culture (Fig. 2C). The results from RT-PCR (Fig. 3) showed the expressions of Nestin (NSC marker) were most remarkable in normoxic culture and suppressed in a hypoxic culture (P , 0.001). These results suggested that hypoxia inhibited the generation of NSCs from mES cells.
The first antibodies, anti-Nestin (rabbit IgG, 1:200; Immuno-Biological Laboratory, Gunma, Japan), antimicrotubule associated protein-2 (anti-MAP2) (mouse IgG, 1:500; Sigma-Aldrich, St. Louis, MO, USA), and anti-glial fibrillary acidic protein (anti-GFAP) (rabbit IgG, 1:500; DAKO, Glostrup, Denmark) in 2% BSA/ PBS were added to the slides and incubated overnight at 4uC. The second antibodies, Alexa Fluor 568 (red) goat anti-mouse IgG (1:1,000, Invitrogen, Eugene, OR, USA) and Alexa Fluor 488 (green) goat antirabbit IgG (1:1,000, Invitrogen, Eugene, OR, USA) were used to visualize the signal for 60 minutes at room temperature. After washing with PBS, the cell nuclei were stained with 4,6-diamino-2-phenylindole (DAPI, 1:1,000, Wako Pure Chemical, Osaka, Japan) for 5 minutes at room temperature.
Cell counts and statistical analysis Photographs for immunohistochemistry staining were taken under a microscope with a high-resolution digital camera (Olympus, Tokyo, Japan). Fluorescence was also photographed under a fluorescence microscope with a high-resolution digital camera (Olympus, Tokyo, Japan). The number of immunoreactive cells in five visual fields (50–100 cells per field) in each sample was counted in a randomized fashion. All results are expressed as mean¡standard error (SE).
Reverse Transcription Polymerase Chain Reaction (RT-PCR) Total RNA was extracted from cells using the RNeasy Mini kit (Qiagen, Valencia, CA, USA). Total RNA (0.5 mg each) was reverse transcribed using Superscript III Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). Quantitative real-time PCR was carried out with the Thermal Cycler Dice Real Time System Single (Takara, Kyoto, Japan) using the SYBR Green (Takara, Kyoto, Japan) method. The primers were as follows: MAP2 (ATGACAGGCAAGTCGGTGAAG and TTGAGTCCACTGGTCGAGGTT) GFAP (CGGAGACGCATCACCTCTG and TGGAGGAGTCATTCGAGACAA) Nestin (GTGCCTCTGGATGATG and TTGACCTTCCTCCCCCTC) Oct4 (ACCAGTTGCCATTGGTGGAAA and CATGAGGAGAGTCCGGTACTT) HIF-1alpha (GTCCCAGCTACGAAGTTACAGC and CAGTGCAGGATACACAAGGTTT) Beta-actin (ATGGAGCCACCGATCCACA and CATCCGTAAAGACCTCTATGCCAAC) For evaluation of gene expression, beta-actin was used as internal control.
Hypoxic condition promoted the generation of neural progenitor cells from NSCs contained in neurospheres Next, to determine the effect of hypoxia on generation of neural progenitor cells from NSCs in neurospheres, we generated neurospheres composed of free-floating clusters of NSCs supplied with EGF, FGF, and B27 in hypoxic or normoxic conditions (Fig. 1B). This culture technique is known as an efficient method for induction of neural progenitor cells from NSCs.13 Immunohistochemical staining examinations showed that neurospheres in hypoxic culture were composed of more MAP2 (neural progenitor cells marker) positive cells and GFAP (glial progenitor cells marker) positive cells as compared with those in normoxic culture (Fig. 4A, B, D, and E). The frequencies of MAP2-positive cells in hypoxic culture and normoxic culture were approximately 28.6 and 15.2%, respectively (Fig. 4C). Similarly, the frequencies of GFAP-positive cells in hypoxic culture and normoxic culture were approximately 7.4 and 3.2%, respectively (Fig. 4F). There was a significant difference in the percentages of GFAP and MAP2 expressing cells between the two culture conditions (P , 0.05). In addition, over 50% of the cells in the neurospheres in normoxic culture were ki-67 (proliferating cell marker) positive, whereas only about 20% positive cells were found in hypoxic culture (Fig. 5A–C). Furthermore, Nestin (primitive NSC marker) immunopositive cells
Neurological Research
2014
VOL .
36
NO .
9
807
Binh et al.
Time-sensitive effects of hypoxia on stem cells
Figure 2 Neural differentiation of mES cells co-cultured with PA6 was inhibited by hypoxia (experiment-1). (A, B) Tuj-1 immunofluorescence staining (early neural stem cells (NSCs) marker in red) was expressed in the outgrowth cells in two cultures conditions. (C) Percentage of Tuj-1-positive cells in hypoxic and normoxic culture condition; there was a significantly different between two culture conditions (P , 0.05). (D, E) Prominent neurite outgrowth emerging from the colonies was observed in the normoxic culture, whereas less frequent neurite outgrowth was seen in the hypoxic culture. These results were shown by the percentage of neurite-bearing cells and neurite length. The bar chart represents mean and SE. * P , 0.05; ** P , 0.01; *** P , 0.001. Bar 5 100 mM.
appeared frequently in normoxic culture but rarely in hypoxic culture (Fig. 5D–F). The presence of many cells positive for Ki-67 and Nestin means that the primitive proliferating NSCs exist in neurospheres under the hypoxic condition. The mRNA expressions of MAP2, GFAP, Nestin, and hypoxia-inducible factor-1alpha (HIF-1alpha) were checked in days 8, 10, and 12 according to our protocol for experiment-2 (Fig. 1B). In the neurospheres, mRNA expressions of MAP2, GFAP, and Nestin were found and the existence of neural
progenitor cells, glia progenitor cells, and NSCs in the neurospheres was confirmed (Fig. 6A–C). The expression of GFAP and MAP2 increased during neurosphere formation in both culture conditions. However, the expression of GFAP and MAP2 was most remarkable in hypoxic culture but was suppressed in normoxic culture (P , 0.05) (Fig. 6A and B). Contrary to GFAP and MAP2, we found the expression of Nestin was maintained in normoxic culture and decreased in hypoxic culture (Fig. 6C). After 5 days of culture in the hypoxic condition, there was a significant difference in Nestin expression between hypoxic culture and normoxic culture (P , 0.01).
The time-course of HIF-1alpha up-regulation under hypoxic stimulation and effects on generation of non-neural cell lines in the neurospheres
Figure 3 RT-PCR was used for analyzing the expression of Oct4 (maker for pluripotent mouse embryonic stem (mES)) and Nestin (marker for primitive NSCs) in day 6 (experiment1). The bar chart represents mean and standard error (SE). NS not significant; *** P , 0.001.
808
Neurological Research
2014
VOL .
36
NO .
9
To follow the time-course of HIF-1alpha up-regulation under hypoxic stimulation we used RT-PCR to check the HIF-1alpha expression in days 8, 10, and 12 in both conditions (Fig. 6). Significantly higher expression of HIF-1alpha was found at days 8, 10, and 12 in hypoxic culture as compared with normoxic culture (Fig. 6D). In particular, a much higher
Binh et al.
Time-sensitive effects of hypoxia on stem cells
Figure 4 Neurospheres were incubated for 5 days under hypoxic condition or normoxic condition (experiment-2). (A, B) MAP2 immunofluorescence staining (neural progenitor cells marker in red) and (D, E) GFAP immunofluorescence staining (glial progenitor cells marker in green) were examined. (C, F) There were significantly different percentages of MAP2 and GFAPpositive cells between two culture conditions. The bar chart represents mean and standard error (SE). * P , 0.05. Bar 5 100 mM.
expression of HIF-1alpha was observed at day 8. The up-regulation of HIF-1alpha under hypoxic condition was confirmed by immunocytochemistry of neurospheres shown in Fig. 8. It was clearly observed that HIF-1alpha showed significantly strong expression in hypoxic culture condition (P , 0.001). The expression of non-neural markers in neurospheres was evaluated in both culture conditions. Immunohistochemical analysis demonstrated that frequencies of immunopositive cells for both Desmin (marker of mesoderm progenitor cells) and Cytokeratin AE1/AE3 (marker for cells of epithelial origin including skin and hair progenitor cells) decreased significantly in hypoxic culture (Fig. 7). These results suggest that HIF-1alpha is more upregulated under hypoxia and may inhibit the expression of non-neural markers in neurospheres.
Discussion The present study addressed the effects of hypoxic condition in two stages of neural differentiation in vitro: (1) inducing mES cells into NSCs; and then (2) inducing NSCs into neural progenitor cells in neurospheres. It was found that (i) in the early stage of NSC induction, hypoxia inhibited neural lineage differentiation from mES cells; (ii) in the later stage of NSC induction, hypoxia induced neural differentiation.
It is known that oxygen levels in developing tissue are regulated, and thus it is no surprise that oxygen levels have specific effects in neural differentiation in vitro as well as in vivo.14 Other studies which have manipulated the oxygen concentration in NSC studies both in vitro and in vivo and their findings suggest that a mild hypoxic microenvironment has an important influence on stem cells because mammalian blastocysts are exposed to a low concentration of O2 ranging from 1.5 to 5.3% during embryonic development.1,12 In most studies, hypoxia was considered to have driver-effects in regulating stem/ progenitor cell differentiation, especially in the regulation of neural differentiation.1,15 However, there is no comprehensive study on the influence of hypoxia on this regulation for neural differentiation associated with the time-course of embryonic neural development, especially in the early stage and later stage of NSC differentiation. In our study, we applied 5% of oxygen as the hypoxic condition for the analysis of neural differentiation in vitro. Our study confirmed that a hypoxic microenvironment is one of the important regulators of neural stem/progenitor differentiation in vitro. Whether the hypoxic condition is required for neural differentiation of mES cell-derived NSCs is controversial.15 In the early stage of NSC induction,
Neurological Research
2014
VOL .
36
NO .
9
809
Binh et al.
Time-sensitive effects of hypoxia on stem cells
Figure 5 Expression of neural stem cells (NSC) markers in neurospheres were inhibited in hypoxic culture condition (experiment-2). (A, B) Immunochemistry staining of Ki-67 (proliferating cell marker) and (D, E) immunofluorescence staining of Nestin (primitive NSCs marker in green) were examined. (C, F) There were significantly different percentages of Ki-67 and Nestin-positive cells between two culture conditions. The bar chart represents mean and standard error (SE). ** P , 0.01. Bar in Ki-67 staining 5 100 mM; bar in Nestin staining 5 50 mM.
our immunocytochemistry and morphological analysis showed less Tuj-1- (early NSCs marker) positive cells and less matured neural morphology (percentage of neurite-bearing cells and the length of neurite) in hypoxic condition compared with those in normoxic condition. It has been shown that hypoxia inhibited neural differentiation during the early stage of NSCs induction. Gustafsson et al.16 found that hypoxia in the early stage of NSC development blocked the differentiation of myogenic satellite cells and primary NSCs. In particular, NSCs were also reported to be less generated from human parthenogenetic stem cells at low oxygen tension in the early stage of NSC development.9 A number of studies have shown that culturing under hypoxic conditions prevents the differentiation of human ES cell colonies and maintains them in a fully pluripotent state.10 These findings support our present study. Thus, hypoxia during the early stage of NSCs induction probably maintains pluripotency of ES cells and consequently inhibits too early neural differentiation in development of the fetal nervous system. Next, our study also confirmed the effect of a hypoxic microenvironment on regulating neural stem/progenitor differentiation in the later stage of
810
Neurological Research
2014
VOL .
36
NO .
9
NSC induction. We found that a hypoxic microenvironment induced more neural progenitor cells (MAP2 -positive cells) and glial progenitor cells (GFAP-positive cells) but reduced the expression of primitive NSC markers (Nestin) and non-neural markers (Desmin and Cytokeratin AE1/3) in the neurospheres. The Ki-67-positive-proliferating cells in neurosphere were also reduced in the hypoxic condition. Our observations regarding the effects of hypoxia on neurospheres were opposite to those seen in the early stage of NCS induction. Recent studies have shown that more neural progenitor cells were produced under the hypoxic conditions.17 Moreover, the differentiation potential of human fetal neural progenitor cells were also explored under lowered oxygen levels.18 Studer et al. and Morrison et al. reported that when oxygen was lowered to more physiological levels (3% oxygen) there were marked trophic and proliferative effects on neural precursors and significantly changed developmental kinetics and outcome as compared with traditional culture conditions (20% oxygen).19,20 These findings about neural differentiation of neural progenitor cells accord with our result of neural differentiation in the later stage of NSC induction under hypoxic conditions. In the
Binh et al.
Time-sensitive effects of hypoxia on stem cells
Figure 6 RT-PCR was used for analyzing the expression of MAP2, GFAP, Nestin, and HIF-1alpha of in days 8, 10, and 12 in two culture conditions (experiment-2). The chart represents mean and standard error (SE). * P , 0.05; ** P , 0.01; *** P , 0.001; NS not significant.
present study, the expression of mRNA showed that MAP2 and GFAP up-regulated during neurosphere formation in both culture conditions, but the expression of MAP2 and GFAP were significantly higher in hypoxic culture than in normoxic culture (Fig. 6A and B). Conversely, mRNA expression of NSC marker such as Nestin decreased after 5 days of hypoxia. These results suggest that a hypoxic microenvironment promotes NSCs to neural and glial progenitor cells and then differentiates them into neurons and glia cells in the later stage of NSCs induction. Neural differentiation is a result of the sum of all signals impinging on the cells and the biochemical state of the cell.14 The potential mechanism of the hypoxia on NSC differentiation remains to be elucidated, but there are several studies showing that HIF-1alpha stabilization under hypoxia is considered to directly or indirectly regulate many genes, which control neural differentiation. Clarke found that low oxygen concentrations may be involved in neural differentiation through different pathways in the early stage of NSCs and later stage of NSCs.21 Consequently, the response of the ES cells and NSCs to a hypoxic microenvironment at different times of NSCs induction might cause different effects on neural differentiation: (i) in the early stage of NSC induction, hypoxia inhibits neural lineage differentiation from mES cells and maintains undifferentiated
property; (ii) in the later stage of NSC induction, hypoxia induces neural differentiation including neural and glial lineages. In the early stage of NSC differentiation, Mazumdar showed that HIF-1alpha modulates Wnt/beta-catenin signaling in hypoxic ES cells by enhancing beta-catenin activation.22 Moreover, enhanced HIF-1alpha expression by hypoxia may affect the transcription of stem cell pluripotency genes such as Pou5f1 (Oct4), Nanog, and Sox2, and then prevent neural differentiation.9 In the later stage of NCS induction, low oxygen tension may activate molecular pathways that regulate Wnt/beta-catenin, Oct4, and Notch signaling and exert a positive effect on early differentiation of NSCs, resulting in a faster commitment toward neural progenitors.1 In the later stage of NSC induction of the present study, HIF1alpha expression up-regulated in hypoxic condition, which was confirmed by RT-PCR in days 8, 10, and 12 (Fig. 6D) and immunocytochemistry staining (Fig. 8), may induce proliferation and neural differentiation of NSCs in neurospheres. Although growing neural progenitor cells under low oxygen concentration depends on the culture conditions and on the cell mode,15 our findings demonstrated that hypoxia is essential for regulating neural differentiation and its effects depend on the timecourse of NSCs differentiation. These results taken together suggest that mild hypoxic microenvironment
Neurological Research
2014
VOL .
36
NO .
9
811
Binh et al.
Time-sensitive effects of hypoxia on stem cells
Figure 7 Expression of non-neural markers in neurospheres was inhibited in hypoxic culture condition (experiment-2). (A, B) Immunohistochemistry staining of Desmin (marker of mesoderm progenitor cells); and (D, E) immunohistochemistry staining of Cytokeratin AE1/3 (marker for cells of epithelial origin including skin and hair progenitor cells) were examined. (C, F) There were significantly different percentages of Desmin and Cytokeratin AE1/3-positive cells between two culture conditions. The bar chart represents mean and standard error (SE). * P , 0.05; ** P , 0.01. Bar 5 100 mM.
might be an important factor in neural differentiation outcome, especially in the later stage of NSCs induction.1,12 In future, NSCs are promising candidates for use as donor cells in transplantation therapy for repairing tissue damage and replacing organs. However, NSCs
derived from pluripotent stem cells have long-life multipotent ability and possess possible risk of teratoma formation when applied in cell replacement therapies in the future. Some studies have identified better protocols for generating neurons with lower teratoma formation risk.23 Our study suggested that
Figure 8 Immunocytochemistry of HIF-1alpha in neurospheres in hypoxic and normoxic culture conditions (experiment-2). (A, B) Immunocytochemistry staining of HIF-1alpha was examined. (C) There was significantly different percentages of HIF-1alphapositive cells between two culture conditions. The bar chart represents mean and standard error (SE). *** P , 0.001. Bar 5 100 mM.
812
Neurological Research
2014
VOL .
36
NO .
9
Binh et al.
hypoxia could be considered as a potential element for controlling proliferation and differentiation of NSCs possessing multipotent ability. In conclusion, we showed that hypoxia is essential for regulating neural differentiation and we demonstrated the different effects on the NSC differentiation occurring during development. These results highlight the importance of oxygen homeostasis in regulating neural differentiation in cell fate commitment and maturation. It is suggested that oxygen tension control may be crucial for neural embryonic development and neural generation in vitro. The hypoxic culture of the present study expanded ES cells into neuron progenitor cells with low risk of teratoma formation and also provided a useful and effective tool for future cell therapy.
Disclaimer statements Contributors None. Funding None. Conflicts of interest No competing financial interests exist. Ethics approval We fully complied with the ‘Guidelines Concerning Experimental Animals’ issued by the Japanese Association for Laboratory Animal Science and exercised due consideration so as not to cause any ethical problems.
Acknowledgements The authors are indebted to Ms. Kyoko Takahashi for her excellent technical assistance. This work was supported by grants from the Ministry of Education, Culture, Sports, Science and Technology of Japan.
References 1 De Filippis L, Delia D. Hypoxia in the regulation of neural stem cells. Cell Mol Life Sci. 2011;68:2831–44. 2 Panchision DM. The role of oxygen in regulating neural stem cells in development and disease. J Cell Physiol. 2009;220:562–8. 3 Breunig JJ, Haydar TF, Rakic P. Neural stem cells: historical perspective and future prospects. Neuron. 2011;70:614–25. 4 Burton G.J. Oxygen, the Janus gas; its effects on human placental development and function. J Anat. 2009;215:27–35. 5 Fischer B, Bavister BD. Oxygen tension in the oviduct and uterus of rhesus monkeys, hamsters and rabbits. J Reprod Fertil. 1993;99:673–9.
Time-sensitive effects of hypoxia on stem cells
6 Jauniaux E, Watson A, Ozturk O, et al. In-vivo measurement of intrauterine gases and acid-base values in early human pregnancy. Hum Reprod. 1999;14:2901–4. 7 Simon MC, Keith B. The role of oxygen availability in embryonic development and stem cell function. Nat Rev Mol Cell Biol. 2008;9:285–96. 8 Hitoshi S, Seaberg R, Koscik C et al. Primitive neural stem cells from the mammalian epiblast differentiate to definitive neural stem cells under the control of Notch signaling. Genes Dev. 2004;18:1806–11. 9 Abramihina TV, Isaev DA, Semechkin RA. Effect of hypoxia on neural induction in colonies of human parthenogenetic stem cells. Bull Exp Biol Med. 2012;154:130–2. 10 Ezashi T, Das P, Roberts RM. Low O2 tensions and the prevention of differentiation of hES cells. Proc Natl Acad Sci USA. 2005;102:4783–8. 11 Hirano M, Yamamoto A, Yoshimura N, et al. Generation of structures formed by lens and retinal cells differentiating from embryonic stem cells. Dev Dyn. 2003;228:664–71. 12 Santilli G, Lamorte G, Carlessi L. Mild hypoxia enhances proliferation and multipotency of human neural stem cells. PLoS One.. 2010;5(1):e8575. 13 Kitajima H, Yoshimura S, Kokuzawa J, et al. (2005). Culture method for the induction of neurospheres from mouse embryonic stem cells by coculture with PA6 stromal cells. J Neurosci Res. 2005;80:467–74. 14 Prithi R, Evan S. Neuronal stem cells and their manipulation. In: Robert L and Irina K. Essential Stem Cell Methods: Elsevier, 2009: pp. 23–51. 15 Vieira HL, Alves PM, Vercelli A. Modulation of neuronal stem cell differentiation by hypoxia and reactive oxygen species. Prog Neurobiol. 2011;93(3):444–55. 16 Zheng X, Pereira T, et al. Hypoxia requires notch signaling to maintain the undifferentiated cell state. Dev Cell. 2005;9:617–28. 17 Zhang CP, Zhu LL, Zhao T, et al. Characteristics of Neural Stem Cells Expanded in Lowered Oxygen and the Potential Role of Hypoxia-Inducible Factor-1Alpha. Neurosignals. 2007;15:259–65. 18 Giese AK, Frahm J, Hu¨bner R, et al. Erythropoietin and the effect of oxygen during proliferation and differentiation of human neural progenitor cells. BMC Cell Biology. 2010;11:94. 19 Morrison SJ, Csete M, Groves AK, et al. Culture in reduced levels of oxygen promotes clonogenic sympathoadrenal differentiation by isolated neural crest stem cells. J Neurosci. 2000;20:7370–6. 20 Studer L, Csete M, Lee SH, et al. Enhanced proliferation, survival, and dopaminergic differentiation of CNS precursors in lowered oxygen. J Neurosci. 2000;20:7377–83. 21 Clarke L, van der Kooy D. Low Oxygen Enhances Primitive and Definitive Neural Stem Cell Colony Formation by Inhibiting Distinct Cell Death Pathways. Stem Cells. 2009;27:1879–86. 22 Mazumdar J, O’Brien WT, Johnson RS, et al. (2010). O2 regulates stem cells through Wnt/b-catenin signalling. Nat Cell Biol. 2010;12:1007–13. 23 Hara A, Taguchi A, Aoki H, et al. Folate antagonist, methotrexate induces neuronal differentiation of human embryonic stem cells transplanted into nude mouse retina. Neurosci Lett. 2010;477(3):138–43.
Neurological Research
2014
VOL .
36
NO .
9
813
