Toxic effects of colloidal nanosilver in zebrafish embryos.

Research Article Received: 5 April 2013,

Revised: 22 October 2013,

Accepted: 15 November 2013

Published online in Wiley Online Library: 7 January 2014

(wileyonlinelibrary.com) DOI 10.1002/jat.2975

Toxic effects of colloidal nanosilver in zebrafish embryos Maider Olasagastia, Antonietta M. Gattib,c, Federico Capitanic, Alejandro Barrancoa, Miguel Angel Pardoa, Kepa Escuredoa and Sandra Rainieria* ABSTRACT: A variety of consumer products containing silver nanoparticles (Ag NPs) are currently marketed. However, their safety for humans and for the environment has not yet been established and no standard method to assess their toxicity is currently available. The objective of this work was to develop an effective method to test Ag NP toxicity and to evaluate the effects of ion release and Ag NP size on a vertebrate model. To this aim, the zebrafish animal model was exposed to a solution of commercial nanosilver. While the exposure of embryos still surrounded by the chorion did not allow a definite estimation of the toxic effects exerted by the compound, the exposure for 48 h of 3-day-old zebrafish hatched embryos afforded a reliable evaluation of the effects of Ag NPs. The effects of the exposure were detected especially at molecular level; in fact, some selected genes expressed differentially after the exposure. The Ag NP toxic performance was due to the combined effect of Ag+ ion release and Ag NP size. However, the effect of NP size was particularly detectable at the lowest concentration of nanosilver tested (0.01 mg l–1) and depended on the solubilization media. The results obtained indicate that in vivo toxicity studies of nanosilver should be performed with ad hoc methods (in this case using hatched embryos) that might be different depending on the type of nanosilver. Moreover, the addition of this compound to commercial products should take into consideration the Ag NP solubilization media. Copyright © 2014 John Wiley & Sons, Ltd. Keywords: Metals; Nanoparticles; Nanotoxicity; Silver; Zebrafish

Introduction

562

Silver is one of the most commonly used elements in nanotechnology. The antiseptic properties of this compound are enhanced when it presents itself at the nanosize scale. A variety of consumer products containing silver nanoparticles (Ag NPs) are currently available on the market, ranging from medical and pharmaceutical products, household appliances (such as the antibacterial systems for refrigerators and washing machines), textiles and food (such as supplements, food packaging materials and filters for sanitized drinking water) (Wijnhoven et al., 2009). In spite of such a widespread presence, their safety for human health has not yet been fully established. So far, the toxic effects of Ag NPs on human health have been studied mainly in vitro. The majority of the studies available on the effect of Ag NPs on human health have been reviewed by Johnston et al. (2010). Its ecotoxicology has been studied on a variety of animal models such as earthworms (Lapied et al., 2010), nematodes (Roh et al., 2009; Yang et al., 2012), and fish such as rainbow trout (Scown et al., 2010), fathead minnow (Laban et al., 2010) and medaka (Wu et al., 2010). Several toxicity studies on Ag NPs were also carried out on zebrafish (Asharani et al., 2008, 2011; Bar-Ilan et al., 2009; Griffitt et al., 2009). All studies agree that Ag NPs show some degree of toxicity for both humans and the environment. The toxic effects detected are generally oxidative stress, inflammation, apoptosis and cell metabolic disorder (Stone et al., 2007; Kim et al., 2009; Choi et al., 2010; Park et al., 2011; Shaw and Handy, 2011; Kim and Ryu, 2013). However, it is still not clear if such effects are due to the size of Ag NPs, the release of ions or both factors, and the results

J. Appl. Toxicol. 2014; 34: 562–575

published on this topic are still rather controversial (see Navarro et al., 2008; Kawata et al., 2009; Kim et al., 2009; Bouwmeester et al., 2011; Zhao and Wang, 2011; Beer et al., 2012). Moreover, no standard toxicity test has currently been developed in this field. In the food sector, a report on nanofood safety has been published by the Food and Agriculture Organization of the United Nations (FAO, 2010) and some basic guidelines on how to perform the risk assessment of NPs in the food chain have been published by the EFSA (2011). A recent report from the Transatlantic Think Tank for Toxicology (t4) stressed the importance of NPs chemical and physical characterization previous to any toxicological study (Silbergeld et al., 2011), as already reported by a number of other studies (Simon and Joner, 2008; Nel et al., 2009) and recommended the development of methods using alternative whole animal models such as zebrafish (Danio rerio) or nematodes (Caenorhabditis elegans). Considering the methodology gaps and the controversy on the toxic mode of action of Ag NPs, the objectives of this study

*Correspondence to: Sandra Rainieri, Food Research Division, Parque Tecnológico de Bizkaia, Astondo Bidea 609, 48160 Derio, Spain. Email: [email protected] a

AZTI-Tecnalia, Food Research Division, Parque Tecnológico de Bizkaia, Astondo Bidea 609, 48160 Derio, Spain

b

CNR-ISTEC Faenza, Via Granarolo, 64, 48018 Faenza RA, Italy

c

Nanodiagnostics srl, Via Enrico Fermi, 1/L-41057 San Vito di Spilamberto MO, Italy

Copyright © 2014 John Wiley & Sons, Ltd.

Toxic effects of colloidal nanosilver in zebrafish embryos were: (i) to establish a suitable protocol allowing the efficient testing of the toxic effects of Ag NPs in vivo in an alternative whole animal model, and (ii) to evaluate if these effects were due to the release of Ag+ ions or to NP size. To evaluate the effects of Ag NPs on a whole animal model, as recommended by the t4 report, zebrafish embryos were used. The choice of this animal model was due to the extended literature available in a variety of scientific fields, including toxicology and medicine as well as its high homology with the human genome. In fact, zebrafish is used as a predictive toxicology model for humans and can be considered an ideal system to be used as an intermediate step between in vitro cell-based tests and mammalian assays. Moreover, it is cheap and easy to grow and breed, it develops rapidly, its embryos are transparent and can be used as a system alternative to animals (Langheinrich, 2003; Parng, 2005; Sipes et al., 2011). In fact, fish embryos are considered alternative models according to the 3Rs concept as they fully comply with the replacement action (Embry et al., 2010; Halder et al., 2010; Strähle et al., 2012). Commercial colloidal nanosilver was used for the test. The choice of commercial nanosilver was performed to test an element that is currently marketed and possibly included in consumer products, and that can therefore be relevant for future risk assessments. Our working hypothesis was that (i) the exposure method can affect the detection and understanding of the toxic effects of NPs, and (ii) metal NPs exert a dual effect (one due to their size and one due to the release of ions by NP chemical corrosion). To test our hypothesis we first compared the efficacy of various exposure protocols based on (i) the stability of the element; (ii) the absorption and distribution of Ag NPs in zebrafish embryos; (iii) the mortality rate; and (iv) the differential expression of some selected genes. To verify if the toxic effect was due to the size of the NPs or to the ions released, we compared the effect of nanosilver dissolved in zebrafish maintenance medium (containing salts that precipitated and neutralized the Ag+ ions at a certain range of concentrations) to those of nanosilver dissolved in deionized water where Ag+ ions were free. This approach allowed the performance of reliable toxicity experiments with nanosilver and offered an insight into the mode of action of Ag NP toxicity, increasing the understanding of the NP mechanism of action on vertebrate animal models.

Materials and Methods Material Characterization

J. Appl. Toxicol. 2014; 34: 562–575

Zebrafish Exposure Two sets of experiments were carried out: (i) one aiming at establishing the most suitable exposure protocol for testing the effects of Ag NPs in zebrafish embryos (in which embryos were exposed to the compound solubilized in embryo water containing salts), and (ii) one aimed at comparing the effects of Ag NPs with those of Ag+ ions, in which embryos were exposed to the compounds solubilized in deionized water. In both cases, fertilized embryos were obtained from wild-type adult zebrafish (Danio rerio) bred and maintained in the AZTI Zebrafish Facility (EU-10-BI) following standard conditions (Westerfield, 2000). All experimental procedures were approved by the Regional Animal Ethics Committee. For the first set of experiments, groups of 30 embryos were suspended in 10 ml of an embryo water solution containing 5 mg l–1 of colloidal nanosilver and respective controls in glass Petri dishes of 6 cm diameter, and incubated at 26 ºC. The 5 mg l–1 concentration was selected based on the results obtained in a preliminary experiment as it was the highest concentration allowing transparency of the solution and, at the same time, to cause sublethal effects on the embryos detectable at the molecular level (results not shown). The following three


wileyonlinelibrary.com/journal/jat

563

A colloidal nanosilver solution of 10 000 mg l–1 dispersed in 1.9% of methanol was purchased at Polytech & Net GmbH (Schwalbach, Germany) and used as a stock solution that was subsequently diluted in embryo maintenance media (Embryo water, in mM: 0.05 CaCl2, 0.0125 MgSO4, 0.01875 NaHCO3 and 0.002 KCl) to obtain the three following testing concentrations: 0.01, 1.0 and 5.0 mg l–1. The nanosilver solution may contain additional stabilizing agents that were not disclosed by the manufacturer, for this reason to prepare the control solution the three nanosilver testing suspensions were passed through elution columns Bond-Elut SPE-NH2 (Varian, Palo Alto, CA., USA) that retained all the silver suspended. The recovered solutions were used directly as controls. An atomic absorption spectrometry analysis (240FS/240Z AA Duo system; Varian) was carried out on the recovered solution and confirmed that they

were free of silver (results not shown). The same technique was used to quantify the total silver concentration in the testing nanosilver solutions. The nanosilver solutions were digested with hot concentrated nitric acid (0.1 M) before the atomic absorption spectrometry measurements. Nanoparticle size was determined in the stock solution by imaging technique using a field emission transmission electron microscope (JEOL JEM-2200FS; JEOL, Tokyo, Japan) and a field emission gun environmental scanning electron microscope (FEG-ESEM, QUANTA 250F; FEI Company, Eindhoven, The Netherlands) coupled with an X-ray microprobe of an energy dispersive spectroscope (EDS; EDAX, Mahwah, NJ., USA). Size and aggregation level were also determined by dynamic light scattering technique (DLS), using the instrument Zetasizer Nano S ZEN1600 (Malvern Instruments, Malvern, UK). Samples were sonicated in an ultrasonic bath (Ultrasons H-9L; Selecta, Barcelona, Spain) for 1 h before use to ensure the homogeneity of the dispersion and size distribution. Particle size was also tested at time intervals over the entire duration of the experiment by DLS to verify if aggregation and changes in size occurred during the exposure. This last determination is described further. Silver solubility and speciation in testing solutions (nanosilver solubilized in embryo water and in deionized water) was simulated using the MEDUSA program (Make Equilibrium Diagrams Using Sophisticated Algorithms). Equilibrium constants were taken from the default database supplied with the software (Puigdomenech, 2010). The amount of free Ag+ ions in Ag NPs solutions was measured by using an Ag+ ion selective electrode (Metrohm, Herissau, Switzerland). A Metrohm double junction Ag/AgCl reference electrode was used as reference and the potential was recorded by a VersaSTAT 3 potentiostat (Princeton Applied Research, Oak Ridge, TN, USA). To avoid any alteration of Ag NPs all measurements were carried out in the same media used for zebrafish exposure (embryo water and deionized water) even though they were not the optimum conditions for the correct performance of the electrode. Calibration curves in the range between 0.1 μM to 100 μM were also performed in both media. Ag+ ion concentrations were obtained from these linear calibrations.

M. Olasagasti et al. exposure protocols were tested: (i) protocol 1: recently fertilized embryos (4 h post-fecundation – hpf) were exposed during 48 h; (ii) protocol 2: embryos of 72 hpf were exposed during 48 h; and (iii) protocol 3: embryos of 96 hpf were exposed during 24 h. Each exposure was carried out in triplicate. Table 1 summarizes the three exposure protocols tested. At the end of each experiment, mortality, malformations and developmental delays were determined by visual inspection under a stereomicroscope (Leica MZ FLIII, Heerbrugg, Switzerland) and recorded as toxic endpoints. Mortality was identified by coagulation or by missing heartbeat. During exposure, particle aggregation in suspension was measured by DLS. At the end of the experiment, embryos were used for determining Ag NPs localization, mortality and gene expression. The second set of experiments was carried out using exposure protocol 2. The commercial solution of colloidal nanosilver was suspended in pure deionized water (obtained by purifying distilled water on a Milli-Q system from Millipore, Billerica, MA, USA) at concentrations of 5.0, 1.0 and 0.01 mg l–1, and its effects on embryos were compared to those caused by an equal elemental concentration of Ag+ in ionic form (as AgNO3 by Sigma-Aldrich, St. Louis, MO, USA) also dissolved in pure deionized water; i.e. 7.9, 1.58 and 0.0158 mg l–1 of AgNO3, respectively. Cumulative mortality and gene expression were checked in the exposed embryos as described earlier. Following the same exposure protocol, the LC50 was determined for the exposure of zebrafish embryos to the colloidal nanosilver dissolved in embryo water and in deionized water and for AgNO3 dissolved in deionized water. The LC50 was calculated with a Probit analysis using the statistical language R.

Determination of Particles Aggregation in Experimental Condition Ag NPs aggregation was evaluated by measuring the hydrodynamic diameter by DLS during the experiments. Data analysis was performed using the Zetasizer software v.6.2. (Malvern Instruments) applying the General Purpose analysis. For each of the three exposure protocols tested, the commercial nanosilver solution was monitored at different time points: (i) at the beginning of the experiment (T0); (ii) after 24 h (T24h); and (iii) in case of protocols 1 and 2 after 48 h (T48h). Exposure experiments were carried out in triplicate as described above. The same nanosilver solution without embryos, placed in the same experimental conditions as the exposure experiments, was also monitored at T0 and T48h, to evaluate if the presence of living organisms affected its stability. For each Petri dish, the 10 ml of solution were tested entirely by sampling and measuring 1 ml at a time. The mean value of all measurements was calculated for each Petri dish and an average of the mean measurements of the three Petri dishes was considered as indicative of the average hydrodynamic

Table 1. Exposure protocols tested in the present study Exposure protocol

564

1 2 3

Start of exposure (T0) (hpf)

End of exposure (hpf)

Exposure time (h)

4 72 96

52 120 120

48 48 24


diameter of the NPs. Standard deviation was also calculated to provide an idea of the size variation at each time point. Silver Nanoparticle Uptake and Distribution Six to eight embryos for each exposure protocol were embedded in paraffin, and 5–10 μm thick sections were cut with a Leica microtome (Leica RM 2125RT, Biberach, Germany). The sections were placed on an acetate sheet, de-paraffined with xylol and mounted on an aluminum stub. To remove the paraffin, samples were covered with a few drops of xylol and, a few seconds later, liquid excess was slid along the sheet edge and absorbed in blotting paper. Dried samples were inserted into the chamber of the FEGESEM equipped with an EDS. The samples were observed in low vacuum from 20 to 30 kV, in secondary and in backscattered electron mode, with spots from 3 to 5. The backscattered modality shows materials with higher atomic density than the biological matrix. After spotting the Ag NPs, they were measured and photographed, and then the X-ray microprobe was focused on one of the Ag NPs to obtain the EDS spectrum. Differential Expression Analysis Total RNA extraction was carried out in triplicate in groups of 30 exposed embryos at the end of each experiment. RNA was extracted using TRIzol (Sigma-Aldrich) following the manufacturer’s instructions. RNA quality and concentrations were determined using a BioAnalyzer 2100 (Agilent, Santa Clara, CA, USA). Reverse transcription reactions were carried out using 40 ng of total RNA using a TaqMan Reverse Transcriptase Reagents kit (Applied Biosystems, Carlsbad, CA, USA). Reaction conditions were as follows: 25 ºC for 10 min, 48 ºC for 30 min and 95 ºC for 5 min. The corresponding cDNA was used as a template for quantitative real-time polymerase chain reaction (qRT-PCR). Five exposure biomarker genes were tested: Mt, considered as a specific biomarker for metal toxicity; Hsp70 and Gst-л1, two genes involved in the response to oxidative stress as well as general stressful conditions; Il1β and Tnfα, two genes that are activated in response to inflammation and involved in the innate immune response. Specific oligonucleotides were synthesized for the zebrafish genes tested using sequences from the NCBI and TIGR databases (see Table 2). qRT-PCR was performed using an ABI Prism 7000 Sequence Detection system (Applied Biosystems) with a SYBR Green PCR master mix (Applied Biosystems). The protocol of the reaction conditions was as follows: 50 °C for 2 min and 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. A dissociation step was added at the end of the PCR using the following program: 95 ºC for 15 s, 60 ºC for 20 s and 95 ºC for 15 s. The β-actin gene was used as a constitutive control, to normalize all samples. The threshold cycles were calculated by the 7000-system software and expression levels of RNAs were calculated according to Livak and Schmittgen (2001) and normalized with the respective controls. Gene expression data were the result of three independent replications. Statistical Analysis Mortality data and data obtained from the measurement of particle size in experimental conditions were analyzed using one-way analysis of variance. Fisher’s least significant difference test was employed to test for statistically significant differences


J. Appl. Toxicol. 2014; 34: 562–575

Toxic effects of colloidal nanosilver in zebrafish embryos Table 2. Primers used in the present study for quantitative real-time polymerase chain reaction Gene β-actin Hsp70 Gstπ1 Mt Il1β Tnfα

Accession number

Forward primer (5′–3′)

Reverse primer (5′–3′)

AF057040 AF210640 AB194127 AY514791 AY340959.1 NM_001015057

TGCTGTTTTCCCCTCCATTG CCATCGAAGACGGCATCTTT ATGAAGGGCGACTTGAAAGC TGTGGATACTCTCTGGAAAAATGG CATTTGCAGGCCGTCACA TGGACGGCAGCAGGAAAA

TTCTGTCCCATGCCAACCA TCACCGCCCAGATGAGTGT CATGGCGTTGGACTGAAACA AGGTAGCACCACAGTTGCAAGTT GGACATGCTGAAGCGCACTT GCAGGCTCTCTGGCGAAGT

between samples. Differences in means were considered significant when P < 0.05. The significance of gene expression data was measured using the Relative Expression Software Tool (REST) based on pairwise fixed reallocation randomization test (Pfaffl et al., 2002).

Results Characterization of the Commercial Solution of Colloidal Nanosilver The commercial nanosilver solution analyzed by means of a SEM microscope (FEG-ESEM) showed well-dispersed Ag NPs particles with an average size of 18 nm (Fig. 1A). Imaging analysis of the same solution using a transmission electron microscope showed Ag NPs particles with a diameter of 19.5 nm and a polyhedral shape (Fig. 1B). The hydrodynamic diameter (determined through light scattering technique) was on average 13.65 nm. The EDS spectrum (carried out on a drop of solution deposited on a carbon disc and analyzed by EDS technique) showed that no metallic contaminants or impurities were present. Characterization of the Testing Solutions Under Experimental Conditions

J. Appl. Toxicol. 2014; 34: 562–575

Figure 1. (A) Environmental scanning electron microscope image at × 20 000 magnification of the stock solution of colloidal nanosilver (10 000 ppm). (B) Transmission electron microscopy image at × 200 000 magnification of the stock solution of colloidal nanosilver (10 000 ppm). Size of each particle is on average 19.5 nm. The particles have a polyhedral shape.

A further characterization was performed by comparing the release of Ag+ ions from the nanosilver solution in embryo water and deionized water using protocol 2 in both cases. Embryo water contains a small amount of chloride (0.102 mM) that is able to form other species such as AgCl2– or AgCl, which may precipitate



565

Total silver concentration was tested by atomic absorbance spectrometry in the testing solutions (nanosilver at 5 mg l–1 in embryo water and in deionized water) to confirm the actual amount of silver present at the beginning of the experiment. The solution of nanosilver suspended in embryo water contained 5.70 mg l–1 of silver, and the solution of nanosilver suspended in deionized water contained 5.87 mg l–1. The testing solution of nanosilver suspended in embryo water was characterized in the three protocols used. A testing solution without embryos was also characterized. The exposure nanosilver solution without embryos did not show significant changes in NP size after 48 h. When using protocol 1 (embryo from 4 to 52 hpf), the size of the NPs changed from 46.31 nm (at T0) to 49.88 nm after 48 h of exposure. Even though, a statistically significant difference was found between the size of the NPs (P < 0.05), the size variation was rather low (3.57 nm) and particles can still be considered as NPs. When using protocol 2 (embryos from 72 to 120 hpf), the size of the NPs also changed after 24 and 48 h. However, the NP diameter was never larger than 48.05 nm. In the case of protocol 3 (embryos from 96 to 120 hpf), after 24 h of exposure the particles showed a hydrodynamic size of 47.52 nm on average. This value differs significantly from the value of the T0, but as stated before the size of the particles can be considered rather homogeneous. Table 3 shows the results obtained for all the exposures at all the times tested.

M. Olasagasti et al. Table 3. Size of Ag NPs measured at four time points during the experiment Time

T0 T24h T48h

Exposure medium without embryos Average size (nm) 46.31 a ND 45.64 a

Protocol 1 (4–48 hpf) SD 0.90 ND 1.00

Average size (nm) 46.31 a 47.74 ab 49.88 b

Protocol 2 (72–120 hpf) SD 0.90 6.18 4.11

Average size (nm) 46.31 a 48.05 b 44.74 c

Protocol 3 (96–120 hpf) SD 0.90 1.59 1.94

Average size (nm) 46.31 a 47.52b ND

SD 0.90 4.33 ND

ND, not determined; SD, standard deviation. The exposure medium without embryos is compared to experiments carried out using protocol 1 and 3 to evaluate the level of particle aggregation in experimental conditions. Measurements were carried out by dynamic light scattering. Data were subjected to one-way analysis of variance and Fisher’s least significant difference test was employed to test for statistically significant differences between samples. Differences in mean were considered significant when P < 0.05 and are indicated by the letters a, b, c. (solubility below 0.1 μg ml–1). All exposure media prepared with embryo water showed Ag+ ion concentrations below 0.185 μg ml–1 (1.72 μM) and at this level of concentration MEDUSA analysis showed that the main species are Ag+ and AgCl(aq) (data not shown). The presence of the neutral complex AgCl(aq) reduces the amount of free Ag+ ions and may also affect the toxicity observed. In the case of deionized water a higher amount of Ag+ ions was detected (up to 0.321 μg ml–1; 2.97 μM) due to the absence of chloride that increases the solubility and the availability of Ag+ ions. The free Ag+ ions detected in embryo water were 1.6–2.5% of the total silver present in the original solution whereas the free ions detected in deionized water were 3.2–4.4%. These percentages were maintained in the concentration range under study. Silver Nanoparticles Uptake and Distribution To verify the Ag NPs uptake of embryos, an investigation was carried out with FEG-ESEM. When using protocol 1, embryos were exposed at the very early stages of development, when they were still protected by the chorion membrane. In this case, Ag NPs were not detected inside the embryos (Fig. 2A) as also demonstrated by the EDS spectrum that does not show a peak for silver (Fig. 2B). However, Ag NPs covered completely and homogeneously the surface of the chorion (Fig. 2B,C). The EDS spectrum of the chorion, in fact, showed a clear peak identifying as silver the particles detected (Fig. 2E). In experiments carried out with protocols 2 and 3, Ag NPs were detected inside the embryo’s digestive tract. Figure 3 shows as an example the Ag NPs detected in embryos exposed using protocol 2. In this case, it was possible to distinguish clearly the particles grouped in the digestive tract (Fig. 3A–C). As shown in Fig. 3E the EDS spectrum of embryos exposed using this protocol showed a peak for silver (Fig. 3E). Lethal and Sublethal Effects

566

In all the protocols tested, the mortality rate was lower than 10% (results not shown) and no statistically significant differences were detected in treated embryos vs the respective controls (results not shown). Embryo mortality below 10% is considered normal for non-treated embryos (Nagel, 2002). No growth delays or malformations were detected in the treated embryos exposed using the protocols tested. The differential expression of five genes involved in different biological activities was determined in embryos exposed to


5.0 mg l–1 of colloidal nanosilver. Figure 4 shows the results obtained for the three protocols tested. The exposure to 5.0 mg l–1 of nanosilver caused in all cases the overexpression of Hsp70. This gene was overexpressed with the highest fold change in comparison to all the other genes tested; specifically, in embryos exposed with protocol 2 (fivefold change). The expression of the other genes differed depending on the protocol used. Embryos exposed using protocol 1 showed the overexpression of Tnfα and the repression of Gst-л1; embryos exposed with protocol 2 showed the overexpression of Mt, and Il1β whereas embryos exposed with protocol 3, only showed the overexpression of Hsp70. The fold changes for all these overexpressed genes were no higher than twofold. A further experiment was performed to test if some exposure– concentration dependency could be detected. To this end, the same five genes were tested at three different concentrations of nanosilver using protocol 2. The results obtained are shown in Fig. 5. The Mt gene was overexpressed at all the concentration tested, even though no significant difference was found between the three concentrations tested and the level of expression was never above 2. The Hsp70 gene was also overexpressed at the three concentrations tested. A statistically significant difference was found between the levels of expression of this gene induced by the exposure to 0.01 and to 1 mg l–1 of nanosilver in comparison to the exposure to 5.0 mg l–1 of nanosilver that showed the highest level of induction. The Il1β gene was overexpressed only at 1 and 5 mg l–1 of nanosilver; in the case of embryos exposed to 1 mg l–1 this overexpression was approximately threefold higher than the overexpression of the same gene in embryos exposed to 5 mg l–1 nanosilver; however, the standard deviation was rather high (5.8). The genes Tnfα and Gst-л1 were not affected at any of the concentrations tested. Effects of Silver Ions and Silver Nanoparticles To identify the influence of Ag+ ions and NP size on nanosilver toxicity, the effects detected in embryos exposed to 5.0, 1.0 and 0.01 mg l–1 of colloidal nanosilver dissolved in embryo water were compared to those detected in embryos exposed to the same concentrations of nanosilver dissolved in deionized water. As shown in Fig. 6, the exposure to nanosilver in deionized water caused a very high level of mortality at 5.0 and 1.0 mg l–1 (100 and 65.6%, respectively); whereas, the exposure to 0.01 mg l–1 did not cause mortality. On the other hand, nanosilver dissolved in embryo water, at the same concentrations, caused a level of mortality that was always below 10%. To investigate the


J. Appl. Toxicol. 2014; 34: 562–575

Toxic effects of colloidal nanosilver in zebrafish embryos

Figure 2. Images of the silver nanoparticle (Ag NP) distribution in embryos exposed using protocol 1 (4–48 hpf). (A) Internal part of the embryos. No NPs were detected inside the embryo. The energy dispersive spectroscope spectrum shown in (B) confirms that silver is not present in this section of the embryos. (C,D) The surface of the chorion is shown at different magnitudes (× 8000 and × 30 000 respectively). In both photographs it is possible to appreciate a homogeneous distribution of NPs. The energy dispersive spectroscope spectrum shown in (E) confirms that these particles are made of silver.

J. Appl. Toxicol. 2014; 34: 562–575

To verify if sublethal effects could be detected in the two exposure conditions, a further experiment was carried out in which we compared the gene expression of embryos exposed 0.01 mg l–1 of nanosilver dissolved in embryo water and in deionized water. This concentration was used, as it was non-lethal in both exposure conditions. As shown in Fig. 7, of the five genes tested, Hsp70 and Il1β were overexpressed in embryos exposed to both conditions. However, embryos exposed to nanosilver in deionized water showed a level of induction of Il1β four times higher than the level of induction of embryos exposed to embryo water (8.1-fold changes). Mt gene was overexpressed only in the experiment carried out in embryo water. Although the overexpression was statistically significant with respect to the controls, the level of induction of this gene was not very high



567

relationship between embryo mortality and Ag+ ion concentration, we quantified the Ag+ ions in the exposure solutions containing different concentrations of nanosilver in embryo or deionized water. The results obtained showed that a higher concentration of Ag+ corresponded to a higher concentration of nanosilver in both solubilization media; however, in deionized water the concentration of Ag+ ions was double with respect to the concentration of Ag+ ions found in embryo water for the same concentration of nanosilver (see Table 4). As shown in Table 4, the percentage of embryo mortality was progressively higher when the concentration of Ag+ ions increased. However, a similar concentration of Ag+ ions was more lethal in deionized water than in embryo water. The LC50 of nanosilver in embryo water was 6.24 mg l–1, whereas the LC50 of nanosilver in deionized water was 0.94 mg l–1.

M. Olasagasti et al.

Figure 3. Images of Ag NPs distribution in embryos exposed using protocol 3 (72–120 hpf). (A) Section of the embryo observed at × 200 magnification. The arrow indicates two agglomerates of metallic particles in the digestive tract of the embryo. (B,C) The same agglomerates at different magnifications (× 2400 and × 10 000 respectively). The energy dispersive spectroscope spectrum shown in (D) confirms that the agglomerates are + made of Ag .

568

Figure 4. Differential expression of five selected genes in embryos exposed to the three protocol tested. The expression was normalized with the housekeeping gene β-actin and compared with the controls (*P < 0.05).



J. Appl. Toxicol. 2014; 34: 562–575


–1

Figure 5. Gene expression caused by exposure to 0.01, 1.0 and 5.0 mg l of nanosilver dissolved in embryo water using protocol 2. The expression was normalized with the housekeeping gene β-actin and compared with the controls (*P < 0.05). For each gene, expression data obtained for the three nanosilver concentrations were subjected to one way analysis of variance and Fisher’s least significant difference test was employed to test for statistically significant differences between samples. Differences in mean were considered significant when P < 0.05 and are indicated by the letters a and b.

J. Appl. Toxicol. 2014; 34: 562–575



569

Figure 6. Mortality percentage of embryos exposed to nanosilver (nAg) in deionized water and embryo water. (**P < 0.01).

M. Olasagasti et al. Table 4. Ag+ ion concentration and mortality observed at different concentrations of nanosilver in embryo water and in deionized water Exposure media Embryo water

Deionized water

[nanosilver] (μg l–1)

[Ag+] (μg l–1)

Mortality (%)

SD

0.01 0.5 1 2.5 5 10 15 0.01 0.5 1 2.5 5 10

– – 0.023 0.064 0.083 0.185 ND – 0.052 0.061 0.088 0.155 0.321

1.33 ND 10.13 ND 25.86 69.75 97.33 0 ND 65.6 ND 100 100

2.3 – 6.78 – 21.68 5.28 3.65 0 – 7.79 – 0 0

ND, not determined; –, not detectable; SD, standard deviation.

(approximately twofold). Gstл1 and Tnfα were not expressed in any of the conditions tested. We also compared the sublethal effects of ionic Ag+ and nanosilver by exposing a non-lethal concentration (0.01 mg l–1) of both compounds in deionized water using exposure protocol 2. Exposure to nanosilver did not cause mortality during the 48 h of the experiment, while exposure to AgNO3 caused 10.6% mortality. The LC50 of AgNO3 in deionized water was 0.163 mg l–1, a much lower value than nanosilver (0.94 mg l–1). In the case of AgNO3 dissolved in embryo water, no mortality was detected

in the range of concentrations tested, so we assumed that its LC50 will be higher in comparison to the LC50 of the other conditions. Figure 8 shows comparison of the gene expression detected in the two experimental conditions. Exposure to AgNO3 only caused the overexpression of gene Gst-л1 with a 2.4-fold change; whereas, as already mentioned, the exposure to nanosilver caused the overexpression of Il1β and Hsp70.

Discussion To define a reliable methodology for testing the effects of the commercial nanosilver solution examined in the present study, three exposure protocols were compared. Protocol 1 was useful for determining the role of the chorion in nanotoxicological experiments performed with zebrafish. Zebrafish is in fact used as a predictive toxicology model for humans or adult stages and therefore the consideration of a barrier function of the chorion is crucial. Protocols 2 and 3 were useful to test the effect of the exposure length (protocol 2 exposed embryos during 48 h while protocol 3 during 24 h). The selection of the most effective protocol was based on the following parameters: stability of the NPs during the exposure, NPs uptake, and lethal and sublethal effects. The physical and chemical characterization of the NPs is a standard procedure in nanotoxicological studies (Simon and Joner, 2008; Nel et al., 2009). This characterization is generally carried out on the stock solution or in the testing solution before starting the experiment. However, it has been shown that NPs characteristics might vary during the experiments as agglomeration phenomena are likely to occur over time depending on the experimental conditions (Fabrega et al., 2011). This might modify the characteristics of the NPs, affecting their stability as well as their toxic potential. For this reason, the hydrodynamic diameter

–1

570

Figure 7. Gene expression caused by exposure to 0.01 mg l of nanosilver in deionized water and embryo water using protocol 2 (embryos of 72–120 hpf). The expression was normalized with the housekeeping gene β-actin and compared with the controls (*P < 0.05).



J. Appl. Toxicol. 2014; 34: 562–575


+

Figure 8. Gene expression caused by the exposure to nanosilver (nAg) and ionic Ag in deionized water using protocol 2 (embryos of 72–120 hpf). The expression was normalized with the housekeeping gene β-actin and compared with the controls (*P < 0.05).

J. Appl. Toxicol. 2014; 34: 562–575

to establish the reliability of the testing method used and of the effects finally observed; that is, to ascertain that the effects detected are due to the presence of the compound. In this study, two different conditions were considered: embryo surrounded by the chorion membrane (protocol 1), and hatched embryos (of 3 and 4 days, protocols 2 and 3). The zebrafish chorion presents pores with a diameter of approximately 0.5–0.7 μm (Rawson et al., 2000). Lee et al. (2007) demonstrated that metal NPs can pass through the chorion pores, but that their passage is random and consequently the effects on embryonic development are stochastic (Browning et al., 2009). In addition, Asharani et al. (2008) could detect Ag NPs of 5–20 nm diameter inside 48 h embryos, distributed in the brain, heart, yolk and blood. In this work, we could not detect the passage of the Ag NPs originating from the commercial nanosilver tested through the chorion pores. As a matter of fact, Ag NPs covered completely and homogeneously the surface of the chorion. In spite of these observations, the presence of a minor number of Ag NPs inside some of the embryos cannot be excluded as they might technically pass across the chorion pores. However, according to our results, this does not seem to be the major way of access to the embryos, at least for the colloidal nanosilver used in this study. Moreover, Ag NPs were not detected at intracellular level and this could be due to intracellular dissolution but may also indicate that only ions were incorporated. Fent et al. (2010) also observed the presence of fluorescent silica NPs of 60 nm diameter on the chorion surface and the absence of NPs inside the exposed embryos. These authors hypothesized that such results were due to the fact that the particles used might have been too big to pass through the chorion pores. Osborne et al. (2013) also detected no evidence for Ag NPs crossing the chorionic membrane in exposed embryos. The passage of Ag NPs could also depend on the presence of a coating or of a specific functionalization of the NP. The nanosilver analyzed in this work is a commercial product, and the distributor could not disclose the presence or the nature of a possible coating or functionalization. For this reason, we were not able to establish such a relationship, which was, however, out of the scope of this work. In any case, the results obtained indicate that the determination of the Ag NPs uptake and distribution is an important and



571

of the exposure solutions was measured by DLS at three different time points (T0, T24h and T48h) during the experiments. This allowed evaluation of possible changes in the initial boundary conditions and to establish if the exposure protocols were suitable to test the actual effect of Ag NPs. Additionally, the hydrodynamic diameter of the exposure solutions was measured in a parallel experiment that was carried out without embryos. This allowed to estimate if the presence of living organisms affected the stability of the compound. The results obtained indicated that no major changes in particle aggregation occurred during the experiments, independently from the protocol used for the exposure. The presence of embryos at different life stages in the exposure solution influenced only slightly the NPs aggregation. Even though, the average size of the particles was no larger than 50 nm, a significant standard deviation was measured after 24 and 48 h exposure. It is possible that some particles shrank in size due to Ag+ ion release and others increased in size by aggregating, thus maintaining the same average dimension. In any case, from this point of view, the protocols evaluated were all similar, and we considered them all suitable for testing the effect of Ag NPs. However, it could be noted that the hydrodynamic diameter of the particles measured at T0 in experimental conditions (5.0 mg l–1 nanosilver) was larger than the hydrodynamic diameter measured in the commercial stock solution (10 000 mg l–1). The aggregation tendency of NPs in experimental conditions was reported in previous works (Lee et al., 2007; Murdock et al., 2008), in which it was observed that different media led to a different level of Ag NPs aggregation. As described above, the 10 000 mg l–1 stock solution of colloidal nanosilver was diluted in embryo water to obtain the testing solution at 5.0 mg l–1. This test solution contained different concentrations of salts with respect to the stock solution and the presence of salts might reduce the thickness of the electric double layer on the surface of the NPs and decrease the zeta potential below its critical point. This situation can lead to an aggregation of the NPs (Lee et al., 2007) and might explain the results obtained. Another important issue to consider in any toxicological study is the level of uptake and distribution of the substance to test in the biological system used. This issue is not always considered in nanotoxicological studies. However, its determination is crucial

M. Olasagasti et al.

572

indispensable step of a nanotoxicological assay. We speculate that the homogeneous surface layer of Ag NPs on the chorion could induce the obstruction of the pore channels. This could affect the normal function of the chorion, and cause effects that are not strictly related to the chemical nature of the particles but more likely to their physical presence, as reported also by Cheng et al. (2007) in a study carried out with single wall carbon nanotubes. In experiments carried out with protocols 2 and 3, Ag NPs were detected inside the embryo’s digestive tract. Zebrafish embryos of 120 hpf do not eat actively; however, they start gaping from the age of 72 hpf (Kimmel et al., 1995). For this reason, it is likely that the particles present in the test solution entered by passive diffusion through the mouth and accumulated along the digestive tract. In these two cases, NPs entered in direct contact with the embryos and were possibly responsible for the toxic effects. Bar-Ilan et al. (2009) also detected Ag NPs and Au NPs in 120 hpf zebrafish embryos using instrumental neuron activation analysis; however, in this case, it is not clear if the particles detected were those that entered the pore channels of the chorion or those that entered through the mouth of the embryos since the analysis was carried out on 120 hpf embryos after exposing 4 hpf embryos over 5 days. The differential expression of five genes was tested in embryos exposed to the different protocols. The effects on gene expression detected in protocol 1 were probably not due to Ag NPs per se, but rather to the occlusion of the chorion’s pores caused by the physical presence of Ag NPs that might alter the chorion function of allowing the passage of oxygen and nutrients, for example. For this reason, they differed from the effects detected in protocol 2. The fact that protocol 3 caused the overexpression of only one gene could be due to the shorter exposure time that the embryos were subjected to in comparison to the other two protocols. It is possible that an exposure of 24 h was not sufficient to cause appreciable changes in the expression of the selected genes. Oyarbide et al. (2012) also reported that a difference of 24 h in exposure was critical for the induction of some immune genes in zebrafish embryos subjected to a variety of stresses. Considering the fact that in protocol 1 the Ag NPs tested in this study do not pass the chorion barrier, and the fact that protocol 3 does not allow a sufficient time of exposure to cause detectable sublethal effects, protocol 2 can be considered the most appropriate method to carry out toxicity tests of colloidal nanosilver, at least in the case of the commercial product studied in this work. The results obtained, in fact, indicate that the type of protocol used to assess the toxicity of NPs need to be selected carefully, to assure the reliability of the results. Other works report the efficacy of zebrafish embryos at the early developmental stages as models for studying Ag NPs toxicity. It is possible that the size of the particle, the presence and the nature of a capping agent and/or a dispersing agent might require specific method adaptation. To meet the objective of this work we do not mean to explain such mode of action. However, we can conclude that it is highly improbable that a general testing method can be applied in the case of Ag NPs and of NPs in general and therefore a protocol optimization should be carried out on a case-by-case basis, especially when a commercial product is tested. To evaluate further the effects of nanosilver and see if there was an exposure–concentration dependency, the differential expression of the same five genes was tested on zebrafish


embryos exposed to three different concentrations of nanosilver using protocol 2. The affected genes were Mt, Il1β and Hsp70, which were all overexpressed. While Mt and Hsp70 were induced at all the concentrations of nanosilver tested, Il1β was induced only starting from 1.0 mg l–1. Even though the induction produced by the exposure to 1.0 mg l–1 was threefold higher than that induced by the exposure to 5.0 mg l–1 of nanosilver and the difference was statistically significant, we believe that the data variability was too high to allow us to conclude that this gene is more induced at the lower concentrations of nanosilver. The Hsp70 gene showed an exposure–concentration dependency. The second objective of this work was to evaluate if the toxic effect of Ag NPs was due to the size of the particles or to the Ag+ ions released. Several studies have addressed this issue, but the results obtained are still controversial. The release of Ag+ ions in aqueous solution by Ag NPs has been confirmed by several authors (Santoro et al., 2007; Asharani et al., 2008; Liu and Hurt, 2010). According to the results of Kim et al. (2009), who studied the cytotoxicity of Ag NPs on human hepatoma HepG2 cells, the toxicity of Ag NPs is due an intrinsic effect of the NPs independent from the presence of free Ag+ ions. On the contrary, the results reported by Bouwmeester et al. (2011), who carried out a transcriptomic study on Caco-2 cells comparing the exposure to nanosilver and ionic Ag+, indicated that the genes expressed were the same in the two conditions. These authors concluded that the effect could be attributed entirely to the presence of Ag+ ions. Zhao and Wang (2011) also observed that the toxic effect of Ag NPs was due to the release of Ag+ ions. Other studies pointed out that the toxic effect of Ag NPs could not be explained uniquely by the release of ions but by the combined effect of ions and NP size (Griffitt et al., 2008; Navarro et al., 2008; Kawata et al., 2009; Laban et al., 2010). Beer et al. (2012) also drew the same conclusion; however, these authors observed that the effect of the NP size depended on the concentration of ions released in the media; that is, at low ions concentrations the effect of NP size was predominant whereas at high Ag+ ions concentrations prevailed the toxic effect of Ag+ in ionic form. Yang et al. (2012) who studied the mechanism of Ag NP toxicity in C. elegans reported that both the release of Ag+ ions and a size-specific nano-effect detected as reactive oxygen species (ROS) production can occur and contribute to the mechanism of Ag NPs toxicity; however, in their study the ROS mechanism was detected only when the amount of dissolved Ag+ was minimal. To study the separate effect of Ag NPs and ions, several approaches have been used such as, rinsing the Ag NPs solution with pure water before exposure (Asharani et al., 2008); treating the exposure solution with ion exchange resins (Kim et al., 2009) or centrifuging (Beer et al., 2012) to separate the ionic fraction, or alternatively binding the Ag+ ions by adding cysteine to the Ag NP solution (Navarro et al., 2008). In this work, we used a different approach relying on the neutralizing effect of various ligands such as chlorides, sulfides and thiosulfates. Ionic Ag+ is a highly reactive species and it combines with such ligands, especially to the chlorides, to form insoluble and stable salts (Choi et al., 2008). Almost all natural waters contain such elements (Hogstrand and Wood, 1998; Naddy et al., 2007), so it is logical to assume that, in nature, ionic Ag+ is mainly present in a stable and no reactive combination. The embryo water used to maintain zebrafish embryos and to solubilize Ag NPs during the experiments carried out in the present work also contained chlorides, which implies that the effect of Ag+ ions possibly released


J. Appl. Toxicol. 2014; 34: 562–575


J. Appl. Toxicol. 2014; 34: 562–575

and not at the highest (25 μg l–1). This shows that Ag NPs at low concentrations, a certain oxidative stress is probably occurring. The exposure to Ag NPs dissolved in deionized water caused only induction of Hsp70 and Il1β. Surprisingly, Mt, which would indicate the action of metal ions, was not induced; this was probably due to the small concentration of nanosilver used for the exposure. The fact that nanosilver dissolved in embryo water caused the overexpression of Mt indicates that at such low concentration methallothioneine might act as scavenger of ROS generated by the Ag NPs present in the solution. The comparison of molecular effects of ionic Ag+ as AgNO3 and colloidal nanosilver both dissolved in deionized water revealed that most of the genes that expressed differentially were those of embryos exposed to nanosilver and not to ionic Ag+. These results indicate that, at that concentration (0.01 mg l–1), Ag NPs have a greater sublethal effect than ionic Ag+ also in deionized water. This could be due to the progressive release of ions from the colloidal nanosilver in a Trojan horse effect, as postulated also by other authors (Limbach et al., 2007; Navarro et al., 2008; Park et al., 2010), and by the concomitant effect of NP size and ion release. Our results, agree with the results reported by Beer et al. (2012) according to which at low ions concentration the effects of Ag NPs predominate over the effects of Ag+ ions. Our results also show that Ag+ ions play a major role in acute toxicity as high levels of mortality were detected at increasing concentrations of Ag+ ions; however, they do not seem to influence sublethal effects that Ag NP exposure can produce. On the contrary, sublethal effects seem to be more related to the nanosize, as it can be seen in differential expression studies.

Conclusions A suitable exposure protocol to assess the toxic effects of Ag NPs was developed in this work. Considering the stability and aggregation of Ag NPs, the level of uptake and distribution, and the sublethal effects detected, we could conclude that the protocol that most reliably evaluates the toxic effect of colloidal nanosilver is protocol 2, in which hatched embryos of 72 hpf are exposed to the compound during 48 h. The results obtained also indicate that embryos of 48 hpf, still protected by the chorion membrane, are not suitable to test potential toxic effects of this specific colloidal nanosilver. As other works report that other types of Ag NPs pass the chorion barrier of zebrafish embryos, it is possible to conclude that for each type of Ag NPs it would be advisable to define and corroborate a specific exposure protocol that assures the direct contact of the NPs with the biological system used in the assay. According to the results obtained, the toxic effect of Ag NPs is due to both the NP size and the release of Ag+ ions. In particular, the toxic effect of NPs is stronger in comparison to ionic Ag+, in media in which the presence of chlorides or other ions that combine with Ag+ ions counteract the effect of ionic Ag+ but not of Ag NPs. The results obtained in deionized water show that the release of ions is probably following a Trojan horse scheme type, as postulated also by other works. However, it is possible that the controversy existing on the role played by ions and by NP size is due to the fact that the type of silver and the mode of NP fabrication influence the mode of action and it is therefore difficult to establish a general protocol as well as a general mode of toxicity in the case of Ag NPs. Moreover, it is important to consider the media of dispersion of the particles during the experiment as this might affect the mode of action. These results give



573

by Ag NPs cannot be detected in this media. To evaluate the effects of Ag+ ions it is therefore necessary to prepare the Ag NP solutions in a deionized water solution. For this reason, in this work nanosilver was solubilized in deionized water, and the effects caused by such solution were compared to those caused by nanosilver solubilized in embryo water. The exposure of embryos to nanosilver in deionized water caused a very high level of mortality (reaching 100% at 5.0 mg l–1), in comparison to the same concentrations of nanosilver solubilized in embryo water in which insignificant levels of mortality were detected. This dramatic effect of nanosilver in deionized water demonstrates that Ag+ ions released from the colloidal nanosilver tested play an important role in the acute toxicity of the compound when this is dissolved in deionized water. As a matter of fact, the concentration of Ag+ ions released from Ag NPs solubilized in deionized water was twice the concentration of ions released from Ag NPs solubilized in embryo water. Metal toxicity is known to be strongly dependent on the water chemistry. Regarding this, the biotic ligand model (BLM) is an approach that tries to predict these effects taking into account the metal speciation and the competitive influence of other ions such as Na+, Ca2+, Cl–, etc. In this study, the ionic strength and hardness of the exposure solutions are very low and in such conditions BLM predictions are less accurate (Bielmyer et al., 2007). The amount of these ions in embryo water, except for chloride, is below 0.05 mM and no influence on the toxicity of Ag+ ion is expected (Zhou et al., 2005). The presence of chloride anions generates AgCl complexes that are not considered toxic by many BLMs (Lee et al., 2005); however, the mortality study revealed a significant higher mortality when the exposure was performed in deionized water than in embryo water at similar free Ag+ ion concentrations. Therefore, in the zebrafish model there seems to be a beneficial effect coming from the AgCl complexes. This fact underlines the importance of the composition of exposure media in the assessment of metal and metal NP toxicity. In this sense, Ag+ ion LC50 value in deionized water (0.1 μg l–1) was much lower than in embryo water (no mortality was observed at the tested concentration range). Furthermore, the amount of free Ag+ ions at the LC50 values of nanosilver in both exposure media were lower than Ag+ ion LC50 suggesting a certain inherent toxicity from the NPs. The amount of Ag+ ions in the exposure media was lower in the case of embryo water, which can be explained by the formation of an AgCl layer around the NPs decreasing the release of Ag+ ions as observed in a previous work (Levard et al., 2013). This covering layer may also affect the acute toxicity of NPs that was lower in embryos exposed to nanosilver solubilized in embryo water. When gene expression was tested on embryos exposed to concentrations of nanosilver that was non-lethal in both conditions; i.e. 0.01 mg l–1, the effects were more evident in embryos exposed to nanosilver dissolved in embryo water. Specifically, in embryos exposed to 0.01 mg l–1 of nanosilver in embryo water the overexpression of Hsp70, Mt and Il1β was detected. These genes were also induced in embryos exposed to 5.0 and to 1.0 mg l–1 of nanosilver (as described earlier). Additionally, in embryos exposed to 0.01 mg l–1 of nanosilver the induction of Gst-л1 was detected. This result is in agreement with the findings of Chae et al. (2009), who studied the differential expression of Gst-л1 and other genes in medaka exposed to Ag NPs and Ag+ ions. These authors also detected induction of the Gst-л1 gene at the lowest concentration of Ag NPs tested (1 μg l–1)

M. Olasagasti et al. indication to the consumers and end users of nanoproducts containing silver, but mostly on the type of disposal of them as a free dispersion of Ag NPs in water, but also in air and soil can damage the environment. Acknowledgments This work was supported by the Department of Agriculture, Fisheries and Food of the Basque Government (Project DARETEST) and by the Spanish Ministry of Research and Innovation (Project ATP-Toxbio, grant code CTQ2011-28328-C02-02). MO was supported by a pre-doctoral fellowship from the Department of Agriculture, Fisheries and Food of the Basque Government. We are grateful to David Gil (CIC-Biogune, Spain) for his assistance with transmission electron microscopy determinations, to Usua Oyarbide (AZTI-Tecnalia, Spain) and Oskar Martinez de Ilarduya (Universidad de La Coruña, Spain) for their advice on toxicity biomarker selection and to Victor F. Puentes (Catalan Institute for Nanotechnology, Spain) for his advice on how to quantify the release of Ag+ ions from Ag NPs and to Giorgio Montanari (Honeywell, Sydney, Australia) for critical reading of the manuscript.

Conflict of Interest The Authors did not report any conflict of interest.

References

574

Asharani PV, Wu YL, Gong Z, Valiyaveettil S. 2008. Toxicity of silver nanoparticles in zebrafish models. Nanotechnology 19: 255102. Asharani PV, Lianwu Y, Gong Z, Valiyaveettil S. 2011. Comparison of the toxicity of silver, gold and platinum nanoparticles in developing zebrafish embryos. Nanotoxicology 5: 43–54. Bar-Ilan O, Albrecht RM, Fako VE, Furgeson DY. 2009. Toxicity assessments of multisized gold and silver nanoparticles in zebrafish embryos. Small 5:1897–1910. Beer C, Foldbjerg R, Hayashi Y, Sutherland DS, Autrup H. 2012. Toxicity of silver nanoparticles – Nanoparticle or silver ion? Toxicol. Lett. 208: 286–292. Bielmyer G, Grosell M, Paquin PR, Mathews R, Wu KB. 2007. Validation study of the acute biotic ligand model for silver. Environ. Toxicol. Chem. 26: 2241–2246. Bouwmeester H, Poortman J, Peters RJ, Wijma E, Kramer E, Makama S, Puspitaninganindita K, Marvin HJ, Peijnenburg AA, Hendriksen PJ. 2011. Characterization of translocation of silver nanoparticles and effects on whole-genome gene expression using an in vitro intestinal epithelium co-culture model. ACS Nano 5: 4091–4103. Browning LM, Lee KJ, Huang T, Nallathamby PD, Lowman JE, Xu X-HN. 2009. Random walk of single gold nanoparticles in zebrafish embryos leadiong to stochastic toxic effects on embryonic developments. Nanoscale 1: 138–152. Chae YJ, Pham CH, Lee J, Bae E, Yi J, Gu MB. 2009. Evaluation of the toxic impact of silver nanoparticles on Japanese medaka (Oryzias latipes). Aquat. Toxicol. 94: 320–327. Cheng J, Flahaut E, Cheng SH. 2007. Effect of carbon nanotubes on development zebrafish (Danio rerio) embryos. Environ. Toxicol. Chem. 26: 708–716. Choi O, Deng KK, Kim N-J, Ross L, Surampalli RY, Hu Z. 2008. The inhibitory effects of silver nanoparticles, silver ions, and silver chloride colloids on microbial growth. Water Res. 42: 3066–3074. Choi JE, Kim S, Ahn JH, Youn P, Kang JS, Park K, Yi J, Ryu D-Y. 2010. Induction of oxidative stress and apoptosis by silver nanoparticles in the liver of adult zebrafish. Aquat. Toxicol. 100: 151–159. EFSA Scientific Committee. 2011. Guidance on the risk assessment of the application of nanoscience and nanotechnologies in the food and feed chain. EFSA J. 9: 2140. Embry MR, Belanger SE, Braunbeck TA, Galay-Burgos M, Halder M, Hinton DE, Léonard MA, Lillicarp A, Norberg-King T, Whale G. 2010. The fish embryo toxicity test as an animal alternative method in hazard and risk assessment and scientific research. Aquat. Toxicol. 97: 79–87.


Fabrega J, Luoma NS, Tyler CR, Galloway TS, Lead JR. 2011. Silver nanoparticles: behaivour and effects in the aquatic environment. Environ. Int. 37: 517–531. FAO. 2010. Report on the Application of Nanotechnologies in the Food and Agriculture Sectors: Potential Food Safety Implications. Ed. Food and Agriculture Organization and WHO, 2010, 1–103. Fent K, Weisbrod CJ, Wirth-Heller A, Pieles U. 2010. Assessment of uptake and toxicity of fluorescent silica nanoparticles in zebrafish (Danio rerio) early life stages. Aquat. Toxicol. 100: 218–228. Griffitt RJ, Lu J, Gao J, Bonzongo JC, Barber DS. 2008. Effects of particle composition and species on toxicity of metallic nanomaterials in aquatic organisms. Environ. Toxicol. Chem. 27: 1972–1978. Griffitt RJ, Hyndman K, Denslow ND, Barber DS. 2009. Comparison of molecular and histological changes in zebrafish gills exposed to metallic nanoparticles. Toxicol. Sci. 107: 404–415. Halder M, Léonard M, Iguchi T, Oris JT, Ryder K, Belanger SE, Braunbeck TA, Embry MR, Whale G, Norberg-King T, Lillicrap A. 2010. Regulatory aspects on the use of fish embryos in environmental toxicology. Integr. Environ. Assess. Manag. 6: 484–491. Hogstrand C, Wood CM. 1998. Toward a better understanding of the bioavailability, physiology, and toxicity of silver in fish: Implications for water quality criteria. Environ. Toxicol. Chem. 17: 547–561. Johnston HJ, Hutchison G, Christensen FM, Peters S, Hankin S, Stone V. 2010. A review on the in vivo and in vitro toxicity of silver and gold particulates: particle attributes and biological mechanisms responsible for the observed toxicity. Crit. Rev. Toxicol. 40: 328–346. Kawata K, Osawa M, Okabe S. 2009. In vitro toxicity of silver nanoparticles at noncytotoxic doses to HepG2 human hepatoma cells. Environ. Sci. Technol. 43: 6046–6051. Kim S, Ryu DY. 2013. Silver nanoparticle-induced oxidative stress, genotoxicity and apoptosis in cultured cells and animal tissues. J. Appl. Toxicol. 33: 78–89. Kim S, Choi JE, Choi J, Chung KH, Park K, Yi J, Ryu DY. 2009. Oxidative stress dependent toxicity of silver nanoparticles in human hepatoma cells. Toxicol. In Vitro 23: 1076–1084. Kimmel CB, Ballard WW, Kimmel SR, Ullmann B, Schilling TF. 1995. Stages of embryonic development of the zebrafish. Dev. Dyn. 203: 253–310. Laban G, Nies LF, Turco RF, Bickham JW, Sepúlveda MS. 2010. The effects of silver nanoparticles on fathead minnow (Pimephales promelas) embryos. Ecotoxicology 19: 185–195. Langheinrich U. 2003. Zebrafish: a new model on the pharmaceutical catwalk. Bioessays 25: 904–912. Lapied E, Moudilou E, Exbrayat JM, Oughton DH, Joner EJ. 2010. Silver nanoparticle exposure causes apoptotic response in the earthworm Lumbricus terrestris (Oligochaeta). Nanomedicine 5: 975–984. Lee DY, Fortin C, Campbell PGC. 2005. Contrasting effects of chloride on the toxicity of silver to two green algae, Pseudokirchneriella subcapitata and Chlamydomonas reinhardtii. Aquatic Toxicol. 75: 127–135. Lee KJ, Nallathamby PD, Browning LM, Osgood CJ, Xu X-H. 2007. In vivo imaging of transport and biocompatibility of single silver nanoparticles in early development of zebrafish embryos. ACS Nano 1:133–143. Levard C, Mitra S, Yang T, Jew AD, Badireddy AR, Lowry GV, Brown GE. 2013. Effect of chloride on the dissolution rate of silver nanoparticles and toxicity to E. coli. Environ. Sci. Technol. 47: 5738–5745. Limbach LK, Wick P, Manser P, Grass RN, Bruinink A, Stark WJ. 2007. Exposure of engineered nanoparticles to human lung epithelial cells: influence of chemical composition and catalytic activity on oxidative stress. Environ. Sci. Technol. 41: 4158–4163. Liu J, Hurt RH. 2010. Ion release kinetics and particles persistence in aqueous nano-silver colloids. Environ. Sci. Technol. 44: 2169–2175. Livak KJ, Schmittgen TD. 2001. Analysis of relative gene expression data –ΔΔCT using real-time quantitative PCR and the 2 Method. Methods 25: 402–408. Murdock RC, Braydich-Stolle L, Schrand AM, Schlager JJ, Hussain SM. 2008. Characterization of nanomaterial dispersion in solution prior to in vitro exposure using dynamic light scattering technique. Toxicol. Sci. 101: 239–253. Naddy RB, Rehner AB, McNerney GR, Gorsuch JW, Kramer JR, Wood CM, Paquin PR, Stubblefield WA. 2007. Comparison of short-term chronic and chronic silver toxicity to fathead minnows in unamended and sodium chloride-amended waters. Environ. Toxicol. Chem. 26: 1922–1930. Nagel R. 2002. DarT: The embryo test with the zebrafish Danio rerio-a general model in ecotoxicology and toxicology. ALTEX 19: 38–48.


J. Appl. Toxicol. 2014; 34: 562–575

Toxic effects of colloidal nanosilver in zebrafish embryos Navarro E, Piccapietra F, Wagner B, Marconi F, Kaegi R, Odzak N, Sigg, L, Behra R. 2008. Toxicity of silver nanoparticles to Chlamydomonas reinhardtii. Environ. Sci. Technol. 42: 8959–8964. Nel A, Mädler L, Velegol D, Xia T, Hoek E, Somasundaran P, Klaessig F, Castranova V, Thompson M. 2009. Understanding biophysicochemical interactions at the nano-bio interface. Nat. Mater. 8: 543–557. Osborne OJ, Johnston BD, Moger J, Balousha M, Lead JR, Kudoh T, Tyler CR. 2013. Effects of particle size and coating on nanoscale Ag and TiO2 exposure in zebrafish (Danio rerio) embryos. Nanotoxicology 7(8): 1315–1324. Oyarbide U, Rainieri S, Pardo MA. 2012. Zebrafish (Danio rerio) larvae as a system to test the efficacy of polysaccharides as immunostimulants. Zebrafish 9:74–87. Park E-J, Yi J, Kim Y, Choi K, Park K. 2010. Silver nanoparticles induce cytotoxicity by a Trojan-horse type mechanism. Toxicol. In Vitro 24: 872–878. Park MVDZ, Neigh AM, Vermeulen JP, de la Fonteyne LJJ, Verharen HW, Briedé JJ, van Loveren H, de Jon WH. 2011. The effect of particle size on the cytotoxicity, inflammation, developmental toxicity and genotoxicity of silver nanoparticles. Biomaterials 32: 9810–9817. Parng C. 2005. In vivo zebrafish assays for toxicity testing. Curr. Opin. Drug Discovery Dev. 8: 100–106. Pfaffl MW, Horgan G, Dempfle L. 2002. Relative expression software tool (REST) for group-wise comparison and statistical analysis of relative expression results in real-time PCR. Nucleic Acids Res. 30: e36. Puigdomenech I. 2010. Medusa Software, Stockholm, Sweden, software available at: http://www.kemi.kth.se/medusa/ Rawson DM, Zhang T, Kalicharan D, Jongebloed WL. 2000. Field emission scanning electron microscopy and transmission electron microscopy studies of the chorion, plasma membrane and syncytial layers of the gastrula-sage embryo of the zebrafish Brachydanio rerio: a consideration of the structural and functional relationships with respect to cryoprotectant penetration. Aquacult. Res. 31: 325–336. Roh JY, Sim SJ, Yi J, Park K, Chung KH, Ryu DY, Choi J. 2009. Ecotoxicity of silver nanoparticles on thesoil nematode Caenorhabditis elegans using functional ecotoxicogenomics. Environ. Sci. Technol. 15: 3933–3944. Santoro CM, Duchsherer NL, Grainger DW. 2007. Minimal in vitro antimicrobial efficacy and ocular cell toxicity from silver nanoparticles. Nanobiotechnol. 3: 55–65. Scown TM, Santos EM, Johnston BD, Gaiser B, Baalousha M, Mitov S, Lead JR, Stone V, Fernandes TF, Jepson M, van Aerle R, Tyler CR. 2010. Effcts of aquesous exposure to silver nanoparticles of different sizes in rainbow trout. Toxicol. Sci. 115: 521–534.

Shaw BJ, Handy RD. 2011. Physiological effects of nanoparticles on fish: a comparison of nanometals versus metal ions. Environ. Int. 37: 1083–1097. Silbergeld EK, Contreras EQ, Hartung T, Hirsch C, Hogberg H, Jachak AC, Jordan W, Landsiedel R, Morris J, Patri A, Pounds JG, de Vizcaya Ruiz A, Shvedova A, Tanguay R, Tarazako N, van Vilet E, Walker NJ, Wiesner M, Wilcox N, Zurlo J. 2011. Nanotoxicology: the endo of the beginning – signs on the roadmap to a strategy for assuring the safe application and use of nanomaterials. ALTEX 28: 236–241. Simon P, Joner E. 2008. Conceivable interactions of biopersistent nanoparticels with food matrix and living systems following from their physic-chemical properties. J. Food Nutr. Res. 47: 51–59. Sipes NS, Padilla S, Knudsen TB. 2011. Zebrafish: as an integrative model for twenty-first century toxicity testing. Birth Defects Res. C Embryo Today 93: 256–267. Stone V, Johnston H, Clift MJ. 2007. Air pollution, ultrafine and nanoparticle toxicology: cellular and molecular interactions. IEEE Trans. Nanobiosci. 6: 331–340. Strähle U, Scholz S, Geisler R, Greiner P, Hollert H, Rastegar S, Schumacher A, Selderslaghs I, Weiss C, Witters H, Braunbeck T. 2012. Zebrafish embryos as an alternative to animal experiments – a commentary on the definition of the onset of protected life stages in animal welfare regulations. Reprod. Toxicol. 33: 128–132. Westerfield M. 2000. The Zebrafish Book. Institute of Neuroscience, University of Oregon, USA. Wijnhoven SWP, Peijnenburg WJGM, Herberts CA, Hagens WI, Oomen AG, Heugens EHW, Roszek B, Bisschops J, Gosens I, Vand de Meent D, Dekkers S, De Jong WH, Van Zijverden M, Sips AJAM, Geertsma RE. 2009. Nano-silver – a review of available data and knowledge gaps in human and environmental risk assessment. Nanotoxicology 3: 109–138. Wu Y, Zhou Q, Li H, Liu W, Wang T, Jiang G. 2010. Effects of silver nanoparticles on the development and histopathology biomarkers of Japanese medaka (Oryzias latipes) using the partial-life test. Aquat. Toxicol. 100: 160–167. Yang X, Gondikas, AP, Marinakos SM, Auffan M, Liu J, Hsu-Kim H, Meyer JN. 2012. Mechanism of silver nanoparticle toxicity is dependent on dissolved silver and surface coating in Caenorhabditis elegans. Environ. Sci. Technol. 46: 1119–1127. Zhao CM, Wang WX. 2011. Comparison of acute and chronic toxicity of silver nanoparticles and silver nitrate to Daphnia magna. Environ. Toxicol. Chem. 30: 885–892. Zhou B, Nichols J, Playle RC, Wood CM. 2005. An in vitro biotic ligand model (BLM) for silver binding to cultured gill epithelia of freshwater rainbow trout (Oncorhynchus mykiss). Toxicol. Appl. Pharmacol. 202: 25–37.

575

J. Appl. Toxicol. 2014; 34: 562–575



Nanosilver-coated socks and their toxicity to zebrafish (Danio rerio) embryos.

Toxic effects of polychlorinated biphenyls on cardiac development in zebrafish.

Axonogenesis in the brain of zebrafish embryos.

Analysis of oxidative stress in zebrafish embryos.

Osteoclast-like Cells in Early Zebrafish Embryos.

Mechanical vessel injury in zebrafish embryos.

Toxicity of chlorine to zebrafish embryos.

Automatic zebrafish heartbeat detection and analysis for zebrafish embryos.

Embryos of the zebrafish Danio rerio in studies of non-targeted effects of ionizing radiation.

Comparison of waterborne and in ovo nanoinjection exposures to assess effects of PFOS on zebrafish embryos.

Endocrine, teratogenic and neurotoxic effects of cyanobacteria detected by cellular in vitro and zebrafish embryos assays.

Erratum to: Acetylcholinesterase in zebrafish embryos as a tool to identify neurotoxic effects in sediments.

Acetylcholinesterase in zebrafish embryos as a tool to identify neurotoxic effects in sediments.

Experimental Dissection of Metalloproteinase Inhibition-Mediated and Toxic Effects of Phenanthroline on Zebrafish Development.

Antioxidant Rescue of Selenomethionine-Induced Teratogenesis in Zebrafish Embryos.

Non-induction of radioadaptive response in zebrafish embryos by neutrons.

Xenotransplantation of human adipose-derived stem cells in zebrafish embryos.

Stimulus-triggered enhancement of chilling tolerance in zebrafish embryos.

Effects-driven chemical fractionation of heavy fuel oil to isolate compounds toxic to trout embryos.

Modeling of human uveal melanoma in zebrafish xenograft embryos.

Production of haploid zebrafish embryos by in vitro fertilization.

Exploring the Effects of Different Types of Surfactants on Zebrafish Embryos and Larvae.

Effects of metal exposure on motor neuron development, neuromasts and the escape response of zebrafish embryos.

Pentachlorophenol exposure causes Warburg-like effects in zebrafish embryos at gastrulation stage.