Tracking of chromosome dynamics in live Streptococcus pneumoniae reveals that transcription promotes chromosome segregation.

Molecular Microbiology (2014) 91(6), 1088–1105 ■

doi:10.1111/mmi.12517 First published online 9 February 2014

Tracking of chromosome dynamics in live Streptococcus pneumoniae reveals that transcription promotes chromosome segregation Morten Kjos and Jan-Willem Veening* Molecular Genetics Group, Groningen Biomolecular Sciences and Biotechnology Institute, Centre for Synthetic Biology, University of Groningen, Nijenborgh 7, Groningen 9747 AG, The Netherlands.

Summary Chromosome segregation is an essential part of the bacterial cell cycle but is poorly characterized in ovalshaped streptococci. Using time-lapse fluorescence microscopy and total internal reflection fluorescence microscopy, we have tracked the dynamics of chromosome segregation in live cells of the human pathogen Streptococcus pneumoniae. Our observations show that the chromosome segregation process last for two-thirds of the total cell cycle; the origin region segregates rapidly in the early stages of the cell cycle while nucleoid segregation finishes just before cell division. Previously we have demonstrated that the DNA-binding protein ParB and the condensin SMC promote efficient chromosome segregation, likely by an active mechanism. We now show that in the absence of SMC, cell division can occur over the unsegregated chromosomes. However, neither smc nor parB are essential in S. pneumoniae, suggesting the importance of additional mechanisms. Here we have identified the process of transcription as one of these mechanisms important for chromosome segregation in S. pneumoniae. Transcription inhibitors rifampicin and streptolydigin as well as mutants affected in transcription elongation cause chromosome segregation defects. Together, our results highlight the importance of passive (or indirect) processes such as transcription for chromosome segregation in oval-shaped bacteria.

Introduction Chromosome segregation remains an enigmatic stage of the bacterial cell cycle, and the molecular mechanism Accepted 9 January, 2014. *For correspondence. E-mail j.w [email protected]; Tel. (+31) 050363 2408; Fax (+31) 050363 2348.

© 2014 John Wiley & Sons Ltd

underlying faithful segregation of sister chromosomes remains poorly understood. Studies of this process in the rod- and crescent-shaped model bacteria Escherichia coli, Bacillus subtilis and Caulobacter crescentus have led to a number of proposed models for how bacterial chromosomes are segregated (for reviews, see Toro and Shapiro, 2010; Possoz et al., 2012; Reyes-Lamothe et al., 2012; Wang et al., 2013). In the present work we have studied chromosome segregation in the Gram-positive human pathogen Streptococcus pneumoniae. Compared with for instance E. coli and B. subtilis, S. pneumoniae cells are small (1 μm) with a rugby-ball-like (ovococcoid) shape, and studies performed so far have shown that the mechanisms by which they segregate their chromosomes are different from these model organisms (Minnen et al., 2011; Pinho et al., 2013). Studies of chromosome segregation in this important human pathogen, which is also a good representative model organism for ovococci in general, is therefore important to understand how they multiply and to identify novel approaches to combat them. In some model bacteria, such as C. crescentus and B. subtilis, protein complexes known as ParABS (chromosome partitioning system) and SMC-ScpAB (chromosome condensation complex) have been shown to be involved in the first steps of the segregation process (Niki et al., 1991; Ireton et al., 1994; Graumann et al., 1998; Moriya et al., 1998; Danilova et al., 2007; Gruber and Errington, 2009; Sullivan et al., 2009; Ptacin et al., 2010; Shebelut et al., 2010). The ParABS system consists of two proteins; ParB is a DNA-binding protein which specifically recognizes origin proximal parS-sites (Lin and Grossman, 1998; Gruber and Errington, 2009; Sullivan et al., 2009), while ParA, a Walker-type ATPase, associates with the ParB-parS complex and pulls newly replicated origins away from each other (Ptacin et al., 2010; Vecchiarelli et al., 2010). The structural maintenance of chromosome protein (SMC) forms a complex with two other proteins; ScpA and ScpB (Mascarenhas et al., 2002). This complex is thought to contribute to chromosome segregation by compacting and organizing the DNA, although the exact mechanism by which this happens remains elusive. SMC-ScpAB interacts, at least in some species, with the Par-system and is

Transcription promotes chromosome segregation 1089

recruited to the ori-region by the action of parS-bound ParB (Gruber and Errington, 2009; Sullivan et al., 2009; Minnen et al., 2011). The importance of these protein complexes seems to vary between different bacterial species. E. coli lacks both a Par-system and the SMC-ScpAB system, but does contain an SMC-ScpAB-equivalent protein complex known as MukBEF (Danilova et al., 2007). In this case, different physical models suggest that segregation may be driven by entropic forces and confinement forces controlled by tethering of sister chromosomes (Holmes and Cozzarelli, 2000; Bates and Kleckner, 2005; Jun and Mulder, 2006; Joshi et al., 2011; Fisher et al., 2013). In the latter models, the primary role of DNA interacting proteins (such as nucleoid associated proteins, topoisomerases or condensins) is to regulate the physical state of the DNA polymer (supercoiling, decatenation, compaction, macrodomain formation) to allow entropic segregation of sister chromosomes. It has also been suggested that general cellular processes are important drivers in bacterial chromosome segregation. For example, the chromosomes may be segregated passively as a result of the action of different DNA interacting processes. DNA replication may work as an extrusion force to separate replicated DNA strands (Lemon and Grossman, 2001). Transcription has also been suggested to contribute to chromosome segregation in B. subtilis (Dworkin and Losick, 2002), but not in E. coli (Wang and Sherratt, 2010). S. pneumoniae is different from other model organisms in that it contains the SMC-ScpAB complex, but only a partial Par-system (contain parBS, but not parA). Although parB and smc are involved in chromosome segregation, their deletion does not reduce the growth rate and only cause a mild chromosome segregation defect (1–4% anucleate cells) (Minnen et al., 2011). The latter phenotype is different from rod-shaped B. subtilis where deletion of smc is lethal at standard growth conditions (Britton et al., 1998; Moriya et al., 1998). Therefore, yet uncharacterized mechanisms are involved in segregation of chromosome in S. pneumoniae. Passive processes contributing to chromosome segregation have not been studied in S. pneumoniae or other cocci so far, but they may be particularly important in these cells, given the moderate role of the chromosome segregation complexes ParB-parS and SMC. While the mechanisms underlying the initial and bulk chromosome segregation differ between bacteria, features of the last steps in the segregation process seem to be more conserved. These last steps include the resolution of chromosome dimers by the action of Xer recombinases and pumping of resolved chromosome dimers to the two daughter cells by the DNA translocase FtsK, a ubiquitous cell division protein (Sherratt et al., 2004; Pinho et al., 2013; Stouf et al., 2013).

In the present work we have characterized the dynamics of chromosome segregation in S. pneumoniae by visualizing the chromosomal origin region as well as the bulk chromosome during the normal cell cycle and in the absence of SMC in live cells. Our observations suggest that S. pneumoniae lacks a nucleoid occlusion factor, since the divisome readily assembles at midcell over the nucleoid. However, we show that SMC plays an important function in preventing cell division to occur over unsegregated chromosomes. Importantly, our results indicate that separate mechanisms are involved in origin separation and bulk chromosome segregation. We show that efficient chromosome segregation in S. pneumoniae is dependent on functional transcription since perturbations of the transcription machinery complex, either by treatment with antibiotics or genetic alterations, induce a chromosome segregation defect.

Results Dynamics of chromosome segregation in S. pneumoniae In order to understand how replicated chromosomes move and segregate during S. pneumoniae growth, we characterized the dynamics of the chromosomal origin of replication (oriC) region as well as the bulk chromosome using fluorescence time-lapse microscopy. To analyse the movement of the nucleoid, we fused a red fluorescent protein (RFP) to HlpA (SPD_0997, hup), a homologue to the histone-like, sequence non-specific, DNA-binding protein HU in Escherichia coli (Drlica and Rouviere-Yaniv, 1987) and the only known nucleoid associated protein in Streptococcus (Liu et al., 2008). To specifically image the origin region, we utilized a GFP fusion to ParB, which specifically binds DNA at parS sequences that are located near oriC (Livny et al., 2007; Minnen et al., 2011). Both fusion genes were integrated at their native genetic loci (see Experimental procedures for details). Finally, to mark the cell division site, we employed a GFP fusion to StkP, a eukaryotic-type serine/threonine kinase which is a membrane-bound regulator of cell division. This fusion gene was integrated at the ectopic bgaA-locus under control of a Zn2+-inducible promoter (see Experimental procedures for details). StkP localizes to the division site after the early cell division protein FtsA but before the late cell division protein DivIVA (Beilharz et al., 2012). Two different double-labelled strains were constructed; one containing the hlpA–rfp fusion combined with parB–gfp (strain MK123) and another where hlpA–rfp is combined with gfp–stkP (strain MK125). Note that all fusions were stably integrated in the chromosome of the encapsulated S. pneumoniae D39 strain by double crossover. Time-lapse fluorescence microscopy experiments are shown in Fig. 1 and Movies S1 and S2. When looking at

© 2014 John Wiley & Sons Ltd, Molecular Microbiology, 91, 1088–1105

1090 M. Kjos and J.-W. Veening ■

Fig. 1. Tracking the S. pneumoniae cell cycle by time lapse microscopy of double labelled strains (A) MK123 expressing ParB–GFP and HlpA–RFP and (B) MK125 expressing GFP–StkP and HlpA–RFP. In each case, fluorescent signals are overlayed with a phase contrast image. An arbitrary time point in the time-lapse experiment was chosen and set to 0 min. Scale bar, 2 μm. Arrowheads indicate a nucleoid that is replicated and segregated during the experiment. C. Timing of cell division and chromosome segregation was estimated from the time lapse imaging. Timing of ParB-splitting and HlpA-splitting is indicated below the images. The generation time was estimated to be the same as the time from one splitting of nucleoids (HlpA) to the next (45 min, as shown in the upper bar). Similarly, generation time can also be estimated as the time from start of one segregation cycle (ParB-splitting) to the next (45 min, as shown in the middle bar). The segregation time was estimated from splitting of origins (ParB) until nucleoids are segregated (HlpA) (30 min, as shown in lower bar). D. A schematic overview showing the approximate timing of replication initiation, chromosome segregation and division ring formation in the S. pneumoniae cell cycle. The nucleoid is shown in red, oriC in green and the division ring in blue.



the chromosome as a whole (HlpA–RFP in Fig. 1A and B) it could be seen that bulk chromosome segregation in S. pneumoniae is a gradual process that proceeds concomitantly with cell cycle progression; the nucleoid first expands before it slowly segregates. The time used for each chromosome segregation cycle (i.e. time from one splitting of the nucleoid to the next) for single cells in these experiments is 42 ± 6 min (n = 60), which is equivalent to the generation time (Fig. 1C demonstrates how generation time was estimated). Importantly, the division ring (GFP–StkP) is formed over the nucleoid and full segregation occurs very late in the cell cycle just before septum closure and cell division (Fig. 1B, Movie S2). Our results showed that the chromosome segregation period covers a major part of the pneumococcal cell cycle; the time it takes to segregate the rest of the chromosome (i.e. time between splitting of ParB-foci (origin regions) to splitting of HlpA–RFP signal) is 28 ± 5 min (n = 60), thus approximately 2/3 of the total cell cycle period (Fig. 1A and C, Movie S1). Therefore, origin-regions (ParB–GFP foci) need to split relatively early in the cell cycle, at least within the first 1/3 of the cell cycle. The speed of replication has not been determined for S. pneumoniae, but estimation of replication speed based on results from whole genome marker frequency analysis (see below) using the method of Couturier and Rocha (2006) suggests that the 2 Mb chromosome of S. pneumoniae D39 is replicated in approximately 25 min under our experimental conditions. Thus, origin separation needs to happen in the first half of the replication cycle (within 12 min under our conditions) in order to allow chromosome segregation to finish before the septum closes (Fig. 1). To further characterize the dynamics of the origin region (ParB–GFP) we used total internal reflection fluorescence microscopy (TIRFM, Fig. 2, Movie S3A–C). With TIRFM only a thin section of approximately 100 nm inside the cell surface can be visualized, and this method thus provides high axial resolution compared with normal epifluorescence microscopy (Spira et al., 2012). During the 40 s time frame shown in Fig. 2A, movement, splitting and appearance/disappearance of ParB–GFP foci were observed in over 50% of the cells (Fig. 2B and C), showing that the origin is dynamic on a short time scale. As shown in the intensity plots, the HlpA–RFP signal visualizing the whole nucleoid remained relatively static in the cells during this time period (Fig. 2B). Chromosome segregation in the absence of SMC We showed previously that SMC is enriched at oriC and somehow contributes to chromosome segregation in S. pneumoniae since deletion of SMC resulted in approximately 2% of anucleate cells (Minnen et al., 2011). In order to determine how SMC contributes to chromosome segre-

gation, smc was deleted in the double-labelled ParB–GFP/ HlpA–RFP strain. Although the majority of cells could still segregate their chromosomes properly in the absence of smc, chromosome organization and segregation was clearly affected when smc was deleted. In wild-type cells, the division ring is always formed over the nucleoid and chromosome segregation finishes before the septum is closed to produce two daughter cells with one copy of the chromosome each (Fig. 1B). When SMC is deleted, a fraction of the cells are unable to finish chromosome segregation before septum closure, which causes guillotining of the chromosome with unequal amounts of DNA in the daughter cells (Fig. 3). Subsequently, this may lead to formation of anucleate cells (2.3%, n = 215, Fig. 3A) or cells containing decondensed or degraded nucleoids (diffuse HlpA–RFP signal which covers the whole cell, 4.7%, n = 215, Fig. 3B). In addition, 6.0% of the cells (n = 215) with smc deletion have > 2 ParB–GFP foci per cell (Fig 3B). This latter observation may be caused by problems with segregation of the origin region or defects in cell division. Thus, while DAPI staining of the nucleoid only showed 1.8% of anucleate cells in the absence of SMC (Minnen et al., 2011), time-lapse microscopy in live cells revealed that approximately 13% of the cells exhibited perturbed chromosome segregation dynamics including guillotined chromosomes. Together, these results show that SMC plays an important role at several stages in the segregation process; in organizing and splitting of the origin region as well as in preventing septum formation across unsegregated chromosomes. Transcription inhibitors rifampicin and streptolydigin cause chromosome segregation defects The results shown above as well as our previous data (Minnen et al., 2011) demonstrate that SMC and ParB are involved in chromosome segregation in S. pneumoniae. However, the majority of cells can still segregate their chromosomes properly also when these proteins are absent. This demonstrates that other mechanisms are also important for efficient separation of sister chromosomes in this oval shaped bacterium. The gradual separation of the nucleoid concomitant with DNA replication and cell division (Fig. 1), suggests that bulk chromosome segregation may not be driven by dedicated segregation proteins but occur rather passively by other cell cycle associated processes. When searching for potential segregation mechanisms, we observed that growing S. pneumoniae cells in the presence of sublethal concentrations of the antibiotic rifampicin (0.04 μg ml−1, corresponding to 1/3 of the MIC, where MIC is defined as the minimum concentration to give full growth inhibition) produced 2.3% anucleate cells (n > 500), as judged by DAPI staining of exponentially growing cells (Fig. S1A). Rifampicin thus



Fig. 2. Total internal reflection fluorescence microscopy on live S. pneumoniae cells. A. The first two panels show RFP signal and GFP signal, respectively, overlaid with a differential interference contrast (DIC) image. The lower panel shows an overlay between the GFP and the RFP signal. The dynamic nature of the origin on a short time scale can be observed by (i) splitting, (ii) partial disappearance and (iii) movement of ParB–GFP foci (arrowheads). The HlpA–RFP signal remains static. An arbitrary time point in the time-lapse experiment was chosen and set to 0 min. Scale bar, 2 μm. B. Plot of intensity values from TIRF time-lapse imaging of three representative, individual cells. The x-axis corresponds to the length of the cell, while the y-axis indicates the arbitrary intensity value for the RFP and the GFP channel respectively. While the intensity peaks of the RFP signal remain static, the GFP signal peaks are clearly shifted or appearing/disappearing (indicating movement or splitting of ParB) during this short time span. C. Quantification of ParB-foci dynamics in single cells (n = 106) during 40 s TIRF time-lapse imaging. In over 50% of the cells the ParB-loci were shown to be dynamic; i.e. they were splitting, appearing/disappearing or moving during this short time-scale. In some cells, the GFP signal was absent or too low to determine whether ParB was dynamic. This might be because ParB was located below the TIRF depth, since such high number of cells without ParB foci was not observed with epifluorescence microscopy.

seems to cause a chromosome segregation defect in S. pneumoniae. Rifampicin is a transcription inhibitor which binds to the β subunit (RpoB) of RNA polymerase (RNAP) and stops the transition from initiation to elongation by blocking the path of the elongating RNA transcript when it becomes 2–3 nucleotides in length (Campbell

et al., 2001). Similarly, growing S. pneumoniae cells with sublethal concentrations of another RNAP inhibitor, streptolydigin (300 μg ml−1, corresponding to 1/3 of the MIC), which binds in the β subunit close to the active site of RNAP to interfere with the conformational changes during RNA synthesis (Tuske et al., 2005; Vassylyev et al.,



Fig. 3. Time-lapse fluorescence microscopy of strain MK129 (ParB–GFP, HlpA–RFP, Δsmc). Overlays of phase contrast with green and red fluorescence signals are shown. An arbitrary time point in the time-lapse experiment was chosen and set to 0 min. A. Formation of an anucleate cell in strain MK129 is shown (big arrowhead). B. Division across an unsegregated chromosome followed by decondensation of the nucleoid (big arrowhead) is shown. Examples of cells with > 2 nucleoids are also shown (small, grey arrow). Scale bar, 2 μm.

2007), also caused 3.0% (n > 500) of anucleate cells during exponential phase (Fig. S1A). To verify that the anucleate cell formation is caused by the action of rifampicin on RNAP and not by secondary effects of the drug, a single point mutation was introduced in the RNAP β subunit to create a rifampicin resist allele (RpoBD489V). In line with previous results (Martín-Galiano and de la Campa, 2003), the mutation increased the MIC of rifampicin > 300-fold (comparing mutated strain MK201 with wild-type D39). Growing this strain in the presence of rifampicin (concentrations up to 100-fold of the wild-type MIC) did not result in any anucleate cell formation (n > 500, Fig. S1B). Thus, it is the specific inhibition of RNAP that causes a chromosome segregation defect in S. pneumoniae. Importantly, similar treatment with sublethal concentrations of translation inhibitors chloramphenicol or kanamycin, produced clearly less anucleate cells (0.1% and 0.3% respectively, n > 500 for both) as compared with the transcription inhibitors (2.2% and 3.0% for rifampicin and streptolydigin respectively). Although we cannot exclude the involvement of specific genes or nontranslated RNA in the process, this result indicates that the observed chromosome segregation defect is caused by the perturbation of the transcription machinery as such. Deletion of the cleavage factor GreA causes a chromosome segregation defect Knowing that drugs inhibiting RNAP could cause problems with chromosome segregation in S. pneumoniae,

we wanted to further investigate the role of transcription in this process. In order to see whether the chromosome segregation defect was specifically due to the action of the drugs on RNAP, or whether perturbation of transcription in general had similar effects, the conserved cleavage factor greA was deleted. The absence of greA has been shown to cause reduced transcription processivity in E. coli (Laptenko et al., 2003). Note that, in contrast to E. coli, S. pneumoniae D39 does not contain transcription factors greB or seqA (Lanie et al., 2007). Interestingly, by DAPI staining we observed that a fraction of the greA deletion mutants were anucleate (Fig. 4A). This proportion (2.9%) is similar to what was found for the parB and smc deletion strains (3.5% and 1.8% respectively). A strain with inducible complementation of greA (greA was deleted in a strain with Zn2+-induced expression of greA from an ectopic locus), showed that the wild-type phenotype could only be restored under greAinducing conditions (Fig. 4A), further demonstrating that a functional greA and a fully functional transcription machinery is important for efficient chromosome segregation in pneumococcus. Mutants with a chromosome segregation defect show increased sensitivity towards rifampicin and streptolydigin As shown before, although not essential, parB and smc are important for efficient chromosome segregation in S. pneumoniae (Minnen et al., 2011) (Fig. 3). When parB



Fig. 4. A. Percentage of anucleate cells in the ΔgreA strain. When greA was expressed from an ectopic locus, anucleate cells were no longer observed. More than 500 cells were counted for each condition and error bars are plotted. B and C. greA is synthetic lethal with smc. Number of transformants when greA (B) or stkP (C, control) were deleted in wild-type S. pneumoniae D39 or in ΔparB, Δsmc or ΔparBΔsmc genetic backgrounds are shown. Error bars represent standard deviations. D. The strain MK201 with the conditional double knock out, expressing greA from a Zn2+-inducible promoter in a ΔgreAΔsmc background, can only grow to high optical density when expression of greA is induced. The strain was pre-grown in Zn2+-containing medium and diluted 1/100 prior to the growth experiment, which probably explains the low growth observed in the non-induced medium. Standard deviations are shown.

or/and smc are deleted from the chromosome of S. pneumoniae, 2–4% of the cells become anucleate. However, the growth rate in liquid media of the mutant strains are not affected significantly, only the lag-phase is slightly extended. Unlike the smc mutant in B. subtilis, the corresponding mutants in S. pneumoniae do not show hypersensitivity to gyrase-inhibiting drugs, such as norfloxacin (Minnen et al., 2011). Knowing that rifampicin and streptolydigin cause a chromosome segregation defect in S. pneumoniae, we investigated the sensitivity of the ΔparB, Δsmc and the double ΔparBΔsmc mutant strains to these antibiotics compared with wild-type. While all the strains grow with the same rate in C+Y medium (1.5 doublings per hour, Fig. 5A), the chromosome segregation mutants display a lower growth rate than wild-type in the presence of sublethal concentrations of rifampicin (1.0 h−1 for wild-type versus 0.6 h−1 for the mutants, Fig. 5B). Moreover, the mutant strains also show higher sensitivity to streptolydigin (Fig. 5C). It is worth noting that ΔparB and the double mutant ΔparBΔsmc are hyper-sensitive to streptolydigin (growth abolished at 300 μg ml−1 streptolydigin), while Δsmc only appears to have a reduced growth rate compared with wild-type (0.5 h−1 for wild-type versus 0.3 h−1 for Δsmc), but the reason for this difference is unknown.

GreA is synthetic lethal with SMC, but not with ParB Above we showed that the chromosome segregation mutant strains Δsmc, ΔparB and ΔsmcΔparB showed a synthetic phenotype when exposed to rifampicin and streptolydigin, i.e. the mutant strains were more sensitive to these transcription inhibitors than the wild-type. In order to see if a similar effect could be observed when transcription was perturbed via greA, we tried to delete greA in the Δsmc, ΔparB and ΔsmcΔparB genetic backgrounds. Interestingly, greA was shown to be synthetic lethal with smc, since no ΔgreA transformants could be obtained in the Δsmc and ΔsmcΔparB backgrounds © 2014 John Wiley & Sons Ltd, Molecular Microbiology, 91, 1088–1105


strain (MK201) could only grow well when greA was induced (Fig. 4D), confirming that ΔsmcΔgreA strains are not viable. Rifampicin inhibits chromosome segregation after origin replication and separation

Fig. 5. Growth of S. pneumoniae D39 wild-type (filled circles), ΔparB (open circles), Δsmc (filled triangles) and ΔparBΔsmc (open triangles) in C+Y (A), in C+Y with 0.04 μg ml−1 rifampicin (B) and in C+Y with 300 μg ml−1 streptolydigin (C). Note that the deletion mutants are more sensitive to rifampicin and streptolydigin compared with wild-type. Cells were grown to OD 0.4 and diluted 1/1000 prior to the growth experiment. Standard deviations are shown.

(Fig. 4B). On the other hand, parB and greA were not synthetic lethal. As a control for the transformability, we showed that stkP could be deleted in all the strains (Fig. 4C). In order to confirm the synthetic lethal phenotype of smc and greA, smc was deleted in a ΔgreA strain containing an ectopic, Zn-inducible copy of greA (strain construction was performed under greA-inducing conditions). As shown by growth analysis, the resulting

In order to understand how transcription inhibitors cause chromosome segregation defects, we visualized the chromosome segregation dynamics when S. pneumoniae is grown in the presence of 0.01 μg ml−1 of rifampicin (Fig. 6). The generation time for single cells under this condition is 47 ± 7 min (estimated from time between splitting of HlpA–RFP signals in cells which not become anucleate, n = 95) and anucleate cells are formed. Thus, at this sublethal rifampicin concentration, growth is only slightly inhibited (42 ± 6 min versus 47 ± 7 min) and chromosome segregation is perturbed. In cells with normal chromosome segregation the time of segregation is 31 ± 5 min (time between ParB–GFP splitting and HlpA– RFP splitting, n = 85) and the segregation process lasts for two-thirds of the total cell cycle, equivalent to normal growth. Interestingly, as shown in Fig. 6, initial separation/ movement of ParB–GFP foci are also observed in mother cells that produce daughter cells without a nucleoid. This indicates that initiation of DNA replication is unperturbed and that the early segregation phase after replication starts normally (Fig. 6). However, the origins do not finish the splitting and the nucleoids do not move towards opposite sides of the cell and when cytokinesis occurs, all DNA is located in one of the daughter cells. Thus, while DNA replication and the early segregation process seems to work normally, the action of rifampicin somehow interferes with the gradual chromosome segregation process that eventually leads to full segregation of chromosomes in the late stages of the S. pneumoniae cell cycle. Importantly, anucleate cells were only formed due to failure to partition the replicated chromosomes and guillotined or decondensed/degraded chromosomes were never observed. Thus, the chromosome segregation defect in the transcription-inhibited cells is different from the one in the Δsmc cells, in which guillotining of chromosomes was frequently observed (in 7% of the cells). Rifampcin and streptolydigin are both RNAP inhibitors which block RNA synthesis. Active RNA synthesis by RNAP is also important for the initiation of DNA replication in some bacteria (Clewell and Evenchik, 1973; Skarstad et al., 1986; Baker and Kornberg, 1988). Therefore, it could be possible that the effects we observed with RNAP inhibitors could be attributed to inhibition of replication initiation instead of transcription inhibition directly. However, the time-lapse imaging showed that the rifampicin-mediated segregation defects occur after replication initiation, since initial movement of origins was observed. It should also be



Fig. 6. Perturbation of transcription by the presence of 0.01 μg ml−1 rifampicin leads to chromosome segregation defects. Separation of the origin regions start normally, indicating that replication is initiated. However, at later stages in the cell cycle segregation stops leading to aggregation of both daughter nucleoids in one of the new daughter cells. An arbitrary time point in the time-lapse experiment was chosen and set to 0 min. Scale bar, 2 μm.

noted that compared with rifampicin, streptolydigin has less effect on replication initiation (Clewell and Evenchik, 1973), and with regard to chromosome segregation these two inhibitors showed the same effects. Furthermore, the origin-to-terminus ratio, as determined by qPCR, was slightly less than the control but not statistically significant affected when S. pneumoniae cells were treated with rifampicin (0.04 μg ml−1) or streptolydigin (300 μg ml−1) (Fig. S2). However, origin-to-terminus ratio determination by qPCR does not provide information about the effects of rifampicin on DNA replication elongation. Therefore, we turned to whole genome wide marker frequency analysis (Khodursky et al., 2000) using next-generation sequencing. Chromosomal DNA of wild-type cells grown with or without 0.04 μg ml−1 of rifampicin was isolated and compared with chromosomal DNA isolated from a strain in which initiation of DNA replication was stopped for 2 h using a temperature sensitive allele of dnaA, the replication initiator protein (dnaAts; J. Slager and J.-W. Veening, unpublished). Shotgun libraries were made and Illumina sequenced as described in the Experimental procedures. For each gene in the pneumococcal genome the relative abundance was calculated (reads per kilo base per million; RPKM value) using Rockhopper (McClure et al., 2013) and plotted as a function of the gene’s location on the chromosome (Fig. 7A). Since replication starts bidirectional from oriC, more reads are expected near the origin of replication

compared with the ter region (Pelve et al., 2012). Indeed, the data points plot as a V-shape for the samples of the control cells and of the rifampicin treated cells with most of the reads coming from genes close to oriC (Fig. 7A). As expected, the reads of the dnaAts sample was distributed rather evenly over the chromosome map, indicative of inactive replication (Fig. 7A). The dnaAts sample allowed us to normalize and correct for potentially under- and overrepresented genes due to the sequencing technique. No obvious differences were observed in replication elongation between normally growing cells and cells grown in the presence of 0.04 μg ml−1 rifampicin (Fig. 7B and Fig. S2B). Note that the origin-to-terminus ratio is similar as was established by classical qPCR analysis (Fig. S2). Finally, treating cells with sublethal concentrations of a drug that directly inhibits replication has much more drastic effects and leads to formation of much higher proportion of anucleate cells (compared with the rifampicin and streptolydigin treated cells); by temporary stalling of replication forks with sublethal concentrations of 6-(phydroxyphenylazo)-uracil (HPUra; at a concentration generating similar growth inhibition as for rifampicin and streptolydigin), around 15% anucleate cells were observed (n > 500). Together, these experiments show that DNA replication in S. pneumoniae is not severely affected by exposure to low concentrations of rifampicin and streptolydigin.



Fig. 7. Genome-wide marker frequency analysis using next-generation sequencing. A. Comparison of normally growing S. pneumoniae (Control), S. pneumoniae grown in the presence of 0.04 μg ml−1 rifampicin (Rifampicin) and the dnaAts strain grown for two hours at the non-permissive temperature. Raw RPKM values (reads per kilo base per million) generated by Rockhopper (McClure et al., 2013) are plotted as a function of the chromosomal position. Each point corresponds to one gene. B. The RPKM values of the control sample and the rifampicin sample was normalized to the dnaAts sample (dotted line), and the normalized RPKM values are plotted as a function of the chromosomal position.

Discussion Tracking chromosome dynamics shows rapid origin separation and gradual bulk chromosome segregation Bacteria come in all sorts of shapes including round, rod-shaped, curved or spiral cells and different mechanisms thus exist to guide proper chromosome segregation. So far it is unclear how the members of the families Streptococcaceae and Enterococcaceae (e.g. S. pneumoniae, Enterococcus faecalis, Lactococcus lactis), which are mainly oval-shaped Gram-positive lactic acid bacteria, organize and segregate their chromosomes.

Using powerful light microscopy techniques in combination with a set of fluorescently labelled proteins, we have tracked chromosome dynamics for the first time in live S. pneumoniae cells. This ‘natural history’ approach showed that chromosome segregation is a gradual process which lasts for two-thirds of the total cell cycle period and the final separation from the sister chromosome occurs just before the division septum closes (Fig. 1A–D). During the S. pneumoniae cell cycle, the origin regions are dynamic and origin separation needs to occur soon after replication (within the first one-third or the cell cycle) in order to finish segregation in time before septum closure. The early origin segregation, as well as the movement of origins shown by high resolution TIRFM, implies that an active partitioning mechanism is involved in this process (Fig. 2). S. pneumoniae does not contain ParA, which has been proposed to be important for origin separation in bacteria (Vecchiarelli et al., 2010; 2012). However, the ParB-parS nucleoprotein complex might still play an important role in origin separation together with the associated condensing complex SMC-ScpAB (Minnen et al., 2011). Supporting this notion, we observed that when we perturbed the system by deleting smc, problems arise with origin separation (Fig. 3). Tracking of several individual chromosomal loci by fluorescent repressor-operator systems (FROS) would be necessary in order to get a more detailed view on how SMC affect the dynamics of different parts of the chromosome. Such a system would also allow determination of segregation speeds with higher resolution. We are therefore aiming to develop FROS for S. pneumoniae, however, our attempts so far have not been successful. SMC is involved in several steps of the chromosome segregation process The exact function of bacterial SMCs is poorly understood, partly because of their essentiality in model bacteria such as E. coli and B. subtilis (Britton et al., 1998; Danilova et al., 2007). The S. pneumoniae system provides great advantages since Δsmc cells are viable at normal growth conditions, allowing us to study chromosome dynamics in the absence of SMC. In the smc deletion mutant, we frequently observed the occurrence of chromosome guillotining; i.e. septa were formed across unsegregated chromosomes leading to anucleate cells or cells with small or decondensed nucleoids. This latter observation indicates that SMC or the SMC-ParB-parS complex has important roles also at later stages in the segregation process to prevent cell division over chromosomes (Fig. 8). Importantly, however, their role is different from nucleoid occlusion factors Noc in B. subtilis (Wu and Errington, 2004) and S. aureus (Veiga et al., 2011) and SlmA in E. coli (Bernhardt and de Boer, 2005), whose function is to



Fig. 8. Different factors and processes that may contribute to chromosome segregation in S. pneumoniae (also see Pinho et al., 2013). Transcription might provide a force for chromosome segregation (directed by the orientation of the genes relative to the origin of replication) and be important for chromosomal architecture such as the maintenance of chromosomal interaction domains (Le et al., 2013), which may help in spontaneous de-mixing of the chromosomes (Jun and Wright, 2010; Junier et al., 2013).

prevent Z-ring formation over the nucleoid. Since GFP– StkP arrives at the division site after Z-ring formation (Beilharz et al., 2012), it is clear from Fig. 1B that in S. pneumoniae wild-type cells, the division ring is formed across an unsegregated nucleoid. S. pneumoniae does not contain any homologues to Noc, SlmA or even the Min-system, which is also important for division site selection and Z-ring formation in many bacteria (Lutkenhaus, 2007). Therefore, the observation that division rings are formed across unsegregated nucleoids in the wild-type, which is different from the situation in wild-type E. coli and B. subtilis, may indicate that pneumococci do not possess such a nucleoid occlusion factor (Morlot et al., 2003; Land et al., 2013; Pinho et al., 2013). In this context, it should be noted that the FtsK DNA-pump protein is highly conserved in Streptococci and was shown to localize to the cell division site in L. lactis (Le Bourgeois et al., 2007). FtsK ensures that unsegregated DNA is pumped into the daughter cells before the septum closes (Fig. 8). Since our data show that DNA is still present at midcell right before cell division, it is tempting to speculate that FtsK-like proteins are more important for Streptococci than for rod-shaped bacteria because of the small volume in which the newly replicated chromosome has to end up. The role of SMC in this context could be to mediate efficient pumping of newly replicated chromosomes into the daughter cells by regulating the nucleoid structure in similar manners as have been observed before (Sun et al., 1998; Dasgupta et al., 2000). Our study of the chromosome segregation process during the pneumococcal cell cycle has shown that proteins that are key to this process in other bacteria are less important (ParB, SMC) or even absent (ParA, Noc, SlmA,

MinCDE) in S. pneumoniae (Pinho et al., 2013). Possibly, other and yet unidentified chromosome segregation proteins may play important roles. Nevertheless, in timelapse experiments of wild-type we observed that the bulk chromosome segregates gradually during the cell cycle and this may imply that passive or indirect mechanisms, rather than specific proteins, are the main drivers of chromosome segregation in S. pneumoniae. It has been proposed that entropic forces or internal pushing and pulling forces constitute major factors in bacterial chromosome segregation (Jun and Mulder, 2006; Jun and Wright, 2010). In this context, ParB and SMC, together with other chromosome interacting proteins such as topoisomerases, small nucleoid associated proteins, and the replication or transcription machineries may be important facilitators of this process (Fig. 8). Transcription promotes chromosome segregation In the present work we show that the transcription machinery is one of the important factors driving chromosome segregation in S. pneumoniae. Chromosome segregation defects were observed when cells were treated with sublethal concentrations of antibiotics targeting RNAP. Sublethal concentrations of antibiotics can cause secondary effects in the cell that might interfere with chromosome segregation, however, also when we genetically interfered with the transcription machinery by deleting a transcription elongation factor (GreA), anucleate cells were observed. Moreover, a strain containing a rifampicin-resistant allele of rpoBD489V (encoding the RNAP β-subunit) did not display any chromosome segregation defects upon rifampicin exposure, showing that



it is indeed the specific inhibition of RNAP that causes the segregation defect. The results described above strongly suggest that transcription per se is important for chromosome segregation rather than transcription of a specific factor, although the latter possibility cannot be totally excluded. Further supporting the involvement of transcription in chromosome segregation, we show that mutants which already have a segregation defect (ΔparB, Δsmc and ΔsmcΔparB) are more sensitive to antibiotics inhibiting RNAP and Δsmc and ΔsmcΔparB are also synthetic lethal with ΔgreA. We cannot explain why parB is not synthetic lethal with greA, although both Δsmc and ΔparB were equally sensitive to rifampicin treatment but it is tempting to speculate that ParB is mainly involved in splitting the oriC region while SMC is involved in both early splitting of oriC and gradually separating the bulk of the DNA (Fig. 3). Importantly, transcription seems to be less important for the early segregation of origins, since segregation defects by rifampicin treatment occur after separation of ParB–GFP foci is initiated (Fig. 6). This also shows that the anucleate cells formed by rifampicin treatment is different from those caused by smc deletion (Fig. 3); in the absence of SMC, anucleate cells mainly originate from degradation of guillotined chromosomes, while with rifampicin treatment, chromosomes were not guillotined but somehow failed to partition causing one of the daughter cells to be anucleate. Our results are in line with several previous studies in model bacteria which have shown that inhibition of transcription can affect the organization and segregation of chromosomes. RNAP inhibitors, such as rifampicin and streptolydigin, disturb chromosome segregation in B. subtilis (Dworkin and Losick, 2002) and E. coli, although live cell tracking experiments demonstrated a lack of drastic chromosome segregation defects in E. coli (Wang and Sherratt, 2010). Also, by using temperature sensitive alleles of the RNAP subunits RpoC and RpoD, it was shown that E. coli had problems with nucleoid separation at semi-permissive temperatures (Kruse et al., 2006). Furthermore, RNAP has been shown to interact with MreB, which are dynamic actin-like filaments important for chromosome segregation in some bacteria (Gitai et al., 2005; Kruse et al., 2006). There are also several reports describing that transcription of rRNA operons in particular are important for chromosome condensation and chromosome dynamics in E. coli (Jin and Cabrera, 2006; Cabrera et al., 2009). Transcription as a driving force for chromosome organization So how can transcription and RNAP contribute to chromosome segregation? RNAP is a powerful molecular motor

which can move DNA when fixed on a solid surface (Gelles and Landick, 1998; Bloom and Joglekar, 2010). Thus, if RNAP movement is restricted in the cell, which may be the case (Lewis et al., 2000), it is possible that the transcription complex can translocate DNA to drive the chromosome away from midcell. It is, however, difficult to imagine how such a mechanism can provide directionality. In this context, it has been suggested that the orientation of genes away from the replication origin is important (Ryan and Shapiro, 2003). It has also been suggested that the coupling of transcription with translation and insertion of membrane proteins, in a process known as transertion, can impose restraints on the movement of chromosomes and anchor them to the membrane in a manner that lead to chromosome segregation (Woldringh, 2002). Recently, Libby et al. (2012) provided direct evidence that membrane protein expression could affect positioning of chromosomal loci in E. coli, and that inhibition of transcription by rifampicin prevented such locus repositioning. However, whether such a mechanisms is important for S. pneumoniae chromosome segregation is questionable, since inhibition of translation using sublethal concentrations of chloramphenicol or kanamycin produced clearly less anucleate cells (0.1–0.3%) as compared with the transcription inhibitors (2.2–3.0%). Another interesting hypothesis is that active transcription contributes to chromosome segregation by shaping local DNA topology or global nucleoid structure. Transcription causes local changes in the topology of DNA and this may be important to control supercoiling in S. pneumoniae, which might also affect chromosome segregation (Usongo et al., 2013). Recently, numerical simulations on the E. coli chromosome showed that the presence of macrodomains within the chromosome, together with specific localization of a few genetic loci is enough to drive chromosome segregation (Junier et al., 2013). In this respect it is interesting to note that transcription is crucial for maintaining chromosomal interaction domains (CIDs) in C. crescentus and high gene expression unwinds the DNA duplex to create barriers and physically separate CIDs (Le et al., 2013). In line with this idea, highly transcribed genes are distributed rather evenly across the S. pneumoniae chromosome (Y. Yuzenkova et al., submitted). Perhaps transcription also establishes CIDs or macrodomains in S. pneumoniae and protein complexes such as ParB/SMC give directionality to certain loci (at least to oriC). Future research needs to address whether such loci exist and other protein factors involved in targeting specific genetic loci need to be identified. Concluding remark A large number of different models have been proposed as driving forces for bacterial chromosome segregation. Most



Table 1. Strains and plasmids used in this study. Relevant characteristics

Reference

S. pneumoniae D39 MT3 AM39 JWV415 PGs6 PGs48 MK119 MK123 MK125 MK129 MK199 MK201 JWV500 MT2 DLA3 DJS21

Serotype 2 strain, wild-type D39, spec, parB::spec D39, trmp, smc::trmp D39, spec, trmp, parB::spec, smc::trmp D39, cm, greA::cat D39, tet, cm, greA::cat, bgaA::PZn-greA D39, cm, hlpA–mKate2 D39, cm, spec, hlpA–mKate2, parB–gfp D39, cm, tet, hlpA–mKate2, bgaA::PZn-stkP–gfp D39, cm, tet, trmp, hlpA–mKate2, parB–gfp, smc::trmp D39, rif, rpoBD489V D39, tet, cm, trmp, greA::cat, smc::trmp, bgaA::PZn–greA D39, cm, hlpA–gfp D39, spec, parB–gfp D39, bgaA::PssbB-luc, wild-type D39, dnaAts (temperature-sensitive DnaA)

Avery et al. (1944) Minnen et al. (2011) Minnen et al. (2011) Minnen et al. (2011) Y. Yuzenkova et al., submitted Y. Yuzenkova et al., submitted This study This study This study This study This study This study J.-W. Veening, unpublished Minnen et al. (2011) L. Attaiech and J.-W. Veening, unpublished J. Slager and J.-W. Veening, unpublished

Plasmids pDELstkP pJWV25-stkP pJWV505

Cm, amp, stkP-flanking regions Amp, tet, bgaA’, PZn–gfp–stkP Cm, P32-mKate2

Nováková et al. (2005) Beilharz et al. (2012) J.-W. Veening, unpublished

likely the drivers of pneumococcal chromosome segregation are truly multifactorial where different mechanisms, including replication and transcription, chromosome segregation proteins SMC and ParB together with physical factors, contribute to achieve efficient segregation of sister chromosomes (Fig. 8). The redundancy of different indirect mechanism may be important, particularly in small ovalshaped bacteria like S. pneumoniae, where the dedicated chromosome segregation proteins are less important than in larger, rod-shaped bacteria.

Experimental procedures Bacterial growth conditions The strains used in this study are listed in Table 1. Bacteria were grown in liquid C+Y medium (Martin et al., 1995) or in Columbia agar supplemented with 3% defibrinated sheep blood (Johnny Rottier, Kloosterzade, The Netherlands) at 37°C. When appropriate, 4.5 μg ml−1 chloramphenicol, 100 μg ml−1 spectinomycin, 18 μg ml−1 trimethoprim, 1 μg ml−1 tetracycline or 4 μg ml−1 rifampicin was added to the medium.

tion was carried out with chromosomal DNA from strain PGs6. As a control, stkP was deleted by transformation with plasmid pDELstkP.

Recombinant DNA techniques Genomic DNA was isolated from S. pneumoniae using a modified protocol of the Wizard® Genomic DNA Purification Kit (Promega). Briefly, the cell pellet was resuspended in Nuclei Lysis Solution (Promega) with 0.05% SDS, 0.025% deoxycholate and 50 μg ml−1 RNase A. Samples were incubated at 37°C for 20 min, 80°C for 5 min, 37°C for 10 min and cooled to room temperature prior to addition of Protein Precipitation Solution (Promega). The precipitate was removed by centrifugation and the supernatant was mixed with isopropanol. Precipitated DNA was collected by centrifugation, washed with 70% ethanol and resuspended in TE buffer. Oligonucleotides were ordered from Biolegio and these are listed in Table 2. Phusion High-Fidelity polymerase (New England Biolabs) was used in PCR amplifications and FastDigest restriction enzymes (Fermentas) were used for digestions.

Strain construction Transformation Cells of OD600 ≈ 0.11 were resuspended in fresh medium and made competent by incubation for 12 min at 37°C in the presence of 0.2 μg ml−1 CSP-1. The competent cells were mixed with DNA and incubated at 30°C for 20 min before the culture was diluted 10-fold and incubated 90 min at 37°C. Transformants were selected on Columbia blood agar with the appropriate antibiotics. For deletion of greA, transforma-

MK123 (hlpA–mKate2–cat, parB–gfp–spec). hlpA, encoding a histone-like protein, was fused to mKate2 to obtain a hlpA– rfp fusion. The fusion gene, together with a chloramphenicol resistance marker, was inserted downstream of, and on the same transcriptional unit as the native hlpA gene. A domain breaking linker (-RGSGGEAAAKAGTS-) was inserted between hlpA and mKate2 to give structural flexibility. hlpA was first amplified from chromosomal DNA of D39 using primers hlpA-F-rbs-SphI and hlpA-up-R-BamHI



Table 2. Oligonucleotides used in this study. Name

Sequence (5′–3′); restriction site (underlined)

hlpA-F-rbs-SphI hlpA-up-R-BamHI mKate2-link-BamHI

CGTGCATGCTGGAGGAATCATTAACATGGCA; SphI CTGCGGATCCTTTAACAGCGTCTTTAAGAGCTTTACCAGC; BamHI CGATGGATCCGGATCTGGTGGAGAAGCTGCAGCTAAAGGATCAG AACTTATCAAGGAAAATATGCACATG; BamHI GCATGAATTCTTATTAACGGTGTCCCAATTTACTAG; EcoRI ACTCGGAATTCTAATGAGCACTAGTAGGAGGCATATC; EcoRI ACGTGCGGCCGCTTATAAAAGCCAGTCATTAG; NotI AACAAGTCAGCCACCTGTAG CGCGCATGCAGACTGATTATTTAACAGCGTC; SphI AGCGCGGCCGCTTAAAAAGCCTATTGTATCAAGCT; NotI CGTGGCTGACGATAATGAGG GATTGTAACCGATTCATCTG GGAATGCTTGGTCAAATCTA GTGTAGACATCGTCCTTCAC CGTGCTCTTGGTTTCTCAGG CACAGTTCATGGTCCAACACAACC GGTTGTGTTGGACCATGAACTGTG TGGTGCAGATGCTACTAAGG GATACCACGATCACGCGCAGCTTTC ACGGTCTATCCCAGCTGTTG ATAGGCGCGTGCTTCTTCTA GAAAAGTACCATCCCCAGCA AGCCTTGGTGCCTATCATTG

mKate2-R-EcoRI cam-up-F-EcoRI sPG12-camR-NotI hlpA-up-F hlpA-R-SphI hlpA-down-F-NotI hlpA-down-R hlpA-F-check hlpA-R-check sPG51 sPG72 rpoB-mut489-F rpoB-mut489-R AM16 AM24 parB prote forward parB prote reverse ter Sp forward ter Sp reverse

MK129 (hlpA–mKate2–cat, parB–gfp–spec, smc::trmp). smc was deleted in strain MK123 to produce MK129. MK123 was transformed with chromosomal DNA from the strain AM39 (Minnen et al., 2011) and transformants were selected on Columbia blood agar with trimethoprim. Correct deletion of smc was confirmed by PCR.

(fragment 1). mKate2 was amplified from plasmid pJWV505 using primers mKate2-link-BamHI and mKate2-R-EcoRI (fragment 2). A chloramphenicol resistance gene (cam) was amplified from strain JWV500 using primers cam-up-F-EcoRI and sPG12-camR-NotI (fragment 3). Fragment 1 was digested with BamHI, fragment 2 with BamHI and EcoRI and fragment 3 with EcoRI. The three fragments were ligated and the combined product (hlpA-mKate2)-cam was amplified using primers hlpA-F-rbs-SphI and sPG12-camR-NotI (fragment 4). The region upstream of the chromosomal insertion site was amplified using primers hlpA-up-F and hlpA-R-SphI (fragment 5) and the downstream region was amplified with primers hlpA-down-F-NotI and hlpA-down (fragment 6). Then, fragment 5 was digested with SphI, fragment 6 with NotI and fragment 4 with both SphI and NotI prior to ligation. The ligation product was then transformed into S. pneumoniae D39 and transformants were selected on Columbia blood agar with chloramphenicol to produce the strain MK119. Correct integration was confirmed by PCR and sequencing. Subsequently, the parB–gfp fusion was introduced into MK119 by transformation with chromosomal DNA from strain MT2 (Minnen et al., 2011). MT2 contains a functional parB–gfp fusion at the parB locus (thereby replacing parB in the chromosome) together with a spectinomycin marker. Transformants were selected on Columbia blood agar with spectinomycin.

MK199 (rpoBD489V). A rifampicin resistant strain of D39 was made by introducing a single point mutation in the rpoB gene, which encodes the β subunit of RNAP. The mutation D489V in RpoB was reported to increase the MIC more than 533-fold in S. pneumoniae R6 (Martín-Galiano and de la Campa, 2003). The construct was made using a two-step PCR approach; first a 0.8 kb fragment upstream of the mutation site was amplified using primers sPG72 and rpoB-mut489-F and a 0.9 kb region downstream of the mutation site was amplified using primers rpoB-mut489-R and sPG51, both using genomic DNA from D39 as template. The mutation was introduced in the two overlapping primers rpoB-mut489-F and rpoB-mut489-R. The two fragments were then used as template DNA in a second PCR with primers sPG72 and sPG51 to produce a 1.7 kb fragment. This fragment was then transformed into D39 to produce MK199. Transformants were selected on Columbia blood agar containing 4 μg ml−1 rifampicin. Presence of the correct mutation was confirmed by sequencing.

MK125 (hlpA–mKate2–cam and bgaA::PZn–gfp–stkP). A gfp–stkP fusion was introduced into the bgaA-locus of MK119 using plasmid pJWV025-stkP (Beilharz et al., 2012). Transformants were selected on Columbia blood agar with tetracycline. Expression of gfp–stkP in this strain is controlled by a Zn2+-inducible promoter and native stkP is still present at its own chromosomal location.

MK201 (ΔgreA::cam, Δsmc::trmp, bgaA::PZn-greA). In order to delete smc from strain sPG48 ((ΔgreA::cam, bgaA::PZngreA), an smc-deletion fragment (Δsmc::trmp, containing a trimethoprim resistance cassette between the smc up- and downstream regions) was amplified from the genome of AM39 (Minnen et al., 2011) using primers AM16 and AM24. The fragment was then transformed into sPG48 and trans-



formants were selected on Columbia agar supplemented with trimethoprim. Correct deletion was verified by PCR. In all steps of the transformation procedure 0.1 mM ZnCl2 was added to induce expression of greA.

TIRFM was performed on a DV Elite (Applied Precision) with a sCMOS camera using 50 mW laser illumination (488 nm and 561 nm) through a 100× oil 1.49 NA TIRF objective. Intensity plot. Data for the intensity plots were obtained using the function ‘Plot Profile’ in ImageJ (http://rsb.info.nih.gov/ij/).

Growth analysis Cells were grown to OD600 = 0.4 and diluted 1000-fold or 100-fold prior to growth analysis. Growth curves were made using 96-wells plates in a TECAN Genios microtitre plate reader. OD595 was measured every 15th min.

Microscopy Anucleate cell counts. Cells were grown in 5 ml plastic capped tubes as described previously (Minnen et al., 2011). Cells of OD600 = 0.4 were diluted 100-fold in C+Y medium with or without antibiotics and grown until OD600 = 0.2. Sublethal concentrations of different antibiotics were used; 0.04 μg ml−1 rifampicin, 300 μg ml−1 streptolydigin, 0.7 μg ml−1 chloramphenicol or 40 μg ml−1 kanamycin. One ml of cells (OD600 = 0.2) were harvested by centrifugation at 7500 rcf for 2 minutes, washed once in TBE buffer and resuspended in 100 μl PBS. For visualizing nucleoids, 2 μg ml−1 DAPI (Invitrogen) was added and when needed, 8 ng ml−1 Nile Red (Invitrogen) was added to visualize membranes. 0.4 μl cell suspension was spotted onto microscope slides with agarose. Microscope pictures were taken with a Nikon Ti-E microscope (Nikon), using a CoolSnap HQ2 camera (Photometrics) with an Intensilight Hg-lamp (Nikon) as light source through at 100× oil immersion objective (phase contrast). For DAPI, the excitation wavelengths were between 340 and 380 nm and emission between 435 and 485 nm. More than 500 cells were counted in each experiment, and cells without DAPI signal were considered anucleate. Time lapse imaging. The time lapse imaging was performed essentially as previously described (de Jong et al., 2011). Cells were grown to OD ≈ 0.1, diluted 3-fold and 2 μl were spotted onto a thin matrix with 1.5% high-resolution lowmelting agarose (Sigma) with C+Y medium. To induce expression of gfp–stkP, 0.1 mM ZnCl2 was added to the C+Y. The slide was incubated at 37°C for 30 min prior to microscopy. Imaging was performed on a DV Elite (Applied Precision) with a CoolSnap HQ2 (Photometrics) or sCMOS camera using SSI Solid State Illumination (Applied Precision) through a 100× oil immersion objective (phase contrast). The slide was incubated at 37°C in a temperature controlled chamber during the experiment. Phase contrast and fluorescent images were taken every 5th min. Images were modified for publication using softWoRx 5.5 (Applied Precision) and ImageJ (http://rsb.info.nih.gov/ij/). Total internal reflection fluorescence microscopy (TIRFM). Cells were grown to OD ≈ 0.15 and applied to slides with a thin matrix with 1.5% agarose. Coverslips of exactly 0.17 mm in thickness (Menzel-Gläzer) were prepared with 1 M NaOH, distilled water and EtOH as described (Spira et al., 2012).

Determination of origin-to-terminus ratio by qPCR Cells grown without or with 0.04 μg ml−1 rifampicin or 300 μg ml−1 streptolydigin were obtained as described under Anucleate cell count, and genomic DNA was isolated as described under Recombinant DNA techniques. The primer pair targeting the origin region was parB prote forward and parB prote reverse and for the terminus ter Sp forward and ter Sp reverse. qPCR reactions of 20 μl contains 8.8 μl of DNA, 0.6 pmos of each primer and 10 μl of SYBR Green Supermix (Bio-Rad), and amplification was performed on a iQ5 RealTime PCR Detection System (Bio-Rad) according to the following protocol: 95°C for 3 min, followed by 40 cycles of 95°C for 30 s, 60°C for 30 s, and 72°C for 30 s. Melting curves were acquired to ensure that the amplification resulted in a unique product. Average CT-values and their corresponding uncertainties were found using Monte Carlo simulations based on the results from at least four separate qPCR reactions. Origin-to-terminus ratios were then analysed using the 2–ΔΔCT method (Livak and Schmittgen, 2001). P-values were obtained by pairwise comparison of the 10 000 randomly simulated values for the antibiotic-treated sample with the 10 000 control values from the non-treated sample.

Whole genome sequencing and data analysis S. pneumoniae DLA3 (wild-type) were grown at 37°C in microtitre plates with or without 0.04 μg ml−1 rifampicin until OD600 = 0.15. A DnaA temperature-sensitive S. pneumoniae D39 derivative (J. Slager and J.-W. Veening, unpublished) was grown to OD600 = 0.15 at 37°C and then incubated at 40°C for 2 h. The dnaATs allele was obtained by error prone PCR using wild-type D39 chromosomal DNA as a template and primers flanking the S. pneumoniae dnaA gene. The resulting PCR product was used to transform competent wild-type D39. More than 2000 colonies were screened for normal growth at 37°C and reduced growth at 40°C. A single dnaATs transformant that showed lack of growth 40°C was selected and used for further experiments (J. Slager and J.-W. Veening, unpublished). Genomic DNA was isolated as described under Recombinant DNA techniques. Genomic DNA shotgun library preparation and sequencing on an Illumina HiSeq 2000 (100 bp read lengths) was performed by Vertis Biotechnologie AG (Freising, Germany). Raw sequence reads were mapped onto the genome of S. pneumoniae D39 using Rockhopper (McClure et al., 2013) and the RPKM values generated by this software was used to estimate the read coverage on different positions of the genome. In Fig. S2B, smoothing of the data has been performed using a sliding window approach with moving averages; for each gene the average normalized RPKM value of the 100 proximal genes is plotted as well as the corresponding standard deviations.



Calculation of replication time The time of replication (c) was calculated using the formula c = τ log (oriC/ter)/log (2) (Couturier and Rocha, 2006), where the oriC/ter ratio was determined by whole genome marker frequency analysis and τ is the generation time.

Acknowledgements We thank Stephan Gruber and Nikolay Zenkin for providing streptolydigin, George Wright for providing HPUra, and Jelle Slager for help with analysis of sequencing data. M.K. is supported by a Long-Term Fellowship from the European Biochemical Societies (FEBS). Work in the lab of J.-W.V. is supported by the EMBO Young Investigator Programme, a VIDI fellowship (864.12.001) from the Netherlands Organisation for Scientific Research, Earth and Life Sciences (NWOALW) and ERC starting grant 337399-PneumoCell.

References Avery, O.T., Macleod, C.M., and McCarty, M. (1944) Studies on the chemical nature of the substance inducing transformation of pneumococcal types: induction of transformation by a deoxyribonucleic acid fraction isolated from pneumococcus type III. J Exp Med 79: 137–158. Baker, T.A., and Kornberg, A. (1988) Transcriptional activation of initiation of replication from the E. coli chromosomal origin: an RNA-DNA hybrid near oriC. Cell 55: 113– 123. Bates, D., and Kleckner, N. (2005) Chromosome and replisome dynamics in E. coli: loss of sister cohesion triggers global chromosome movement and mediates chromosome segregation. Cell 121: 899–911. Beilharz, K., Nováková, L., Fadda, D., Branny, P., Massidda, O., and Veening, J.-W. (2012) Control of cell division in Streptococcus pneumoniae by the conserved Ser/Thr protein kinase StkP. Proc Natl Acad Sci USA 109: E905– E913. Bernhardt, T.G., and de Boer, P.A.J. (2005) SlmA, a nucleoidassociated, FtsZ binding protein required for blocking septal ring assembly over chromosomes in E. coli. Mol Cell 18: 555–564. Bloom, K., and Joglekar, A. (2010) Towards building a chromosome segregation machine. Nature 463: 446–456. Le Bourgeois, P., Bugarel, M., Campo, N., Daveran-Mingot, M.-L., Labonté, J., Lanfranchi, D., et al. (2007) The unconventional Xer recombination machinery of Streptococci/ Lactococci. PLoS Genet 3: e117. Britton, R.A., Lin, D.C., and Grossman, A.D. (1998) Characterization of a prokaryotic SMC protein involved in chromosome partitioning. Genes Dev 12: 1254–1259. Cabrera, J.E., Cagliero, C., Quan, S., Squires, C.L., and Jin, D.J. (2009) Active transcription of rRNA operons condenses the nucleoid in Escherichia coli: examining the effect of transcription on nucleoid structure in the absence of transertion. J Bacteriol 191: 4180–4185. Campbell, E.A., Korzheva, N., Mustaev, A., Murakami, K., Nair, S., Goldfarb, A., and Darst, S.A. (2001) Structural mechanism for rifampicin inhibition of bacterial RNA polymerase. Cell 104: 901–912.

Clewell, D.B., and Evenchik, B.G. (1973) Effects of rifampicin, streptolydigin and actinomycin D on the replication of Col E1 plasmid DNA in Escherichia coli. J Mol Biol 75: 503–513. Couturier, E., and Rocha, E.P.C. (2006) Replicationassociated gene dosage effects shape the genomes of fast-growing bacteria but only for transcription and translation genes. Mol Microbiol 59: 1506–1518. Danilova, O., Reyes-Lamothe, R., Pinskaya, M., Sherratt, D., and Possoz, C. (2007) MukB colocalizes with the oriC region and is required for organization of the two Escherichia coli chromosome arms into separate cell halves. Mol Microbiol 65: 1485–1492. Dasgupta, S., Maisnier-Patin, S., and Nordstrom, K. (2000) New genes with old modus operandi: the connection between supercoiling and partitioning of DNA in Escherichia coli. EMBO Rep 1: 323–327. Drlica, K., and Rouviere-Yaniv, J. (1987) Histonelike proteins of bacteria. Microbiol Rev 51: 301–319. Dworkin, J., and Losick, R. (2002) Does RNA polymerase help drive chromosome segregation in bacteria? Proc Natl Acad Sci USA 99: 14089–14094. Fisher, J.K., Bourniquel, A., Witz, G., Weiner, B., Prentiss, M., and Kleckner, N. (2013) Four-dimensional imaging of E. coli nucleoid organization and dynamics in living cells. Cell 153: 882–895. Gelles, J., and Landick, R. (1998) RNA polymerase as a molecular motor. Cell 93: 13–16. Gitai, Z., Dye, N.A., Reisenauer, A., Wachi, M., and Shapiro, L. (2005) MreB actin-mediated segregation of a specific region of a bacterial chromosome. Cell 120: 329–341. Graumann, P., Losick, R., and Strunnikov, A.V. (1998) Subcellular localization of Bacillus subtilis SMC, a protein involved in chromosome condensation and segregation. J Bacteriol 180: 5749–5755. Gruber, S., and Errington, J. (2009) Recruitment of condensin to replication origin regions by ParB/SpoOJ promotes chromosome segregation in B. subtilis. Cell 137: 685–696. Holmes, V.F., and Cozzarelli, N.R. (2000) Closing the ring: links between SMC proteins and chromosome partitioning, condensation, and supercoiling. Proc Natl Acad Sci USA 97: 1322–1324. Ireton, K., Gunther, N.W., 4th, and Grossman, A.D. (1994) spo0J is required for normal chromosome segregation as well as the initiation of sporulation in Bacillus subtilis. J Bacteriol 176: 5320–5329. Jin, D.J., and Cabrera, J.E. (2006) Coupling the distribution of RNA polymerase to global gene regulation and the dynamic structure of the bacterial nucleoid in Escherichia coli. J Struct Biol 156: 284–291. de Jong, I.G., Beilharz, K., Kuipers, O.P., and Veening, J.-W. (2011) Live Cell Imaging of Bacillus subtilis and Streptococcus pneumoniae using Automated Time-lapse Microscopy. J Vis Exp 53: pii:3145. doi: 10.3791/3145 Joshi, M.C., Bourniquel, A., Fisher, J., Ho, B.T., Magnan, D., Kleckner, N., and Bates, D. (2011) Escherichia coli sister chromosome separation includes an abrupt global transition with concomitant release of late-splitting intersister snaps. Proc Natl Acad Sci USA 108: 2765–2770. Jun, S., and Mulder, B. (2006) Entropy-driven spatial organization of highly confined polymers: lessons for the bacterial



chromosome. Proc Natl Acad Sci USA 103: 12388– 12393. Jun, S., and Wright, A. (2010) Entropy as the driver of chromosome segregation. Nat Rev Microbiol 8: 600–607. Junier, I., Boccard, F., and Espéli, O. (2013) Polymer modeling of the E. coli genome reveals the involvement of locus positioning and macrodomain structuring for the control of chromosome conformation and segregation. Nucleic Acids Res. doi: 10.1093/nar/gkt1005 Khodursky, A.B., Peter, B.J., Schmid, M.B., DeRisi, J., Botstein, D., Brown, P.O., and Cozzarelli, N.R. (2000) Analysis of topoisomerase function in bacterial replication fork movement: use of DNA microarrays. Proc Natl Acad Sci USA 97: 9419–9424. Kruse, T., Blagoev, B., Løbner-Olesen, A., Wachi, M., Sasaki, K., Iwai, N., et al. (2006) Actin homolog MreB and RNA polymerase interact and are both required for chromosome segregation in Escherichia coli. Genes Dev 20: 113–124. Land, A.D., Tsui, H.-C.T., Kocaoglu, O., Vella, S.A., Shaw, S.L., Keen, S.K., et al. (2013) Requirement of essential Pbp2x and GpsB for septal ring closure in Streptococcus pneumoniae D39. Mol Microbiol 90: 939–955. Lanie, J.A., Ng, W.-L., Kazmierczak, K.M., Andrzejewski, T.M., Davidsen, T.M., Wayne, K.J., et al. (2007) Genome sequence of Avery’s virulent serotype 2 strain D39 of Streptococcus pneumoniae and comparison with that of unencapsulated laboratory strain R6. J Bacteriol 189: 38–51. Laptenko, O., Lee, J., Lomakin, I., and Borukhov, S. (2003) Transcript cleavage factors GreA and GreB act as transient catalytic components of RNA polymerase. EMBO J 22: 6322–6334. Le, T.B.K., Imakaev, M.V., Mirny, L.A., and Laub, M.T. (2013) High-resolution mapping of the spatial organization of a bacterial chromosome. Science 342: 731–734. Lemon, K.P., and Grossman, A.D. (2001) The extrusioncapture model for chromosome partitioning in bacteria. Genes Dev 15: 2031–2041. Lewis, P.J., Thaker, S.D., and Errington, J. (2000) Compartmentalization of transcription and translation in Bacillus subtilis. EMBO J 19: 710–718. Libby, E.A., Roggiani, M., and Goulian, M. (2012) Membrane protein expression triggers chromosomal locus repositioning in bacteria. Proc Natl Acad Sci USA 109: 7445–7450. Lin, D.C., and Grossman, A.D. (1998) Identification and characterization of a bacterial chromosome partitioning site. Cell 92: 675–685. Liu, D., Yumoto, H., Murakami, K., Hirota, K., Ono, T., Nagamune, H., et al. (2008) The essentiality and involvement of Streptococcus intermedius histone-like DNAbinding protein in bacterial viability and normal growth. Mol Microbiol 68: 1268–1282. Livak, K.J., and Schmittgen, T.D. (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCT method. Methods 25: 402–408. Livny, J., Yamaichi, Y., and Waldor, M.K. (2007) Distribution of centromere-like parS sites in bacteria: insights from comparative genomics. J Bacteriol 189: 8693–8703. Lutkenhaus, J. (2007) Assembly dynamics of the bacterial MinCDE system and spatial regulation of the Z-ring. Annu Rev Biochem 76: 539–562. McClure, R., Balasubramanian, D., Sun, Y., Bobrovskyy, M.,

Sumby, P., Genco, C.A., et al. (2013) Computational analysis of bacterial RNA-Seq data. Nucleic Acids Res 41: e140–e140. Martín-Galiano, A.J., and de la Campa, A.G. (2003) Highefficiency generation of antibiotic-resistant strains of Streptococcus pneumoniae by PCR and transformation. Antimicrob Agents Chemother 47: 1257–1261. Martin, B., García, P., Castanié, M.P., and Claverys, J.P. (1995) The recA gene of Streptococcus pneumoniae is part of a competence-induced operon and controls lysogenic induction. Mol Microbiol 15: 367–379. Mascarenhas, J., Soppa, J., Strunnikov, A.V., and Graumann, P.L. (2002) Cell cycle-dependent localization of two novel prokaryotic chromosome segregation and condensation proteins in Bacillus subtilis that interact with SMC protein. EMBO J 21: 3108–3118. Minnen, A., Attaiech, L., Thon, M., Gruber, S., and Veening, J.-W. (2011) SMC is recruited to oriC by ParB and promotes chromosome segregation in Streptococcus pneumoniae. Mol Microbiol 81: 676–688. Moriya, S., Tsujikawa, E., Hassan, A.K., Asai, K., Kodama, T., and Ogasawara, N. (1998) A Bacillus subtilis geneencoding protein homologous to eukaryotic SMC motor protein is necessary for chromosome partition. Mol Microbiol 29: 179–187. Morlot, C., Zapun, A., Dideberg, O., and Vernet, T. (2003) Growth and division of Streptococcus pneumoniae: localization of the high molecular weight penicillin-binding proteins during the cell cycle. Mol Microbiol 50: 845–855. Niki, H., Jaffé, A., Imamura, R., Ogura, T., and Hiraga, S. (1991) The new gene mukB codes for a 177 kDa protein with coiled-coil domains involved in chromosome partitioning of E. coli. EMBO J 10: 183–193. Nováková, L., Sasková, L., Pallová, P., Janecek, J., Novotná, J., Ulrych, A., et al. (2005) Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identification of kinase substrates. FEBS J 272: 1243–1254. Pelve, E.A., Lindås, A.-C., Knöppel, A., Mira, A., and Bernander, R. (2012) Four chromosome replication origins in the archaeon Pyrobaculum calidifontis. Mol Microbiol 85: 986–995. Pinho, M.G., Kjos, M., and Veening, J.-W. (2013) How to get (a)round: mechanisms controlling growth and division of coccoid bacteria. Nat Rev Microbiol 11: 601–614. Possoz, C., Junier, I., and Espeli, O. (2012) Bacterial chromosome segregation. Front Biosci 17: 1020–1034. Ptacin, J.L., Lee, S.F., Garner, E.C., Toro, E., Eckart, M., Comolli, L.R., et al. (2010) A spindle-like apparatus guides bacterial chromosome segregation. Nat Cell Biol 12: 791– 798. Reyes-Lamothe, R., Nicolas, E., and Sherratt, D.J. (2012) Chromosome replication and segregation in bacteria. Annu Rev Genet 46: 121–143. Ryan, K.R., and Shapiro, L. (2003) Temporal and spatial regulation in prokaryotic cell cycle progression and development. Annu Rev Biochem 72: 367–394. Shebelut, C.W., Guberman, J.M., Teeffelen, S., van Yakhnina, A.A., and Gitai, Z. (2010) Caulobacter chromosome segregation is an ordered multistep process. Proc Natl Acad Sci USA 107: 14194–14198.



Sherratt, D.J., Søballe, B., Barre, F.-X., Filipe, S., Lau, I., Massey, T., and Yates, J. (2004) Recombination and chromosome segregation. Philos Trans R Soc Lond B Biol Sci 359: 61–69. Skarstad, K., Boye, E., and Steen, H.B. (1986) Timing of initiation of chromosome replication in individual Escherichia coli cells. EMBO J 5: 1711–1717. Spira, F., Dominguez-Escobar, J., Müller, N., and Wedlich-Söldner, R. (2012) Visualization of cortex organization and dynamics in microorganisms, using total internal reflection fluorescence microscopy. J Vis Exp 63: e3982. Stouf, M., Meile, J.-C., and Cornet, F. (2013) FtsK actively segregates sister chromosomes in Escherichia coli. Proc Natl Acad Sci USA 110: 11157–11162. Sullivan, N.L., Marquis, K.A., and Rudner, D.Z. (2009) Recruitment of SMC by ParB-parS organizes the origin region and promotes efficient chromosome segregation. Cell 137: 697–707. Sun, Q., Yu, X.-C., and Margolin, W. (1998) Assembly of the FtsZ ring at the central division site in the absence of the chromosome. Mol Microbiol 29: 491–503. Toro, E., and Shapiro, L. (2010) Bacterial chromosome organization and segregation. Cold Spring Harb Perspect Biol 2: a000349. Tuske, S., Sarafianos, S.G., Wang, X., Hudson, B., Sineva, E., Mukhopadhyay, J., et al. (2005) Inhibition of bacterial RNA polymerase by streptolydigin: stabilization of a straight-bridge-helix active-center conformation. Cell 122: 541–552. Usongo, V., Tanguay, C., Nolent, F., Bessong, J.E., and Drolet, M. (2013) Interplay between type 1A topoisomerases and gyrase in chromosome segregation in Escherichia coli. J Bacteriol 195: 1758–1768.

Vassylyev, D.G., Vassylyeva, M.N., Zhang, J., Palangat, M., Artsimovitch, I., and Landick, R. (2007) Structural basis for substrate loading in bacterial RNA polymerase. Nature 448: 163–168. Vecchiarelli, A.G., Han, Y.-W., Tan, X., Mizuuchi, M., Ghirlando, R., Biertümpfel, C., et al. (2010) ATP control of dynamic P1 ParA-DNA interactions: a key role for the nucleoid in plasmid partition. Mol Microbiol 78: 78–91. Vecchiarelli, A.G., Mizuuchi, K., and Funnell, B.E. (2012) Surfing biological surfaces: exploiting the nucleoid for partition and transport in bacteria. Mol Microbiol 86: 513–523. Veiga, H., Jorge, A.M., and Pinho, M.G. (2011) Absence of nucleoid occlusion effector Noc impairs formation of orthogonal FtsZ rings during Staphylococcus aureus cell division. Mol Microbiol 80: 1366–1380. Wang, X., and Sherratt, D.J. (2010) Independent segregation of the two arms of the Escherichia coli ori region requires neither RNA synthesis nor MreB dynamics. J Bacteriol 192: 6143–6153. Wang, X., Llopis, P.M., and Rudner, D.Z. (2013) Organization and segregation of bacterial chromosomes. Nat Rev Genet 14: 191–203. Woldringh, C.L. (2002) The role of co-transcriptional translation and protein translocation (transertion) in bacterial chromosome segregation. Mol Microbiol 45: 17–29. Wu, L.J., and Errington, J. (2004) Coordination of cell division and chromosome segregation by a nucleoid occlusion protein in Bacillus subtilis. Cell 117: 915–925.

Supporting information Additional Supporting Information may be found in the online version of this article at the publisher’s web-site.


Visualizing chromosome segregation in live cells.

Chromosome segregation proteins of Vibrio cholerae as transcription regulators.

Mechanisms for chromosome segregation.

Chromosome segregation in plant meiosis.

Chromosome segregation in Vibrio cholerae.

Cell cycle: regulating chromosome segregation.

Histone Marks Direct Chromosome Segregation.

Bacterial chromosome organization and segregation.

Segregation of chromosome 13 in retinoblastoma.

ChromoShake: a chromosome dynamics simulator reveals that chromatin loops stiffen centromeric chromatin.

Cohesin in cancer: chromosome segregation and beyond.

Chromosome architecture and segregation in prokaryotic cells.

Chromosome reproduction: units of DNA for segregation.

Physical modeling of chromosome segregation in escherichia coli reveals impact of force and DNA relaxation.

A highly conserved repeated DNA element located in the chromosome of Streptococcus pneumoniae.

Accurate chromosome segregation by probabilistic self-organisation.

PICH promotes mitotic chromosome segregation: Identification of a novel role in rDNA disjunction.

Gene localization, size, and physical map of the chromosome of Streptococcus pneumoniae.

Chromosome Dynamics during Mitosis.

The dynamics of signal amplification by macromolecular assemblies for the control of chromosome segregation.

The negatively charged carboxy-terminal tail of β-tubulin promotes proper chromosome segregation.

The spatio-temporal dynamics of PKA activity profile during mitosis and its correlation to chromosome segregation.

Chromosome synapsis and genetic recombination: their roles in meiotic chromosome segregation.

Human oocytes. Error-prone chromosome-mediated spindle assembly favors chromosome segregation defects in human oocytes.