Gene, 101 (1991) 113-116 0 1991 Elsevier Science Publishers B.V. 0378-l 119/91/$03.50

113

GENE 03998

Short Communications Transcription of the Bacillus subtilis spoIlA locus (Recombinant

Jiunn-Jong

DNA;

oH-RNA

polymerase;

Wus, Patrick J. Piggot”,

sporulation)

Kathleen M. Tatti b and Charles P. Moran Jr. b

a Department of Microbiology and Immunology, Temple University School of Medicine, Philadelphia, PA 19140 (U.S.A.). Microbiology

and Immunology,

Emory

University School of Medicine,

Atlanta, GA 30322

(U.S.A.)

and b Department of

Tel. (404) 727-5969

Received by R.E. Yasbin: 22 October 1990 Accepted: 10 December 1990

SUMMARY

The spoZZA operon encodes three genes, including the structural gene for a sporulation-induced sigma factor, gF. We used deletion analysis of spoIlA-1ucZ fusions to define the location of the spoIlA promoter. We found that oH-RNA polymerase transcribes spoZZA accurately in vitro and propose that aH directs transcription of spoZZA during sporulation.

INTRODUCTION

The spoIlA locus is an important regulatory locus required for the formation of spores by Bacillus subtilis. It contains three genes (Fort and Piggot, 1984). The third gene codes for an RNA polymerase factor, cF (Errington et al., 1985; Sun et al., 1989). Transcription of spoZZA begins about 1 h after the start of sporulation (Piggot et al., 1985). The 5’ end of spoZZA mRNA isolated from sporulating bacteria has been identified by primer extension analysis (Wu et al., 1989). The maximum size of the spoZZA locus on the chromosome that is required for efficient sporulation has been delimited with integrative plasmids. It extends no more than 168 nt upstream from the tsp (Wu et al., 1989). At least two classes of promoters are activated at the start of sporulation. A secondary factor, aH, directs the transcription of spoVG (Zuber et al., 1989), and genetic evi-

Correspondence to: Dr. P.J. Piggot, Department of Microbiology and Immunology, Temple University School of Medicine, 3400 N. Broad Street, Philadelphia, PA 19140 (U.S.A.) Tel. (215)221-7927; Fax (215)221-7788.

Abbreviations: B., &&/us; /?Gal, /%galactosidase; bp, base pair(s); EoH, RNA polymerase containing oH; kb, kilobase or 1000 bp; nt, nucleotide(s); ORF, open reading frame; PolIk, Klenow (large) fragment of E. coli DNA polymerase I; tsp, transcription start point(s); wt, wild type.

dence has been used to show that the primary factor in growing cells, d\, directs the transcription of spoZZG during the first 2 h after the start of sporulation (Kenney et al., 1989). To determine which form of o factor directs spoZZA transcription, we have used deletion analysis ofspoZZA-lucZ fusions to obtain a more precise location of the spoZZA control region. We show that purified RNA polymerase holoenzyme containing $I (EaH) transcribes spoZZA in vitro, and that tsp expressed in vitro is identical to the 5’ end of mRNA isolated from sporulating bacteria. Therefore, we conclude that the 5’ end of the mRNA isolated from sporulating bacteria represents the true tsp and that # directs transcription of spoZZA during sporulation.

EXPERIMENTAL

AND DISCUSSION

(a) The 5’ region necessary for spoZZ-4 transcription Previous studies employing integrative plasmid had shown that a chromosome region extending more than 51 bp but less than 168 bp upstream from the position corresponding to the tsp of spoIlA mRNA was necessary for efficient spore formation (Wu et al., 1989). To quantify expression and delimit the region further, it was subjected to BAL 31 deletion analysis and assayed as IucZ transcriptional fusions. The fusions were introduced into a derivative of the lysogenic phage SPfl as described by Zuber

114 -180 *

- 170 *

-150

-160 *

AAAGGATGGAGMGTACTCGCTGMAGTCCTGTTGCTGCAGC * *ScaI

-120

-110 *

*

l*

71%

100%

56%

-90 *

-100 *

8000

-130 *

-140 *

l

-70 *

-80 1

CGGGTTTATCACATTCTTAGCGGACGATGGGAGACTGGAC~TTT~GTAATTATG * * 42% -60 *

-50 *

-40 *

** 10%