Vol. 12, No. 5
MOLECULAR AND CELLULAR BIOLOGY, May 1992, p. 2260-2272 0270-7306/92/052260-13$02.00/0 Copyright C 1992, American Society for Microbiology
Transcription Termination by RNA Polymerase III: Uncoupling of Polymerase Release from Termination Signal Recognition FRANK E. CAMPBELL, JR., AND DAVID R. SETZER*
Department of Molecular Biology and Microbiology, School of Medicine, Case Western Reserve University, Cleveland, Ohio 44106-4960 Received 16 December 1991/Accepted 20 February 1992
Xenopus RNA polymerase III specifically initiates transcription on poly(dC)-tailed DNA templates in the absence of other class III transcription factors normally required for transcription initiation. In experimental analyses of transcription termination using DNA fragments with a 5S rRNA gene positioned downstream of the tailed end, only 40% of the transcribing polymerase molecules terminate at the normally efficient Xenopus borealis somatic-type 5S rRNA terminators; the remaining 60% read through these signals and give rise to runoff transcripts. We find that the nascent RNA strand is inefficiently displaced from the DNA template during transcription elongation. Interestingly, only polymerases synthesizing a displaced RNA terminate at the 5S rRNA gene terminators; when the nascent RNA is not displaced from the template, read-through transcripts are synthesized. RNAs with 3' ends at the 5S rRNA gene terminators are judged to result from authentic termination events on the basis of multiple criteria, including kinetic properties, the precise 3' ends generated, release of transcripts from the template, and recycling of the polymerase. Even though only 40%o of the polymerase molecules ultimately terminate at either of the tandem 5S rRNA gene terminators, virtually all polymerases pause there, demonstrating that termination signal recognition can be experimentally uncoupled from polymerase release. Thus, termination is dependent on RNA strand displacement during transcription elongation, whereas termination signal recognition is not. We interpret our results in terms of a two-step model for transcription termination in which polymerase release is dependent on the fate of the nascent RNA strand during transcription elongation.
residues, and the corresponding oligo (dT).4 cluster on the nontemplate strand of the transcribed gene has been shown to constitute the transcription termination signal in 5S rRNA genes (4) and tRNALYS genes (33) and has been inferred as the termination signal for most genes transcribed by RNA polymerase III (16). Although the central core of four or more dT residues appears to be necessary for termination signal function, the identity of flanking nucleotides affects the efficiency of termination (4). The two tandem terminators at the end of the Xenopus borealis somatic-type 5S rRNA gene have been shown to be particularly efficient termination signals (4, 8). Studies using purified RNA polymerase III from Xenopus ovaries (8) indicated that these termination signals are efficiently recognized by RNA polymerase III in the absence of additional factors. Analysis of transcription termination by calf thymus RNA polymerase III led to a similar conclusion (52). Further evidence that the RNA polymerase III molecule itself is important in the recognition or utilization of transcription termination signals has been provided by the discovery that a mutation at the RET] locus in Saccharomyces cerevisiae results in reduced termination efficiency at weak termination signals (21). The RET] gene has been shown to encode the second-largest subunit of RNA polymerase III (22). All of these studies have promoted the view that transcription termination by RNA polymerase III involves the recognition of a simple, uniform cis-acting sequence signal by the RNA polymerase molecule itself. Other studies, however, have suggested that transcription termination by RNA polymerase III may be somewhat more complex. For example, several termination sites that do not conform to the rules derived from the analysis of Xenopus 5S rRNA genes (4) have been described (1, 13, 20, 32, 33). It has also been suggested that a bend in the DNA template in the region of the termination signal may be important in termi-
Transcription of a gene involves three distinct processes: (i) recognition of the transcription start site by RNA polymerase and initiation of RNA synthesis, (ii) transcript elongation, and (iii) termination, that is, release of the newly synthesized transcript and dissociation of the polymerase. Even though studies of eukaryotic transcription have tended to focus on transcription initiation, biochemical and mechanistic dissection of transcription elongation and termination will be equally important in arriving at a full understanding of RNA synthesis and its control. Transcription termination is likely to play a particularly important role in the production of functional transcripts by RNA polymerase III, since the mature 3' ends of many class III products are generated by transcription termination rather than by RNA processing events, as is the case for RNAs synthesized by RNA polymerases I and II. Among the best-characterized eukaryotic genes are the Xenopus 5S rRNA genes, transcribed by RNA polymerase III (16, 53). Multiple factors in addition to RNA polymerase III are required for accurate and efficient transcription initiation on 5S rRNA genes (15, 45, 47, 56), including the relatively well characterized Zn2+ finger protein TFIIIA (14, 34). These factors and the 5S rRNA gene assemble into a nucleoprotein complex which serves as a substrate for efficient and specific transcription initiation by RNA polymerase III (2, 5, 26, 30, 46) and which remains functionally stable through many rounds of transcription (2, 5, 9, 30, 46). In contrast to the complex machinery controlling transcription initiation by RNA polymerase III, transcription termination appears to be relatively simple. Most transcripts synthesized by RNA polymerase III end in a cluster of U *
Corresponding author. 2260
VOL. 12, 1992
TRANSCRIPTION TERMINATION BY RNA POLYMERASE III
nation by RNA polymerase III (17), as has been described for RNA polymerase II (29). Furthermore, experiments by Gottlieb and Steitz (17, 18) have implicated the 50-kDa La antigen in transcription termination by RNA polymerase III in mammalian cell extracts. In the absence of La antigen, polymerase molecules became reversibly stalled near the 3' end of the gene in a complex with the template and a nascent transcript 1 to 5 nucleotides short of the authentic 3' end. These results suggested that La antigen is required for completion and release of class III transcripts and release and recycling of polymerase when RNA synthesis is directed by a complete transcription complex. To identify and analyze activities intrinsic to the polymerase molecule itself, we have studied transcription elongation and termination by RNA polymerase III in the absence of factors normally required to promote accurate and efficient transcription initiation. The use of these factors to direct specific transcription initiation makes it difficult to exclude the possibility that they or other components in the relatively crude preparations of the factors now available modify the properties of the polymerase or directly participate in the elongation or termination reactions. To circumvent this problem, we have made use of an approach developed by Kadesch and Chamberlin (23) in which linear DNA templates with single-stranded poly(dC) tails are used as templates for transcription by purified RNA polymerase. In their experiments, purified RNA polymerase II efficiently initiated transcription near the single-strand/double-strand junction of such poly(dC)-tailed templates in the absence of other factors. This approach has been very successfully applied to the study of postinitiation activities of both prokaryotic and eukaryotic RNA polymerases from a variety of sources (7, 10, 11, 24, 25, 28, 29, 39-42, 48, 49). We have applied the same method to the study of transcription termination by Xenopus RNA polymerase III and have confirmed that purified RNA polymerase III efficiently recognizes the strong termination signals at the end of the X. borealis somatic-type 5S rRNA gene. Surprisingly, we have also found that termination, but not termination signal recognition, is dependent on the fate of the nascent RNA strand during transcription elongation and that termination by RNA polymerase III can be resolved into two separate mechanistic steps that can be experimentally uncoupled.
MATERIALS AND METHODS Plasmid. Plasmid pG45C is a derivative of pGEM4 (Promega) which contains the X. borealis somatic-type 5S rRNA gene (6). Template preparation. For tailing reactions, 25 ,ug of pG45C cleaved at the unique PstI site was added to a 100-,u reaction mixture containing 0.2 M potassium cacodylate, 1 mM CoCl2, 2 mM P-mercaptoethanol, and 50 p,M dCTP. After addition of 31.25 U of terminal deoxynucleotidyltransferase (Boehringer Mannheim), the mixture was incubated at 37°C for 45 min, and the reaction was terminated by the addition of 100 ,u of SETS (150 mM NaCl, 5 mM EDTA, 0.5% sodium dodecyl sulfate [SDS], 50 mM Tris [pH 8.0]). After the sample was extracted twice with phenol-CHCl3 (1:1), precipitated with ethanol, and washed with 80% ethanol, the template was cleaved at the unique SmaI and HindIII sites, generating a tailed PstI-SmaI fragment 277 bp in length, with an average tail length of 100 to 150 dCMP residues. This fragment contains the 5S rRNA gene positioned downstream of the tailed end, so that polymerase molecules initiating at the tailed end transcribe the coding
2261
strand of the 5S rRNA gene. Other fragments present include a short tailed PstI-HindIII fragment and a large HindIII-SmaI fragment. RNA polymerase III purification. RNA polymerase III was purified from Xenopus laevis ovaries according to the method of Cozzarelli et al. (8) through the DEAE-Sephadex column step, which resolves RNA polymerases I, II, and III. Peak fractions of RNA polymerase III activity were used in all experiments shown in this report. As judged from at-amanitin sensitivity, there was no detectable RNA polymerase I or II activity in these fractions. Standard transcription reaction. In vitro transcription reaction mixtures in a final volume of 25 ,ul contained 25 fmol (1 nM) of tailed template, 10 p.M ZnCl2, and J buffer (70 mM NH4Cl, 7 mM MgCI2, 0.1 mM EDTA, 2 mM dithiothreitol, 8% glycerol, 10 mM N-2-hydroxyethylpiperazine-N'-2ethanesulfonic acid [HEPES; pH 7.4]) (54). Template DNA in 14 to 16 p.1 of buffer was incubated at 25°C for 5 min prior to addition of 4 p.1 of RNA polymerase III. After 3 min more at 25°C, ribonucleoside triphosphates were added (unless noted otherwise, 0.5 mM ATP, CTP, and GTP and 0.025 mM UTP with 10 ,uCi of [a-32P]UTP). The reaction was allowed to proceed for 30 min more before being stopped by the addition of 75 ,ul of SETS/tRNA (1x SETS, 33 p.g of tRNA per ml) and/or a-amanitin (1 mg/ml) as indicated. Labeled RNA products were extracted, precipitated, and resolved on a 5% polyacrylamide-7 M urea gel according to standard procedures. RNase H and RNase A assays. A standard transcription reaction was carried out as described above and stopped by the addition of a-amanitin. Then 1.2 p.1 of 50 mM dithiothreitol (2 mM, final concentration) and 1 p.1 of RNase H (Bethesda Research Laboratories) at 2 U/pl were added to the reaction mix, which was incubated at 25°C for 5 min. A 10.8-pA aliquot was removed to a tube containing 39.2 pl of SETS/tRNA. Conditions were identical in a control reaction except that after addition of ot-amanitin, the reaction mixture was placed in a boiling water bath for 3 min and then placed on ice prior to the addition of RNase H. For the RNase A assays, a 125-pA transcription reaction was used to synthesize labeled RNA products. After the reaction was stopped with ot-amanitin as described above, a 24-pA aliquot was transferred to a tube containing 4 p.l of RNase A at 1 ,ug/pA. After incubation for 2 min, a 12-pA aliquot was removed to a tube containing 38 pl of SETS/tRNA. In a control reaction, a 10.3-pA aliquot of the a-amanitin-treated master reaction mixture was transferred to a tube containing SETS/tRNA. All samples were processed as described above. For the experiment shown in Fig. 6, a 125-pA transcription reaction was carried out. After the standard 3-min incubation with RNA polymerase and tailed template, RNase H (5 pl at 2 U/pl) was added, and the mixture was incubated for 1 min prior to the initiation of transcription by the addition of ribonucleotides. At each of the indicated times, a 12.5-pA aliquot was removed to a tube containing 87.5 RI of SETS/ tRNA. A 12.5-,u control reaction mixture was incubated in the absence of RNase H for 30 min after the addition of ribonucleotides. Labeled transcripts were extracted, precipitated, and analyzed on a denaturing polyacrylamide gel as described above. The T4-A band was quantified by densitometric scanning of the autoradiogram with a U.S. Biochemical Sci-Scan scanner. Pulse-chase analysis. Two minutes after addition of RNA polymerase III to tailed template in a standard transcription reaction mixture, ribonucleotides and 6 p.g of single-stranded M13 DNA (if indicated) were added to the reaction mixture
2262
CAMPBELL AND SETZER
a 5-pI volume. GTP was used as the labeled nucleotide instead of UTP; consequently, each reaction mixture contained 10 puCi of [a-32P]GTP and 0.025 mM GTP. The reaction mixtures contained either 0.025 or 2.3 mM UTP. Thirty seconds after addition of the nucleotide/ single-stranded DNA mixture, unlabeled GTP was added in a volume of 2 RI to a final concentration of 2.8 mM. After the indicated chase times, the reactions were stopped by the addition of 75 RI of SETS/tRNA. Samples were processed and analyzed on denaturing polyacrylamide gels. The transcripts were quantified by densitometric scanning of the
simultaneously in
autoradiogram. A5M gel filtration chromatography. Transcription products and DNA and RNA markers were analyzed by gel filtration on an ASM column (0.5 by 8.5 cm). The column was packed and equilibrated with lx J buffer. Generally, 2-drop fractions were collected (each drop was approximately 55 pl); the actual volume of each collected fraction was determined. Glycogen (20 ,ug) was added to each fraction prior to precipitation with ethanol, and the resulting pellet was dried and dissolved in 99% formamide. The samples were analyzed on a 5% polyacrylamide-8 M urea sequencing gel according to standard procedures. RNA and DNA molecules eluting in each fraction were quantified by densitometric scanning of the autoradiogram. Preparation of samples for gel filtration. Tailed template (420 ng) was mixed with 20 U of RNasin, 20 ,ul of 5 x J buffer, and water to a final volume of 84 pI. After incubation at 25°C for 5 min, 8 pI of RNA polymerase III was added, and the mixture was incubated for 3 min more. Ribonucleoside triphosphates (final concentrations of 0.5 mM ATP and CTP, 0.025 mM GTP, and 40 ,uCi of [a-32P]GTP) were added (in a volume of 8 VI), and the reaction mixture was incubated for 30 min at 25°C. One half of this reaction was used as a no-transcription control (no UTP present). UTP was added to the other 50-pul aliquot of the reaction to a final concentration of 25 ,M along with 40 puCi of [a-32P]UTP in a volume of 4 pI. This mixture was incubated for an additional 30 min at 25°C. Radiolabeled 5S rRNA and tailed-template markers (see below) were added, and the reaction mixture was incubated for 10 min more at 25°C before being loaded on the A5M column. Radiolabeled, tailed template was prepared by tailing pG45C at the PstI site and subsequently digesting it with XbaI. The XbaI site was filled in with the Klenow fragment of DNA polymerase I in the presence of [a-32P]dCTP. Finally, the DNA was digested with EcoRI and HindIII. The product of this procedure is a labeled XbaI-PstI fragment of 267 bp, tailed at the PstI site. Primer extension reactions. A 10-,ul hybridization reaction mixture containing 5 pI of 2 x annealing buffer (500 mM KCI, 20 mM Tris-Cl [pH 8.3] at 42°C), RNA, and 250 fmol 32P-end-labeled primer (see below) was prepared. This mixture was heated at 100°C for 3 min, transferred to a 45°C bath for 3 h, and then transferred to a 37°C bath for 5 min. A mixture containing 8 pI of 2.5 x RT buffer (1 mM each dATP, dGTP, dCTP, and dTTP, 40 mM MgCl2, 20 mM dithiothreitol, 60 mM Tris [pH 8.3] at 42°C), 1 pl of water, and 1 pI of reverse transcriptase (20.4 U/pul; Life Sciences, Inc.) was added to the reaction mixture, and incubation was continued for 1 h at 37°C. The reaction was terminated by the addition of 80 pA of SETS/tRNA, and labeled products were extracted, precipitated with ethanol, and analyzed on an 8%
polyacrylamide-7 M urea sequencing gel. (i) RNA preparation for primer extensions. Variations on a standard 100-pu transcription reaction were used to generate
MOL. CELL. BIOL.
three populations of RNAs. Total transcription products were generated in a reaction in which the runoff period was extended to 2 h and no labeled nucleotides were present. RNasin was included in the initial mixture. A second reaction was identical to this except that after the 3-min incubation with polymerase, RNase H (8 U; Bethesda Research Laboratories) was added and incubation was continued for 1 min prior to nucleotide addition. The third reaction was identical to the first with the following exceptions: no RNasin was present, and after the 2-h runoff period, 8 pug of RNase A was added and incubation was continued for 2 min. A mock reaction mixture contained no RNasin and no polymerase but was otherwise identical to the first reaction mixture described above. All of these reactions were stopped with the addition of SETS/tRNA, and products were isolated and processed further for primer extension analysis. (ii) DNase I treatment. RNA samples were treated with 17 pug of DNase I (RNase free; Bethesda Research Laboratories) in a 44-pA reaction mixture containing DNase I buffer (10 mM MgCl2, 2 mM CaCl2, 50 mM NaCH3COO [pH 5.2]) for 10 min at 37°C to remove template DNA. The digestion was terminated by the addition of 106 pA of SETS. The sample was then extracted, precipitated with ethanol in the presence of glycogen, and redissolved in water. (iii) Primer. The oligonucleotide used for primer extension analysis is a 20-mer that is complementary to the X. borealis SS rRNA gene from +20 to +1 (5'-AGGGTGGTATGGC CGTAGGC-3'). Consequently, it anneals to the SS rRNA portion of the tailed-template transcript as well as to the noncoding strand of the DNA template. This 20-mer was synthesized on an Applied Biosystems oligonucleotide synthesizer, purified by using an oligonucleotide purification cartridge (Applied Biosystems) and end labeled according to standard procedures, using T4 polynucleotide kinase and [_y-32P]ATP (43, 44). Dideoxy sequencing markers for the primer extension analysis were obtained by using the same oligonucleotide primer and pG45C, the source of the tailed template used in transcription reactions. RNase T2 protection assay. Hybridization reaction mixtures (15 ,u) contained lx hybridization buffer (750 mM NaCl, 1 mM EDTA, 10 mM Tris [pH 7.4]), 52-mer oligonucleotide (amount determined empirically in titrations), and 3,000 cpm of gel-purified RNA. This mixture was heated to 85°C for 3 min to denature the RNA and subsequently placed at 50°C for 3 h to permit hybridization of the oligonucleotide to the RNA; 200 ,ul of T2 buffer (200 mM NaCl, 25 pug of tRNA per ml, 20 mM NaCH3COO [pH 4.5]) was then added, and this mixture was incubated at 30°C for 5 min. Where appropriate, 1 pl of RNase T2 at 0.25 U/pA (in 20 mM NaCH3COO [pH 4.5]; Sigma) was added, and incubation continued at 30°C for 30 min. At this point, 21 [lI of Tris/SDS (10 pl of 1 M Tris base and 11 pA of 20% SDS) was added to the reaction mixture. Then 46 pug of proteinase K was added, and the reaction mixture was incubated for 1 h at 30°C. After extraction and precipitation, products were analyzed on a 12% polyacrylamide-7 M urea sequencing gel. Labeled RNA substrates for these assays were prepared in the following manner. Xenopus germinal vesicle extracts were used for the synthesis of authentically terminated 5$ rRNA (3). The terminated RNAs (T4-A and T4-B) generated by RNA polymerase III on tailed templates were prepared in a reaction mixture containing J buffer, tailed DNA, and 200 U of RNasin in a volume of 190 pA. After incubation at 25°C for 5 min, 20 pA of RNA polymerase III was added, and the reaction mixture was incubated for 3 min more. Twenty units of RNase H (2 U/pul) was added, and, after 1 min,
VOL. 12, 1992
TRANSCRIPTION TERMINATION BY RNA POLYMERASE III
ribonucleotides were added in 30 ,ul to final concentrations of 0.5 mM CTP and ATP, 0.025 mM UTP and GTP, and 100 ,uCi each of [a-32P]UTP and [ct-32P]GTP. This reaction mixture was incubated at 25°C for 4 h. Labeled transcripts from this reaction, as well as labeled 5S rRNA synthesized in germinal vesicle extract, were purified on a denaturing 5% polyacrylamide sequencing gel, eluted from gel slices, precipitated, and used in the RNase T2 protection assay. The 52-mer used for RNase protection analysis was synthesized on an Applied Biosystems oligonucleotide synthesizer and purified by using an oligonucleotide purification cartridge and by electrophoresis on a 12% polyacrylamide-7 M urea gel. The oligonucleotide was quantified spectrophotometrically. The sequence of this oligonucleotide is 5'-
XQ\
A
-:~
I
AATGGCAAAAGTGCAAAAGCCTACGACACCTGG TATTCCCAGGCGGTCTCCC-3' and corresponds to the template-strand sequence of the 5S rRNA gene and flanking sequence from +136 to +85.
O-
RUNOFF
RESULTS Use of poly(dC)-tailed templates to analyze transcription by Xenopus RNA polymerase III. We wished to determine whether purified Xenopus RNA polymerase III would initiate transcription specifically on poly(dC)-tailed templates similar to those described for analyses with other RNA polymerases (23). Using terminal deoxynucleotidyltransferase, a single-stranded tail of dC residues was added at the unique PstI site of plasmid pG45C under conditions which yield an average tail length of approximately 100 to 150 dCMP residues. When this template was tested in a transcription assay with RNA polymerase III, a discrete runoff product was observed, indicating that initiation was occurring at a specific site (Fig. 1; see below). The level of transcription observed was markedly stimulated over that seen with an untailed template; transcriptional efficiency was shown to be relatively insensitive to tail lengths varying from 20 to 200 residues (data not shown). Termination of transcription by purified RNA polymerase Ill at the 5S rRNA gene termination signal is inefficient. To utilize poly(dC)-tailed templates to study the mechanism of transcription termination by RNA polymerase III, an X. borealis somatic-type 5S rRNA gene was positioned downstream of the PstI site used for tailing (Fig. 1B). RNA polymerase III molecules initiating transcription at this site would transcribe the template strand of the 5S rRNA gene and encounter the two strong tandem 5S rRNA termination signals found at the 3' end of the gene (4). Any nonterminating polymerases would result in the production of longer transcripts, including runoff transcripts that would extend to the end of the DNA fragment. Hence, an initial assessment of termination efficiency could be made by determining the fraction of transcripts with lengths corresponding to those expected for products with 3' ends at the 5S rRNA gene termination signals. Assuming that the purified polymerase would recognize the strong 5S rRNA gene terminators with efficiencies similar to those previously described (8), we expected to observe little or no runoff transcription, with a high yield of RNA corresponding to termination at the first 5S rRNA gene terminator and a small amount of readthrough product terminated at the second of the two sequential terminators. Surprisingly, four discrete RNA products were observed (Fig. 1A, lane 1). The synthesis of all four transcripts is resistant to the presence of concentrations of x-amanitin sufficient to inhibit RNA polymerase II activity (1
%(f
2263
-
_
T5 -
T4-BT4-A -
-
RUNOFF T5
-
T4-B T4-A
t
1
2 3
T4 T4
D
BCccA[G CCCACGT C(n) T4-A T4-B T5
//,+1 5S rANA GENE
T5
.120 (232)
RUNOFF
FIG. 1. Inefficient termination of transcription by RNA polymerIII at the X. borealis somatic-type 5S rRNA gene terminator by using a poly(dC)-tailed template. (A) Assay in which purified Xenopus RNA polymerase III was used to transcribe the poly(dC)-tailed PstI-SmaI fragment of pG45C illustrated in panel B. Lanes: 1, products synthesized in a standard 30-min reaction; 2, products obtained when single-stranded M13 DNA was added to the reaction mixture prior to the polymerase, thereby competing for polymerase binding and preventing transcription of the tailed template; 3, products obtained when single-stranded M13 DNA was added simultaneously with nucleotides and after preincubation of polymerase and tailed template, thereby limiting transcription to a single round. On the basis of length, the transcripts were identified as shown here and in panel B as T4-A (180 nucleotides), T4-B (188 nucleotides), T5 (232 nucleotides), and runoff (273 nucleotides). (B) PstI-SmaI fragment of pG45C. The single-stranded tail of dC residues is indicated at the 3' end of the PstI site by C(n), where n is the number of residues added. Positioned downstream of the tailed end is the 120-nucleotide X. borealis somatic-type 5S rRNA gene, denoted by the stippled area. The hatched areas both 3' and 5' to the gene denote regions of 5S rRNA gene-flanking sequences extending from -49 to +189 with respect to the 5S rRNA transcription start site. The two tandem terminators (separated by 8 nucleotides) at the end of the 5S rRNA gene are shown (T4 clusters), as is a T5 cluster 52 nucleotides downstream of the 5S rRNA gene. The tailed strand corresponds to the coding strand of the 5S rRNA gene and is the strand transcribed by RNA polymerase III. The two vertical arrows designate transcription start sites mapped by primer extension analysis (Fig. 4). Transcripts synthesized from this template by RNA polymerase III are indicated, with their lengths given in nucleotides. ase
2264
CAMPBELL AND SETZER
,ug/ml) but sensitive to concentrations of ax-amanitin that fail to inhibit RNA polymerase I (1 mg/ml) (data not shown). All transcripts are therefore synthesized by RNA polymerase III and not by small amounts of otherwise undetectable RNA polymerase I or II contaminating our RNA polymerase III preparation. Assuming initiation at or near the single-strand/ double-strand junction of the template (see below), the two smallest products (T4-A and T4-B) were of the sizes expected for transcripts ending at the two adjacent terminators. A minor third product (T5) was of a length consistent with a 3' end at a T5 cluster 52 nucleotides downstream of the first terminator. A major fourth product corresponded to the length of transcript expected for runoff transcription. In fact, only 40% of the transcripts appeared to have 3' ends mapping to either of the two termination signals at the end of the 5S rRNA gene; the remaining 60% resulted from failure to terminate at either of the normally efficient 5S rRNA gene terminators. We considered it likely that the read-through transcripts resulted from termination failure by 60% of the transcribing polymerases; alternatively, these transcripts could have resulted from preferential recycling of a smaller subpopulation of polymerases defective in termination. To distinguish between these possibilities, it was necessary to prevent
polymerase recycling by limiting transcription to a single round. We found that it was possible to form stable preinitiation complexes between poly(dC)-tailed templates and RNA polymerase III in the absence of nucleoside triphosphates; such complexes are resistant to concentrations of single-stranded M13 DNA that prevent formation of new complexes (Fig. 1A, lane 2) and will initiate, elongate, and
terminate RNA chains in the presence of the competing single-stranded DNA (Fig. 1A, lane 3). Consequently, transcription from preformed preinitiation complexes can be limited to a single round by adding single-stranded DNA simultaneously with the nucleoside triphosphates required for initiation and chain elongation. Under these conditions, we found transcripts of the same size and relative abundance as previously observed (Fig. 1A, lane 3). Thus, 60% of the polymerase molecules transcribe through the normally very efficient 5S rRNA termination signals. We have obtained the same result by using multiple preparations of RNA polymerase III and with cruder fractions of the polymerase obtained from earlier steps in the purification (data not shown). Termination signal recognition can be uncoupled from transcription termination. Although pausing of RNA polymerase during transcription elongation is often considered to be a first step in the termination process (37, 55), direct evidence for the use of termination signals as transcriptional pause sites is available only for the rho-dependent termination signals recognized by Eschenchia coli RNA polymerase (27, 31, 35, 36). The production of terminator read-through products as a result of transcription of tailed templates by RNA polymerase III, however, made us consider the possibility that nonterminating polymerases nonetheless efficiently recognized the 5S rRNA gene terminators as pause sites. Consequently, we analyzed the production of transcripts from poly (dC)-tailed templates kinetically in pulsechase experiments. Transcripts were labeled during a 30-s pulse with [a-32P]GTP (25 FM). The pulse was followed by a chase with a large excess of unlabeled GTP (2.8 mM), and transcripts were analyzed after various times. To limit template utilization to a single round of RNA synthesis and thereby improve the effectiveness of the chase protocol, single-stranded M13 DNA was added to the reaction mixture simultaneously with nucleoside triphosphates during the
MOL. CELL. BIOL.
labeling pulse, which was administered after formation of a preinitiation complex between polymerase and template. Such experiments were carried out at both low (25 ,uM) and high (2.3 mM) concentrations of UTP, since we thought it probable that UTP concentration would affect the elongation rate of the polymerase and/or the pause time of the polymerase at dT clusters. The results of such experiments are shown in Fig. 2A and C and presented graphically in Fig. 2B and D. Analysis of control reactions in which unlabeled GTP (final concentration of 2.8 mM) was added simultaneously with the other nucleotides (Fig. 2A and C, lanes 8) and single-stranded M13 DNA was added prior to the polymerase (lanes 7) confirmed that no significant levels of label were incorporated during the chase. At the shortest chase time, all counts appeared in the T4-A band (low concentrations of UTP) or in either the T4-A or T4-B band (high concentrations of UTP). As the chase time was extended, some but not all of the counts were chased into longer transcripts, with the majority of counts ultimately accumulating in the full-length runoff product. Results obtained at low or high concentrations of UTP were similar, differing primarily in that more rapid elongation rates and/or reduced pause times were observed at high UTP concentrations and that the T5 product was greatly reduced in abundance at high concentrations of UTP. We conclude the following from these experiments. (i) Some of the transcripts with 3' ends at the 5S gene terminators result from authentic termination events. This conclusion follows from the observation that some of the counts in these transcripts cannot be chased into longer products, even at high nucleotide concentrations and long chase times (in other experiments, up to 3 h in the presence of millimolar concentrations of nucleotides; further evidence is presented below). (ii) Transcripts with 3' ends in the T5 cluster represent kinetic intermediates that result from use of the T5 cluster as a UTP-concentration-dependent pause site. These transcripts can be chased into longer RNAs and are barely detectable at high UTP concentrations. (iii) Most importantly, it is clear that more polymerases pause at the 5S rRNA termination signals than actually terminate there; more counts appear in transcripts with 3' ends at the two tandem 5S rRNA terminators (T4-A and T4-B) early in the chase than at later chase times. (iv) Furthermore, the data indicate that virtually all polymerases recognize and pause at these termination signals, since all of the counts that ultimately accumulate in read-through products are present in RNAs corresponding to polymerases paused at the termination signals at early time points. Thus, while all polymerases recognize and pause at these normally efficient termination signals, only 40% appear to terminate; the remaining 60% of the polymerases ultimately read through the termination signal and continue elongation to generate runoff transcripts. Transcripts resulting from nonterminating polymerases exist as RNA:DNA hybrids. The results of the pulse-chase analysis raised an obvious question: What distinguishes ternary complexes that terminate at the 5S rRNA gene terminators from those that only pause there? Others have demonstrated that RNA polymerases from several sources may produce persistent RNA:DNA hybrids in addition to or instead of free RNA products when transcribing poly(dC)tailed templates (7, 10, 23, 24, 49). The hybrid presumably results from the failure of polymerase to displace nascent RNA strands during transcription elongation. Production of RNA:DNA hybrids, instead of displaced RNA, appears to be dependent in part on the particular polymerase used and the sequence adjacent to the site of tailing. To determine
VOL. 12, 1992
TRANSCRIPTION TERMINATION BY RNA POLYMERASE III
2265
A CHASFTME (minj
ns
1.5
4.5
9.5
19.5
29.5 29.5
CHASE TIME
30
RUNOFF -
RUNOFF -
T5 -
100lo
90 Q L
T4-B - a T4-A_
.
A-
2
3
5
4
6
7
1
8
60
\T4-A
U) 0.
800 6 0.
E
MOLECULAR AND CELLULAR BIOLOGY, May 1992, p. 2260-2272 0270-7306/92/052260-13$02.00/0 Copyright C 1992, American Society for Microbiology
Transcription Termination by RNA Polymerase III: Uncoupling of Polymerase Release from Termination Signal Recognition FRANK E. CAMPBELL, JR., AND DAVID R. SETZER*
Department of Molecular Biology and Microbiology, School of Medicine, Case Western Reserve University, Cleveland, Ohio 44106-4960 Received 16 December 1991/Accepted 20 February 1992
Xenopus RNA polymerase III specifically initiates transcription on poly(dC)-tailed DNA templates in the absence of other class III transcription factors normally required for transcription initiation. In experimental analyses of transcription termination using DNA fragments with a 5S rRNA gene positioned downstream of the tailed end, only 40% of the transcribing polymerase molecules terminate at the normally efficient Xenopus borealis somatic-type 5S rRNA terminators; the remaining 60% read through these signals and give rise to runoff transcripts. We find that the nascent RNA strand is inefficiently displaced from the DNA template during transcription elongation. Interestingly, only polymerases synthesizing a displaced RNA terminate at the 5S rRNA gene terminators; when the nascent RNA is not displaced from the template, read-through transcripts are synthesized. RNAs with 3' ends at the 5S rRNA gene terminators are judged to result from authentic termination events on the basis of multiple criteria, including kinetic properties, the precise 3' ends generated, release of transcripts from the template, and recycling of the polymerase. Even though only 40%o of the polymerase molecules ultimately terminate at either of the tandem 5S rRNA gene terminators, virtually all polymerases pause there, demonstrating that termination signal recognition can be experimentally uncoupled from polymerase release. Thus, termination is dependent on RNA strand displacement during transcription elongation, whereas termination signal recognition is not. We interpret our results in terms of a two-step model for transcription termination in which polymerase release is dependent on the fate of the nascent RNA strand during transcription elongation.
residues, and the corresponding oligo (dT).4 cluster on the nontemplate strand of the transcribed gene has been shown to constitute the transcription termination signal in 5S rRNA genes (4) and tRNALYS genes (33) and has been inferred as the termination signal for most genes transcribed by RNA polymerase III (16). Although the central core of four or more dT residues appears to be necessary for termination signal function, the identity of flanking nucleotides affects the efficiency of termination (4). The two tandem terminators at the end of the Xenopus borealis somatic-type 5S rRNA gene have been shown to be particularly efficient termination signals (4, 8). Studies using purified RNA polymerase III from Xenopus ovaries (8) indicated that these termination signals are efficiently recognized by RNA polymerase III in the absence of additional factors. Analysis of transcription termination by calf thymus RNA polymerase III led to a similar conclusion (52). Further evidence that the RNA polymerase III molecule itself is important in the recognition or utilization of transcription termination signals has been provided by the discovery that a mutation at the RET] locus in Saccharomyces cerevisiae results in reduced termination efficiency at weak termination signals (21). The RET] gene has been shown to encode the second-largest subunit of RNA polymerase III (22). All of these studies have promoted the view that transcription termination by RNA polymerase III involves the recognition of a simple, uniform cis-acting sequence signal by the RNA polymerase molecule itself. Other studies, however, have suggested that transcription termination by RNA polymerase III may be somewhat more complex. For example, several termination sites that do not conform to the rules derived from the analysis of Xenopus 5S rRNA genes (4) have been described (1, 13, 20, 32, 33). It has also been suggested that a bend in the DNA template in the region of the termination signal may be important in termi-
Transcription of a gene involves three distinct processes: (i) recognition of the transcription start site by RNA polymerase and initiation of RNA synthesis, (ii) transcript elongation, and (iii) termination, that is, release of the newly synthesized transcript and dissociation of the polymerase. Even though studies of eukaryotic transcription have tended to focus on transcription initiation, biochemical and mechanistic dissection of transcription elongation and termination will be equally important in arriving at a full understanding of RNA synthesis and its control. Transcription termination is likely to play a particularly important role in the production of functional transcripts by RNA polymerase III, since the mature 3' ends of many class III products are generated by transcription termination rather than by RNA processing events, as is the case for RNAs synthesized by RNA polymerases I and II. Among the best-characterized eukaryotic genes are the Xenopus 5S rRNA genes, transcribed by RNA polymerase III (16, 53). Multiple factors in addition to RNA polymerase III are required for accurate and efficient transcription initiation on 5S rRNA genes (15, 45, 47, 56), including the relatively well characterized Zn2+ finger protein TFIIIA (14, 34). These factors and the 5S rRNA gene assemble into a nucleoprotein complex which serves as a substrate for efficient and specific transcription initiation by RNA polymerase III (2, 5, 26, 30, 46) and which remains functionally stable through many rounds of transcription (2, 5, 9, 30, 46). In contrast to the complex machinery controlling transcription initiation by RNA polymerase III, transcription termination appears to be relatively simple. Most transcripts synthesized by RNA polymerase III end in a cluster of U *
Corresponding author. 2260
VOL. 12, 1992
TRANSCRIPTION TERMINATION BY RNA POLYMERASE III
nation by RNA polymerase III (17), as has been described for RNA polymerase II (29). Furthermore, experiments by Gottlieb and Steitz (17, 18) have implicated the 50-kDa La antigen in transcription termination by RNA polymerase III in mammalian cell extracts. In the absence of La antigen, polymerase molecules became reversibly stalled near the 3' end of the gene in a complex with the template and a nascent transcript 1 to 5 nucleotides short of the authentic 3' end. These results suggested that La antigen is required for completion and release of class III transcripts and release and recycling of polymerase when RNA synthesis is directed by a complete transcription complex. To identify and analyze activities intrinsic to the polymerase molecule itself, we have studied transcription elongation and termination by RNA polymerase III in the absence of factors normally required to promote accurate and efficient transcription initiation. The use of these factors to direct specific transcription initiation makes it difficult to exclude the possibility that they or other components in the relatively crude preparations of the factors now available modify the properties of the polymerase or directly participate in the elongation or termination reactions. To circumvent this problem, we have made use of an approach developed by Kadesch and Chamberlin (23) in which linear DNA templates with single-stranded poly(dC) tails are used as templates for transcription by purified RNA polymerase. In their experiments, purified RNA polymerase II efficiently initiated transcription near the single-strand/double-strand junction of such poly(dC)-tailed templates in the absence of other factors. This approach has been very successfully applied to the study of postinitiation activities of both prokaryotic and eukaryotic RNA polymerases from a variety of sources (7, 10, 11, 24, 25, 28, 29, 39-42, 48, 49). We have applied the same method to the study of transcription termination by Xenopus RNA polymerase III and have confirmed that purified RNA polymerase III efficiently recognizes the strong termination signals at the end of the X. borealis somatic-type 5S rRNA gene. Surprisingly, we have also found that termination, but not termination signal recognition, is dependent on the fate of the nascent RNA strand during transcription elongation and that termination by RNA polymerase III can be resolved into two separate mechanistic steps that can be experimentally uncoupled.
MATERIALS AND METHODS Plasmid. Plasmid pG45C is a derivative of pGEM4 (Promega) which contains the X. borealis somatic-type 5S rRNA gene (6). Template preparation. For tailing reactions, 25 ,ug of pG45C cleaved at the unique PstI site was added to a 100-,u reaction mixture containing 0.2 M potassium cacodylate, 1 mM CoCl2, 2 mM P-mercaptoethanol, and 50 p,M dCTP. After addition of 31.25 U of terminal deoxynucleotidyltransferase (Boehringer Mannheim), the mixture was incubated at 37°C for 45 min, and the reaction was terminated by the addition of 100 ,u of SETS (150 mM NaCl, 5 mM EDTA, 0.5% sodium dodecyl sulfate [SDS], 50 mM Tris [pH 8.0]). After the sample was extracted twice with phenol-CHCl3 (1:1), precipitated with ethanol, and washed with 80% ethanol, the template was cleaved at the unique SmaI and HindIII sites, generating a tailed PstI-SmaI fragment 277 bp in length, with an average tail length of 100 to 150 dCMP residues. This fragment contains the 5S rRNA gene positioned downstream of the tailed end, so that polymerase molecules initiating at the tailed end transcribe the coding
2261
strand of the 5S rRNA gene. Other fragments present include a short tailed PstI-HindIII fragment and a large HindIII-SmaI fragment. RNA polymerase III purification. RNA polymerase III was purified from Xenopus laevis ovaries according to the method of Cozzarelli et al. (8) through the DEAE-Sephadex column step, which resolves RNA polymerases I, II, and III. Peak fractions of RNA polymerase III activity were used in all experiments shown in this report. As judged from at-amanitin sensitivity, there was no detectable RNA polymerase I or II activity in these fractions. Standard transcription reaction. In vitro transcription reaction mixtures in a final volume of 25 ,ul contained 25 fmol (1 nM) of tailed template, 10 p.M ZnCl2, and J buffer (70 mM NH4Cl, 7 mM MgCI2, 0.1 mM EDTA, 2 mM dithiothreitol, 8% glycerol, 10 mM N-2-hydroxyethylpiperazine-N'-2ethanesulfonic acid [HEPES; pH 7.4]) (54). Template DNA in 14 to 16 p.1 of buffer was incubated at 25°C for 5 min prior to addition of 4 p.1 of RNA polymerase III. After 3 min more at 25°C, ribonucleoside triphosphates were added (unless noted otherwise, 0.5 mM ATP, CTP, and GTP and 0.025 mM UTP with 10 ,uCi of [a-32P]UTP). The reaction was allowed to proceed for 30 min more before being stopped by the addition of 75 ,ul of SETS/tRNA (1x SETS, 33 p.g of tRNA per ml) and/or a-amanitin (1 mg/ml) as indicated. Labeled RNA products were extracted, precipitated, and resolved on a 5% polyacrylamide-7 M urea gel according to standard procedures. RNase H and RNase A assays. A standard transcription reaction was carried out as described above and stopped by the addition of a-amanitin. Then 1.2 p.1 of 50 mM dithiothreitol (2 mM, final concentration) and 1 p.1 of RNase H (Bethesda Research Laboratories) at 2 U/pl were added to the reaction mix, which was incubated at 25°C for 5 min. A 10.8-pA aliquot was removed to a tube containing 39.2 pl of SETS/tRNA. Conditions were identical in a control reaction except that after addition of ot-amanitin, the reaction mixture was placed in a boiling water bath for 3 min and then placed on ice prior to the addition of RNase H. For the RNase A assays, a 125-pA transcription reaction was used to synthesize labeled RNA products. After the reaction was stopped with ot-amanitin as described above, a 24-pA aliquot was transferred to a tube containing 4 p.l of RNase A at 1 ,ug/pA. After incubation for 2 min, a 12-pA aliquot was removed to a tube containing 38 pl of SETS/tRNA. In a control reaction, a 10.3-pA aliquot of the a-amanitin-treated master reaction mixture was transferred to a tube containing SETS/tRNA. All samples were processed as described above. For the experiment shown in Fig. 6, a 125-pA transcription reaction was carried out. After the standard 3-min incubation with RNA polymerase and tailed template, RNase H (5 pl at 2 U/pl) was added, and the mixture was incubated for 1 min prior to the initiation of transcription by the addition of ribonucleotides. At each of the indicated times, a 12.5-pA aliquot was removed to a tube containing 87.5 RI of SETS/ tRNA. A 12.5-,u control reaction mixture was incubated in the absence of RNase H for 30 min after the addition of ribonucleotides. Labeled transcripts were extracted, precipitated, and analyzed on a denaturing polyacrylamide gel as described above. The T4-A band was quantified by densitometric scanning of the autoradiogram with a U.S. Biochemical Sci-Scan scanner. Pulse-chase analysis. Two minutes after addition of RNA polymerase III to tailed template in a standard transcription reaction mixture, ribonucleotides and 6 p.g of single-stranded M13 DNA (if indicated) were added to the reaction mixture
2262
CAMPBELL AND SETZER
a 5-pI volume. GTP was used as the labeled nucleotide instead of UTP; consequently, each reaction mixture contained 10 puCi of [a-32P]GTP and 0.025 mM GTP. The reaction mixtures contained either 0.025 or 2.3 mM UTP. Thirty seconds after addition of the nucleotide/ single-stranded DNA mixture, unlabeled GTP was added in a volume of 2 RI to a final concentration of 2.8 mM. After the indicated chase times, the reactions were stopped by the addition of 75 RI of SETS/tRNA. Samples were processed and analyzed on denaturing polyacrylamide gels. The transcripts were quantified by densitometric scanning of the
simultaneously in
autoradiogram. A5M gel filtration chromatography. Transcription products and DNA and RNA markers were analyzed by gel filtration on an ASM column (0.5 by 8.5 cm). The column was packed and equilibrated with lx J buffer. Generally, 2-drop fractions were collected (each drop was approximately 55 pl); the actual volume of each collected fraction was determined. Glycogen (20 ,ug) was added to each fraction prior to precipitation with ethanol, and the resulting pellet was dried and dissolved in 99% formamide. The samples were analyzed on a 5% polyacrylamide-8 M urea sequencing gel according to standard procedures. RNA and DNA molecules eluting in each fraction were quantified by densitometric scanning of the autoradiogram. Preparation of samples for gel filtration. Tailed template (420 ng) was mixed with 20 U of RNasin, 20 ,ul of 5 x J buffer, and water to a final volume of 84 pI. After incubation at 25°C for 5 min, 8 pI of RNA polymerase III was added, and the mixture was incubated for 3 min more. Ribonucleoside triphosphates (final concentrations of 0.5 mM ATP and CTP, 0.025 mM GTP, and 40 ,uCi of [a-32P]GTP) were added (in a volume of 8 VI), and the reaction mixture was incubated for 30 min at 25°C. One half of this reaction was used as a no-transcription control (no UTP present). UTP was added to the other 50-pul aliquot of the reaction to a final concentration of 25 ,M along with 40 puCi of [a-32P]UTP in a volume of 4 pI. This mixture was incubated for an additional 30 min at 25°C. Radiolabeled 5S rRNA and tailed-template markers (see below) were added, and the reaction mixture was incubated for 10 min more at 25°C before being loaded on the A5M column. Radiolabeled, tailed template was prepared by tailing pG45C at the PstI site and subsequently digesting it with XbaI. The XbaI site was filled in with the Klenow fragment of DNA polymerase I in the presence of [a-32P]dCTP. Finally, the DNA was digested with EcoRI and HindIII. The product of this procedure is a labeled XbaI-PstI fragment of 267 bp, tailed at the PstI site. Primer extension reactions. A 10-,ul hybridization reaction mixture containing 5 pI of 2 x annealing buffer (500 mM KCI, 20 mM Tris-Cl [pH 8.3] at 42°C), RNA, and 250 fmol 32P-end-labeled primer (see below) was prepared. This mixture was heated at 100°C for 3 min, transferred to a 45°C bath for 3 h, and then transferred to a 37°C bath for 5 min. A mixture containing 8 pI of 2.5 x RT buffer (1 mM each dATP, dGTP, dCTP, and dTTP, 40 mM MgCl2, 20 mM dithiothreitol, 60 mM Tris [pH 8.3] at 42°C), 1 pl of water, and 1 pI of reverse transcriptase (20.4 U/pul; Life Sciences, Inc.) was added to the reaction mixture, and incubation was continued for 1 h at 37°C. The reaction was terminated by the addition of 80 pA of SETS/tRNA, and labeled products were extracted, precipitated with ethanol, and analyzed on an 8%
polyacrylamide-7 M urea sequencing gel. (i) RNA preparation for primer extensions. Variations on a standard 100-pu transcription reaction were used to generate
MOL. CELL. BIOL.
three populations of RNAs. Total transcription products were generated in a reaction in which the runoff period was extended to 2 h and no labeled nucleotides were present. RNasin was included in the initial mixture. A second reaction was identical to this except that after the 3-min incubation with polymerase, RNase H (8 U; Bethesda Research Laboratories) was added and incubation was continued for 1 min prior to nucleotide addition. The third reaction was identical to the first with the following exceptions: no RNasin was present, and after the 2-h runoff period, 8 pug of RNase A was added and incubation was continued for 2 min. A mock reaction mixture contained no RNasin and no polymerase but was otherwise identical to the first reaction mixture described above. All of these reactions were stopped with the addition of SETS/tRNA, and products were isolated and processed further for primer extension analysis. (ii) DNase I treatment. RNA samples were treated with 17 pug of DNase I (RNase free; Bethesda Research Laboratories) in a 44-pA reaction mixture containing DNase I buffer (10 mM MgCl2, 2 mM CaCl2, 50 mM NaCH3COO [pH 5.2]) for 10 min at 37°C to remove template DNA. The digestion was terminated by the addition of 106 pA of SETS. The sample was then extracted, precipitated with ethanol in the presence of glycogen, and redissolved in water. (iii) Primer. The oligonucleotide used for primer extension analysis is a 20-mer that is complementary to the X. borealis SS rRNA gene from +20 to +1 (5'-AGGGTGGTATGGC CGTAGGC-3'). Consequently, it anneals to the SS rRNA portion of the tailed-template transcript as well as to the noncoding strand of the DNA template. This 20-mer was synthesized on an Applied Biosystems oligonucleotide synthesizer, purified by using an oligonucleotide purification cartridge (Applied Biosystems) and end labeled according to standard procedures, using T4 polynucleotide kinase and [_y-32P]ATP (43, 44). Dideoxy sequencing markers for the primer extension analysis were obtained by using the same oligonucleotide primer and pG45C, the source of the tailed template used in transcription reactions. RNase T2 protection assay. Hybridization reaction mixtures (15 ,u) contained lx hybridization buffer (750 mM NaCl, 1 mM EDTA, 10 mM Tris [pH 7.4]), 52-mer oligonucleotide (amount determined empirically in titrations), and 3,000 cpm of gel-purified RNA. This mixture was heated to 85°C for 3 min to denature the RNA and subsequently placed at 50°C for 3 h to permit hybridization of the oligonucleotide to the RNA; 200 ,ul of T2 buffer (200 mM NaCl, 25 pug of tRNA per ml, 20 mM NaCH3COO [pH 4.5]) was then added, and this mixture was incubated at 30°C for 5 min. Where appropriate, 1 pl of RNase T2 at 0.25 U/pA (in 20 mM NaCH3COO [pH 4.5]; Sigma) was added, and incubation continued at 30°C for 30 min. At this point, 21 [lI of Tris/SDS (10 pl of 1 M Tris base and 11 pA of 20% SDS) was added to the reaction mixture. Then 46 pug of proteinase K was added, and the reaction mixture was incubated for 1 h at 30°C. After extraction and precipitation, products were analyzed on a 12% polyacrylamide-7 M urea sequencing gel. Labeled RNA substrates for these assays were prepared in the following manner. Xenopus germinal vesicle extracts were used for the synthesis of authentically terminated 5$ rRNA (3). The terminated RNAs (T4-A and T4-B) generated by RNA polymerase III on tailed templates were prepared in a reaction mixture containing J buffer, tailed DNA, and 200 U of RNasin in a volume of 190 pA. After incubation at 25°C for 5 min, 20 pA of RNA polymerase III was added, and the reaction mixture was incubated for 3 min more. Twenty units of RNase H (2 U/pul) was added, and, after 1 min,
VOL. 12, 1992
TRANSCRIPTION TERMINATION BY RNA POLYMERASE III
ribonucleotides were added in 30 ,ul to final concentrations of 0.5 mM CTP and ATP, 0.025 mM UTP and GTP, and 100 ,uCi each of [a-32P]UTP and [ct-32P]GTP. This reaction mixture was incubated at 25°C for 4 h. Labeled transcripts from this reaction, as well as labeled 5S rRNA synthesized in germinal vesicle extract, were purified on a denaturing 5% polyacrylamide sequencing gel, eluted from gel slices, precipitated, and used in the RNase T2 protection assay. The 52-mer used for RNase protection analysis was synthesized on an Applied Biosystems oligonucleotide synthesizer and purified by using an oligonucleotide purification cartridge and by electrophoresis on a 12% polyacrylamide-7 M urea gel. The oligonucleotide was quantified spectrophotometrically. The sequence of this oligonucleotide is 5'-
XQ\
A
-:~
I
AATGGCAAAAGTGCAAAAGCCTACGACACCTGG TATTCCCAGGCGGTCTCCC-3' and corresponds to the template-strand sequence of the 5S rRNA gene and flanking sequence from +136 to +85.
O-
RUNOFF
RESULTS Use of poly(dC)-tailed templates to analyze transcription by Xenopus RNA polymerase III. We wished to determine whether purified Xenopus RNA polymerase III would initiate transcription specifically on poly(dC)-tailed templates similar to those described for analyses with other RNA polymerases (23). Using terminal deoxynucleotidyltransferase, a single-stranded tail of dC residues was added at the unique PstI site of plasmid pG45C under conditions which yield an average tail length of approximately 100 to 150 dCMP residues. When this template was tested in a transcription assay with RNA polymerase III, a discrete runoff product was observed, indicating that initiation was occurring at a specific site (Fig. 1; see below). The level of transcription observed was markedly stimulated over that seen with an untailed template; transcriptional efficiency was shown to be relatively insensitive to tail lengths varying from 20 to 200 residues (data not shown). Termination of transcription by purified RNA polymerase Ill at the 5S rRNA gene termination signal is inefficient. To utilize poly(dC)-tailed templates to study the mechanism of transcription termination by RNA polymerase III, an X. borealis somatic-type 5S rRNA gene was positioned downstream of the PstI site used for tailing (Fig. 1B). RNA polymerase III molecules initiating transcription at this site would transcribe the template strand of the 5S rRNA gene and encounter the two strong tandem 5S rRNA termination signals found at the 3' end of the gene (4). Any nonterminating polymerases would result in the production of longer transcripts, including runoff transcripts that would extend to the end of the DNA fragment. Hence, an initial assessment of termination efficiency could be made by determining the fraction of transcripts with lengths corresponding to those expected for products with 3' ends at the 5S rRNA gene termination signals. Assuming that the purified polymerase would recognize the strong 5S rRNA gene terminators with efficiencies similar to those previously described (8), we expected to observe little or no runoff transcription, with a high yield of RNA corresponding to termination at the first 5S rRNA gene terminator and a small amount of readthrough product terminated at the second of the two sequential terminators. Surprisingly, four discrete RNA products were observed (Fig. 1A, lane 1). The synthesis of all four transcripts is resistant to the presence of concentrations of x-amanitin sufficient to inhibit RNA polymerase II activity (1
%(f
2263
-
_
T5 -
T4-BT4-A -
-
RUNOFF T5
-
T4-B T4-A
t
1
2 3
T4 T4
D
BCccA[G CCCACGT C(n) T4-A T4-B T5
//,+1 5S rANA GENE
T5
.120 (232)
RUNOFF
FIG. 1. Inefficient termination of transcription by RNA polymerIII at the X. borealis somatic-type 5S rRNA gene terminator by using a poly(dC)-tailed template. (A) Assay in which purified Xenopus RNA polymerase III was used to transcribe the poly(dC)-tailed PstI-SmaI fragment of pG45C illustrated in panel B. Lanes: 1, products synthesized in a standard 30-min reaction; 2, products obtained when single-stranded M13 DNA was added to the reaction mixture prior to the polymerase, thereby competing for polymerase binding and preventing transcription of the tailed template; 3, products obtained when single-stranded M13 DNA was added simultaneously with nucleotides and after preincubation of polymerase and tailed template, thereby limiting transcription to a single round. On the basis of length, the transcripts were identified as shown here and in panel B as T4-A (180 nucleotides), T4-B (188 nucleotides), T5 (232 nucleotides), and runoff (273 nucleotides). (B) PstI-SmaI fragment of pG45C. The single-stranded tail of dC residues is indicated at the 3' end of the PstI site by C(n), where n is the number of residues added. Positioned downstream of the tailed end is the 120-nucleotide X. borealis somatic-type 5S rRNA gene, denoted by the stippled area. The hatched areas both 3' and 5' to the gene denote regions of 5S rRNA gene-flanking sequences extending from -49 to +189 with respect to the 5S rRNA transcription start site. The two tandem terminators (separated by 8 nucleotides) at the end of the 5S rRNA gene are shown (T4 clusters), as is a T5 cluster 52 nucleotides downstream of the 5S rRNA gene. The tailed strand corresponds to the coding strand of the 5S rRNA gene and is the strand transcribed by RNA polymerase III. The two vertical arrows designate transcription start sites mapped by primer extension analysis (Fig. 4). Transcripts synthesized from this template by RNA polymerase III are indicated, with their lengths given in nucleotides. ase
2264
CAMPBELL AND SETZER
,ug/ml) but sensitive to concentrations of ax-amanitin that fail to inhibit RNA polymerase I (1 mg/ml) (data not shown). All transcripts are therefore synthesized by RNA polymerase III and not by small amounts of otherwise undetectable RNA polymerase I or II contaminating our RNA polymerase III preparation. Assuming initiation at or near the single-strand/ double-strand junction of the template (see below), the two smallest products (T4-A and T4-B) were of the sizes expected for transcripts ending at the two adjacent terminators. A minor third product (T5) was of a length consistent with a 3' end at a T5 cluster 52 nucleotides downstream of the first terminator. A major fourth product corresponded to the length of transcript expected for runoff transcription. In fact, only 40% of the transcripts appeared to have 3' ends mapping to either of the two termination signals at the end of the 5S rRNA gene; the remaining 60% resulted from failure to terminate at either of the normally efficient 5S rRNA gene terminators. We considered it likely that the read-through transcripts resulted from termination failure by 60% of the transcribing polymerases; alternatively, these transcripts could have resulted from preferential recycling of a smaller subpopulation of polymerases defective in termination. To distinguish between these possibilities, it was necessary to prevent
polymerase recycling by limiting transcription to a single round. We found that it was possible to form stable preinitiation complexes between poly(dC)-tailed templates and RNA polymerase III in the absence of nucleoside triphosphates; such complexes are resistant to concentrations of single-stranded M13 DNA that prevent formation of new complexes (Fig. 1A, lane 2) and will initiate, elongate, and
terminate RNA chains in the presence of the competing single-stranded DNA (Fig. 1A, lane 3). Consequently, transcription from preformed preinitiation complexes can be limited to a single round by adding single-stranded DNA simultaneously with the nucleoside triphosphates required for initiation and chain elongation. Under these conditions, we found transcripts of the same size and relative abundance as previously observed (Fig. 1A, lane 3). Thus, 60% of the polymerase molecules transcribe through the normally very efficient 5S rRNA termination signals. We have obtained the same result by using multiple preparations of RNA polymerase III and with cruder fractions of the polymerase obtained from earlier steps in the purification (data not shown). Termination signal recognition can be uncoupled from transcription termination. Although pausing of RNA polymerase during transcription elongation is often considered to be a first step in the termination process (37, 55), direct evidence for the use of termination signals as transcriptional pause sites is available only for the rho-dependent termination signals recognized by Eschenchia coli RNA polymerase (27, 31, 35, 36). The production of terminator read-through products as a result of transcription of tailed templates by RNA polymerase III, however, made us consider the possibility that nonterminating polymerases nonetheless efficiently recognized the 5S rRNA gene terminators as pause sites. Consequently, we analyzed the production of transcripts from poly (dC)-tailed templates kinetically in pulsechase experiments. Transcripts were labeled during a 30-s pulse with [a-32P]GTP (25 FM). The pulse was followed by a chase with a large excess of unlabeled GTP (2.8 mM), and transcripts were analyzed after various times. To limit template utilization to a single round of RNA synthesis and thereby improve the effectiveness of the chase protocol, single-stranded M13 DNA was added to the reaction mixture simultaneously with nucleoside triphosphates during the
MOL. CELL. BIOL.
labeling pulse, which was administered after formation of a preinitiation complex between polymerase and template. Such experiments were carried out at both low (25 ,uM) and high (2.3 mM) concentrations of UTP, since we thought it probable that UTP concentration would affect the elongation rate of the polymerase and/or the pause time of the polymerase at dT clusters. The results of such experiments are shown in Fig. 2A and C and presented graphically in Fig. 2B and D. Analysis of control reactions in which unlabeled GTP (final concentration of 2.8 mM) was added simultaneously with the other nucleotides (Fig. 2A and C, lanes 8) and single-stranded M13 DNA was added prior to the polymerase (lanes 7) confirmed that no significant levels of label were incorporated during the chase. At the shortest chase time, all counts appeared in the T4-A band (low concentrations of UTP) or in either the T4-A or T4-B band (high concentrations of UTP). As the chase time was extended, some but not all of the counts were chased into longer transcripts, with the majority of counts ultimately accumulating in the full-length runoff product. Results obtained at low or high concentrations of UTP were similar, differing primarily in that more rapid elongation rates and/or reduced pause times were observed at high UTP concentrations and that the T5 product was greatly reduced in abundance at high concentrations of UTP. We conclude the following from these experiments. (i) Some of the transcripts with 3' ends at the 5S gene terminators result from authentic termination events. This conclusion follows from the observation that some of the counts in these transcripts cannot be chased into longer products, even at high nucleotide concentrations and long chase times (in other experiments, up to 3 h in the presence of millimolar concentrations of nucleotides; further evidence is presented below). (ii) Transcripts with 3' ends in the T5 cluster represent kinetic intermediates that result from use of the T5 cluster as a UTP-concentration-dependent pause site. These transcripts can be chased into longer RNAs and are barely detectable at high UTP concentrations. (iii) Most importantly, it is clear that more polymerases pause at the 5S rRNA termination signals than actually terminate there; more counts appear in transcripts with 3' ends at the two tandem 5S rRNA terminators (T4-A and T4-B) early in the chase than at later chase times. (iv) Furthermore, the data indicate that virtually all polymerases recognize and pause at these termination signals, since all of the counts that ultimately accumulate in read-through products are present in RNAs corresponding to polymerases paused at the termination signals at early time points. Thus, while all polymerases recognize and pause at these normally efficient termination signals, only 40% appear to terminate; the remaining 60% of the polymerases ultimately read through the termination signal and continue elongation to generate runoff transcripts. Transcripts resulting from nonterminating polymerases exist as RNA:DNA hybrids. The results of the pulse-chase analysis raised an obvious question: What distinguishes ternary complexes that terminate at the 5S rRNA gene terminators from those that only pause there? Others have demonstrated that RNA polymerases from several sources may produce persistent RNA:DNA hybrids in addition to or instead of free RNA products when transcribing poly(dC)tailed templates (7, 10, 23, 24, 49). The hybrid presumably results from the failure of polymerase to displace nascent RNA strands during transcription elongation. Production of RNA:DNA hybrids, instead of displaced RNA, appears to be dependent in part on the particular polymerase used and the sequence adjacent to the site of tailing. To determine
VOL. 12, 1992
TRANSCRIPTION TERMINATION BY RNA POLYMERASE III
2265
A CHASFTME (minj
ns
1.5
4.5
9.5
19.5
29.5 29.5
CHASE TIME
30
RUNOFF -
RUNOFF -
T5 -
100lo
90 Q L
T4-B - a T4-A_
.
A-
2
3
5
4
6
7
1
8
60
\T4-A
U) 0.
800 6 0.
E
