JOURNAL OF VIROLOGY, Jan. 1992,

p. 325-333

Vol. 66, No. 1

0022-538XI92/010325-09$02.00/0 Copyright C) 1992, American Society for Microbiology

Transcriptional Activation of Several Heterologous Promoters by the E6 Protein of Human Papillomavirus Type 16 CHRISTIAN DESAINTES,* SOPHIE HALLEZ, PATRICK VAN ALPHEN, AND ARSENE BURNY Laboratoire de Chimie Biologique, Faculte des Sciences, Universite Libre de Bruxelles, 67, rue des chevaux, 1640 Rhode-St-Genese, Belgium Received 22 July 1991/Accepted 3 October 1991

The E6 protein of human papillomavirus type 16 (HPV-16), along with E7, is responsible for the HPV-induced malignant transformation of the cervix. However, the mechanism of this transformation activity is not well understood. We investigated whether the entire E6 protein of HPV-16 could act as an activator of transcription. Experiments in which NIH 3T3 cells were cotransfected with an E6 expression vector together with the reporter chloramphenicol acetyltransferase (CAT) gene linked to various minimal promoters indicated that E6 could activate transcription from a series of viral TATA-containing promoters. Mutations or deletions that affected all upstream regulatory elements present in the thymidine kinase (TK) promoter, such as the GC and CAAT boxes, reduced the level of E6-induced transcription. However, compared with the basal level, these truncated promoters were still activated by E6. Although site-directed mutations of the TATA sequence present in the TK or human immunodeficiency virus long terminal repeat promoters reduced the level of basal transcription, they did not abolish the E6-mediated activation. Moreover, E6 could restore almost completely the full level of wild-type E6-induced transcription as long as the upstream regulatory elements (GC/CAAT in the TK promoter, NF-KcB in the human immunodeficiency virus long terminal repeat) were intact. This dual interaction of HPV-16 E6 is reminiscent of the activity of a coactivator.

dependent degradation of p53 after specific binding (42). Destruction of p53, which has tumor suppressor activity (23), might be responsible for the oncogenic property of E6, but at present, there is not direct evidence for this hypothesis. The HPV-16 E6 ORF encodes a 158-amino-acid protein which has 57% homology with the HPV-18 E6 product (5). The latter is located in the nuclear as well as in the nonnuclear membrane fractions of infected cells (16), nonspecifically binds double-stranded DNA (27), and has a zinc-binding activity conferred by four repeated regularly spaced cysteine motifs (Cys-X-X-Cys) commonly found in the E6 proteins of all the papillomaviruses sequenced so far (2). The involvement of these cysteine residues in E6mediated transformation has been well documented for bovine papillomavirus type 1 (BPV-1) (50). The BPV-1 E6 protein has only moderate amino acid homology with the homologous proteins encoded by HPVs and, unlike them, is able by itself to transform the established rodent cell line C-127 (43, 53). It has recently been demonstrated that a chimeric protein containing the BPV-1 E6 protein linked to a truncated BPV-1 E2 protein, including the DNA-binding domain without the transactivating domain, activates a reporter plasmid containing E2-binding elements. Moreover, it has been suggested that the transforming and transactivation functions of the BPV-1 E6 protein are related, since mutants defective for transformation are also defective for transactivation (22). In this report, using a transient-cotransfection assay in NIH 3T3 cells, we showed that the entire E6 protein from HPV-16 activated the promoter of the herpes simplex virus (HSV) thymidine kinase (TK) gene at the transcriptional level and in a dose-dependent manner. In addition, the E6 protein also increased transcription from five heterologous viral class II promoters (HPV-16 p97, human immunodeficiency virus [HIVI long terminal repeat [LTR], adenovirus major late, adenovirus E2, and SV40 early), all of which (except the adenovirus E2 promoter) lack enhancer se-

Human papillomaviruses (HPVs) are small DNA viruses that induce epithelial cell hyperproliferation. Among the 66 HPV genotypes identified so far, about one-third have been found in anogenital lesions. This class of viruses can be further divided into two groups: the low-risk HPVs, including HPV type 6 (HPV-6) and HPV-11, are associated with benign condylomas, whereas the high-risk HPVs have been detected in 90% of anogenital cancers, the most prevalent type being HPV-16 and, to a lesser extent, HPV-18 (for reviews, see references 7 and 55). The ability of the cloned high-risk viral DNAs to transform rodent cells (54) and to immortalize primary human keratinocytes (37) suggests that these HPV types play a causative role in the induction of anogenital tumors. In human genital cancers and in carcinoma-derived cell lines, HPV DNA is usually found integrated into the host genome (44). This integration often interrupts the El and E2 open reading frames (ORFs) and disrupts the 3' viral ORFs. As a result, generally only the 5' noncoding regulatory long control region (LCR) and the early E6/E7 ORFs are intact. E6 and E7 proteins are expressed (1, 45), indicating that these two functions are essential for HPV-associated carcinogenesis. Direct support for this hypothesis comes from studies that demonstrate that both E6 and E7 are required to immortalize primary human keratinocytes in culture (18, 31, 51). Moreover, proliferation of HPV-positive cervical carcinoma cell lines appears to be linked to E6/E7 expression (4). The functions of E6 are not well documented, although it has recently been shown that the E6 protein of the high-risk but not of the low-risk HPV types can bind to the cellular p53 protein (52), a property shared by the adenovirus type 5 (Ad5) Elb and simian virus 40 (SV40) T proteins (for a review, see reference 23). Moreover, HPV-16 and HPV-18 E6 proteins have been shown to promote in vitro ubiquitin*

Corresponding author. 325

326

J. VIROL.

DESAINTES ET AL.

TABLE 1. CAT plasmids used in this study Plasmid

pBLCAT2 flLCR-TK-CAT 3'LCR-TK-CAT

5'LCR-TK-CAT flLCR-CAT 3'LCR-CAT pTK-109 (TKM) pTK-109DTA pTK-80 pTK-50 pTK-5ODTA pTK-109m pTK-109mDTA pSV2CAT pSVlCAT PEC113 pML-44 p97CAT HIV WT574 HIV NTATA HIV DTATA HIV Dk HIV DTADk

Promoter

TK HPV-16 LCR (TK) HPV-16 LCR (TK) HPV-16 LCR (TK) HPV-16 LCR p97 HPV-16 LCR p97 TK TK TK TK TK TK TK SV40 early SV40 early Adenovirus E2 Adenovirus major late HPV-16 p97 HIV LTR HIV LTR HIV LTR HIV LTR HIV LTR HIV LTR

Sequences'

-105 to +51 -997 to +19* -537 to +19* -851 to -556* -997 to +19* -537 to +19* -109 to +55 -109 to +55 -80 to +55 -46 to +55 -46 to +55 -109 to +55 -109 to +55 -263 to +60 -138 to +60 -285 to +40 -44 to +11 -72 to +15 - 177 to +80 -177 to +80 -453 to +80 -453 to +80 -453 to +80 -57 to +80

Point mutation(s)b

TATA TATA 2GC + CAAT 2GC + CAAT + TATA

TATA TATA NF-KB TATA + NF-KB

Reference

26 This study This study This study This study This study 49 This study 17 17 This study 17 This study 15 15 20 17 This study 12 12 32 32 32 39

pU3R-57 "Numbering is relative to the cap site except for entries marked with an asterisk, for which numbers refer to distance relative to the p97 promoter. b2GC indicates mutations in both GC sites.

by which E6 mediated transactivation was investigated by using TK and HIV LTR promoters that contained mutations within upstream regulatory elements and/or the TATA sequence. The results suggest that E6 may behave like a coactivator by interacting with upstream regulatory elements (GC/CAAT and NK-KB) and elements of the transcription initiation complex. quences. The mechanism

MATERIALS AND METHODS Cells. NIH 3T3 cells were grown in Dulbecco's modified Eagle's medium containing 10% newborn calf serum supplemented with penicillin (100 U/ml) and streptomycin (100 jig/ml). Cells were plated at a density of 6.4 x 103 cells per cm2 and allowed to grow for 24 h before transfection. Plasmids. pSV2E6 was constructed in two steps. An E6 DdeI fragment (nucleotides [nt] 24 to 654) was isolated from the original HPV-16 genome (9), filled in with Klenow fragment, and inserted into the HindIl site of a modified pUC18 plasmid. Restriction of the resulting plasmid with Hindlll and SmaI, two enzymes that cut at the 5' and 3' ends, respectively, of the E6 ORF, was used to excise E6. This fragment was subsequently cloned into pSV2neo (14) in place of the HindIII-SmaI neo gene fragment, generating pSV2E6. pSV2A6 was constructed by inserting a bluntended DraII-DdeI fragment (nt 112 to 654) in an antisense orientation respective to the promoter into the blunt-ended HindIII-SmaI sites of pSV2neo. A translation termination linker was introduced at the beginning of the E6 ORF by joining an E6 PpuMI-DdeI fragment (nt 111 to 654) to an oligonucleotide linker, regenerating the 5' end of E6 with a point mutation at nt 110 (upper strand, 5'-CTAGATCTC GAGTTAACTGCAATGTTTTAG). The mutated E6 gene was cloned downstream of the Rous sarcoma virus (RSV) LTR promoter, replacing the HindIII-BalI chloramphenicol acetyltransferase (CAT) gene fragment from RSVcat (14), generating RSVMUE6. Positive clones were confirmed by

DNA sequencing. For RSVE6 construction, an oligonucleotide linker reconstituting the wild-type 5'. E6 sequence from nt 104 to 110 (upper strand, 5'-GGGGTACCGCAATGTT TCAG) was ligated to the PpuMI-DdeI E6 fragment (nt 111 to 654) and transferred into RSVcat as described for RSVMUE6. E6BS was constructed by ligating a blunt-ended HPV-16 E6 DdeI fragment (nt 24 to 654) to the HindIIrestricted Bluescribe plasmid. A DraII restriction fragment from this vector, containing HPV-16 promoter sequences between nt 24 and 111, was inserted into the XhoI site of pBLCAT3 (26), generating p97CAT. The CAT reporter plasmids used in this study are detailed in Table 1. Plasmids pTK-109DTA and pTK-109mDTA were constructed by the asymmetric polymerase chain reaction (PCR) method (36). In the initial amplification, plasmids pTK-109 and pTK-109m were hybridized separately with a mutant primer (5'-GCGTCACCAGGGCATGCGAAGTG GA), in which the wild-type ATATTAA sequence was replaced by ATGCCCT, and a wild-type primer (5'-GGCAT CAGTCGACCAAGCTTATAGA), matching polylinker sequences (SalI-HindIII-XbaI) located just upstream of the TK promoter. The single-stranded 128-nt amplified fragments were purified and used as 5' primers in the second PCR reaction in combination with DNA templates (pTK-109 and pTK-109m) and a 3' wild-type primer (5'-GCCAAGCTCCT CGAGATCTGCGGCA) that perfectly matched sequences downstream of the TK promoter (position +55). The 210-bp amplified fragments were digested with Hindlll and BglII and subsequently cloned into the HindIII-BglII-restricted pTK-109 and pTK-109m plasmids to yield pTK-109DTA and pTK-109mDTA, respectively. pTK-5ODTA has the same mutation within the TATA box and was constructed in the same way as the two other TATA box-mutated TK promoters, except that only one PCR amplification was performed on pTK-50 sequences with the same 3' primer and a 5' mutant oligonucleotide (5'-GACCAAGCTTATAGAGGTC

VOL. 66, 1992

HPV-16 E6 PROTEIN ACTS AS A TRANSACTIVATOR

CGAGGTCCACTTCGCATGCCCTGGTGACGCG) spanning from the polylinker sequences to nt -11. Inserts were sequenced with a T7 sequencing kit (Pharmacia). LCR-TK-CAT plasmids were constructed in two steps. HPV-16 was digested with AvaII, filled in with Klenow fragment, and further restricted with PstI or SphI. The respective 1,016-bp and 556-bp LCR fragments (nt 7005 to 115 for PstI-AvaII and nt 7465 to 115 for SphI-AvaII) were isolated and ligated to the PstI-XhoI (blunt-ended) or SphIXhoI (blunt-ended) sites of pBLCAT3, generating flLCRCAT and 3'LCR-CAT, respectively. From these plasmids, LCR fragments were excised with XhoI and PstI or SphI digestion and subcloned upstream of the TK promoter into the PstI-Sall (blunt-ended) or SphI-SaIl (blunt-ended) sites of pBLCAT2, generating flLCR-TK-CAT and 3'LCR-TKCAT, respectively. 5'LCR-TK-CAT was obtained by cloning a 295-bp AluI LCR fragment (nt 7151 to 7446) into the Sall (blunt-ended) site of pBLCAT2. TK-CATBS was generated by cloning a HindIII-PvuII fragment from pBLCAT2 (26) (nt 399 to 751) into the HindIII-SmaI sites of Bluescribe. Vectors that express Ela 13S (pSVN20) (47), Ela 12S (pSVF12) (47), and HSV ICPO (pSHZ) (32) have been described elsewhere. Transfections. Calcium phosphate coprecipitates of plasmid DNAs purified by double CsCl gradient centrifugation were prepared by the method of Gorman (14) and allowed to stand on the cells for 18 h. Bluescribe DNA was used to adjust the DNA content to 15 ,ug per 100-mm dish. Cells were harvested 44 to 48 h after transfection. Cell extracts were prepared by three cycles of freeze-thawing in 250 mM Tris-HCl (pH 7.8), followed by heating at 65°C for 5 min and centrifugation at 14,000 x g for 10 min. The protein concentration of the extracts was determined by using a kit that measures the formation of a pyrogallol molybdate complex (Sopachem; Sopar-Biochem, Brussels, Belgium). CAT assays. From 5 to 20 ,ug of total proteins was incubated with 2 ,1u of ['4C]chloramphenicol (50 mCi/mmol) and 20 ,ul of 4.2 mM acetyl coenzyme A in 150 p.1 of 250 mM Tris-HCI (pH 7.8) for 1 to 3 h at 37°C. The products of the acetylation reaction were separated by thin-layer chromatography. Acetylated and nonacetylated spots were cut and quantitated by liquid scintillation counting. RNA extraction. Total RNA was extracted by lysis in 4 M guanidium isothiocyanate (28). Briefly, the lysate was layered over a cushion of 5.7 M CsCI-0.1 M EDTA (pH 6.5) and centrifuged overnight at 42,000 rpm in an SW50.1 Beckman rotor. RNA pellets were resuspended in TE (10 mM TrisHCl [pH 7.4], 1 mM EDTA) and ethanol precipitated twice. RNase protection. Complementary TK-CAT and E6 RNA probes were synthesized by incubating linearized TKCATBS and E6BS plasmids with T7 or T3 RNA polymerase, respectively, in 25 ,ul of a reaction mixture containing [32P]UTP (800 Ci/mmol). Five micrograms of total RNA, or tRNA as a negative control, was hybridized overnight to 105 cpm of complementary TK-CAT or E6 32P-labeled riboprobes at 45°C in a PIPES [piperazine-N,N'-bis(2-ethanesulfonic acid)] buffer as described by Sambrook et al. (40). RNase digestion was performed at 30°C for 60 min. Protected fragments were separated on a 6% (TK-CAT) or 5% (E6) polyacrylamide-7 M urea denaturing gel. RESULTS E6 transactivates the HSV TK promoter, but no E6-recognized enhancer element is found in the HPV-16 LCR. It has previously been reported that a 388-bp fragment located at

Li Put I Alu I

70o0

HPV 16 LCR

E6

Avall

Alu I

7500

327

790611

pSV2A6

100

PSV2E6

* E2 RE

IIIIfLCR-TK-CAT

10.6

CrrLMTKCA

4.90

5'LCR-T*KCAT

T

pBLCAT2 a TK pmOftw

Induction

6.60 10.8

0 10 20 30 40 %

convrmion

FIG. 1. Effect of the HPV-16 E6 protein on the activity of the HPV-16 LCR. Schematic illustration of the HPV-16 LCR subfragments cloned upstream of the TK promoter into pBLCAT2. The arrow indicates the p97 promoter. Reporter plasmid DNAs (5 ,ug) were transiently cotransfected into NIH 3T3 cells with 5 p.g of pSV2E6 (E6 in sense orientation) or pSV2A6 (E6 in antisense orientation). CAT activities are expressed as percent chloramphenicol converted by one-fifth of total cellular extracts in a 1-h assay and represent the means of triplicate transfections. Induction is shown as the ratio between the percent conversion obtained with pSV2E6 and pSV2A6. Standard deviations for the E6-induced CAT activities ranged from 6.6 to 25%.

the 5' boundary of the HPV-18 LCR responds to the viral E6 gene product in NIH 3T3 cells (13). Initially, we intended to extend these observations to HPV-16. The entire HPV-16 LCR (flLCR-TK-CAT) or LCR subfragments (3'LCR-TKCAT and 5'LCR-TK-CAT, the latter being equivalent to the 388-bp E6-responsive element described for HPV-18) were cloned upstream of the basal HSV TK promoter into pBLCAT2 (Fig. 1). Transient cotransfections of the LCRTK-CAT reporter plasmids into NIH 3T3 cells with pSV2E6 (HPV-16 E6 in a sense orientation) resulted in a substantial increase in CAT activity (4.9- to 10.6-fold) compared with cotransfections with pSV2A6 (E6 in an antisense orientation). Induction by E6 of the different LCR-TK-CAT plasmids never exceeded that observed with pBLCAT2 (10.8fold). However, this plasmid, which contains the TK promoter, was activated in a dose-dependent manner by the E6 product of HPV-16 (Fig. 2). As the heterologous promoter used in this system may already be fully activated by E6 and thus may be masking any potential E6-responsive element present in the LCR, we assayed the E6 inducibility of the HPV-16 LCR containing its p97 autologous promoter. Since the activity of the LCR was extremely low in NIH 3T3 cells, we used a human keratinocyte cell line (HaCaT), in which plasmids containing the entire LCR (flLCR-CAT) or a 5'-deleted version of the LCR (3'LCR-CAT) cloned upstream of the CAT gene were transiently cotransfected with various concentrations of pSV2E6 or pSV2A6. None of these LCR-CAT plasmids was activated by E6 (data not shown), suggesting that, unlike in the homologous HPV-18 LCR, no enhancer element recognized by the HPV-16 E6 protein could be detected in the HPV-16 LCR. The mRNAs produced by pSV2E6 in NIH 3T3 cells were analyzed by a quantitative RNase protection assay (Fig. 3). The splicing pattern (the full-length E6 mRNA representing 7% of total E6 transcripts) (lane 4) was similar to that observed in the human cervical carcinoma-derived CaSki cell line (lane 5) (48). pSV2E6 contained, downstream of the

J. VIROL.

DESAINTES ET AL.

328

0

0.5

2.5

5

9

0 pSV2E6

a

pSV2A6 2.2

5.8

10.8 ± 4.8

Induction

FIG. 2. Effect of the HPV-16 E6 protein on HSV TK promoter activity. NIH 3T3 cells, plated in 100-mm dishes, were transfected by the calcium phosphate coprecipitation method with 5 jig of pBLCAT2 and increasing amounts of pSV2E6 (sense) or pSV2A6 (antisense). Ten micrograms of total proteins was analyzed for CAT activity in a 2-h assay. Values given at the bottom are the ratios of the percent conversion with pSV2E6 and that observed with pSV2A6. They were calculated from at least triplicate transfections. The standard deviation was calculated from five independent experiments, each performed in triplicate.

E6 ORF, the first 92 bp of the E7 ORF (nt 562 to 654) and generated a major mRNA species that retained the potential to code for a short 29-amino-acid E7 peptide (the 216-nt plus 269-nt protected fragments). To exclude any possible transcriptional activation effect due to the NH2-terminal portion of the E7 protein, we constructed a vector that contained a translation termination linker at the 5' end of the E6 ORF (RSVMUE6). The CAT activity of pBLCAT2 cotransfected

with RSVMUE6 was not higher than that of pBLCAT2 transfected alone (data not shown). Moreover, the transcriptional activity of pBLCAT2 was induced sixfold after RSVE6 (wild-type E6 expressed from the RSV promoter) cotransfection compared with RSVMUE6 cotransfection (data not shown). These results indicated that E6 and not the NH2 end of E7 was responsible for the activation of pBLCAT2 by pSV2E6. The lower level of E6-mediated activation observed with RSVE6 (6-fold versus 10.8-fold with pSV2E6) could result from the reduced amount of E6 mRNAs transcribed from the RSV promoter (Fig. 3, compare lanes 2 and 3 with lane 4). To further confirm that E6-mediated activation of the TK promoter occurred at the transcriptional level, steady-state levels of specifically initiated CAT RNAs were measured by quantitative RNase protection analysis with a riboprobe complementary to the TK promoter and 5' end of the CAT gene (Fig. 4). NIH 3T3 cells were cotransfected with pBLCAT2 and the E6 expression plasmids. One-fifth of the cell suspension was used to monitor CAT activity (15 ,ug of total protein extract in a 2-h assay), and RNA was isolated from the rest. As shown in Fig. 4, most of the transcripts were initiated at the predicted site (represented by the 211-nt protected fragment), and the steady-state level of correctly initiated RNAs (lane 3 for pSV2E6, lane 4 for pSV2A6) was proportional to the corresponding CAT activities. E6 can activate transcription from several heterologous viral promoters. Some viral transactivators have been shown to modulate transcription of several promoters. The bestillustrated example is the adenovirus Ela protein, which can modulate the expression of both viral and cellular genes by a variety of mechanisms (for a review, see reference 34).

B

A 1 2

798nt ES 672 nt 528 nt

3 4 _V-o

5 . 672 nt _-560 nt

tr

.

L

.

~~E6

. .

E7 . ...

*r;

oi-

E6 probe 672 nt

_. :__

2 37 n1t

_

+ RNase

-269 nt -249 nt -216 nt

560nt

1 80 nt

aCSki

249 nt

672 nt

- I -..

29 nt

130 nt

.

NIH3T3 pSV2E6

573nit

4-129 nt

-- 122

nt

12rnt 580 n

269nt

NIH3T3 RSVMUFL6

FIG. 3. Quantitative mapping of E6 transcripts. (A) tRNA (lane 1) or RNA extracted from CaSki cells (lane 5) or from NIH 3T3 cells transiently transfected with either pSV2E6 (lane 4), RSVE6 (lane 3). or RSVMUE6 (lane 2) was hybridized to an E6 riboprobe and digested with RNase. The resulting protected fragments were resolved on a 5% polyacrylamide-7 M urea denaturing gel. The sizes of molecular size markers are indicated on the left, and those of the protected fragments are shown on the right. (B) Map of the probe and interpretation of the RNase digestion products. The numbers 226 and 409 correspond to the map positions of the predicted donor and acceptor splice signals, respectively.

VOL. 66, 1992

HPV-16 E6 PROTEIN ACTS AS A TRANSACTIVATOR

1 2

3 4 5

528 nt d

TK 373 nt -

237 nt

-

211 nt __

180 nt

*

-

FIG. 4. Effect of E6 on CAT transcripts specifically initiated from the HSV TK promoter. tRNA (lane 5) or RNA extracted from NIH 3T3 cells transiently cotransfected with pBLCAT2 in combination with pSV2E6 (lane 3) or pSV2A6 (lane 4) was hybridized to a 373-nt TK-CAT complementary riboprobe and digested with RNase. The resulting protected fragments were resolved on a denaturing 6% polyacrylamide gel. Lanes 1 and 2 represent the TK-CAT probe and the RNA molecular size markers, respectively. The arrow marks the expected 211-nt protected fragment originating from a transcript initiated at the predicted site.

E6-mediated transcriptional activation was tested on six viral TATA-containing promoters not known to contain enhancer elements except for the adenovirus E2 promoter. The TATA boxes of these promoters can be classified into four groups: (i) the perfect ATATAA match present in the HIV LTR, HPV-16 p97, and adenovirus major late promoters, (ii) the TATTA present in the HSV TK promoter, (iii)

329

the TATTTA present in the SV40 early promoter, and (iv) the pseudo-TATA box of the Ad5 E2 promoter. In addition to the TATA box, four promoters tested (HPV-16 p97, TK, SV40 early, and HIV LTR) possess one or more Spl recognition sites. The reporter plasmids were cotransfected into NIH 3T3 cells with either pSV2E6 or pSV2A6. The basal activities of all the reporter plasmids were similar except for the HIV LTR-CAT construct, which showed approximately a 20-fold higher basal transcription (Fig. 5). All promoters were activated equally well by E6 (5.3- to 8.6-fold) with the exception of the Ad5 E2 promoter, which was induced 30-fold, a result in accordance with the recent observations reported by Sedman et al. (46). This level of induction represented one-fifth of the induction observed with an Ela 13S expression plasmid (pSVN20) included as a positive control in our experiments (data not shown). The finding that the HPV-16 p97 promoter was activated by E6 in NIH 3T3 cells but not in HaCaT cells suggested that E6mediated transactivation might be cell type specific. These results indicated that E6 activated a whole range of eukaryotic promoters containing different upstream regulatory and TATA sequences. However, we could not distinguish between activation by E6 through a common upstream factor, such as Spl (whose recognition sequence is present in four of the promoters tested), or through an element of the basal transcriptional machinery, such as TFIID or the RNA polymerase II itself. We investigated these points further by using promoters with mutated upstream regulatory elements and modified TATA boxes. Both upstream regulatory elements and the basal transcription machinery are required for full E6-mediated activation of transcription. The TK promoter driving the expression of the CAT gene in pBLCAT2 contains sequence elements known to be important for transcription, such as the TATA, GC, and CAAT boxes (29). These motifs were either mutated or

Fold -109 d

O pSV2A6 I pSV2E6

Spl

Spl i

55

ATATrAA

+ 80

ATATAA

.

Spl -57^ Spl E2 -n 8MV -44 3

+1s

TATAAAA

L+11

TATAAAA

Sp4

-138. @@see

A28STED

v

r

t

60 +4

TATITAT

GTCCTrAAA

HSV TK HI-V LTR HPV 16 Ad ML

SV40early Ad E2

i-

6.5 5.3 5.5 8.6 6.6 29.8

_~~

6 6 6 n 0 0%

4 A

a a

I

I

12

60

Conversion (%0)

FIG. 5. E6-mediated transactivation of heterologous viral promoters. Schematic illustration of the viral promoters that were cloned upstream of the bacterial CAT gene is shown on the left. Numbers refer to distance from the RNA start site (arrow). The known upstream regulatory elements are also indicated. Solid triangles represent the TATA boxes, whose sequences are shown. The reporter plasmids were transiently cotransfected into NIH 3T3 cells with pSV2E6 or pSV2A6. CAT activities are expressed as percent chloramphenicol converted by 20 p.g of total proteins in a 3-h assay and represent the means of triplicate transfections. Induction is shown by the ratio between the percent conversion obtained with pSV2E6 and with pSV2A6. Standard deviations ranged between 8 and 40%. Ad, adenovirus; ML, major late promoter.

J. VIROL.

DESAINTES ET AL.

330

Relatve CAT activities

Fold induction GC CAAT GC

TATA

pTK-109 -109

-80

-40

0

_

0

GC CAAT 8.6

0

-,

*-J4pTK -80 *

|I

.

P

pTK -50

0

13.0

0

0

7.7

S

4.0

_

:

TATA

A **

+ I

A

GC

- so

- 109

*

r*

-40

A6

E6

100

350

13

200

-109mn

10

32

pTK -1O9mDTA

26

40

pTK -50

13

40

pTK -109

+1

~

pTK-109DTA

*

pTK-109m

-

pTK

pSV2A697 -

pSV2E6

FIG. 6. Role of the GC and CAAT elements in E6-mediated transactivation of the TK promoter. Schematic illustration of the HSV TK promoter (pTK-109) and its truncated forms is shown on the left. Numbers refer to distance from the transcription initiation site (arrow). Mutations of upstream regulatory elements are indicated by the omission of the corresponding symbols. Reporter plasmids were transiently cotransfected into NIH 3T3 cells with pSV2E6 or pSV2A6 (pSV2A697). CAT analysis was performed with 30 ju.g of total proteins in a 3-h assay. Induction values are the ratios between the percent conversion obtained with pSV2E6 and with pSV2A6. Standard deviations ranged from 6 to 37%.

eliminated by 5' deletions of TK promoter sequences present in pTK-109, and the resulting truncated TK plasmids were cotransfected into NIH 3T3 cells with pSV2E6 or pSV2A6 (Fig. 6). The pTK-109 plasmid used in these experiments had a basal activity 6.5-fold lower than that of pBLCAT2 (data not shown) but retained a similar level of E6 inducibility (8.6-fold). Deletions removing the most distal of the two GC motifs and the CAAT box (pTK-80) or the three sites together (pTK-50) did not considerably alter the level of E6-dependent induction (13- and 7.7-fold activation, respectively). pTK-109m (TK promoter containing site-directed mutations within the two GC and CAAT boxes) was also inducible by E6, although at a lower level (fourfold). Relating the CAT activities to P-galactosidase activities (used to monitor the transfection efficiency of pSV2,-gal-cotransfected dishes) indicated similar levels of E6-mediated activation with the various TK promoters (3.6-fold for pTK-109, 4.2-fold for pTK-80, 3.8-fold for pTK-50, and 5.0-fold for pTK-109m). However, the basal CAT activities of the modified TK promoters were approximately three times lower than that of the wild-type TK promoter, and E6 did not restore the maximal E6-induced activity observed with the wild-type promoter. Since TK promoters which retained only a TATA box as known regulatory element (pTK-50 and pTK-109m) were still inducible by E6, we looked at the possible involvement of the TATA sequence by examining the response to E6 of various truncated TK promoters containing mutations within the TATA box (Fig. 7). Mutations altering the TATA box in the wild-type promoter (pTK-109DTA) affected the basal activity, which dropped about eightfold. In contrast, E6 could almost completely restore the level of E6-induced CAT activity observed with the wild-type promoter and led to a 16-fold activation of the TATA box-mutated promoter compared with its basal activity. When the GC and CAAT elements were altered (pTK-109m and pTK-50), the basal activity dropped 10-fold, and the truncated promoters still responded to E6. However, the levels of E6-induced CAT activity of these truncated promoters remained 10 times

*

r r+

13 32 pTK-5ODTA FIG. 7. Role of the GC, CAAT, and TATA elements in E6mediated transactivation of the TK promoter. A schematic illustration of the truncated TK promoters is shown on the left. Mutations of upstream regulatory elements and TATA box are indicated by the omission of the corresponding symbols. The reporter plasmids were cotransfected into NIH 3T3 cells with pSV2E6 or pSV2A6. The whole-cell extract was used in a 3-h CAT assay. Values were normalized to those observed with the wild-type pTK-109 in the presence of pSV2A6 and represent the means of duplicate transfections. Standard deviations ranged from 2 to 44%.

lower than that of the wild-type promoter. Results obtained with mutants in which both the GC/CAAT and TATA elements (pTK-109mDTA and pTK-50DTA) were affected showed that when the TATA box was mutated, E6 could restore a full level of induced CAT activity only if the GC/ CAAT sites were intact. In order to determine whether the mechanism of E6mediated transactivation was a unique characteristic of the TK promoter or was a general feature of E6-activated promoters, we tested the E6 induction of a series of HIV LTR-CAT reporter plasmids containing single mutations within the TATA sequence (DTATA and NTATA) or the two NF-KB sites (Dk) or double mutations within both the TATA and the NF-KB elements (DTADk) (Fig. 8). The two different mutations in the TATA box resulted in a drop in basal CAT activity but did not abolish E6 induction (5-fold for the wild type, 3.5-fold for NTATA, and 10.2-fold for DTATA). This last plasmid could almost completely recover the full level of wild-type E6-induced transcription. In these experiments, we also included the adenovirus Ela and HSV ICPO viral proteins, which have been shown to transactivate the HIV LTR promoter, the former through the TATA box and the latter independently of the TATA box (32). Both Ela 13S (pSV2N20) and Ela 12S (pSVF12) failed to activate transcription from the TATA-mutated HIV promoter (data not shown), whereas HSV ICPO (pSHZ) activated DTATA about 20-fold, a result in accordance with those reported by Nabel et al. (32). The induction by E6 corresponded to 50 to 64% of that observed with ICPO. To assess the importance of the NF-KB sites, the HIV LTR promoter containing mutations within these elements (Dk) was assayed for CAT activity and was found to respond to E6, although at a lower level (60% of the wild-type level). When both NF-KB sites and the TATA box were mutated (DTADk), the basal

VOL. 66, 1992

HPV-16 E6 PROTEIN ACTS AS A TRANSACTIVATOR

Reativ CAT

kB Spl

BMnW 453

-177

+1

+80

C mm

wr

m

ATATAA

AAAAAA I cat NTATATA

1

A6

E6

ICPO

1

5

ND

Q2 Q7

ND

ATATAA

.1

32 5.0

C< DTATA IAGCGCA

0.4

41 S .2 0.2

my

nfw

activ

HIV LTR

Dk

FDale

IyrADfl

AGCGCA

0

FIG. 8. Role of the TATA box and the NF-K B sites in E6mediated transcriptional activation of the HIV type 1 LTR. Schematic illustration of the HIV LTR is shown at the top. Numbers refer to distance from the transcription initiation site (+1). The inverted triangle represents the TATA box. The biinding sites for Spl and NF-KB are indicated by ovals and rectangle s, respectively, The LTR-CAT plasmids are depicted on the left. Thie sequences of the wild-type and mutated TATA boxes are shovvn in the box. Mutations of upstream regulatory elements are in dicated by the omission of the corresponding symbols. The reporter transiently cotransfected into NIH 3T3 cells with pSN or pSHZ (ICPO). CAT activities were normalized to those observed with the wild type (WT) in the presence of pSV2Af6 and represent the means of triplicate transfections. Standard de)viations ranged from 2.5 to 27%.

V2E6l pSV2A6m

activity of this promoter dropped to a very kcw level, and only weak activation by E6 was observed (twi ofold). DISCUSSION

In the present study, we showed that the e ntire HPV-16 E6 protein activated transcription from the TI C promoter in a dose-dependent manner after transient expre-ssion in NIH 3T3 cells. Furthermore, E6 could also increase transcription from five viral class II promoters, e.g., HPV -16 p97, HIV LTR, adenovirus major late, SV40 early, and a(denovirus E2. Since five of the six viral promoters inducible by E6 had no known enhancer sequences, and since we coul d not identify any specific E6-responsive enhancer element iin the HPV-16 LCR, we postulated that E6 might be int( eracting with elements common to minimal promoters. Suclh interactions could be due to (i) binding of E6 to a spec ,ific upstream regulatory element, such as the GC and CA)AT boxes, or interaction with the transcription factors (SPI1, CTF/NF-1) that recognize these sequences; (ii) binding of E6 to the TATA box, or interaction with TATA-binding factors such as TFIID; or (iii) coactivation through bridgiing of cellular transcription factors bound to upstream regulaltory elements with components of the transcription preinitiattion complex. Regarding the first hypothesis, we tested E6-mediated activation on a series of TK-CAT plasmids that contain mutations and deletions affecting the GC and C'AAT motifs. The CAAT box is a binding site for several factiors, including CTF/NF-1 (41). The GC box is found in singl le or multiple copies in many cellular and viral promoters (f our of the six viral promoters inducible by E6 contain GC bo Ixes [HPV-16, HIV LTR, HSV TK, SV40 early]) and is kriown to be a specific target for several transcription factors, most notably Spl (10) and also AP-2 (30), LSF (19), and p53 (3). The best-characterized GC box-binding factor is th e Spl protein. Upon binding to its recognition sequence, Spli interacts with specific coactivators. The complex formed by these factors

331

activates transcription through interactions with the basal transcription machinery (38). It has recently been shown that Spl interacts with the BPV-1 E2 protein (which modulates papillomavirus transcription upon binding to its recognition site; for a review, see reference 8) to synergistically enhance E2-mediated transactivation of an E2-responsive promoter (24). However, Ham et al. (17) have suggested that the BPV-1 E2 protein can interact not only with Spl but also with USF, another cellular transcription factor. In our experiments, E6 did behave like E2 in the sense that mutations or deletions eliminating the two GC and CAAT elements of the TK promoter (pTK-109m and pTK-50) caused a 10-fold drop in the level of E6-induced CAT activity. However, even when upstream regulatory elements were missing in the TK promoter, transcription was still activated by E6, suggesting that the target could be a more proximal element, like the TATA motif. Binding of TFIID to the TATA box (33) initiates the ordered assembly of the other general transcription factors, such as TFIIA, TFIIB, TFIIE/F, and the RNA polymerase II itself, allowing this multicomponent complex to enter into active transcription. The role of the TATA motif in the activation of transcription has been well documented for at least two viral transactivators that do not bind directly to a specific DNA recognition element. The HSV ICPO protein transactivates the HIV LTR promoter independently of the TATA motif (32), whereas the adenovirus Ela-mediated transactivation of some cellular and viral promoters, such as those of c-fos, hsp-70, adenovirus Elb, and HIV LTR, requires the TATA box and especially needs a specific TATA box element in which the sequence is TATAA (for a review, see reference 34). Such TATA sequence specificity was not observed with E6, since it could activate promoters containing different TATA motifs. Furthermore, point mutations within the TATA box of the HIV LTR or TK promoter, while reducing the level of basal transcription, did not change the level of E6-induced transcription. These results indicated that E6, like ICPO, could compensate for the loss of TFIID binding to its recognition site and suggested that E6 might interact with the transcription initiation complex to anchor it properly to the promoter and to potentiate its assembly, its stability, or its activation. To clarify whether the downstream interaction of E6 with the basal transcription apparatus and the upstream interaction with the GC and CAAT elements were related, we used reporter plasmids containing mutations within both upstream regulatory elements and the TATA box. The observations that TATA box-mutated TK and HIV LTR promoters recovered full wild-type E6-induced transcriptional activity only when their respective upstream regulatory elements (GC/CAAT and NF-KB) were intact suggested that E6 acted as a coactivator, possibly by contacting upstream transcription factors and elements of the basal transcription complex. The question of the identity of the general transcription factors that might interact with E6 remains. Likely candidates for such an interaction would be the TATAbinding TFIID or TFIIB factors. Both have been shown to bind to the potent acidic activation domain of the HSV VP16 protein (21, 25). Binding of VP16 to these two general transcription factors correlates with its transcriptional activation property, since a mutation within the acidic domain that alters the critical phenylalanine residue at position 442 eliminates both transcriptional activation and TFIIB- and TFIID-binding properties (21, 25). Interestingly, transcriptional activators of several classes (Spl, GCN4, CTF, etc.) contain hydrophobic amino acids arranged in patterns re-

332

DESAINTES ET AL.

sembling that of VP16 around phenylalanine residue 442 (6). Examination of E6 sequences from HPV-16 and HPV-18 revealed a similar arrangement of hydrophobic amino acids within the third Cys-X-X-Cys motif. We are currently testing the importance of these residues for E6 transactivation. Further studies will be necessary to elucidate the role of E6 transactivation in the immortalization process. Since E6 binds and degrades the tumor suppressor p53 protein (42), it is tempting to speculate that inactivation of p53 might lead to deregulated cellular growth. It is interesting, however, that wild-type p53 contains an activator domain (11, 35) and binds to specific DNA sequences (3). Therefore, it is not excluded that E6 might mediate its transactivating activity through binding to p53. Possible mechanisms would involve (i) reduction of available cellular transcription factors by p53, either through transcriptional regulation of their expression or through their inactivation (protein-protein interactions) and (ii) binding of p53 to upstream DNA-regulatory elements and thus blocking of their access to their corresponding transcription factors. In both cases, destruction of p53 by E6 would result in an increase of the level of active transcription factors and/or their target DNA sites, leading to a general activation of transcription. Whether these three functions of E6 (binding to p53, immortalization, and trans-

activation) are related remains to be elucidated.

ACKNOWLEDGMENTS We thank N. Dostatni for the TK-CAT plasmids (pTK-109, pTK-80, pTK-50, and pTK-109m). We are particularly grateful to F. Thierry and M. Sitbon for valuable suggestions and critical reading of the manuscript. We thank S. Gonzales and M. Wathelet for critical comments during the redaction of this article. We also thank N. Dostatni and E. Verdin for fruitful discussions concerning this work. C.D. was supported by a grant from the Fonds National de la Recherche Scientifique (operation Televie). This work benefited from the financial support of the Lefebvre Foundation and the Yvonne Boel Foundation. REFERENCES 1. Baker, C. C., W. C. Phelps, V. Lingren, M. J. Braun, M. A. Gonda, and P. M. Howley. 1987. Structural and transcriptional analysis of human papillomavirus type 16 sequences in cervical carcinoma cell lines. J. Virol. 61:962-971. 2. Barbosa, M. S., D. R. Lowy, and J. T. Schiller. 1989. Papillomavirus polypeptides E6 and E7 are zinc-binding proteins. J.

Virol. 63:1404-1407. 3. Bargonetti, J., P. N. Friedman, S. E. Kern, B. Vogelstein, and C. Prives. 1991. Wild-type but not mutant p53 immunopurified proteins bind to sequences adjacent to the SV40 origin of replication. Cell 65:1083-1091. 4. Bosch, F. X., E. Schwarz, P. Boukamp, N. E. Fusenig, D. Bartsch, and H. zur Hausen. 1990. Suppression in vivo of human papillomavirus type 18 E6-E7 gene expression in nontumorigenic HeLa x fibroblast hybrid cells. J. Virol. 64:4743-4754. 5. Cole, S. T., and 0. Danos. 1987. Nucleotide sequence and comparative analysis of the human papillomavirus type 18 genome: phylogeny of papillomaviruses and repeated structure of the E6 and E7 gene products. J. Mol. Biol. 193:599-608. 6. Cress, W. D., and S. J. Triezenberg. 1990. Critical structural elements of the VP16 transcriptional activation domain. Science 251:87-90. 7. de Villiers, E.-M. 1989. Heterogeneity of the human papillomavirus group. J. Virol. 63:4898-4903. 8. Dostatni, N., I. Giri, R. Sousa, F. Thierry, and M. Yaniv. 1989. Mechanisms of activation or repression of viral transcription by the E2 product of papillomaviruses, p. 165-180. In L. P. Villareal (ed.), Common mechanisms of transformation by small DNA tumor viruses. American Society for Microbiology, Wash-

J. VIROL.

ington, D.C. 9. Durst, M., L. Gissmann, H. Ikenberg, and H. zur Hausen. 1983. A papillomavirus DNA from a cervical carcinoma and its prevalence in cancer biopsy samples from different geographic regions. Proc. Natl. Acad. Sci. USA 80:3812-3815. 10. Dynan, W. S., and R. Tjian. 1983. The promoter-specific transcription factor Spl binds to upstream sequences in the SV40 early promoter. Cell 35:79-87. 11. Fields, S., and S. K. Jang. 1990. Presence of a potent transcription activating sequence in the p53 protein. Science 249:10461051. 12. Garcia, J. A., D. Harrich, E. Soultanakis, F. Wu, R. Mitsuyasu, and R. B. Gaynor. 1989. Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation. EMBO J. 8:765-778. 13. Gius, D., S. Grossman, M. A. Bedell, and L. A. Laimins. 1988. Inducible and constitutive enhancer domains in the noncoding region of human papillomavirus type 18. J. Virol. 62:665-672. 14. Gorman, C. M. 1985. High-efficiency gene transfer into mammalian cells, p. 143-190. In D. M. Glover (ed.), DNA cloning, vol. II: a practical approach. IRL Press, Oxford. 15. Gorman, C. M., L. F. Moffat, and B. H. Howard. 1982. Recombinant genomes which express chloramphenicol acetyltransferase in mammalian cells. Mol. Cell. Biol. 2:1044-1051. 16. Grossman, S. R., R. Mora, and L. A. Laimins. 1989. Intracellular localization and DNA-binding properties of human papillomavirus type 18 E6 protein expressed with a baculovirus vector. J. Virol. 63:366-374. 17. Ham, J., N. Dostatni, F. Arnos, and M. Yaniv. 1991. Several different upstream promoter elements can potentiate transactivation by the BPV-1 E2 protein. EMBO J. 10:2931-2940. 18. Hawley-Nelson, P., K. H. Voudsen, N. L. Hubbert, D. R. Lowy, and J. T. Schiller. 1989. HPV-16 E6 and E7 proteins cooperate to immortalize human foreskin keratinocytes. EMBO J. 8:39053910. 19. Huang, H.-C., R. Sundseth, and U. Hansen. 1990. Transcription factor LSF binds two variant bipartite sites within the SV40 late promoter. Genes Dev. 4:287-298. 20. Imperiale, M. J., R. P. Hart, and J. R. Nevins. 1985. An enhancer-like element in the adenovirus E2 promoter contains sequences essential for uninduced and Ela-induced transcription. Proc. Natl. Acad. Sci. USA 82:381-385. 21. Ingles, C. J., M. Shales, W. D. Cress, S. J. Triezenberg, and J. Greenblatt. 1991. Reduced binding of TFIID to transcriptionally compromised mutants of VP16. Nature (London) 351:588-590. 22. Lamberti, C., L. C. Morrissey, S. R. Grossman, and E. J. Androphy. 1990. Transcriptional activation by the papillomavirus E6 zinc finger oncoprotein. EMBO J. 9:1907-1913. 23. Levine, A. J., J. Mornand, and C. A. Finley. 1991. The p53 tumour suppressor gene. Nature (London) 351:453-456. 24. Li, R., J. D. Knight, S. P. Jackson, R. Tjian, and M. R. Botchan. 1991. Direct interaction between Spl and the BPV enhancer E2 protein mediates synergistic activation of transcription. Cell 65:493-505. 25. Lin, Y.-S., and M. R. Green. 1991. Mechanism of action of an acidic transcriptional activator in vitro. Cell 64:971-981. 26. Luckow, B., and G. Schutz. 1987. CAT constructions with multiple unique restriction sites for the functional analysis of eukaryotic promoters and regulatory elements. Nucleic Acids Res. 15:5490. 27. Mallon, R. G., D. Wojciechowicz, and V. Defendi. 1987. DNAbinding activity of papillomavirus proteins. J. Virol. 61:16551660. 28. McDonald, R. J., G. H. Swift, A. E. Przybyla, and J. M. Chirgwin. 1987. Isolation of RNA using guanidium salts. Methods Enzymol. 152:219-227. 29. McKnight, S. L., and R. Kingsbury. 1982. Transcriptional control signals of a eukaryotic protein-coding gene. Science 217:316-324. 30. Mitchell, P. J., C. Wang, and R. Tjian. 1987. Positive and negative regulation of transcription in vitro: enhancer-binding protein AP-2 is inhibited by SV40 T antigen. Cell 50:847-861. 31. Munger, K., W. C. Phelps, V. Bubb, P. M. Howley, and R.

VOL. 66, 1992

32. 33.

34. 35.

36. 37.

38. 39.

40. 41.

42.

43.

Schlegel. 1989. The E6 and E7 genes of the human papillomavirus type 16 together are necessary and sufficient for transformation of primary human keratinocytes. J. Virol. 63:4417-4421. Nabel, G. J., S. A. Rice, D. M. Knipe, and D. Baltimore. 1988. Alternative mechanisms for activation of human immunodeficiency virus enhancer in T cells. Science 239:1299-1302. Nakajima, N., M. Horikoshi, and R. G. Roeder. 1988. Factors involved in specific transcription by mammalian RNA polymerase II: purification, genetic specificity, and TATA box-promoter interaction of TFIID. Mol. Cell. Biol. 8:4028-4032. Nevins, J. R. 1989. Mechanisms of viral-mediated trans-activation of transcription. Adv. Virus Res. 37:35-83. O'Rourke, R. W., C. W. Miller, G. J. Kato, K. J. Simon, D.-L. Chen, C. V. Dang, and H. P. Koeffler. 1990. A potential transcriptional activation element in the p53 protein. Oncogene 5:1829-1832. Perrin, S., and G. Gilliland. 1990. Site-specific mutagenesis using asymmetric polymerase chain reaction and a single mutant primer. Nucleic Acids Res. 18:7433-7438. Pirisi, L., S. Yasumoto, M. Feller, J. Doniger, and J. A. DiPaolo. 1987. Transformation of human fibroblasts and keratinocytes with human papillomavirus type 16 DNA. J. Virol. 61:10611066. Pugh, B. F., and R. Tjian. 1990. Mechanisms of transcriptional activation by Spl: evidence for coactivators. Cell 61:1187-1197. Rosen, C. A., J. G. Sodroski, and W. A. Haseltine. 1985. The location of cis-acting regulatory sequences in the human T cell lymphotropic virus type III (HTLV-III/LAV) long terminal repeat. Cell 41:813-823. Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y. Santoro, C., N. Mermod, P. C. Andrews, and R. Tjian. 1988. A family of human CCAAT-box binding proteins active in transcription and DNA replication: cloning and expression of multiple cDNAs. Nature (London) 334:218-224. Scheffner, M., B. A. Werness, J. M. Huibregtse, A. J. Levine, and P. M. Howley. 1990. The E6 oncoprotein encoded by human papillomavirus type 16 and 18 promotes the degradation of p53. Cell 63:1129-1136. Schiller, J. T., W. C. Vass, and D. R. Lowy. 1984. Identification of a second transforming region in bovine papillomavirus DNA. Proc. Natl. Acad. Sci. USA 81:7880-7884.

HPV-16 E6 PROTEIN ACTS AS A TRANSACTIVATOR

333

44. Schneider-Maunoury, S., 0. Croissant, and G. Orth. 1987. Integration of human papillomavirus type 16 DNA sequences: a possible early event in the progression of genital tumors. J. Virol. 61:3295-3298. 45. Schwarz, E., U. K. Freese, L. Gissmann, W. Mayer, B. Roggenbuck, A. Stremlau, and H. zur Hausen. 1985. Structure and transcription of human papillomavirus sequences in cervical carcinoma cells. Nature (London) 314:111-113. 46. Sedman, S. A., M. S. Barbosa, W. C. Vass, N. L. Hubbert, J. A. Haas, D. R. Lowy, and J. T. Schiller. 1991. The full-length E6 protein of human papillomavirus type 16 has transforming and trans-activating activities and cooperates with E7 to immortalize keratinocytes in culture. J. Virol. 65:4860-4866. 47. Smith, D. H., D. M. Kegler, and E. B. Ziff. 1985. Vector expression of adenovirus type 5 Ela proteins: evidence for Ela autoregulation. Mol. Cell. Biol. 5:2684-2696. 48. Smotkin, D., and F. 0. Wettstein. 1986. Transcription of human papillomavirus type 16 early genes in a cervical cancer and a cancer-derived cell line and identification of the E7 protein. Proc. Natl. Acad. Sci. USA 83:4680-4684. 49. Thierry, F., N. Dostatni, F. Arnos, and M. Yaniv. 1990. Cooperative activation of transcription by bovine papillomavirus type 1 E2 can occur over a large distance. Mol. Cell. Biol. 10:44314437. 50. Vousden, K. H., E. J. Androphy, J. T. Schiller, and D. R. Lowy. 1989. Mutational analysis of bovine papillomavirus E6 gene. J. Virol. 63:2340-2342. 51. Watanabe, S., T. Kanda, and K. Yoshiike. 1989. Human papillomavirus type 16 transformation of primary human embryonic fibroblasts requires expression of open reading frames E6 and E7. J. Virol. 63:965-969. 52. Werness, B. A., A. J. Levine, and P. M. Howley. 1990. Association of human papillomavirus types 16 and 18 proteins with p53. Science 248:76-79. 53. Yang, Y.-C., H. Okayama, and P. M. Howley. 1985. Bovine papillomavirus contains multiple transforming genes. Proc. Natl. Acad. Sci. USA 82:1030-1034. 54. Yasumoto, S., A. L. Burkhardt, J. Doniger, and J. A. DiPaolo. 1986. Human papillomavirus type 16 DNA-induced malignant transformation in NIH 3T3 cells. J. Virol. 57:572-577. 55. zur Hausen, H. 1988. Papillomaviruses in human cancers. Mol. Carcinogen. 1:147-150.